#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADNP2	22850	genome.wustl.edu	37	18	77895478	77895478	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr18:77895478G>C	ENST00000262198.4	+	4	2637	c.2182G>C	c.(2182-2184)Gag>Cag	p.E728Q		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	728					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TGAGAAACTTGAGCCTGAAAA	0.517																																						dbGAP											0													147.0	143.0	144.0					18																	77895478		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2182G>C	18.37:g.77895478G>C	ENSP00000262198:p.Glu728Gln		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.E728Q	ENST00000262198.4	37	c.2182	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875559	0.33162	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.02	4.04	0.47022	.	0.251784	0.33854	N	0.004496	T	0.53029	0.1771	L	0.43152	1.355	0.34974	D	0.753416	D	0.56746	0.977	P	0.51016	0.656	T	0.63829	-0.6548	8	.	.	.	-20.691	13.0958	0.59190	0.0835:0.0:0.9165:0.0	.	728	Q6IQ32	ADNP2_HUMAN	Q	728	.	.	E	+	1	0	ADNP2	75996469	0.963000	0.33076	0.674000	0.29902	0.125000	0.20455	3.238000	0.51352	1.175000	0.42826	0.585000	0.79938	GAG	ADNP2	-	NULL	ENSG00000101544		0.517	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	66	0.00	0	G	NM_014913		77895478	77895478	+1	no_errors	ENST00000262198	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.819	C
C11orf24	53838	genome.wustl.edu	37	11	68029901	68029901	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:68029901G>C	ENST00000304271.6	-	4	964	c.562C>G	c.(562-564)Ctc>Gtc	p.L188V	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'Flank	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	188						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GCTGTGCTGAGAGATGGATGC	0.637																																					NSCLC(21;855 905 4198 36694)	dbGAP											0													62.0	60.0	61.0					11																	68029901		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.562C>G	11.37:g.68029901G>C	ENSP00000307264:p.Leu188Val		Q9H2K4	Missense_Mutation	SNP	NULL	p.L188V	ENST00000304271.6	37	c.562	CCDS8180.1	11	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710667	0.30322	.	.	ENSG00000171067	ENST00000304271	T	0.32272	1.46	4.13	0.796	0.18648	.	1.437920	0.05229	N	0.509927	T	0.28928	0.0718	L	0.46157	1.445	0.09310	N	1	P	0.46912	0.886	P	0.45829	0.494	T	0.17410	-1.0370	10	0.26408	T	0.33	-1.3505	3.3727	0.07227	0.0916:0.1426:0.4753:0.2905	.	188	Q96F05	CK024_HUMAN	V	188	ENSP00000307264:L188V	ENSP00000307264:L188V	L	-	1	0	C11orf24	67786477	0.000000	0.05858	0.002000	0.10522	0.049000	0.14656	0.165000	0.16564	0.301000	0.22738	0.460000	0.39030	CTC	C11orf24	-	NULL	ENSG00000171067		0.637	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf24	HGNC	protein_coding	OTTHUMT00000394750.1	92	0.00	0	G	NM_022338		68029901	68029901	-1	no_errors	ENST00000304271	ensembl	human	known	69_37n	missense	80	10.87	10	SNP	0.000	C
C11orf24	53838	genome.wustl.edu	37	11	68029945	68029945	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:68029945G>A	ENST00000304271.6	-	4	920	c.518C>T	c.(517-519)tCc>tTc	p.S173F	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'UTR	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	173						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						CCGCCCTGTGGAAGTGGACGT	0.627																																					NSCLC(21;855 905 4198 36694)	dbGAP											0													45.0	48.0	47.0					11																	68029945		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.518C>T	11.37:g.68029945G>A	ENSP00000307264:p.Ser173Phe		Q9H2K4	Missense_Mutation	SNP	NULL	p.S173F	ENST00000304271.6	37	c.518	CCDS8180.1	11	.	.	.	.	.	.	.	.	.	.	G	2.164	-0.391541	0.04932	.	.	ENSG00000171067	ENST00000304271	T	0.35973	1.28	0.819	-1.64	0.08318	.	3.133510	0.01237	N	0.008509	T	0.18635	0.0447	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12915	-1.0529	10	0.51188	T	0.08	-0.4008	2.1796	0.03871	0.2528:0.0:0.461:0.2862	.	173	Q96F05	CK024_HUMAN	F	173	ENSP00000307264:S173F	ENSP00000307264:S173F	S	-	2	0	C11orf24	67786521	0.043000	0.20138	0.001000	0.08648	0.001000	0.01503	-0.346000	0.07760	-0.779000	0.04560	-0.763000	0.03452	TCC	C11orf24	-	NULL	ENSG00000171067		0.627	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf24	HGNC	protein_coding	OTTHUMT00000394750.1	89	0.00	0	G	NM_022338		68029945	68029945	-1	no_errors	ENST00000304271	ensembl	human	known	69_37n	missense	77	12.50	11	SNP	0.000	A
ATM	472	genome.wustl.edu	37	11	108114711	108114711	+	Silent	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:108114711G>C	ENST00000452508.2	+	7	717	c.528G>C	c.(526-528)ctG>ctC	p.L176L	ATM_ENST00000278616.4_Silent_p.L176L			Q13315	ATM_HUMAN	ATM serine/threonine kinase	176					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGCTCTATCTGAAACCTTCAC	0.279			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													70.0	64.0	66.0					11																	108114711		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.528G>C	11.37:g.108114711G>C			B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L176	ENST00000452508.2	37	c.528	CCDS31669.1	11																																																																																			ATM	-	NULL	ENSG00000149311		0.279	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	41	0.00	0	G	NM_000051		108114711	108114711	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	0.996	C
TMEM263	90488	genome.wustl.edu	37	12	107360901	107360901	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr12:107360901C>T	ENST00000280756.4	+	3	425	c.7C>T	c.(7-9)Cag>Tag	p.Q3*	C12orf23_ENST00000551813.1_Nonsense_Mutation_p.Q3*|C12orf23_ENST00000551489.1_Nonsense_Mutation_p.Q3*|C12orf23_ENST00000547242.1_Nonsense_Mutation_p.Q3*|C12orf23_ENST00000547081.1_Nonsense_Mutation_p.Q3*|C12orf23_ENST00000548125.1_Nonsense_Mutation_p.Q3*|C12orf23_ENST00000550344.1_Nonsense_Mutation_p.Q3*	NM_152261.2	NP_689474.1	Q8WUH6	TM263_HUMAN		3						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)	3						GATCATGAATCAGACAGATAA	0.323																																						dbGAP											0													128.0	127.0	128.0					12																	107360901		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0																														ENST00000280756.4:c.7C>T	12.37:g.107360901C>T	ENSP00000280756:p.Gln3*		B3KMN9	Nonsense_Mutation	SNP	NULL	p.Q3*	ENST00000280756.4	37	c.7	CCDS9110.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.606145	0.97701	.	.	ENSG00000151135	ENST00000548125;ENST00000280756;ENST00000547242;ENST00000551489;ENST00000550344;ENST00000547081;ENST00000551813	.	.	.	6.07	6.07	0.98685	.	0.059383	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-4.8629	18.8399	0.92180	0.0:1.0:0.0:0.0	.	.	.	.	X	3	.	ENSP00000280756:Q3X	Q	+	1	0	C12orf23	105885031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.347000	0.59373	2.885000	0.99019	0.655000	0.94253	CAG	C12orf23	-	NULL	ENSG00000151135		0.323	C12orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C12orf23	HGNC	protein_coding	OTTHUMT00000406857.1	61	0.00	0	C			107360901	107360901	+1	no_errors	ENST00000280756	ensembl	human	known	69_37n	nonsense	44	25.42	15	SNP	1.000	T
CCDC125	202243	genome.wustl.edu	37	5	68606974	68606974	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr5:68606974C>G	ENST00000396496.2	-	4	531	c.424G>C	c.(424-426)Gag>Cag	p.E142Q	CCDC125_ENST00000383374.2_Missense_Mutation_p.E141Q|CCDC125_ENST00000460090.1_Intron|CCDC125_ENST00000396499.1_Missense_Mutation_p.E142Q|CCDC125_ENST00000511257.1_Missense_Mutation_p.E17Q			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	142						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		AATGCTTCCTCTTTACCTCTG	0.328																																						dbGAP											0													132.0	122.0	126.0					5																	68606974		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.424G>C	5.37:g.68606974C>G	ENSP00000379754:p.Glu142Gln		Q86Z19	Missense_Mutation	SNP	NULL	p.E142Q	ENST00000396496.2	37	c.424	CCDS4000.1	5	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985835	0.53934	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374;ENST00000511257	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.48	4.41	0.53225	.	0.180091	0.47455	D	0.000221	T	0.45316	0.1336	L	0.27053	0.805	0.24403	N	0.994699	P;B	0.52316	0.952;0.241	P;B	0.53360	0.724;0.294	T	0.30475	-0.9977	10	0.38643	T	0.18	-21.9304	12.4642	0.55749	0.0:0.9039:0.0:0.0961	.	17;142	Q86Z20-2;Q86Z20	.;CC125_HUMAN	Q	142;142;141;17	ENSP00000379754:E142Q;ENSP00000379756:E142Q;ENSP00000372865:E141Q;ENSP00000426795:E17Q	ENSP00000372865:E141Q	E	-	1	0	CCDC125	68642730	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.051000	0.30417	2.588000	0.87417	0.485000	0.47835	GAG	CCDC125	-	NULL	ENSG00000183323		0.328	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	HGNC	protein_coding	OTTHUMT00000254027.4	66	0.00	0	C	NM_176816		68606974	68606974	-1	no_errors	ENST00000396496	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	1.000	G
CCDC86	79080	genome.wustl.edu	37	11	60609811	60609811	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:60609811C>T	ENST00000227520.5	+	1	268	c.214C>T	c.(214-216)Ctg>Ttg	p.L72L	RP11-804A23.2_ENST00000539897.1_RNA|RP11-804A23.4_ENST00000538705.1_RNA	NM_024098.3	NP_077003.1	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	72	Pro-rich.				viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|liver(2)|lung(2)|urinary_tract(3)	10						ATCACCCCGTCTGCAGCAGGG	0.677																																						dbGAP											0													35.0	41.0	39.0					11																	60609811		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK025974	CCDS7993.1	11q12.2	2006-03-16			ENSG00000110104	ENSG00000110104			28359	protein-coding gene	gene with protein product		611293					Standard	NM_024098		Approved	MGC2574	uc001nqa.2	Q9H6F5	OTTHUMG00000167706	ENST00000227520.5:c.214C>T	11.37:g.60609811C>T			B4DY99	Missense_Mutation	SNP	NULL	p.S65F	ENST00000227520.5	37	c.194	CCDS7993.1	11																																																																																			CCDC86	-	NULL	ENSG00000110104		0.677	CCDC86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC86	HGNC	protein_coding	OTTHUMT00000395743.1	66	0.00	0	C	NM_024098		60609811	60609811	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000535217	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	0.001	T
CDH1	999	genome.wustl.edu	37	16	68857527	68857530	+	Splice_Site	DEL	TAAG	TAAG	-			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	TAAG	TAAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:68857527_68857530delTAAG	ENST00000261769.5	+	13	2353_2355	c.2162_2164delTAAG	c.(2161-2166)ctaagt>cgt	p.LS721fs	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Splice_Site_p.LS660fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	721					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTTGCTTTGCTAAGTAAGTCCAGC	0.436			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0																																										-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2164+1TAAG>-	16.37:g.68857531_68857534delTAAG			A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	DEL	-	e14-1	ENST00000261769.5	37	c.2164+4_2164+1	CCDS10869.1	16																																																																																			CDH1	-	-	ENSG00000039068		0.436	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	35	0.00	0	TAAG	NM_004360	Frame_Shift_Del	68857527	68857530	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site_del	21	22.22	6	DEL	0.843:0.380:0.737:1.000	-
CDO1	1036	genome.wustl.edu	37	5	115151972	115151972	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr5:115151972C>G	ENST00000250535.4	-	1	679	c.123G>C	c.(121-123)gaG>gaC	p.E41D	CDO1_ENST00000502631.1_Intron	NM_001801.2	NP_001792.2	Q16878	CDO1_HUMAN	cysteine dioxygenase type 1	41					cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|inflammatory response (GO:0006954)|L-cysteine catabolic process (GO:0019448)|lactation (GO:0007595)|oxidation-reduction process (GO:0055114)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid biosynthetic process (GO:0000097)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)	cytosol (GO:0005829)	cysteine dioxygenase activity (GO:0017172)|ferrous iron binding (GO:0008198)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|skin(5)	11		all_cancers(142;0.0046)|all_epithelial(76;0.000161)|Prostate(80;0.0132)|Ovarian(225;0.0776)		OV - Ovarian serous cystadenocarcinoma(64;7.8e-08)|Epithelial(69;7.32e-07)|all cancers(49;3.24e-05)	L-Cysteine(DB00151)	TGGGGTCGCTCTCGTAGGCTT	0.627																																						dbGAP											0													158.0	141.0	147.0					5																	115151972		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4121.1	5q23.2	2013-06-11	2013-06-11		ENSG00000129596	ENSG00000129596	1.13.11.20		1795	protein-coding gene	gene with protein product		603943	"""cysteine dioxygenase, type I"""			7524679	Standard	NM_001801		Approved		uc003krg.3	Q16878	OTTHUMG00000128891	ENST00000250535.4:c.123G>C	5.37:g.115151972C>G	ENSP00000250535:p.Glu41Asp		B2RAK4|P78513|Q6FHZ8|Q8TB64	Missense_Mutation	SNP	pfam_Cys_dOase_I,pfam_Cysteamine_dioxygenase,superfamily_RmlC_Cupin	p.E41D	ENST00000250535.4	37	c.123	CCDS4121.1	5	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111769	0.37242	.	.	ENSG00000129596	ENST00000250535	T	0.42900	0.96	5.4	2.4	0.29515	Cupin, RmlC-type (1);	0.050882	0.85682	D	0.000000	T	0.20210	0.0486	N	0.13140	0.3	0.46849	D	0.999224	B	0.02656	0.0	B	0.01281	0.0	T	0.05289	-1.0894	10	0.13108	T	0.6	-18.2592	6.6817	0.23123	0.0:0.5714:0.2787:0.1499	.	41	Q16878	CDO1_HUMAN	D	41	ENSP00000250535:E41D	ENSP00000250535:E41D	E	-	3	2	CDO1	115179871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.332000	0.43903	0.740000	0.32651	0.655000	0.94253	GAG	CDO1	-	pfam_Cys_dOase_I,superfamily_RmlC_Cupin	ENSG00000129596		0.627	CDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDO1	HGNC	protein_coding	OTTHUMT00000250853.2	39	0.00	0	C	NM_001801		115151972	115151972	-1	no_errors	ENST00000250535	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	G
CECR2	27443	genome.wustl.edu	37	22	18022655	18022655	+	Silent	SNP	G	G	A	rs546071652		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr22:18022655G>A	ENST00000400585.2	+	16	2772	c.2334G>A	c.(2332-2334)ccG>ccA	p.P778P	CECR2_ENST00000262608.8_Silent_p.P920P|CECR2_ENST00000400573.5_Silent_p.P919P			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	961					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GGAGGGCACCGGAGAACAGTG	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16676	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													52.0	54.0	53.0					22																	18022655		1955	4151	6106	-	-	-	SO:0001819	synonymous_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.2334G>A	22.37:g.18022655G>A			A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P919	ENST00000400585.2	37	c.2757		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.522	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	42	0.00	0	G	NM_031413		18022655	18022655	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	silent	31	16.22	6	SNP	1.000	A
CELF4	56853	genome.wustl.edu	37	18	34839144	34839144	+	Splice_Site	SNP	C	C	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr18:34839144C>A	ENST00000591282.1	-	11	1332	c.1333G>T	c.(1333-1335)Ggc>Tgc	p.G445C	CELF4_ENST00000601019.1_Splice_Site_p.G443C|CELF4_ENST00000412753.1_Splice_Site_p.G444C|CELF4_ENST00000334919.5_Intron|CELF4_ENST00000361795.5_Splice_Site_p.G443C|CELF4_ENST00000588597.1_Missense_Mutation_p.G433C|CELF4_ENST00000591287.1_Splice_Site_p.G443C|CELF4_ENST00000420428.2_Splice_Site_p.G445C|CELF4_ENST00000603232.1_Splice_Site_p.G444C			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	445	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						ATGACATTACCGAAAGGGAGG	0.517																																						dbGAP											0													75.0	62.0	67.0					18																	34839144		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.1333+1G>T	18.37:g.34839144C>A			Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G445C	ENST00000591282.1	37	c.1333	CCDS32818.1	18	.	.	.	.	.	.	.	.	.	.	c	26.5	4.745148	0.89663	.	.	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428	T	0.21734	1.99	4.79	4.79	0.61399	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.060116	0.64402	D	0.000003	T	0.64483	0.2602	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.976;1.0	T	0.79988	-0.1571	9	.	.	.	-9.3343	18.024	0.89263	0.0:1.0:0.0:0.0	.	443;433;443;445	Q9BZC1-3;B4DHA8;Q9BZC1-2;Q9BZC1	.;.;.;CELF4_HUMAN	C	445;444;443	ENSP00000406823:G444C	.	G	-	1	0	CELF4	33093142	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.625000	0.83145	2.480000	0.83734	0.650000	0.86243	GGC	CELF4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000101489		0.517	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF4	HGNC	protein_coding	OTTHUMT00000440892.1	30	0.00	0	C	NM_020180	Missense_Mutation	34839144	34839144	-1	no_errors	ENST00000361795	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	A
CEP350	9857	genome.wustl.edu	37	1	179991935	179991935	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:179991935C>T	ENST00000367607.3	+	13	3756	c.3338C>T	c.(3337-3339)tCt>tTt	p.S1113F		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1113	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTTGTCTCCTCTCCAGGGACT	0.403																																						dbGAP											0													72.0	70.0	70.0					1																	179991935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3338C>T	1.37:g.179991935C>T	ENSP00000356579:p.Ser1113Phe		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S1113F	ENST00000367607.3	37	c.3338	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004197	0.74932	.	.	ENSG00000135837	ENST00000367607	T	0.23348	1.91	5.84	4.93	0.64822	.	0.000000	0.48286	D	0.000185	T	0.37517	0.1006	L	0.36672	1.1	0.44485	D	0.997428	D;D	0.89917	0.998;1.0	D;D	0.85130	0.986;0.997	T	0.08066	-1.0740	9	.	.	.	.	10.1889	0.43015	0.0:0.7919:0.1361:0.072	.	1113;1113	E7EU22;Q5VT06	.;CE350_HUMAN	F	1113	ENSP00000356579:S1113F	.	S	+	2	0	CEP350	178258558	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.337000	0.59310	1.485000	0.48380	-0.262000	0.10625	TCT	CEP350	-	NULL	ENSG00000135837		0.403	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	59	0.00	0	C	NM_014810		179991935	179991935	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	T
COPB1	1315	genome.wustl.edu	37	11	14507916	14507916	+	Missense_Mutation	SNP	G	G	C	rs528031760		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:14507916G>C	ENST00000249923.3	-	7	1134	c.834C>G	c.(832-834)atC>atG	p.I278M	COPB1_ENST00000439561.2_Missense_Mutation_p.I278M	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	278					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						ACAGTACCTTGATTGCAGTTG	0.393																																						dbGAP											0													155.0	150.0	152.0					11																	14507916		2200	4294	6494	-	-	-	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.834C>G	11.37:g.14507916G>C	ENSP00000249923:p.Ile278Met		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_bsu	p.I278M	ENST00000249923.3	37	c.834	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937761	0.73557	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.27890	1.64;1.64;1.64	5.36	4.42	0.53409	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.045827	0.85682	D	0.000000	T	0.60470	0.2271	M	0.90977	3.165	0.80722	D	1	P	0.41102	0.738	P	0.62298	0.9	T	0.64664	-0.6354	10	0.87932	D	0	.	9.4023	0.38440	0.0746:0.0:0.7763:0.1491	.	278	P53618	COPB_HUMAN	M	278	ENSP00000249923:I278M;ENSP00000397873:I278M;ENSP00000436383:I278M	ENSP00000249923:I278M	I	-	3	3	COPB1	14464492	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.725000	0.47294	1.187000	0.43000	0.563000	0.77884	ATC	COPB1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_bsu	ENSG00000129083		0.393	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	39	0.00	0	G	NM_016451		14507916	14507916	-1	no_errors	ENST00000249923	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	1.000	C
CROCCP2	84809	genome.wustl.edu	37	1	16955075	16955075	+	lincRNA	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:16955075C>T	ENST00000412962.1	-	0	364							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TGCAGCTTCTCCCGCTCCTGC	0.687																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16955075C>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.687	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	144	0.00	0	C	NR_026752.1		16955075	16955075	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	123	10.22	14	SNP	0.995	T
CROCC	9696	genome.wustl.edu	37	1	17275597	17275597	+	Intron	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:17275597C>T	ENST00000375541.5	+	19	2905				CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		cctttcctctctgggctgcag	0.572																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2836+176C>T	1.37:g.17275597C>T				RNA	SNP	-	NULL	ENST00000375541.5	37	NULL	CCDS30616.1	1																																																																																			CROCC	-	-	ENSG00000058453		0.572	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	29	0.00	0	C	NM_014675		17275597	17275597	+1	no_errors	ENST00000488646	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.003	T
DLG2	1740	genome.wustl.edu	37	11	83877976	83877976	+	Intron	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:83877976C>T	ENST00000532653.1	-	4	561				DLG2_ENST00000531015.1_Intron|DLG2_ENST00000537455.1_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000398301.2_Intron|DLG2_ENST00000330014.6_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000398309.2_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)						nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TGTACAGTAACACTTACGGTA	0.373																																						dbGAP											0													117.0	120.0	119.0					11																	83877976		876	1990	2866	-	-	-	SO:0001627	intron_variant	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.259-3422G>A	11.37:g.83877976C>T			B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	RNA	SNP	-	NULL	ENST00000532653.1	37	NULL		11																																																																																			DLG2	-	-	ENSG00000150672		0.373	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	72	0.00	0	C	NM_001364		83877976	83877976	-1	no_errors	ENST00000524941	ensembl	human	known	69_37n	rna	48	21.31	13	SNP	0.000	T
DNASE2B	58511	genome.wustl.edu	37	1	84867704	84867704	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:84867704C>A	ENST00000370665.3	+	2	279	c.246C>A	c.(244-246)gaC>gaA	p.D82E		NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	82					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		TAATGAATGACACCAAGAGTG	0.373																																					Pancreas(54;788 1175 11852 16034 30034)	dbGAP											0													84.0	81.0	82.0					1																	84867704		1893	4120	6013	-	-	-	SO:0001583	missense	0			AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.246C>A	1.37:g.84867704C>A	ENSP00000359699:p.Asp82Glu		Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Missense_Mutation	SNP	pfam_DNase_II	p.D82E	ENST00000370665.3	37	c.246	CCDS44167.1	1	.	.	.	.	.	.	.	.	.	.	C	9.189	1.025467	0.19512	.	.	ENSG00000137976	ENST00000370665	T	0.15256	2.44	5.12	2.05	0.26809	.	0.800937	0.11625	N	0.545345	T	0.04363	0.0120	L	0.33245	0.995	0.47037	D	0.99929	B	0.21309	0.054	B	0.16722	0.016	T	0.27434	-1.0074	10	0.15952	T	0.53	-7.2844	9.0697	0.36484	0.0:0.3987:0.5097:0.0916	.	82	Q8WZ79	DNS2B_HUMAN	E	82	ENSP00000359699:D82E	ENSP00000359699:D82E	D	+	3	2	DNASE2B	84640292	0.561000	0.26578	0.024000	0.17045	0.273000	0.26683	1.141000	0.31528	0.734000	0.32515	-0.499000	0.04595	GAC	DNASE2B	-	pfam_DNase_II	ENSG00000137976		0.373	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNASE2B	HGNC	protein_coding	OTTHUMT00000027248.1	35	0.00	0	C	NM_021233		84867704	84867704	+1	no_errors	ENST00000370665	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.437	A
DOCK1	1793	genome.wustl.edu	37	10	129178358	129178358	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr10:129178358G>C	ENST00000280333.6	+	36	3734	c.3625G>C	c.(3625-3627)Gaa>Caa	p.E1209Q		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1209	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTTCTACAAAGAAATTGAAAG	0.269																																						dbGAP											0													28.0	27.0	27.0					10																	129178358		1637	3684	5321	-	-	-	SO:0001583	missense	0			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3625G>C	10.37:g.129178358G>C	ENSP00000280333:p.Glu1209Gln		A9Z1Z5	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,superfamily_Cyt_c_dom,smart_SH3_domain,pfscan_SH3_domain	p.E1209Q	ENST00000280333.6	37	c.3625		10	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421913	0.83559	.	.	ENSG00000150760	ENST00000280333	T	0.55413	0.52	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.69886	0.3161	L	0.58810	1.83	0.80722	D	1	D;D;P	0.69078	0.968;0.997;0.791	P;D;P	0.75484	0.843;0.986;0.449	T	0.73216	-0.4053	10	0.87932	D	0	.	18.191	0.89807	0.0:0.0:1.0:0.0	.	1209;1275;1209	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	Q	1209	ENSP00000280333:E1209Q	ENSP00000280333:E1209Q	E	+	1	0	DOCK1	129068348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.956000	0.93066	2.585000	0.87301	0.655000	0.94253	GAA	DOCK1	-	superfamily_ARM-type_fold	ENSG00000150760		0.269	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	HGNC	protein_coding	OTTHUMT00000050979.2	31	0.00	0	G	NM_001380		129178358	129178358	+1	no_errors	ENST00000280333	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	C
DOCK5	80005	genome.wustl.edu	37	8	25198459	25198459	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr8:25198459C>A	ENST00000276440.7	+	23	2438	c.2394C>A	c.(2392-2394)ttC>ttA	p.F798L		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	798					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTCTTGCTTTCAATATGCTGA	0.423																																					Pancreas(145;34 1887 3271 10937 30165)	dbGAP											0													77.0	73.0	74.0					8																	25198459		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2394C>A	8.37:g.25198459C>A	ENSP00000276440:p.Phe798Leu		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.F798L	ENST00000276440.7	37	c.2394	CCDS6047.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.043|9.043	0.990131|0.990131	0.18966|0.18966	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000276440|ENST00000444569	T|.	0.26373|.	1.74|.	4.99|4.99	4.09|4.09	0.47781|0.47781	Armadillo-type fold (1);|.	0.110739|.	0.64402|.	D|.	0.000007|.	T|T	0.25005|0.25005	0.0607|0.0607	N|N	0.04090|0.04090	-0.28|-0.28	0.53005|0.53005	D|D	0.999964|0.999964	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.06405|.	0.002;0.002;0.002|.	T|T	0.06881|0.06881	-1.0802|-1.0802	10|5	0.15066|.	T|.	0.55|.	.|.	7.216|7.216	0.25959|0.25959	0.0:0.711:0.1449:0.1441|0.0:0.711:0.1449:0.1441	.|.	788;573;798|.	D3DSS6;Q68DL4;Q9H7D0|.	.;.;DOCK5_HUMAN|.	L|K	798|570	ENSP00000276440:F798L|.	ENSP00000276440:F798L|.	F|Q	+|+	3|1	2|0	DOCK5|DOCK5	25254376|25254376	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.247000|0.247000	0.25773|0.25773	1.684000|1.684000	0.37649|0.37649	2.590000|2.590000	0.87494|0.87494	0.650000|0.650000	0.86243|0.86243	TTC|CAA	DOCK5	-	superfamily_ARM-type_fold	ENSG00000147459		0.423	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	65	0.00	0	C	NM_024940		25198459	25198459	+1	no_errors	ENST00000276440	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	1.000	A
AGO2	27161	genome.wustl.edu	37	8	141551357	141551357	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr8:141551357C>T	ENST00000220592.5	-	15	2052	c.1940G>A	c.(1939-1941)cGc>cAc	p.R647H	AGO2_ENST00000519980.1_Missense_Mutation_p.R647H	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	647	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GAGGAGCTCGCGGACCATGGC	0.637																																						dbGAP											0													107.0	83.0	91.0					8																	141551357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1940G>A	8.37:g.141551357C>T	ENSP00000220592:p.Arg647His		Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R647H	ENST00000220592.5	37	c.1940	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.529252	0.96446	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.32272	1.46;1.46	5.36	5.36	0.76844	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	M	0.84082	2.675	0.80722	D	1	D;D	0.76494	0.985;0.999	D;D	0.65140	0.923;0.932	T	0.65429	-0.6170	10	0.87932	D	0	-14.4067	19.4371	0.94799	0.0:1.0:0.0:0.0	.	647;647	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	H	647	ENSP00000220592:R647H;ENSP00000430176:R647H	ENSP00000220592:R647H	R	-	2	0	EIF2C2	141620539	1.000000	0.71417	0.964000	0.40570	0.998000	0.95712	7.745000	0.85046	2.642000	0.89623	0.650000	0.86243	CGC	EIF2C2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000123908		0.637	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	44	0.00	0	C			141551357	141551357	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.998	T
EIF4ENIF1	56478	genome.wustl.edu	37	22	31858942	31858942	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr22:31858942G>A	ENST00000397525.1	-	6	986	c.763C>T	c.(763-765)Cga>Tga	p.R255*	EIF4ENIF1_ENST00000344710.5_Intron|RP11-247I13.11_ENST00000464523.1_RNA|EIF4ENIF1_ENST00000330125.5_Nonsense_Mutation_p.R255*|EIF4ENIF1_ENST00000397523.1_Nonsense_Mutation_p.R255*|RP11-247I13.8_ENST00000439588.1_RNA|RP11-247I13.11_ENST00000483736.1_RNA	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	255						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GCTGTCCGTCGCCTTGTTCTT	0.473																																						dbGAP											0													123.0	98.0	106.0					22																	31858942		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.763C>T	22.37:g.31858942G>A	ENSP00000380659:p.Arg255*		B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Nonsense_Mutation	SNP	pfam_eIF4E_transporter	p.R255*	ENST00000397525.1	37	c.763	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.958883	0.97964	.	.	ENSG00000184708	ENST00000397525;ENST00000330125;ENST00000397523;ENST00000420671	.	.	.	5.66	5.66	0.87406	.	0.063239	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5725	13.7051	0.62633	0.0:0.0:0.8458:0.1542	.	.	.	.	X	255	.	ENSP00000328103:R255X	R	-	1	2	EIF4ENIF1	30188942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.656000	0.54467	2.857000	0.98124	0.650000	0.86243	CGA	EIF4ENIF1	-	pfam_eIF4E_transporter	ENSG00000184708		0.473	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	63	0.00	0	G	NM_019843		31858942	31858942	-1	no_errors	ENST00000330125	ensembl	human	known	69_37n	nonsense	53	19.40	13	SNP	1.000	A
RP1-274L7.1	0	genome.wustl.edu	37	X	129629119	129629119	+	lincRNA	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chrX:129629119C>T	ENST00000458525.1	-	0	1076				FAM45B_ENST00000592932.1_RNA																							AGCTGCGCGCCGCGGCGGCGG	0.547																																						dbGAP											0													38.0	40.0	39.0					X																	129629119		2202	4299	6501	-	-	-			0																															X.37:g.129629119C>T				RNA	SNP	-	NULL	ENST00000458525.1	37	NULL		X																																																																																			RP1-274L7.1	-	-	ENSG00000229702		0.547	RP1-274L7.1-001	KNOWN	basic	lincRNA	ENSG00000229702	Clone_based_vega_gene	lincRNA	OTTHUMT00000058271.1	40	0.00	0	C			129629119	129629119	-1	no_errors	ENST00000458525	ensembl	human	known	69_37n	rna	42	12.50	6	SNP	0.000	T
IFT80	57560	genome.wustl.edu	37	3	159997088	159997088	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:159997088C>T	ENST00000326448.7	-	16	2161	c.1729G>A	c.(1729-1731)Gat>Aat	p.D577N	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.D748N|IFT80_ENST00000483465.1_Missense_Mutation_p.D440N|IFT80_ENST00000496589.1_Missense_Mutation_p.D440N	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	577					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGGGAGCCATCAGCTCTTCTA	0.358																																						dbGAP											0													93.0	94.0	94.0					3																	159997088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1729G>A	3.37:g.159997088C>T	ENSP00000312778:p.Asp577Asn		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D748N	ENST00000326448.7	37	c.2242	CCDS3188.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.502216	0.96371	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	T;T;T	0.78816	-0.14;-1.21;-1.21	6.16	6.16	0.99307	.	0.000000	0.64402	U	0.000012	D	0.90803	0.7112	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90896	0.4765	10	0.72032	D	0.01	-4.0733	20.8598	0.99761	0.0:1.0:0.0:0.0	.	577	Q9P2H3	IFT80_HUMAN	N	577;440;440	ENSP00000312778:D577N;ENSP00000418196:D440N;ENSP00000420646:D440N	ENSP00000312778:D577N	D	-	1	0	IFT80	161479782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.572000	0.74005	2.937000	0.99478	0.650000	0.86243	GAT	RP11-432B6.3	-	NULL	ENSG00000248710		0.358	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248710	Clone_based_vega_gene	protein_coding	OTTHUMT00000352651.2	38	0.00	0	C	NM_020800		159997088	159997088	-1	no_errors	ENST00000483754	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	T
FAM47C	442444	genome.wustl.edu	37	X	37026995	37026995	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chrX:37026995C>T	ENST00000358047.3	+	1	564	c.512C>T	c.(511-513)aCa>aTa	p.T171I		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	171								p.T171K(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAGGAGAAGACAACTGACGAA	0.602																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											45.0	41.0	42.0					X																	37026995		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.512C>T	X.37:g.37026995C>T	ENSP00000367913:p.Thr171Ile		Q6ZU46	Missense_Mutation	SNP	NULL	p.T171I	ENST00000358047.3	37	c.512	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	C	6.383	0.438815	0.12104	.	.	ENSG00000198173	ENST00000358047	T	0.18810	2.19	0.502	-0.959	0.10343	.	.	.	.	.	T	0.25344	0.0616	L	0.57536	1.79	0.09310	N	1	D	0.54047	0.964	P	0.51833	0.681	T	0.13710	-1.0499	8	0.35671	T	0.21	.	.	.	.	.	171	Q5HY64	FA47C_HUMAN	I	171	ENSP00000367913:T171I	ENSP00000367913:T171I	T	+	2	0	FAM47C	36936916	0.006000	0.16342	0.000000	0.03702	0.002000	0.02628	-1.808000	0.01732	-0.497000	0.06641	0.292000	0.19580	ACA	FAM47C	-	NULL	ENSG00000198173		0.602	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	72	0.00	0	C	NM_001013736		37026995	37026995	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	0.000	T
FAM127A	8933	genome.wustl.edu	37	X	134166665	134166665	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chrX:134166665C>T	ENST00000257013.7	+	1	333	c.252C>T	c.(250-252)atC>atT	p.I84I	FAM127A_ENST00000464369.1_Intron	NM_001078171.1	NP_001071639.1	O15255	CXX1_HUMAN	family with sequence similarity 127, member A	0						plasma membrane (GO:0005886)				endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TCCCCTACATCAAGAAGGAGA	0.602																																						dbGAP											0													46.0	49.0	48.0					X																	134166665		2181	4278	6459	-	-	-	SO:0001819	synonymous_variant	0			Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590			2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1		9403077, 15716091, 16093683	Standard	NM_001078171		Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.252C>T	X.37:g.134166665C>T			Q6IBF1	Silent	SNP	NULL	p.I84	ENST00000257013.7	37	c.252	CCDS43997.1	X																																																																																			FAM127A	-	NULL	ENSG00000134590		0.602	FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM127A	HGNC	protein_coding	OTTHUMT00000058391.2	121	0.00	0	C	NM_001078171		134166665	134166665	+1	no_errors	ENST00000257013	ensembl	human	novel	69_37n	silent	68	10.53	8	SNP	0.980	T
FAT2	2196	genome.wustl.edu	37	5	150911490	150911490	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr5:150911490C>T	ENST00000261800.5	-	13	9481	c.9469G>A	c.(9469-9471)Gaa>Aaa	p.E3157K		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3157	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGTGGCCTTCGGCTGAATCC	0.652																																						dbGAP											0													55.0	60.0	58.0					5																	150911490		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9469G>A	5.37:g.150911490C>T	ENSP00000261800:p.Glu3157Lys		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.E3157K	ENST00000261800.5	37	c.9469	CCDS4317.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.41|17.41	3.382220|3.382220	0.61845|0.61845	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	T|.	0.51574|.	0.7|.	5.43|5.43	5.43|5.43	0.79202|0.79202	Cadherin (4);Cadherin-like (1);|.	0.413693|.	0.22494|.	N|.	0.059338|.	T|T	0.32224|0.32224	0.0822|0.0822	N|N	0.21373|0.21373	0.66|0.66	0.31358|0.31358	N|N	0.681755|0.681755	P|.	0.42375|.	0.778|.	B|.	0.34138|.	0.176|.	T|T	0.30357|0.30357	-0.9981|-0.9981	10|5	0.12766|.	T|.	0.61|.	.|.	8.3719|8.3719	0.32421|0.32421	0.0:0.8674:0.0:0.1326|0.0:0.8674:0.0:0.1326	.|.	3157|.	Q9NYQ8|.	FAT2_HUMAN|.	K|Q	3157|15	ENSP00000261800:E3157K|.	ENSP00000261800:E3157K|.	E|R	-|-	1|2	0|0	FAT2|FAT2	150891683|150891683	0.776000|0.776000	0.28616|0.28616	0.903000|0.903000	0.35520|0.35520	0.610000|0.610000	0.37248|0.37248	1.491000|1.491000	0.35583|0.35583	2.557000|2.557000	0.86248|0.86248	0.557000|0.557000	0.71058|0.71058	GAA|CGA	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.652	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	59	0.00	0	C	NM_001447		150911490	150911490	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	0.972	T
FMO4	2329	genome.wustl.edu	37	1	171303694	171303694	+	Silent	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:171303694G>A	ENST00000367749.3	+	8	1302	c.972G>A	c.(970-972)gtG>gtA	p.V324V		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	324					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.V324V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TTGATGTTGTGATCTTCACTA	0.373																																					Pancreas(24;816 862 7754 7993 32832)	dbGAP											1	Substitution - coding silent(1)	lung(1)											95.0	97.0	96.0					1																	171303694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.972G>A	1.37:g.171303694G>A			Q53XR0	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.V324	ENST00000367749.3	37	c.972	CCDS1295.1	1																																																																																			FMO4	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000076258		0.373	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	61	0.00	0	G	NM_002022		171303694	171303694	+1	no_errors	ENST00000367749	ensembl	human	known	69_37n	silent	19	42.42	14	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39261869	39261869	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr13:39261869G>A	ENST00000280481.7	+	1	604	c.388G>A	c.(388-390)Gac>Aac	p.D130N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	130					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTTCCCGTGCGACTTTGGCCC	0.721																																						dbGAP											0													22.0	22.0	22.0					13																	39261869		2202	4297	6499	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.388G>A	13.37:g.39261869G>A	ENSP00000280481:p.Asp130Asn		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D130N	ENST00000280481.7	37	c.388	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936915	0.52972	.	.	ENSG00000150893	ENST00000280481	T	0.19806	2.12	5.46	3.61	0.41365	.	0.060210	0.64402	D	0.000001	T	0.20007	0.0481	L	0.58810	1.83	0.36750	D	0.882682	B	0.26876	0.162	B	0.21546	0.035	T	0.11767	-1.0574	10	0.29301	T	0.29	.	10.9658	0.47412	0.0709:0.1293:0.7998:0.0	.	130	Q5SZK8	FREM2_HUMAN	N	130	ENSP00000280481:D130N	ENSP00000280481:D130N	D	+	1	0	FREM2	38159869	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.595000	0.54016	1.286000	0.44565	0.655000	0.94253	GAC	FREM2	-	NULL	ENSG00000150893		0.721	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	77	0.00	0	G	NM_207361		39261869	39261869	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	1.000	A
GBP6	163351	genome.wustl.edu	37	1	89847524	89847524	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:89847524G>C	ENST00000370456.4	+	7	1236	c.1143G>C	c.(1141-1143)aaG>aaC	p.K381N	GBP6_ENST00000535065.1_Missense_Mutation_p.K251N	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	381					cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		AATTCCAGAAGAAGTTCATGG	0.458																																						dbGAP											0													79.0	70.0	73.0					1																	89847524		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.1143G>C	1.37:g.89847524G>C	ENSP00000359485:p.Lys381Asn		A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.K381N	ENST00000370456.4	37	c.1143	CCDS723.1	1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303169	0.23736	.	.	ENSG00000183347	ENST00000544311;ENST00000370456;ENST00000535065	T;T	0.02682	4.2;4.2	4.75	1.72	0.24424	Guanylate-binding protein, C-terminal (3);	0.291902	0.31381	N	0.007756	T	0.01730	0.0055	M	0.79343	2.45	0.26540	N	0.974098	B	0.23316	0.083	B	0.29077	0.098	T	0.35968	-0.9767	10	0.62326	D	0.03	-15.8311	6.0871	0.19973	0.4416:0.0:0.5584:0.0	.	381	Q6ZN66	GBP6_HUMAN	N	352;381;251	ENSP00000359485:K381N;ENSP00000442530:K251N	ENSP00000359485:K381N	K	+	3	2	GBP6	89620112	0.000000	0.05858	0.247000	0.24249	0.023000	0.10783	-0.973000	0.03798	0.380000	0.24823	-0.225000	0.12378	AAG	GBP6	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000183347		0.458	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP6	HGNC	protein_coding	OTTHUMT00000028001.1	37	0.00	0	G	NM_198460		89847524	89847524	+1	no_errors	ENST00000370456	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	0.384	C
GDAP1L1	78997	genome.wustl.edu	37	20	42876092	42876092	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr20:42876092G>T	ENST00000342560.5	+	1	206	c.118G>T	c.(118-120)Gcc>Tcc	p.A40S	GDAP1L1_ENST00000372952.3_Missense_Mutation_p.A40S|GDAP1L1_ENST00000537864.1_5'UTR	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	40										endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGCCAGCCCCGCCCATTGGCC	0.716																																						dbGAP											0													8.0	11.0	10.0					20																	42876092		2186	4270	6456	-	-	-	SO:0001583	missense	0				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.118G>T	20.37:g.42876092G>T	ENSP00000341782:p.Ala40Ser		B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.A40S	ENST00000342560.5	37	c.118	CCDS13328.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.23|11.23	1.578519|1.578519	0.28180|0.28180	.|.	.|.	ENSG00000124194|ENSG00000124194	ENST00000372947;ENST00000545149|ENST00000342560;ENST00000372946;ENST00000438466;ENST00000372952	.|T;T;T	.|0.76709	.|-0.01;-0.01;-1.04	4.2|4.2	3.17|3.17	0.36434|0.36434	.|Thioredoxin-like fold (1);	.|0.464890	.|0.22187	.|N	.|0.063432	.|T	.|0.52709	.|0.1751	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.11235	.|0.0;0.004;0.001	.|B;B;B	.|0.09377	.|0.001;0.004;0.001	.|T	.|0.46830	.|-0.9163	.|10	.|0.13470	.|T	.|0.59	.|.	7.922|7.922	0.29852|0.29852	0.0938:0.0:0.7337:0.1725|0.0938:0.0:0.7337:0.1725	.|.	.|40;40;40	.|B7Z1I3;B7Z621;Q96MZ0	.|.;.;GD1L1_HUMAN	.|S	-1|40	.|ENSP00000341782:A40S;ENSP00000392881:A40S;ENSP00000362043:A40S	.|ENSP00000341782:A40S	.|A	+|+	.|1	.|0	GDAP1L1|GDAP1L1	42309506|42309506	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.635000|2.635000	0.46537|0.46537	2.190000|2.190000	0.69967|0.69967	0.462000|0.462000	0.41574|0.41574	.|GCC	GDAP1L1	-	superfamily_Thioredoxin-like_fold	ENSG00000124194		0.716	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1L1	HGNC	protein_coding	OTTHUMT00000079356.1	109	0.89	1	G	NM_024034		42876092	42876092	+1	no_errors	ENST00000342560	ensembl	human	known	69_37n	missense	103	11.97	14	SNP	1.000	T
GPS2	2874	genome.wustl.edu	37	17	7218277	7218277	+	Splice_Site	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr17:7218277C>G	ENST00000380728.2	-	2	395		c.e2+1		NEURL4_ENST00000574120.1_5'Flank|GPS2_ENST00000389167.5_Splice_Site|RP11-542C16.2_ENST00000575474.1_Splice_Site|GPS2_ENST00000391950.3_Splice_Site			Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CCCCGGCTCACCCTGCCGCTT	0.692																																						dbGAP											0													13.0	13.0	13.0					17																	7218277		2194	4293	6487	-	-	-	SO:0001630	splice_region_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.94+1G>C	17.37:g.7218277C>G			B4DXA1|Q6FHM8	Splice_Site	SNP	-	e1+1	ENST00000380728.2	37	c.94+1	CCDS11100.1	17	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844989	0.91197	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6751	0.85276	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPS2	7159001	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.553000	0.73918	2.440000	0.82611	0.563000	0.77884	.	GPS2	-	-	ENSG00000132522		0.692	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	131	0.00	0	C	NM_004489	Intron	7218277	7218277	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	splice_site	67	30.93	30	SNP	1.000	G
GTF3C3	9330	genome.wustl.edu	37	2	197654048	197654048	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr2:197654048G>C	ENST00000263956.3	-	6	862	c.773C>G	c.(772-774)tCa>tGa	p.S258*	GTF3C3_ENST00000470386.1_5'UTR|GTF3C3_ENST00000409364.3_Nonsense_Mutation_p.S258*	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	258					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						ATAAAGGCTTGATCGCTCCCA	0.388																																						dbGAP											0													94.0	84.0	87.0					2																	197654048		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.773C>G	2.37:g.197654048G>C	ENSP00000263956:p.Ser258*		Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S258*	ENST00000263956.3	37	c.773	CCDS2316.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.259668	0.95368	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	.	.	.	4.87	4.87	0.63330	.	0.079005	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-12.756	18.1981	0.89829	0.0:0.0:1.0:0.0	.	.	.	.	X	258	.	ENSP00000263956:S258X	S	-	2	0	GTF3C3	197362293	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.629000	0.83207	2.536000	0.85505	0.591000	0.81541	TCA	GTF3C3	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000119041		0.388	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C3	HGNC	protein_coding	OTTHUMT00000256104.1	41	0.00	0	G			197654048	197654048	-1	no_errors	ENST00000263956	ensembl	human	known	69_37n	nonsense	41	12.77	6	SNP	1.000	C
GUCA2B	2981	genome.wustl.edu	37	1	42619172	42619172	+	Silent	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:42619172C>G	ENST00000372581.1	+	1	81	c.51C>G	c.(49-51)ctC>ctG	p.L17L		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	17					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCGTGGTCCTCCTGCTGCTGC	0.657																																						dbGAP											0													70.0	56.0	61.0					1																	42619172		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.51C>G	1.37:g.42619172C>G			Q52LV0	Silent	SNP	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	p.L17	ENST00000372581.1	37	c.51	CCDS464.1	1																																																																																			GUCA2B	-	pfam_Guanylin,pirsf_Guanylin,prints_Guanylin	ENSG00000044012		0.657	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA2B	HGNC	protein_coding	OTTHUMT00000018307.1	81	0.00	0	C	NM_007102		42619172	42619172	+1	no_errors	ENST00000372581	ensembl	human	known	69_37n	silent	46	26.98	17	SNP	0.331	G
MROH7	374977	genome.wustl.edu	37	1	55144987	55144987	+	Missense_Mutation	SNP	G	G	A	rs554316180		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:55144987G>A	ENST00000421030.2	+	12	2386	c.2101G>A	c.(2101-2103)Gcc>Acc	p.A701T	MROH7_ENST00000395690.2_Missense_Mutation_p.A701T|MROH7_ENST00000454855.2_Missense_Mutation_p.A219T|MROH7_ENST00000409996.1_Missense_Mutation_p.A269T|MROH7_ENST00000545244.1_Missense_Mutation_p.A269T|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.A701T|MROH7_ENST00000339553.5_Missense_Mutation_p.A701T	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	701						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GCTGCTGGCCGCCCTGGAAGG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		18498	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													71.0	78.0	76.0					1																	55144987		1921	4127	6048	-	-	-	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2101G>A	1.37:g.55144987G>A	ENSP00000396622:p.Ala701Thr		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A701T	ENST00000421030.2	37	c.2101	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902147	0.33628	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4	4.88	3.95	0.45737	.	0.000000	0.47093	D	0.000243	T	0.41236	0.1150	L	0.33485	1.01	0.32843	D	0.505581	D;D;D	0.89917	0.999;1.0;0.997	D;D;P	0.71414	0.95;0.973;0.67	T	0.42882	-0.9425	10	0.22706	T	0.39	-6.3043	8.1381	0.31067	0.1075:0.0:0.8925:0.0	.	701;701;269	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	T	701;269;730;701;269;219;701	ENSP00000396622:A701T;ENSP00000442333:A269T;ENSP00000343211:A701T;ENSP00000387048:A269T;ENSP00000401130:A219T;ENSP00000379044:A701T	ENSP00000343211:A701T	A	+	1	0	HEATR8	54917575	0.974000	0.33945	0.992000	0.48379	0.751000	0.42716	2.215000	0.42862	2.250000	0.74265	0.557000	0.71058	GCC	HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.592	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	55	0.00	0	G	NM_198547		55144987	55144987	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.898	A
HMGB1P5	10354	genome.wustl.edu	37	3	22423998	22423998	+	RNA	SNP	C	C	T	rs13070522	byFrequency	TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:22423998C>T	ENST00000451497.1	+	0	563									high mobility group box 1 pseudogene 5																		GCATTTAACCCCCCTGTACAC	0.333													-|||	2365	0.472244	0.2799	0.6354	5008	,	,		18259	0.4296		0.5388	False		,,,				2504	0.592					dbGAP											0																																										-	-	-			0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423998C>T				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	24	0.00	0	C	NG_000897		22423998	22423998	+1	no_errors	ENST00000451497	ensembl	human	known	69_37n	rna	12	20.00	3	SNP	1.000	T
HTR1A	3350	genome.wustl.edu	37	5	63256619	63256619	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr5:63256619C>T	ENST00000323865.3	-	1	1161	c.928G>A	c.(928-930)Gag>Aag	p.E310K	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	310					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GGACCAGCCTCGCTGGGCAGA	0.647																																						dbGAP											0													38.0	38.0	38.0					5																	63256619		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.928G>A	5.37:g.63256619C>T	ENSP00000316244:p.Glu310Lys		Q6LAE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.E310K	ENST00000323865.3	37	c.928	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	C	9.813	1.183669	0.21870	.	.	ENSG00000178394	ENST00000323865	T	0.61859	0.07	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.472354	0.23083	N	0.052138	T	0.33059	0.0850	N	0.16233	0.39	0.35940	D	0.83313	P	0.38300	0.626	B	0.28385	0.089	T	0.41822	-0.9487	10	0.06891	T	0.86	.	13.5703	0.61843	0.0:0.8444:0.1556:0.0	.	310	P08908	5HT1A_HUMAN	K	310	ENSP00000316244:E310K	ENSP00000316244:E310K	E	-	1	0	HTR1A	63292375	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	2.236000	0.43052	2.692000	0.91855	0.655000	0.94253	GAG	HTR1A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000178394		0.647	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	29	0.00	0	C	NM_000524		63256619	63256619	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.998	T
HTR1D	3352	genome.wustl.edu	37	1	23520084	23520084	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:23520084G>A	ENST00000374619.1	-	1	1138	c.629C>T	c.(628-630)tCg>tTg	p.S210L	HTR1D_ENST00000314113.3_Missense_Mutation_p.S210L	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	210					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GAGCAACACCGAGGGAATGTA	0.592																																						dbGAP											0													63.0	68.0	66.0					1																	23520084		2203	4300	6503	-	-	-	SO:0001583	missense	0			M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.629C>T	1.37:g.23520084G>A	ENSP00000363748:p.Ser210Leu			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1D_rcpt,prints_5HT_rcpt	p.S210L	ENST00000374619.1	37	c.629	CCDS231.1	1	.	.	.	.	.	.	.	.	.	.	G	1.731	-0.494080	0.04322	.	.	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.28666	1.6;1.6	5.57	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.056971	0.64402	D	0.000002	T	0.12178	0.0296	N	0.01473	-0.845	0.37898	D	0.930951	P	0.44627	0.839	B	0.43658	0.426	T	0.20505	-1.0273	10	0.02654	T	1	.	13.5891	0.61948	0.0743:0.0:0.9257:0.0	.	210	P28221	5HT1D_HUMAN	L	210	ENSP00000313661:S210L;ENSP00000363748:S210L	ENSP00000313661:S210L	S	-	2	0	HTR1D	23392671	1.000000	0.71417	0.038000	0.18304	0.665000	0.39181	5.819000	0.69243	1.379000	0.46325	0.655000	0.94253	TCG	HTR1D	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000179546		0.592	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1D	HGNC	protein_coding	OTTHUMT00000008924.1	55	0.00	0	G	NM_000864		23520084	23520084	-1	no_errors	ENST00000314113	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.682	A
HTR2C	3358	genome.wustl.edu	37	X	114082707	114082707	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chrX:114082707G>A	ENST00000276198.1	+	5	1219	c.491G>A	c.(490-492)cGt>cAt	p.R164H	HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Missense_Mutation_p.R164H	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	164					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R164H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GAGCATAGCCGTTTCAATTCG	0.398																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											131.0	111.0	118.0					X																	114082707		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.491G>A	X.37:g.114082707G>A	ENSP00000276198:p.Arg164His		B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2C_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.R164H	ENST00000276198.1	37	c.491	CCDS14564.1	X	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783801	0.70222	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.19938	2.11;2.11	4.41	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.32793	0.0841	M	0.64260	1.97	0.80722	D	1	D	0.58620	0.983	P	0.58820	0.846	T	0.07654	-1.0761	10	0.17832	T	0.49	.	9.4759	0.38871	0.1094:0.0:0.8906:0.0	.	164	P28335	5HT2C_HUMAN	H	164	ENSP00000276198:R164H;ENSP00000361019:R164H	ENSP00000276198:R164H	R	+	2	0	HTR2C	113988963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.596000	0.74113	0.665000	0.31066	0.544000	0.68410	CGT	HTR2C	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000147246		0.398	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	HGNC	protein_coding	OTTHUMT00000057962.1	59	0.00	0	G	NM_000868		114082707	114082707	+1	no_errors	ENST00000276198	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	1.000	A
IGF1R	3480	genome.wustl.edu	37	15	99440122	99440122	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr15:99440122A>T	ENST00000268035.6	+	4	1701	c.1090A>T	c.(1090-1092)Atc>Ttc	p.I364F	IGF1R_ENST00000558762.1_Missense_Mutation_p.I364F	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	364					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCTCATTAACATCCGACGGGG	0.458																																						dbGAP											0													115.0	99.0	105.0					15																	99440122		2197	4297	6494	-	-	-	SO:0001583	missense	0			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1090A>T	15.37:g.99440122A>T	ENSP00000268035:p.Ile364Phe		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.I364F	ENST00000268035.6	37	c.1090	CCDS10378.1	15	.	.	.	.	.	.	.	.	.	.	A	30	5.049674	0.93740	.	.	ENSG00000140443	ENST00000268035	D	0.83419	-1.72	5.49	5.49	0.81192	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000016	D	0.90960	0.7158	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.991	D	0.92151	0.5728	10	0.87932	D	0	.	15.6057	0.76668	1.0:0.0:0.0:0.0	.	364;364	C9J5X1;P08069	.;IGF1R_HUMAN	F	364	ENSP00000268035:I364F	ENSP00000268035:I364F	I	+	1	0	IGF1R	97257645	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	9.339000	0.96797	2.089000	0.63090	0.533000	0.62120	ATC	IGF1R	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L	ENSG00000140443		0.458	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	HGNC	protein_coding	OTTHUMT00000313537.2	34	0.00	0	A	NM_000875		99440122	99440122	+1	no_errors	ENST00000268035	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	T
KCNJ11	3767	genome.wustl.edu	37	11	17408790	17408790	+	Silent	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:17408790G>T	ENST00000339994.4	-	1	1416	c.849C>A	c.(847-849)atC>atA	p.I283I	KCNJ11_ENST00000528731.1_Silent_p.I196I|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	283					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	GGATGACGATGATCTCGAGGT	0.622											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													132.0	122.0	126.0					11																	17408790		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.849C>A	11.37:g.17408790G>T		717	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Silent	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir6.2	p.I283	ENST00000339994.4	37	c.849	CCDS31436.1	11																																																																																			KCNJ11	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000187486		0.622	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ11	HGNC	protein_coding	OTTHUMT00000387037.1	32	0.00	0	G	NM_000525		17408790	17408790	-1	no_errors	ENST00000339994	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	1.000	T
IL18	3606	genome.wustl.edu	37	11	112025729	112025729	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr11:112025729C>T	ENST00000280357.7	-	2	267	c.48G>A	c.(46-48)atG>atA	p.M16I	IL18_ENST00000524595.1_Missense_Mutation_p.M16I|SDHD_ENST00000532699.1_Intron|IL18_ENST00000528832.1_Missense_Mutation_p.M16I|IL18_ENST00000533858.1_5'UTR	NM_001562.3	NP_001553.1	Q14116	IL18_HUMAN	interleukin 18	16					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cellular response to organic cyclic compound (GO:0071407)|chemokine biosynthetic process (GO:0042033)|granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0042253)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma biosynthetic process (GO:0042095)|interleukin-13 biosynthetic process (GO:0042231)|interleukin-2 biosynthetic process (GO:0042094)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|natural killer cell activation (GO:0030101)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of tissue remodeling (GO:0034105)|regulation of cell adhesion (GO:0030155)|sleep (GO:0030431)|T-helper 1 type immune response (GO:0042088)|type 2 immune response (GO:0042092)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)						all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)		CAATAAATTTCATTGCCACAA	0.348																																						dbGAP											0													136.0	125.0	128.0					11																	112025729		1861	4098	5959	-	-	-	SO:0001583	missense	0			U90434	CCDS44731.1, CCDS58180.1	11q22.2-q22.3	2014-04-04	2014-04-04		ENSG00000150782	ENSG00000150782		"""Interleukins and interleukin receptors"""	5986	protein-coding gene	gene with protein product	"""interferon-gamma-inducing factor"""	600953	"""interleukin 18 (interferon-gamma-inducing factor)"""			7477296, 9693051	Standard	NM_001562		Approved	IGIF, IL1F4, IL-1g, IL-18	uc001pnb.2	Q14116	OTTHUMG00000167006	ENST00000280357.7:c.48G>A	11.37:g.112025729C>T	ENSP00000280357:p.Met16Ile		O75599|Q6FGY3|Q6WWJ7	Missense_Mutation	SNP	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,pirsf_Interleukin_18,prints_Interleukin_18	p.M16I	ENST00000280357.7	37	c.48	CCDS44731.1	11	.	.	.	.	.	.	.	.	.	.	C	7.688	0.690464	0.15039	.	.	ENSG00000150782	ENST00000280357;ENST00000524595;ENST00000528832	.	.	.	4.89	3.91	0.45181	.	0.088659	0.48286	D	0.000200	T	0.42585	0.1209	L	0.59436	1.845	0.29406	N	0.861555	B;B	0.17852	0.024;0.013	B;B	0.12156	0.007;0.006	T	0.42616	-0.9441	9	0.52906	T	0.07	-21.8731	10.622	0.45484	0.0:0.8054:0.1946:0.0	.	16;16	Q6WWJ7;Q14116	.;IL18_HUMAN	I	16	.	ENSP00000280357:M16I	M	-	3	0	IL18	111530939	0.856000	0.29760	1.000000	0.80357	0.161000	0.22273	0.654000	0.24918	2.698000	0.92095	0.591000	0.81541	ATG	IL18	-	pirsf_Interleukin_18	ENSG00000150782		0.348	IL18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL18	HGNC	protein_coding	OTTHUMT00000392409.1	63	0.00	0	C	NM_001562		112025729	112025729	-1	no_errors	ENST00000280357	ensembl	human	known	69_37n	missense	60	10.45	7	SNP	0.998	T
KDM5B	10765	genome.wustl.edu	37	1	202700129	202700129	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:202700129C>T	ENST00000367265.3	-	25	5248	c.4084G>A	c.(4084-4086)Gaa>Aaa	p.E1362K	KDM5B_ENST00000367264.2_Missense_Mutation_p.E1398K	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1362					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						TCCTGAATTTCAGGAAGGGAT	0.463																																						dbGAP											0													98.0	87.0	91.0					1																	202700129		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.4084G>A	1.37:g.202700129C>T	ENSP00000356234:p.Glu1362Lys		O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E1362K	ENST00000367265.3	37	c.4084	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.891810	0.97074	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.90900	-2.75;-2.58;-2.35	6.14	6.14	0.99180	.	0.044322	0.85682	D	0.000000	D	0.95680	0.8595	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.967	D	0.95213	0.8327	10	0.87932	D	0	-25.4841	20.4548	0.99139	0.0:1.0:0.0:0.0	.	1398;1362	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	K	1362;1204;1398;1204	ENSP00000356234:E1362K;ENSP00000356233:E1398K;ENSP00000235790:E1204K	ENSP00000235790:E1204K	E	-	1	0	KDM5B	200966752	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.754000	0.74909	2.937000	0.99478	0.650000	0.86243	GAA	KDM5B	-	NULL	ENSG00000117139		0.463	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	50	0.00	0	C	NM_006618		202700129	202700129	-1	no_errors	ENST00000367265	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
KIAA0430	9665	genome.wustl.edu	37	16	15698049	15698049	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:15698049C>T	ENST00000396368.3	-	22	4595	c.4389G>A	c.(4387-4389)ctG>ctA	p.L1463L	KIAA0430_ENST00000548025.1_Silent_p.L1460L|KIAA0430_ENST00000602337.1_Silent_p.L1460L|KIAA0430_ENST00000547936.1_5'UTR|KIAA0430_ENST00000344181.3_Silent_p.L1065L|KIAA0430_ENST00000551742.1_Silent_p.L1463L|KIAA0430_ENST00000540441.2_Silent_p.L1298L	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1463	HTH OST-type 7. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GCAGGCTCTTCAGCAGTTCGG	0.453																																						dbGAP											0													98.0	96.0	97.0					16																	15698049		1914	4141	6055	-	-	-	SO:0001819	synonymous_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4389G>A	16.37:g.15698049C>T			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.L1463	ENST00000396368.3	37	c.4389	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.453	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	50	0.00	0	C	NM_014647		15698049	15698049	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	silent	47	16.07	9	SNP	1.000	T
LCT	3938	genome.wustl.edu	37	2	136594528	136594528	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr2:136594528A>G	ENST00000264162.2	-	1	222	c.212T>C	c.(211-213)tTc>tCc	p.F71S		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	71					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTCTGGCAGGAAAGTGGGCAG	0.507																																						dbGAP											0													75.0	75.0	75.0					2																	136594528		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.212T>C	2.37:g.136594528A>G	ENSP00000264162:p.Phe71Ser		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.F71S	ENST00000264162.2	37	c.212	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	a	7.262	0.605467	0.14002	.	.	ENSG00000115850	ENST00000264162	T	0.28895	1.59	5.16	-1.17	0.09648	Glycoside hydrolase, superfamily (1);	0.731566	0.13766	N	0.364243	T	0.19927	0.0479	L	0.29908	0.895	0.09310	N	0.999999	B	0.12013	0.005	B	0.08055	0.003	T	0.19484	-1.0304	10	0.42905	T	0.14	-4.6926	10.0156	0.42011	0.4653:0.0:0.5347:0.0	.	71	P09848	LPH_HUMAN	S	71	ENSP00000264162:F71S	ENSP00000264162:F71S	F	-	2	0	LCT	136310998	0.000000	0.05858	0.205000	0.23548	0.770000	0.43624	0.083000	0.14871	-0.107000	0.12088	0.529000	0.55759	TTC	LCT	-	superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.507	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	49	0.00	0	A	NM_002299		136594528	136594528	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.122	G
LNX1	84708	genome.wustl.edu	37	4	54373554	54373554	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:54373554C>G	ENST00000263925.7	-	4	1019	c.705G>C	c.(703-705)aaG>aaC	p.K235N	LNX1-AS1_ENST00000511989.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000510785.1_RNA|LNX1-AS1_ENST00000514364.1_RNA|LNX1_ENST00000306888.2_Missense_Mutation_p.K139N	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	235	Interaction with MAGEB18.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CACTCCCGCTCTTTGTCCTTC	0.478																																						dbGAP											0													120.0	114.0	116.0					4																	54373554		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.705G>C	4.37:g.54373554C>G	ENSP00000263925:p.Lys235Asn		Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.K235N	ENST00000263925.7	37	c.705	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431581	0.62844	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.09073	3.02;4.5	5.13	3.25	0.37280	.	0.044203	0.85682	D	0.000000	T	0.14570	0.0352	L	0.36672	1.1	0.52099	D	0.999942	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	T	0.11446	-1.0587	10	0.23891	T	0.37	.	6.9811	0.24704	0.0:0.7144:0.0:0.2856	.	235;139	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	N	139;73;235	ENSP00000302879:K139N;ENSP00000263925:K235N	ENSP00000263925:K235N	K	-	3	2	LNX1	54068311	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	1.776000	0.38594	1.399000	0.46721	0.555000	0.69702	AAG	LNX1	-	NULL	ENSG00000072201		0.478	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	50	0.00	0	C			54373554	54373554	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	G
LRIF1	55791	genome.wustl.edu	37	1	111506249	111506249	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:111506249G>A	ENST00000369763.4	-	1	452	c.62C>T	c.(61-63)tCg>tTg	p.S21L	LRIF1_ENST00000485275.2_5'UTR|RP11-96K19.5_ENST00000609118.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						TTACCAACGCGAGGCGTTGCC	0.547											OREG0013667	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													54.0	49.0	51.0					1																	111506249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.62C>T	1.37:g.111506249G>A	ENSP00000358778:p.Ser21Leu	1435	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.S21L	ENST00000369763.4	37	c.62	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836050	0.50951	.	.	ENSG00000121931	ENST00000369763	T	0.23950	1.88	4.34	4.34	0.51931	.	0.558906	0.15977	N	0.235502	T	0.09512	0.0234	N	0.24115	0.695	0.80722	D	1	P	0.39920	0.695	B	0.35312	0.2	T	0.07790	-1.0754	10	0.87932	D	0	.	12.5257	0.56085	0.0:0.0:1.0:0.0	.	21	Q5T3J3	LRIF1_HUMAN	L	21	ENSP00000358778:S21L	ENSP00000358778:S21L	S	-	2	0	LRIF1	111307772	1.000000	0.71417	1.000000	0.80357	0.472000	0.32918	3.926000	0.56491	2.413000	0.81919	0.655000	0.94253	TCG	LRIF1	-	NULL	ENSG00000121931		0.547	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	42	0.00	0	G	NM_018372		111506249	111506249	-1	no_errors	ENST00000369763	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
MAGEE1	57692	genome.wustl.edu	37	X	75648839	75648839	+	Silent	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chrX:75648839G>A	ENST00000361470.2	+	1	794	c.516G>A	c.(514-516)acG>acA	p.T172T		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	172	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GTGAGGGAACGAGCACCTCCG	0.682																																						dbGAP											0													31.0	28.0	29.0					X																	75648839		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.516G>A	X.37:g.75648839G>A			Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.T172	ENST00000361470.2	37	c.516	CCDS14433.1	X																																																																																			MAGEE1	-	NULL	ENSG00000198934		0.682	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	26	0.00	0	G	NM_020932		75648839	75648839	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	0.000	A
MDN1	23195	genome.wustl.edu	37	6	90383950	90383950	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr6:90383950G>A	ENST00000369393.3	-	79	13235	c.13120C>T	c.(13120-13122)Cgg>Tgg	p.R4374W	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.R4374W|MDN1_ENST00000468568.1_5'Flank			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4374					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCCTGTTTCCGCATCCGGCAA	0.463																																						dbGAP											0													117.0	104.0	109.0					6																	90383950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13120C>T	6.37:g.90383950G>A	ENSP00000358400:p.Arg4374Trp		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R4374W	ENST00000369393.3	37	c.13120	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437955	0.62955	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03801	3.8;3.8	5.96	5.07	0.68467	.	0.069202	0.56097	D	0.000027	T	0.10165	0.0249	M	0.62723	1.935	0.47065	D	0.999302	D	0.89917	1.0	P	0.60609	0.877	T	0.01460	-1.1349	10	0.72032	D	0.01	.	16.0917	0.81094	0.0:0.0:0.8613:0.1387	.	4374	Q9NU22	MDN1_HUMAN	W	4374	ENSP00000358400:R4374W;ENSP00000413970:R4374W	ENSP00000358400:R4374W	R	-	1	2	MDN1	90440671	0.999000	0.42202	1.000000	0.80357	0.863000	0.49368	1.293000	0.33353	1.466000	0.48025	0.655000	0.94253	CGG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	30	0.00	0	G			90383950	90383950	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	8	52.94	9	SNP	1.000	A
MEIOB	254528	genome.wustl.edu	37	16	1891885	1891885	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:1891885G>A	ENST00000397344.3	-	11	1164	c.970C>T	c.(970-972)Ctt>Ttt	p.L324F	MEIOB_ENST00000412554.2_Missense_Mutation_p.L324F|LA16c-429E7.1_ENST00000570247.1_RNA|MEIOB_ENST00000452149.2_Missense_Mutation_p.L324F|MEIOB_ENST00000470044.1_Missense_Mutation_p.L117F|MEIOB_ENST00000325962.3_Missense_Mutation_p.L324F	NM_152764.2	NP_689977.2	Q8N635	MEIOB_HUMAN	meiosis specific with OB domains	324					double-strand break repair via homologous recombination (GO:0000724)|female meiosis I (GO:0007144)|fertilization (GO:0009566)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|resolution of meiotic recombination intermediates (GO:0000712)|synapsis (GO:0007129)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA binding (GO:0003697)										TAGGCATAAAGGATGCCATAG	0.343																																						dbGAP											0													152.0	121.0	132.0					16																	1891885		2199	4300	6499	-	-	-	SO:0001583	missense	0			BC029829	CCDS10449.2, CCDS53983.1	16p13.3	2012-08-13	2012-08-13	2012-08-13	ENSG00000162039	ENSG00000162039			28569	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 73"""	C16orf73		12477932	Standard	NM_152764		Approved	MGC35212	uc010uvq.1	Q8N635	OTTHUMG00000128683	ENST00000397344.3:c.970C>T	16.37:g.1891885G>A	ENSP00000380504:p.Leu324Phe		B1AK39|C9J0S1|Q96RY0	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.L324F	ENST00000397344.3	37	c.970	CCDS10449.2	16	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917938	0.52546	.	.	ENSG00000162039	ENST00000412554;ENST00000452149;ENST00000325962;ENST00000397344	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	5.76	5.76	0.90799	.	0.113753	0.64402	D	0.000014	T	0.13798	0.0334	L	0.49350	1.555	0.38327	D	0.943701	P;P	0.43024	0.69;0.798	B;B	0.38264	0.269;0.269	T	0.01715	-1.1289	10	0.66056	D	0.02	.	10.3359	0.43850	0.0:0.144:0.707:0.149	.	324;324	C9J0S1;Q8N635	.;CP073_HUMAN	F	324	ENSP00000390778:L324F;ENSP00000391033:L324F;ENSP00000314484:L324F;ENSP00000380504:L324F	ENSP00000314484:L324F	L	-	1	0	C16orf73	1831886	1.000000	0.71417	0.993000	0.49108	0.955000	0.61496	3.429000	0.52800	2.880000	0.98712	0.650000	0.86243	CTT	MEIOB	-	superfamily_NA-bd_OB-fold-like	ENSG00000162039		0.343	MEIOB-001	KNOWN	basic|CCDS	protein_coding	MEIOB	HGNC	protein_coding	OTTHUMT00000250580.1	55	0.00	0	G	NM_152764		1891885	1891885	-1	no_errors	ENST00000325962	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	0.990	A
MFAP3L	9848	genome.wustl.edu	37	4	170913069	170913069	+	Silent	SNP	G	G	A	rs560309385		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:170913069G>A	ENST00000361618.3	-	3	997	c.690C>T	c.(688-690)ttC>ttT	p.F230F	MFAP3L_ENST00000393704.3_Silent_p.F127F|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		TGTAGCGGGCGAACTCCATGG	0.542																																						dbGAP											0													63.0	70.0	68.0					4																	170913069		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.690C>T	4.37:g.170913069G>A			A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F230	ENST00000361618.3	37	c.690	CCDS34103.1	4																																																																																			MFAP3L	-	NULL	ENSG00000198948		0.542	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	HGNC	protein_coding	OTTHUMT00000363043.2	51	0.00	0	G	NM_021647		170913069	170913069	-1	no_errors	ENST00000361618	ensembl	human	known	69_37n	silent	34	27.66	13	SNP	0.994	A
MIB1	57534	genome.wustl.edu	37	18	19438554	19438554	+	Missense_Mutation	SNP	G	G	A	rs200035428		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr18:19438554G>A	ENST00000261537.6	+	20	3091	c.2827G>A	c.(2827-2829)Gtc>Atc	p.V943I	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	943			V -> F (in LVNC7). {ECO:0000269|PubMed:23314057}.		blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TAATACCAATGTCAATGCAGA	0.328																																						dbGAP											0													116.0	120.0	119.0					18																	19438554		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2827G>A	18.37:g.19438554G>A	ENSP00000261537:p.Val943Ile		B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Mib_Herc2,pfam_Znf_ZZ,superfamily_Ankyrin_rpt-contain_dom,smart_Znf_ZZ,smart_Ankyrin_rpt,smart_Znf_RING,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_RING,pfscan_Znf_ZZ	p.V943I	ENST00000261537.6	37	c.2827	CCDS11871.1	18	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718582	0.48622	.	.	ENSG00000101752	ENST00000261537	T	0.36157	1.27	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	L	0.46157	1.445	0.80722	D	1	B	0.26744	0.158	B	0.20184	0.028	T	0.06127	-1.0844	10	0.34782	T	0.22	-11.6846	19.7059	0.96071	0.0:0.0:1.0:0.0	.	943	Q86YT6	MIB1_HUMAN	I	943	ENSP00000261537:V943I	ENSP00000261537:V943I	V	+	1	0	MIB1	17692552	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.948000	0.87774	2.673000	0.90976	0.591000	0.81541	GTC	MIB1	-	NULL	ENSG00000101752		0.328	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIB1	HGNC	protein_coding	OTTHUMT00000254675.1	35	0.00	0	G	NM_020774		19438554	19438554	+1	no_errors	ENST00000261537	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	A
MICAL3	57553	genome.wustl.edu	37	22	18301084	18301084	+	Missense_Mutation	SNP	G	G	A	rs201688866		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr22:18301084G>A	ENST00000441493.2	-	26	4695	c.4343C>T	c.(4342-4344)tCg>tTg	p.S1448L	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1448	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGCGGAGTCCGAGGTGTTGAA	0.716													G|||	1	0.000199681	0.0	0.0	5008	,	,		7416	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													9.0	11.0	10.0					22																	18301084		1967	4095	6062	-	-	-	SO:0001583	missense	0			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4343C>T	22.37:g.18301084G>A	ENSP00000416015:p.Ser1448Leu		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.S1448L	ENST00000441493.2	37	c.4343	CCDS46659.1	22	3|3	0.0013736263736263737|0.0013736263736263737	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	G|G	31|31	5.102442|5.102442	0.94245|0.94245	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.69175	.|-0.38	4.42|4.42	4.42|4.42	0.53409|0.53409	.|.	.|.	.|.	.|.	.|.	T|T	0.79839|0.79839	0.4515|0.4515	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.76575	.|0.988	T|T	0.82955|0.82955	-0.0200|-0.0200	5|9	.|0.87932	.|D	.|0	.|.	17.0491|17.0491	0.86513|0.86513	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1448	.|Q7RTP6	.|MICA3_HUMAN	W|L	430|1448	.|ENSP00000416015:S1448L	.|ENSP00000416015:S1448L	R|S	-|-	1|2	2|0	XXbac-B461K10.4|XXbac-B461K10.4	16681084|16681084	1.000000|1.000000	0.71417|0.71417	0.846000|0.846000	0.33378|0.33378	0.987000|0.987000	0.75469|0.75469	7.516000|7.516000	0.81772|0.81772	2.013000|2.013000	0.59113|0.59113	0.455000|0.455000	0.32223|0.32223	CGG|TCG	MICAL3	-	NULL	ENSG00000243156		0.716	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	31	0.00	0	G			18301084	18301084	-1	no_errors	ENST00000441493	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.999	A
DHRS11	79154	genome.wustl.edu	37	17	34958632	34958632	+	IGR	SNP	G	G	C	rs376476399		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr17:34958632G>C	ENST00000251312.5	+	0	1598				MRM1_ENST00000585770.1_Intron|MRM1_ENST00000250156.7_Missense_Mutation_p.W131C	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						CCCGGCCTTGGAGAGAGGCCG	0.662																																						dbGAP											0													15.0	19.0	17.0					17																	34958632		2123	4167	6290	-	-	-	SO:0001628	intergenic_variant	0				CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442		17.37:g.34958632G>C			B2RDZ3|Q9BUC7|Q9H674	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,pfam_SpoU_subst-bd,smart_SpoU_subst-bd,tigrfam_rRNA_MeTrfase_TrmH	p.W131C	ENST00000251312.5	37	c.393	CCDS11315.2	17	.	.	.	.	.	.	.	.	.	.	G	8.444	0.851466	0.17034	.	.	ENSG00000129282	ENST00000250156	T	0.29142	1.58	4.9	3.88	0.44766	.	0.866451	0.10351	N	0.685127	T	0.26231	0.0640	L	0.35542	1.07	0.58432	D	0.999994	B	0.06786	0.001	B	0.06405	0.002	T	0.02533	-1.1145	10	0.41790	T	0.15	-6.8341	12.3181	0.54969	0.0:0.2324:0.7676:0.0	.	131	Q6IN84	MRM1_HUMAN	C	131	ENSP00000250156:W131C	ENSP00000250156:W131C	W	+	3	0	MRM1	32032745	0.006000	0.16342	0.657000	0.29651	0.298000	0.27526	0.598000	0.24074	1.074000	0.40909	0.555000	0.69702	TGG	MRM1	-	tigrfam_rRNA_MeTrfase_TrmH	ENSG00000129282		0.662	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRM1	HGNC	protein_coding	OTTHUMT00000256681.2	47	0.00	0	G	NM_024308		34958632	34958632	+1	no_errors	ENST00000250156	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.017	C
MYH7	4625	genome.wustl.edu	37	14	23886162	23886162	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr14:23886162C>T	ENST00000355349.3	-	33	4721	c.4559G>A	c.(4558-4560)gGa>gAa	p.G1520E	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1520					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GATAGTCTTTCCGCTGGAACC	0.587																																						dbGAP											0													118.0	106.0	110.0					14																	23886162		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4559G>A	14.37:g.23886162C>T	ENSP00000347507:p.Gly1520Glu		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G1520E	ENST00000355349.3	37	c.4559	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080830	0.55753	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.80824	-1.42	5.01	5.01	0.66863	Myosin tail (1);	.	.	.	.	D	0.88916	0.6567	M	0.93283	3.4	0.47407	D	0.999415	B	0.31026	0.304	P	0.45167	0.472	D	0.89885	0.4033	9	0.87932	D	0	.	11.4873	0.50361	0.0:0.8713:0.0:0.1287	.	1520	P12883	MYH7_HUMAN	E	1520;1525	ENSP00000347507:G1520E	ENSP00000347507:G1520E	G	-	2	0	MYH7	22956002	0.007000	0.16637	0.722000	0.30670	0.186000	0.23388	1.825000	0.39081	2.596000	0.87737	0.591000	0.81541	GGA	MYH7	-	pfam_Myosin_tail	ENSG00000092054		0.587	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	31	0.00	0	C	NM_000257		23886162	23886162	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.968	T
MYH7	4625	genome.wustl.edu	37	14	23895175	23895175	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr14:23895175C>G	ENST00000355349.3	-	19	2322	c.2160G>C	c.(2158-2160)caG>caC	p.Q720H		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	720	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ATACCCACCTCTGCCGGAAGT	0.607																																						dbGAP											0													57.0	58.0	58.0					14																	23895175		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2160G>C	14.37:g.23895175C>G	ENSP00000347507:p.Gln720His		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q720H	ENST00000355349.3	37	c.2160	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769569	0.69992	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88124	-2.34	5.03	5.03	0.67393	Myosin head, motor domain (2);	.	.	.	.	D	0.91573	0.7338	M	0.77712	2.385	0.50813	D	0.999894	P	0.52170	0.951	D	0.63113	0.911	D	0.91595	0.5290	9	0.66056	D	0.02	.	9.2621	0.37619	0.0:0.8419:0.0:0.1581	.	720	P12883	MYH7_HUMAN	H	720	ENSP00000347507:Q720H	ENSP00000347507:Q720H	Q	-	3	2	MYH7	22965015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.909000	0.39917	2.612000	0.88384	0.655000	0.94253	CAG	MYH7	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000092054		0.607	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	51	0.00	0	C	NM_000257		23895175	23895175	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	1.000	G
NBPF22P	285622	genome.wustl.edu	37	5	85586679	85586679	+	RNA	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr5:85586679G>C	ENST00000590707.1	+	0	966					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AAGGGACTTGGAGTGGAGACT	0.547																																						dbGAP											0																																										-	-	-			0			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85586679G>C				RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			NBPF22P	-	-	ENSG00000205449		0.547	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	62	0.00	0	G	XM_208333		85586679	85586679	+1	no_errors	ENST00000590707	ensembl	human	known	69_37n	rna	52	14.75	9	SNP	0.002	C
NFIA	4774	genome.wustl.edu	37	1	61547540	61547541	+	5'Flank	INS	-	-	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:61547540_61547541insT	ENST00000403491.3	+	0	0				NFIA_ENST00000485903.2_5'Flank|NFIA_ENST00000371184.2_5'Flank|NFIA_ENST00000407417.3_Intron|NFIA_ENST00000371185.2_5'Flank|AC096534.1_ENST00000584315.1_RNA|NFIA_ENST00000371191.1_Intron|NFIA_ENST00000371189.4_5'UTR|NFIA_ENST00000479364.1_3'UTR|NFIA_ENST00000371187.3_5'Flank	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A						DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						GATTACAATGCTTTGAGCCTTA	0.465																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618		1.37:g.61547543_61547543dupT	Exception_encountered		B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	RNA	INS	-	NULL	ENST00000403491.3	37	NULL	CCDS44156.1	1																																																																																			NFIA	-	-	ENSG00000162599		0.465	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIA	HGNC	protein_coding	OTTHUMT00000023799.3	61	0.00	0	-	NM_005595		61547540	61547541	+1	no_errors	ENST00000479364	ensembl	human	known	69_37n	rna	42	28.81	17	INS	1.000:1.000	T
NKTR	4820	genome.wustl.edu	37	3	42680623	42680623	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:42680623G>C	ENST00000232978.8	+	13	3615	c.3427G>C	c.(3427-3429)Gag>Cag	p.E1143Q	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	1143					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AGCAAAAGTAGAGGAGACTTC	0.463																																						dbGAP											0													88.0	88.0	88.0					3																	42680623		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.3427G>C	3.37:g.42680623G>C	ENSP00000232978:p.Glu1143Gln			Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	p.E1143Q	ENST00000232978.8	37	c.3427	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758847	0.31137	.	.	ENSG00000114857	ENST00000232978	D	0.81821	-1.54	4.8	4.8	0.61643	.	0.728345	0.13000	N	0.421760	D	0.84857	0.5565	L	0.53249	1.67	0.80722	D	1	D;P	0.62365	0.991;0.808	P;B	0.58970	0.849;0.288	D	0.83942	0.0312	10	0.62326	D	0.03	-17.6791	11.7101	0.51620	0.0824:0.0:0.9176:0.0	.	843;1143	Q6M1B8;P30414	.;NKTR_HUMAN	Q	1143	ENSP00000232978:E1143Q	ENSP00000232978:E1143Q	E	+	1	0	NKTR	42655627	1.000000	0.71417	0.812000	0.32479	0.480000	0.33159	3.791000	0.55469	2.356000	0.79943	0.557000	0.71058	GAG	NKTR	-	NULL	ENSG00000114857		0.463	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2	40	0.00	0	G	NM_005385		42680623	42680623	+1	no_errors	ENST00000232978	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.930	C
NKX2-3	159296	genome.wustl.edu	37	10	101292921	101292921	+	Silent	SNP	T	T	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr10:101292921T>A	ENST00000344586.7	+	1	232	c.33T>A	c.(31-33)ccT>ccA	p.P11P	RP11-129J12.2_ENST00000548010.1_RNA	NM_145285.2	NP_660328.2	Q8TAU0	NKX23_HUMAN	NK2 homeobox 3	11					CD4-positive, alpha-beta T cell differentiation (GO:0043367)|gland morphogenesis (GO:0022612)|leukocyte homeostasis (GO:0001776)|leukocyte migration (GO:0050900)|lymph node development (GO:0048535)|macrophage differentiation (GO:0030225)|odontogenesis of dentin-containing tooth (GO:0042475)|Peyer's patch development (GO:0048541)|plasma cell differentiation (GO:0002317)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic digestive tract morphogenesis (GO:0048621)|regulation of cell proliferation (GO:0042127)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)|triglyceride metabolic process (GO:0006641)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.45e-08)		CCTCCACCCCTTTCTCAGTCA	0.582																																					Pancreas(173;2021 2035 19403 19989 27291)	dbGAP											0													63.0	73.0	70.0					10																	101292921		1987	4150	6137	-	-	-	SO:0001819	synonymous_variant	0				CCDS41558.1	10q24.2	2013-09-20	2011-06-01	2002-10-04	ENSG00000119919	ENSG00000119919		"""Homeoboxes / ANTP class : NKL subclass"""	7836	protein-coding gene	gene with protein product		606727	"""NK-2 (Drosophila) homolog C"", ""NK2 transcription factor related, locus 3 (Drosophila)"""	NKX2C		1346742, 9142493	Standard	NM_145285		Approved	NKX2.3, CSX3, NKX4-3	uc009xwj.3	Q8TAU0	OTTHUMG00000018887	ENST00000344586.7:c.33T>A	10.37:g.101292921T>A			B4DUZ4|Q9NYS6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.P11	ENST00000344586.7	37	c.33	CCDS41558.1	10																																																																																			NKX2-3	-	NULL	ENSG00000119919		0.582	NKX2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-3	HGNC	protein_coding	OTTHUMT00000049808.2	82	0.00	0	T			101292921	101292921	+1	no_errors	ENST00000344586	ensembl	human	known	69_37n	silent	59	10.61	7	SNP	1.000	A
NSFL1C	55968	genome.wustl.edu	37	20	1433679	1433679	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr20:1433679C>T	ENST00000216879.4	-	6	1511	c.644G>A	c.(643-645)aGa>aAa	p.R215K	NSFL1C_ENST00000476071.1_Missense_Mutation_p.R217K|NSFL1C_ENST00000353088.2_Missense_Mutation_p.R184K|NSFL1C_ENST00000350991.4_Missense_Mutation_p.R217K|NSFL1C_ENST00000381658.4_Missense_Mutation_p.R104K|NSFL1C_ENST00000461211.1_5'UTR	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	215	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.					chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						CACTCACCCTCTGCGGATAGA	0.458																																						dbGAP											0													180.0	169.0	173.0					20																	1433679		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.644G>A	20.37:g.1433679C>T	ENSP00000216879:p.Arg215Lys		A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	pfam_SEP_domain,pfam_UBX,superfamily_SEP_domain,superfamily_UBA-like,smart_SEP_domain,smart_UBX,pfscan_UBX	p.R217K	ENST00000216879.4	37	c.650	CCDS13015.1	20	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188797	0.78789	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T;T	0.44083	0.98;0.95;0.94;0.95;0.93	5.21	5.21	0.72293	SEP domain (4);	0.000000	0.85682	D	0.000000	T	0.46698	0.1406	N	0.12853	0.265	0.80722	D	1	D;P;P	0.56035	0.974;0.81;0.842	D;D;D	0.72075	0.969;0.96;0.976	T	0.41270	-0.9518	10	0.30854	T	0.27	.	17.5459	0.87861	0.0:1.0:0.0:0.0	.	184;104;215	Q9UNZ2-4;Q9UNZ2-6;Q9UNZ2	.;.;NSF1C_HUMAN	K	184;217;215;104;217	ENSP00000338643:R184K;ENSP00000418529:R217K;ENSP00000216879:R215K;ENSP00000371074:R104K;ENSP00000202584:R217K	ENSP00000216879:R215K	R	-	2	0	NSFL1C	1381679	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.884000	0.69729	2.890000	0.99128	0.650000	0.86243	AGA	NSFL1C	-	pfam_SEP_domain,superfamily_SEP_domain,smart_SEP_domain	ENSG00000088833		0.458	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NSFL1C	HGNC	protein_coding	OTTHUMT00000077525.2	27	0.00	0	C	NM_016143		1433679	1433679	-1	no_errors	ENST00000350991	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	T
NUDT15	55270	genome.wustl.edu	37	13	48611981	48611981	+	Missense_Mutation	SNP	G	G	T	rs150241065		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr13:48611981G>T	ENST00000258662.2	+	1	279	c.99G>T	c.(97-99)aaG>aaT	p.K33N	SUCLA2_ENST00000543413.1_5'UTR	NM_018283.1	NP_060753.1	Q9NV35	NUD15_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 15	33	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				dGTP catabolic process (GO:0006203)|GTP catabolic process (GO:0006184)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity (GO:0035539)|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity (GO:0008413)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	7		all_cancers(8;3.75e-25)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|all_hematologic(8;0.000219)|Lung NSC(96;0.000226)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;4.83e-07)		TCCTGGGGAAGAGGAAAGGCT	0.672											OREG0022405	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													43.0	39.0	40.0					13																	48611981		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9407.1	13q14.12	2006-04-12			ENSG00000136159	ENSG00000136159		"""Nudix motif containing"""	23063	protein-coding gene	gene with protein product		615792				12767940	Standard	NM_018283		Approved	MTH2, FLJ10956	uc001vbw.1	Q9NV35	OTTHUMG00000016890	ENST00000258662.2:c.99G>T	13.37:g.48611981G>T	ENSP00000258662:p.Lys33Asn	955	A2RUR6|Q32Q27|Q6P2C9	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.K33N	ENST00000258662.2	37	c.99	CCDS9407.1	13	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777335	0.49786	.	.	ENSG00000136159	ENST00000258662	T	0.09630	2.96	5.57	2.86	0.33363	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.046321	0.85682	D	0.000000	T	0.28466	0.0704	M	0.77406	2.37	0.41327	D	0.987216	D	0.67145	0.996	D	0.69479	0.964	T	0.01899	-1.1251	10	0.87932	D	0	-6.1292	8.3864	0.32503	0.3193:0.0:0.6807:0.0	.	33	Q9NV35	NUD15_HUMAN	N	33	ENSP00000258662:K33N	ENSP00000258662:K33N	K	+	3	2	NUDT15	47509982	1.000000	0.71417	0.979000	0.43373	0.097000	0.18754	1.735000	0.38176	0.715000	0.32103	-0.126000	0.14955	AAG	NUDT15	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	ENSG00000136159		0.672	NUDT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT15	HGNC	protein_coding	OTTHUMT00000044862.3	82	0.00	0	G	NM_018283		48611981	48611981	+1	no_errors	ENST00000258662	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	1.000	T
NUP188	23511	genome.wustl.edu	37	9	131762022	131762022	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr9:131762022G>C	ENST00000372577.2	+	34	3802	c.3781G>C	c.(3781-3783)Gac>Cac	p.D1261H		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1261					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TGCCACAGAGGACAAGGACAG	0.587																																						dbGAP											0													89.0	75.0	79.0					9																	131762022		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3781G>C	9.37:g.131762022G>C	ENSP00000361658:p.Asp1261His		Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.D1261H	ENST00000372577.2	37	c.3781	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166984	0.78339	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.34667	1.35	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	M	0.67953	2.075	0.80722	D	1	P;D	0.60160	0.93;0.987	P;P	0.54460	0.635;0.753	T	0.54964	-0.8214	10	0.54805	T	0.06	-16.1642	17.8831	0.88846	0.0:0.0:1.0:0.0	.	594;1261	E9PET9;Q5SRE5	.;NU188_HUMAN	H	1150;1261	ENSP00000361658:D1261H	ENSP00000349125:D1150H	D	+	1	0	NUP188	130801843	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	6.635000	0.74295	2.473000	0.83533	0.563000	0.77884	GAC	NUP188	-	NULL	ENSG00000095319		0.587	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	68	0.00	0	G			131762022	131762022	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	missense	50	16.39	10	SNP	1.000	C
OLFML2B	25903	genome.wustl.edu	37	1	161953686	161953686	+	Missense_Mutation	SNP	C	C	T	rs141909728	byFrequency	TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:161953686C>T	ENST00000294794.3	-	8	2455	c.2032G>A	c.(2032-2034)Gtc>Atc	p.V678I	OLFML2B_ENST00000367940.2_Missense_Mutation_p.V679I|OLFML2B_ENST00000367938.1_Missense_Mutation_p.V161I	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	678	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CCACAGATGACGAAGCAGTTG	0.572																																						dbGAP											0													217.0	197.0	204.0					1																	161953686		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.2032G>A	1.37:g.161953686C>T	ENSP00000294794:p.Val678Ile		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_NA-bd_OB-fold-like,smart_Olfac-like,pfscan_Olfac-like	p.V678I	ENST00000294794.3	37	c.2032	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406371	0.42715	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.88741	-2.42;-2.42;-2.42	5.36	4.43	0.53597	Olfactomedin-like (3);	.	.	.	.	T	0.63954	0.2555	N	0.02697	-0.525	0.34758	D	0.732438	P;P	0.51537	0.946;0.891	B;B	0.43331	0.416;0.34	T	0.67432	-0.5672	8	0.24483	T	0.36	.	13.0504	0.58952	0.1622:0.8378:0.0:0.0	.	679;678	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	I	678;679;161	ENSP00000294794:V678I;ENSP00000356917:V679I;ENSP00000356915:V161I	ENSP00000294794:V678I	V	-	1	0	OLFML2B	160220310	0.996000	0.38824	0.990000	0.47175	0.967000	0.64934	2.961000	0.49168	1.200000	0.43188	0.561000	0.74099	GTC	OLFML2B	-	pfam_Olfac-like,superfamily_NA-bd_OB-fold-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000162745		0.572	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	90	0.00	0	C	NM_015441		161953686	161953686	-1	no_errors	ENST00000294794	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	1.000	T
OTOF	9381	genome.wustl.edu	37	2	26693475	26693475	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr2:26693475C>T	ENST00000272371.2	-	32	4135	c.4009G>A	c.(4009-4011)Gac>Aac	p.D1337N	OTOF_ENST00000403946.3_Missense_Mutation_p.D1337N|OTOF_ENST00000338581.6_Missense_Mutation_p.D570N|OTOF_ENST00000402415.3_Missense_Mutation_p.D647N|OTOF_ENST00000339598.3_Missense_Mutation_p.D570N	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1337					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCATGGTGTCAATGGAGGCA	0.597																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													238.0	203.0	215.0					2																	26693475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4009G>A	2.37:g.26693475C>T	ENSP00000272371:p.Asp1337Asn		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.D1337N	ENST00000272371.2	37	c.4009	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626168	0.87560	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.79653	-1.07;-1.07;-1.03;-1.29;-1.29	5.79	5.79	0.91817	.	0.044485	0.85682	D	0.000000	T	0.78622	0.4312	L	0.60455	1.87	0.58432	D	0.999994	P;B;P;B	0.44195	0.736;0.002;0.828;0.002	B;B;B;B	0.39531	0.223;0.007;0.302;0.004	T	0.76252	-0.3027	10	0.23891	T	0.37	-40.8166	19.6264	0.95679	0.0:1.0:0.0:0.0	.	1337;570;647;570	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	N	570;570;647;1337;1337	ENSP00000345137:D570N;ENSP00000344521:D570N;ENSP00000383906:D647N;ENSP00000272371:D1337N;ENSP00000385255:D1337N	ENSP00000272371:D1337N	D	-	1	0	OTOF	26546979	1.000000	0.71417	0.970000	0.41538	0.975000	0.68041	7.715000	0.84713	2.746000	0.94184	0.655000	0.94253	GAC	OTOF	-	NULL	ENSG00000115155		0.597	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	27	0.00	0	C			26693475	26693475	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	T
PI4K2B	55300	genome.wustl.edu	37	4	25278651	25278651	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:25278651C>T	ENST00000264864.6	+	10	1477	c.1288C>T	c.(1288-1290)Cag>Tag	p.Q430*	PI4K2B_ENST00000512921.1_Nonsense_Mutation_p.Q334*	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	430	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				AAACCTTACTCAGGCATTGAG	0.393																																						dbGAP											0													78.0	73.0	75.0					4																	25278651		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.1288C>T	4.37:g.25278651C>T	ENSP00000264864:p.Gln430*		Q9NUW2	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom	p.Q430*	ENST00000264864.6	37	c.1288	CCDS3433.1	4	.	.	.	.	.	.	.	.	.	.	C	38	7.049898	0.98029	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-17.5013	20.4581	0.99154	0.0:1.0:0.0:0.0	.	.	.	.	X	334;430;399	.	ENSP00000264864:Q430X	Q	+	1	0	PI4K2B	24887749	1.000000	0.71417	0.715000	0.30552	0.971000	0.66376	7.776000	0.85560	2.835000	0.97688	0.650000	0.86243	CAG	PI4K2B	-	pfam_PI3/4_kinase_cat_dom	ENSG00000038210		0.393	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2B	HGNC	protein_coding	OTTHUMT00000250415.1	48	0.00	0	C	NM_018323		25278651	25278651	+1	no_errors	ENST00000264864	ensembl	human	known	69_37n	nonsense	27	25.00	9	SNP	1.000	T
PIGQ	9091	genome.wustl.edu	37	16	628900	628900	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:628900C>T	ENST00000026218.5	+	6	1273	c.1185C>T	c.(1183-1185)ctC>ctT	p.L395L	PIGQ_ENST00000409527.2_Silent_p.L395L|PIGQ_ENST00000321878.5_Silent_p.L395L	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	395	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				TCGCCCTCCTCACCTTCCACA	0.667																																						dbGAP											0													148.0	128.0	135.0					16																	628900		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1185C>T	16.37:g.628900C>T			A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	pfam_GlcNAc_Gpi1	p.H73Y	ENST00000026218.5	37	c.217	CCDS10411.1	16																																																																																			PIGQ	-	pfam_GlcNAc_Gpi1	ENSG00000007541		0.667	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	87	0.00	0	C	NM_004204		628900	628900	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000420990	ensembl	human	known	69_37n	missense	52	11.67	7	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	46	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	A
PAQR4	124222	genome.wustl.edu	37	16	3019901	3019901	+	Intron	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:3019901G>A	ENST00000318782.8	+	1	596				PAQR4_ENST00000576565.1_Intron|PAQR4_ENST00000293978.8_Intron|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000574988.1_5'Flank|PAQR4_ENST00000572687.1_Intron|PKMYT1_ENST00000571102.1_5'UTR	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV							integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						GCGTTGGGCCGGGGGCACTGA	0.706																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.166+60G>A	16.37:g.3019901G>A			A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	RNA	SNP	-	NULL	ENST00000318782.8	37	NULL	CCDS10485.1	16																																																																																			PKMYT1	-	-	ENSG00000127564		0.706	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKMYT1	HGNC	protein_coding	OTTHUMT00000250966.1	11	0.00	0	G	NM_152341		3019901	3019901	-1	no_errors	ENST00000571102	ensembl	human	putative	69_37n	rna	8	33.33	4	SNP	0.000	A
PLEKHG2	64857	genome.wustl.edu	37	19	39914915	39914915	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:39914915G>A	ENST00000409794.3	+	19	3992	c.3142G>A	c.(3142-3144)Gag>Aag	p.E1048K	PLEKHG2_ENST00000458508.2_Missense_Mutation_p.E989K|PLEKHG2_ENST00000378550.1_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.E1019K|PLEKHG2_ENST00000409797.2_Intron	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1048					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCTAGACAGCGAGAGCCCAAC	0.542																																						dbGAP											0													136.0	130.0	132.0					19																	39914915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3142G>A	19.37:g.39914915G>A	ENSP00000386733:p.Glu1048Lys		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E1048K	ENST00000409794.3	37	c.3142	CCDS33022.2	19	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520139	0.27211	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508	T;T;T	0.68025	-0.17;-0.17;-0.3	3.68	1.53	0.23141	.	0.385414	0.19186	N	0.120554	T	0.47395	0.1443	N	0.22421	0.69	0.25006	N	0.991438	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.01281	0.0;0.0;0.0	T	0.41770	-0.9490	10	0.62326	D	0.03	.	6.4009	0.21638	0.2046:0.5868:0.2085:0.0	.	1019;1048;989	Q9H7P9-3;Q9H7P9;E7ESZ3	.;PKHG2_HUMAN;.	K	1048;1019;989	ENSP00000386733:E1048K;ENSP00000392906:E1019K;ENSP00000408857:E989K	ENSP00000386733:E1048K	E	+	1	0	PLEKHG2	44606755	0.001000	0.12720	0.186000	0.23195	0.068000	0.16541	0.569000	0.23638	0.556000	0.29098	-1.434000	0.01081	GAG	PLEKHG2	-	NULL	ENSG00000090924		0.542	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG2	HGNC	protein_coding	OTTHUMT00000326802.1	65	0.00	0	G	NM_022835		39914915	39914915	+1	no_errors	ENST00000409794	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.382	A
PLEKHH1	57475	genome.wustl.edu	37	14	68029173	68029173	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr14:68029173C>T	ENST00000329153.5	+	7	957	c.825C>T	c.(823-825)ttC>ttT	p.F275F		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	275						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TTCTTACCTTCAGATGTAGTT	0.572																																						dbGAP											0													68.0	82.0	77.0					14																	68029173		1933	4136	6069	-	-	-	SO:0001819	synonymous_variant	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.825C>T	14.37:g.68029173C>T			A6H8X6|Q6PJL4|Q6ZWC7	Silent	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.F275	ENST00000329153.5	37	c.825	CCDS45128.1	14																																																																																			PLEKHH1	-	NULL	ENSG00000054690		0.572	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	48	0.00	0	C	XM_031054		68029173	68029173	+1	no_errors	ENST00000329153	ensembl	human	known	69_37n	silent	39	17.02	8	SNP	0.014	T
PNKP	11284	genome.wustl.edu	37	19	50367447	50367447	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:50367447C>T	ENST00000322344.3	-	6	734	c.625G>A	c.(625-627)Gag>Aag	p.E209K	PNKP_ENST00000595792.1_5'Flank|PNKP_ENST00000600573.1_Missense_Mutation_p.E209K|PNKP_ENST00000600910.1_Missense_Mutation_p.E209K|PNKP_ENST00000596014.1_Missense_Mutation_p.E209K	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	209	Phosphatase. {ECO:0000250}.				dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TTGTAGCCCTCGGCTTCCAGC	0.642								Other BER factors																														dbGAP											0													44.0	48.0	47.0					19																	50367447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.625G>A	19.37:g.50367447C>T	ENSP00000323511:p.Glu209Lys		Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Missense_Mutation	SNP	pfam_PNK3P,superfamily_HAD-like_dom,superfamily_SMAD_FHA_domain,tigrfam_PNK_3Pase_met,tigrfam_Polynucleotide_phosphatase,tigrfam_HAD-SF_hydro_IIIA	p.E209K	ENST00000322344.3	37	c.625	CCDS12783.1	19	.	.	.	.	.	.	.	.	.	.	C	8.387	0.838901	0.16891	.	.	ENSG00000039650	ENST00000322344	T	0.64438	-0.1	5.69	1.07	0.20283	HAD-like domain (2);Polynucleotide kinase 3 phosphatase, central region (1);	0.729361	0.13339	N	0.395275	T	0.33614	0.0869	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.16600	-1.0397	10	0.31617	T	0.26	-15.5444	5.5311	0.16985	0.0:0.6134:0.1426:0.244	.	170;209	Q9BUL2;Q96T60	.;PNKP_HUMAN	K	209	ENSP00000323511:E209K	ENSP00000323511:E209K	E	-	1	0	PNKP	55059259	0.010000	0.17322	0.002000	0.10522	0.147000	0.21601	0.679000	0.25291	0.327000	0.23409	-0.137000	0.14449	GAG	PNKP	-	pfam_PNK3P,superfamily_HAD-like_dom,tigrfam_PNK_3Pase_met,tigrfam_Polynucleotide_phosphatase,tigrfam_HAD-SF_hydro_IIIA	ENSG00000039650		0.642	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNKP	HGNC	protein_coding	OTTHUMT00000465830.1	42	0.00	0	C	NM_007254		50367447	50367447	-1	no_errors	ENST00000322344	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.001	T
POLR3C	10623	genome.wustl.edu	37	1	145601595	145601595	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:145601595G>T	ENST00000334163.3	-	7	971	c.811C>A	c.(811-813)Ctc>Atc	p.L271I	POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Missense_Mutation_p.L271I	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	271					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			CTCATTCGGAGCATGGTTCGC	0.463																																						dbGAP											0													192.0	173.0	180.0					1																	145601595		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.811C>A	1.37:g.145601595G>T	ENSP00000334564:p.Leu271Ile		O15317|Q9Y3R6	Missense_Mutation	SNP	pfam_RNA_pol_III_Rpc82_C,pfam_RNA_pol_III_RPC82-rel_HTH	p.L271I	ENST00000334163.3	37	c.811	CCDS921.1	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533821	0.85812	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.75260	-0.92;-0.92	5.79	5.79	0.91817	RNA polymerase III Rpc82, C -terminal (1);	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.996;0.998	T	0.81895	-0.0723	10	0.56958	D	0.05	-14.3163	17.5248	0.87796	0.0:0.0:1.0:0.0	.	271;271;271	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	I	271	ENSP00000334564:L271I;ENSP00000358300:L271I	ENSP00000334564:L271I	L	-	1	0	POLR3C	144312952	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.491000	0.81471	2.728000	0.93425	0.561000	0.74099	CTC	POLR3C	-	pfam_RNA_pol_III_Rpc82_C	ENSG00000186141		0.463	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	HGNC	protein_coding	OTTHUMT00000038542.1	29	0.00	0	G	NM_006468		145601595	145601595	-1	no_errors	ENST00000334163	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
POU4F2	5458	genome.wustl.edu	37	4	147561653	147561653	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:147561653C>G	ENST00000281321.3	+	2	1171	c.923C>G	c.(922-924)tCc>tGc	p.S308C	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	308	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					CTCACACTGTCCCACAATAAT	0.597																																						dbGAP											0													77.0	78.0	78.0					4																	147561653		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.923C>G	4.37:g.147561653C>G	ENSP00000281321:p.Ser308Cys		B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S308C	ENST00000281321.3	37	c.923	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987268	0.53934	.	.	ENSG00000151615	ENST00000281321	D	0.88818	-2.43	5.37	4.47	0.54385	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.115069	0.64402	D	0.000009	D	0.95570	0.8560	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96430	0.9318	10	0.87932	D	0	.	15.5196	0.75854	0.0:0.8616:0.1384:0.0	.	308	Q12837	PO4F2_HUMAN	C	308	ENSP00000281321:S308C	ENSP00000281321:S308C	S	+	2	0	POU4F2	147781103	1.000000	0.71417	0.988000	0.46212	0.941000	0.58515	6.021000	0.70832	2.528000	0.85240	0.561000	0.74099	TCC	POU4F2	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific,prints_POU	ENSG00000151615		0.597	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	58	0.00	0	C	NM_004575		147561653	147561653	+1	no_errors	ENST00000281321	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	0.996	G
PPFIA3	8541	genome.wustl.edu	37	19	49644726	49644726	+	Silent	SNP	C	C	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:49644726C>A	ENST00000334186.4	+	19	2767	c.2418C>A	c.(2416-2418)gcC>gcA	p.A806A	PPFIA3_ENST00000602351.1_Silent_p.A806A	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	806					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGGGGCTAGCCAAGCTGACAG	0.547																																						dbGAP											0													93.0	56.0	68.0					19																	49644726		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2418C>A	19.37:g.49644726C>A			A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.A806	ENST00000334186.4	37	c.2418	CCDS12758.1	19																																																																																			PPFIA3	-	NULL	ENSG00000177380		0.547	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	31	0.00	0	C	NM_003660		49644726	49644726	+1	no_errors	ENST00000334186	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	0.999	A
PTPRH	5794	genome.wustl.edu	37	19	55718603	55718603	+	Intron	SNP	C	C	G			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:55718603C>G	ENST00000376350.3	-	2	74				PTPRH_ENST00000588559.1_Intron|PTPRH_ENST00000263434.5_Intron	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GTCAGCCTCTCAACCACTCCT	0.672																																						dbGAP											0													27.0	32.0	30.0					19																	55718603		2198	4296	6494	-	-	-	SO:0001627	intron_variant	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.52-36G>C	19.37:g.55718603C>G			C9JCH2|Q15426|Q2NKN9|Q2NKP0	RNA	SNP	-	NULL	ENST00000376350.3	37	NULL	CCDS33110.1	19																																																																																			PTPRH	-	-	ENSG00000080031		0.672	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	82	0.00	0	C			55718603	55718603	-1	no_errors	ENST00000586852	ensembl	human	known	69_37n	rna	50	24.24	16	SNP	0.000	G
RHOQ	23433	genome.wustl.edu	37	2	46803734	46803734	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr2:46803734G>T	ENST00000238738.4	+	4	720	c.401G>T	c.(400-402)aGa>aTa	p.R134I	RP11-417F21.1_ENST00000506009.2_RNA	NM_012249.3	NP_036381.2	P17081	RHOQ_HUMAN	ras homolog family member Q	134					cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|GTP catabolic process (GO:0006184)|insulin receptor signaling pathway (GO:0008286)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GBD domain binding (GO:0032427)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|profilin binding (GO:0005522)			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ACTTTAGCAAGACTGAATGAT	0.318																																						dbGAP											0													82.0	87.0	85.0					2																	46803734		2203	4300	6503	-	-	-	SO:0001583	missense	0			M31470	CCDS33191.1	2p21	2012-02-27	2012-02-27	2004-03-24	ENSG00000119729	ENSG00000119729			17736	protein-coding gene	gene with protein product		605857	"""RAS-like, family 7, member A"", ""ras homolog gene family, member Q"""	RASL7A, ARHQ		2108320	Standard	NM_012249		Approved	TC10	uc002rva.3	P17081	OTTHUMG00000150653	ENST00000238738.4:c.401G>T	2.37:g.46803734G>T	ENSP00000238738:p.Arg134Ile		D6W5A6|Q0VGN1|Q52LS8|Q53SJ1|Q6NS39|Q6P146|Q7Z480	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R134I	ENST00000238738.4	37	c.401	CCDS33191.1	2	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843009	0.71488	.	.	ENSG00000119729	ENST00000238738;ENST00000482449	T;T	0.68331	-0.32;-0.32	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045197	0.85682	D	0.000000	T	0.58708	0.2141	L	0.45137	1.4	0.80722	D	1	B	0.31318	0.319	B	0.29524	0.103	T	0.61589	-0.7032	10	0.87932	D	0	.	12.8859	0.58042	0.0735:0.0:0.9265:0.0	.	134	P17081	RHOQ_HUMAN	I	134;55	ENSP00000238738:R134I;ENSP00000428006:R55I	ENSP00000238738:R134I	R	+	2	0	RHOQ	46657238	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.920000	0.70017	2.878000	0.98634	0.650000	0.86243	AGA	RHOQ	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000119729		0.318	RHOQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOQ	HGNC	protein_coding	OTTHUMT00000319409.1	24	0.00	0	G	NM_012249		46803734	46803734	+1	no_errors	ENST00000238738	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	1.000	T
RND3	390	genome.wustl.edu	37	2	151326603	151326603	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr2:151326603C>T	ENST00000375734.2	-	5	882	c.633G>A	c.(631-633)caG>caA	p.Q211Q	RND3_ENST00000263895.4_Silent_p.Q211Q|RND3_ENST00000472416.1_5'Flank|RND3_ENST00000409557.1_Silent_p.Q82Q	NM_001254738.1	NP_001241667.1	P61587	RND3_HUMAN	Rho family GTPase 3	211					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.106)		TTGTGGCTCTCTGTGATTTGT	0.453																																						dbGAP											0													186.0	172.0	177.0					2																	151326603		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2190.1	2q23.3	2008-02-05	2005-01-24	2005-01-27	ENSG00000115963	ENSG00000115963			671	protein-coding gene	gene with protein product		602924	"""ras homolog gene family, member E"""	ARHE		8649376	Standard	NM_001254738		Approved	RhoE, Rho8	uc002txe.3	P61587	OTTHUMG00000131859	ENST00000375734.2:c.633G>A	2.37:g.151326603C>T			D3DP95|P52199	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q211	ENST00000375734.2	37	c.633	CCDS2190.1	2																																																																																			RND3	-	NULL	ENSG00000115963		0.453	RND3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RND3	HGNC	protein_coding	OTTHUMT00000254809.1	37	0.00	0	C	NM_005168		151326603	151326603	-1	no_errors	ENST00000263895	ensembl	human	known	69_37n	silent	29	17.14	6	SNP	0.999	T
RNF167	26001	genome.wustl.edu	37	17	4843816	4843816	+	5'UTR	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr17:4843816G>A	ENST00000262482.6	+	0	268				RNF167_ENST00000572430.1_5'UTR|RNF167_ENST00000576229.1_5'UTR|RNF167_ENST00000575111.1_5'UTR|RNF167_ENST00000571816.1_5'UTR|SLC25A11_ENST00000225665.7_5'Flank|SLC25A11_ENST00000544061.2_5'Flank	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167						negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						ATCCAATGCTGAAAGCGGCCT	0.562																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.-389G>A	17.37:g.4843816G>A			D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	RNA	SNP	-	NULL	ENST00000262482.6	37	NULL	CCDS11060.1	17																																																																																			RNF167	-	-	ENSG00000108523		0.562	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF167	HGNC	protein_coding	OTTHUMT00000216854.3	72	0.00	0	G	NM_015528		4843816	4843816	+1	no_errors	ENST00000571365	ensembl	human	known	69_37n	rna	31	11.43	4	SNP	0.465	A
SCNM1	79005	genome.wustl.edu	37	1	151139007	151139007	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:151139007C>T	ENST00000368905.4	+	2	223	c.112C>T	c.(112-114)Cgg>Tgg	p.R38W	LYSMD1_ENST00000368908.5_5'Flank|SCNM1_ENST00000461862.1_3'UTR|LYSMD1_ENST00000440902.2_5'Flank	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	38					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGATGCTTCGGGATGGACG	0.527																																						dbGAP											0													40.0	38.0	39.0					1																	151139007		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.112C>T	1.37:g.151139007C>T	ENSP00000357901:p.Arg38Trp		B4DWR1|Q5JR74	Missense_Mutation	SNP	NULL	p.R38W	ENST00000368905.4	37	c.112	CCDS987.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625048	0.87560	.	.	ENSG00000163156	ENST00000368905;ENST00000368902	.	.	.	5.72	5.72	0.89469	.	0.212817	0.43579	D	0.000545	T	0.52885	0.1762	L	0.36672	1.1	0.33329	D	0.568375	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.60409	-0.7269	9	0.87932	D	0	0.2919	12.1694	0.54148	0.2733:0.7267:0.0:0.0	.	38;38	B4DWR1;Q9BWG6	.;SCNM1_HUMAN	W	38;3	.	ENSP00000357898:R3W	R	+	1	2	SCNM1	149405631	0.997000	0.39634	0.999000	0.59377	0.935000	0.57460	3.709000	0.54853	2.698000	0.92095	0.455000	0.32223	CGG	SCNM1	-	NULL	ENSG00000163156		0.527	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	SCNM1	HGNC	protein_coding	OTTHUMT00000034064.2	56	0.00	0	C	NM_024041		151139007	151139007	+1	no_errors	ENST00000368905	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.992	T
SETX	23064	genome.wustl.edu	37	9	135206816	135206816	+	Silent	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr9:135206816G>A	ENST00000224140.5	-	8	1040	c.858C>T	c.(856-858)ttC>ttT	p.F286F	SETX_ENST00000372169.2_Silent_p.F286F|SETX_ENST00000393220.1_Silent_p.F286F	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	286					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ACGCTGGCCAGAAAGGATCCA	0.368																																						dbGAP											0													91.0	78.0	83.0					9																	135206816		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.858C>T	9.37:g.135206816G>A			A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	NULL	p.F286	ENST00000224140.5	37	c.858	CCDS6947.1	9																																																																																			SETX	-	NULL	ENSG00000107290		0.368	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	59	0.00	0	G	NM_015046		135206816	135206816	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	silent	51	10.53	6	SNP	1.000	A
SF3B3	23450	genome.wustl.edu	37	16	70595653	70595653	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr16:70595653G>A	ENST00000302516.5	+	17	2465	c.2254G>A	c.(2254-2256)Gag>Aag	p.E752K		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	752					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				ACAGTGTCCCGAGGGCATTGT	0.527																																						dbGAP											0													146.0	120.0	129.0					16																	70595653		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2254G>A	16.37:g.70595653G>A	ENSP00000305790:p.Glu752Lys		Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.E752K	ENST00000302516.5	37	c.2254	CCDS10894.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.187202	0.97357	.	.	ENSG00000189091	ENST00000302516	T	0.34667	1.35	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	M	0.90309	3.105	0.80722	D	1	D	0.56746	0.977	B	0.43052	0.406	T	0.66752	-0.5844	10	0.66056	D	0.02	-17.3127	20.2982	0.98569	0.0:0.0:1.0:0.0	.	752	Q15393	SF3B3_HUMAN	K	752	ENSP00000305790:E752K	ENSP00000305790:E752K	E	+	1	0	SF3B3	69153154	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.751000	0.98889	2.873000	0.98535	0.563000	0.77884	GAG	SF3B3	-	superfamily_WD40_repeat_dom	ENSG00000189091		0.527	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	73	0.00	0	G	NM_012426		70595653	70595653	+1	no_errors	ENST00000302516	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	A
SLC22A2	6582	genome.wustl.edu	37	6	160668273	160668273	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr6:160668273C>T	ENST00000366953.3	-	5	1158	c.900G>A	c.(898-900)atG>atA	p.M300I	SLC22A2_ENST00000366952.1_Missense_Mutation_p.M279I|SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	300					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	TAATGATTCTCATGGCTTCAG	0.488																																						dbGAP											0													151.0	135.0	140.0					6																	160668273		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.900G>A	6.37:g.160668273C>T	ENSP00000355920:p.Met300Ile		Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.M300I	ENST00000366953.3	37	c.900	CCDS5276.1	6	.	.	.	.	.	.	.	.	.	.	C	3.119	-0.180872	0.06380	.	.	ENSG00000112499	ENST00000366953;ENST00000366952	T;T	0.73897	-0.79;-0.79	5.35	2.55	0.30701	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.362530	0.33401	N	0.004952	T	0.21227	0.0511	N	0.02391	-0.57	0.09310	N	0.999999	B;B	0.10296	0.0;0.003	B;B	0.11329	0.006;0.006	T	0.30268	-0.9984	10	0.18276	T	0.48	.	6.0781	0.19927	0.0:0.6456:0.1385:0.2159	.	300;300	O15244;O15244-2	S22A2_HUMAN;.	I	300;279	ENSP00000355920:M300I;ENSP00000355919:M279I	ENSP00000355919:M279I	M	-	3	0	SLC22A2	160588263	0.861000	0.29849	0.775000	0.31657	0.592000	0.36648	1.966000	0.40481	0.733000	0.32492	0.655000	0.94253	ATG	SLC22A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000112499		0.488	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	HGNC	protein_coding	OTTHUMT00000042943.1	100	0.00	0	C	NM_003058		160668273	160668273	-1	no_errors	ENST00000366953	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	0.230	T
SLC24A1	9187	genome.wustl.edu	37	15	65918261	65918261	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr15:65918261A>C	ENST00000261892.6	+	2	2130	c.1843A>C	c.(1843-1845)Agc>Cgc	p.S615R	SLC24A1_ENST00000546330.1_Missense_Mutation_p.S615R|SLC24A1_ENST00000544319.2_Missense_Mutation_p.S615R|SLC24A1_ENST00000339868.6_Missense_Mutation_p.S615R|SLC24A1_ENST00000537259.1_Missense_Mutation_p.S615R|SLC24A1_ENST00000399033.4_Missense_Mutation_p.S615R	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	615					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GGAGCAGCTCAGCAGGAGGCC	0.537																																						dbGAP											0													111.0	107.0	108.0					15																	65918261		2045	4209	6254	-	-	-	SO:0001583	missense	0			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.1843A>C	15.37:g.65918261A>C	ENSP00000261892:p.Ser615Arg		O43485|O75184|Q17RM9	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K-dep_Na/Ca-exchanger-like	p.S615R	ENST00000261892.6	37	c.1843	CCDS45284.1	15	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386076	0.61956	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.66460	0.03;-0.2;-0.2;-0.19;-0.21;-0.2	6.06	3.77	0.43336	.	0.292371	0.42682	N	0.000665	T	0.65943	0.2740	M	0.74258	2.255	0.30582	N	0.76239	B;B;B;B;B	0.29612	0.01;0.006;0.006;0.251;0.162	B;B;B;B;B	0.34138	0.015;0.012;0.007;0.176;0.085	T	0.67662	-0.5613	10	0.49607	T	0.09	.	9.3158	0.37932	0.856:0.0:0.144:0.0	.	615;615;615;615;615	O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;NCKX1_HUMAN;.;.	R	615	ENSP00000439693:S615R;ENSP00000261892:S615R;ENSP00000341837:S615R;ENSP00000445163:S615R;ENSP00000381991:S615R;ENSP00000439190:S615R	ENSP00000261892:S615R	S	+	1	0	SLC24A1	63705315	0.968000	0.33430	0.782000	0.31804	0.825000	0.46686	2.161000	0.42358	1.105000	0.41606	0.533000	0.62120	AGC	SLC24A1	-	tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000074621		0.537	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	59	0.00	0	A	NM_004727		65918261	65918261	+1	no_errors	ENST00000261892	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	0.767	C
SLC6A16	28968	genome.wustl.edu	37	19	49793527	49793527	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:49793527G>C	ENST00000335875.4	-	12	2305	c.2064C>G	c.(2062-2064)ttC>ttG	p.F688L	SLC6A16_ENST00000454748.3_3'UTR	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	688					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		TCTTGGGCCTGAAGGGAATCC	0.512																																						dbGAP											0													137.0	134.0	135.0					19																	49793527		1964	4141	6105	-	-	-	SO:0001583	missense	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.2064C>G	19.37:g.49793527G>C	ENSP00000338627:p.Phe688Leu		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.F688L	ENST00000335875.4	37	c.2064	CCDS42590.1	19	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199542	0.58126	.	.	ENSG00000063127	ENST00000335875	T	0.73789	-0.78	4.54	2.39	0.29439	.	3.617710	0.00982	N	0.003394	T	0.63426	0.2510	N	0.24115	0.695	0.23791	N	0.99684	D	0.52996	0.957	B	0.44224	0.444	T	0.55522	-0.8128	10	0.11182	T	0.66	.	7.9417	0.29963	0.1977:0.0:0.8023:0.0	.	688	Q9GZN6	S6A16_HUMAN	L	688	ENSP00000338627:F688L	ENSP00000338627:F688L	F	-	3	2	SLC6A16	54485339	0.019000	0.18553	0.140000	0.22221	0.128000	0.20619	0.936000	0.28938	0.615000	0.30124	-0.256000	0.11100	TTC	SLC6A16	-	NULL	ENSG00000063127		0.512	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	35	0.00	0	G	NM_014037		49793527	49793527	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.394	C
SMG6	23293	genome.wustl.edu	37	17	2203078	2203078	+	Silent	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr17:2203078C>T	ENST00000263073.6	-	2	1019	c.969G>A	c.(967-969)agG>agA	p.R323R	SMG6_ENST00000544865.1_Silent_p.R292R	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	323	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AATGTCTCTTCCTTTCTGAAC	0.478																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0													124.0	121.0	122.0					17																	2203078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.969G>A	17.37:g.2203078C>T			B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	pfam_EST1,smart_PINc_nuc-bd	p.R323	ENST00000263073.6	37	c.969	CCDS11016.1	17																																																																																			SMG6	-	NULL	ENSG00000070366		0.478	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	83	0.00	0	C			2203078	2203078	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	silent	69	10.39	8	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25330466	25330466	+	RNA	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr15:25330466G>A	ENST00000546682.1	+	0	450				SNORD116-19_ENST00000384729.1_RNA|SNORD116-18_ENST00000383961.1_RNA|SNORD116-17_ENST00000383929.1_RNA|SNORD116-16_ENST00000384533.1_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA|SNHG14_ENST00000549804.2_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		GATTCCTTAGGATGGTAAGTG	0.488																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25330466G>A				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.488	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	91	0.00	0	G			25330466	25330466	+1	no_errors	ENST00000546682	ensembl	human	known	69_37n	rna	57	16.18	11	SNP	0.001	A
SPEN	23013	genome.wustl.edu	37	1	16262705	16262705	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr1:16262705C>T	ENST00000375759.3	+	11	10174	c.9970C>T	c.(9970-9972)Cag>Tag	p.Q3324*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3324	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CACACACACTCAGTTTCCCGC	0.622																																						dbGAP											0													58.0	59.0	59.0					1																	16262705		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.9970C>T	1.37:g.16262705C>T	ENSP00000364912:p.Gln3324*		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.Q3324*	ENST00000375759.3	37	c.9970	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	50	17.251814	0.99882	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-14.7011	18.3517	0.90340	0.0:1.0:0.0:0.0	.	.	.	.	X	3324	.	ENSP00000364912:Q3324X	Q	+	1	0	SPEN	16135292	1.000000	0.71417	0.952000	0.39060	0.356000	0.29392	4.654000	0.61469	2.303000	0.77524	0.563000	0.77884	CAG	SPEN	-	NULL	ENSG00000065526		0.622	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	53	0.00	0	C	NM_015001		16262705	16262705	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	nonsense	34	10.53	4	SNP	0.998	T
SPTLC3	55304	genome.wustl.edu	37	20	13090784	13090784	+	Silent	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr20:13090784G>T	ENST00000399002.2	+	7	1126	c.852G>T	c.(850-852)ctG>ctT	p.L284L	SPTLC3_ENST00000378194.4_Silent_p.L284L	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	284					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						AGAAGCTCCTGAGAGATGCTG	0.408																																						dbGAP											0													57.0	56.0	57.0					20																	13090784		1848	4098	5946	-	-	-	SO:0001819	synonymous_variant	0			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.852G>T	20.37:g.13090784G>T			A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Silent	SNP	pfam_Aminotransferase_I/II,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L284	ENST00000399002.2	37	c.852	CCDS13115.2	20																																																																																			SPTLC3	-	pfam_Aminotransferase_I/II,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000172296		0.408	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	21	0.00	0	G	NM_018327		13090784	13090784	+1	no_errors	ENST00000399002	ensembl	human	known	69_37n	silent	13	18.75	3	SNP	1.000	T
STX19	415117	genome.wustl.edu	37	3	93733952	93733952	+	Silent	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:93733952G>A	ENST00000315099.2	-	2	418	c.162C>T	c.(160-162)atC>atT	p.I54I	ARL13B_ENST00000535334.1_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000471138.1_Intron|ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000486562.1_Intron|ARL13B_ENST00000303097.7_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	54					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						GTAGTTTTTGGATTTCATGTA	0.388																																						dbGAP											0													105.0	105.0	105.0					3																	93733952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.162C>T	3.37:g.93733952G>A				Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.I54	ENST00000315099.2	37	c.162	CCDS33793.1	3																																																																																			STX19	-	pfam_Syntaxin_N,superfamily_t-SNARE	ENSG00000178750		0.388	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX19	HGNC	protein_coding	OTTHUMT00000352909.1	58	0.00	0	G	NM_001001850		93733952	93733952	-1	no_errors	ENST00000315099	ensembl	human	known	69_37n	silent	39	13.33	6	SNP	0.998	A
TBCK	93627	genome.wustl.edu	37	4	107092416	107092416	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:107092416C>T	ENST00000273980.5	-	24	2518	c.2071G>A	c.(2071-2073)Gaa>Aaa	p.E691K	TBCK_ENST00000432496.2_Missense_Mutation_p.E691K|TBCK_ENST00000394708.2_Missense_Mutation_p.E691K|TBCK_ENST00000514689.1_5'UTR|TBCK_ENST00000394706.3_Missense_Mutation_p.E652K|TBCK_ENST00000361687.4_Missense_Mutation_p.E628K					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						ACACAGCGTTCAATGTCAATT	0.348																																						dbGAP											0													112.0	112.0	112.0					4																	107092416		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2071G>A	4.37:g.107092416C>T	ENSP00000273980:p.Glu691Lys			Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rhodanese-like_dom,superfamily_Kinase-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Rab-GTPase-TBC_dom,smart_Rhodanese-like_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Prot_kinase_cat_dom,pfscan_Rhodanese-like_dom	p.E691K	ENST00000273980.5	37	c.2071	CCDS54788.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.277135	0.95459	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	4.99	4.99	0.66335	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.998	D;D;D	0.91635	0.937;0.999;0.982	T	0.61207	-0.7109	10	0.87932	D	0	.	17.4038	0.87468	0.0:1.0:0.0:0.0	.	691;652;628	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	K	691;691;628;652;691	ENSP00000273980:E691K;ENSP00000405847:E691K;ENSP00000355338:E628K;ENSP00000378196:E652K;ENSP00000378198:E691K	ENSP00000273980:E691K	E	-	1	0	TBCK	107311865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.223000	0.78033	2.473000	0.83533	0.585000	0.79938	GAA	TBCK	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000145348		0.348	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCK	HGNC	protein_coding	OTTHUMT00000253953.4	37	0.00	0	C	NM_033115		107092416	107092416	-1	no_errors	ENST00000273980	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	T
THAP5	168451	genome.wustl.edu	37	7	108210035	108210035	+	5'UTR	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr7:108210035G>A	ENST00000415914.3	-	0	132				THAP5_ENST00000493722.1_5'UTR|DNAJB9_ENST00000249356.3_5'UTR|THAP5_ENST00000438865.1_5'UTR|THAP5_ENST00000313516.5_5'Flank	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5						cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						GGCCCCTGGAGACCGGGGCCG	0.637																																						dbGAP											0													40.0	40.0	40.0					7																	108210035		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.-22C>T	7.37:g.108210035G>A				RNA	SNP	-	NULL	ENST00000415914.3	37	NULL	CCDS47687.1	7																																																																																			THAP5	-	-	ENSG00000177683		0.637	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	59	0.00	0	G	NM_182529		108210035	108210035	-1	no_errors	ENST00000412935	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43766949	43766949	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr15:43766949C>A	ENST00000263801.3	-	10	1339	c.1087G>T	c.(1087-1089)Gtt>Ttt	p.V363F	TP53BP1_ENST00000382039.3_Missense_Mutation_p.V368F|TP53BP1_ENST00000450115.2_Missense_Mutation_p.V368F|TP53BP1_ENST00000382044.4_Missense_Mutation_p.V368F	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	363					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GAAGGAGCAACAAGATCTGAA	0.398								Other conserved DNA damage response genes																														dbGAP											0													79.0	82.0	81.0					15																	43766949		2201	4298	6499	-	-	-	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1087G>T	15.37:g.43766949C>A	ENSP00000263801:p.Val363Phe		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.V368F	ENST00000263801.3	37	c.1102	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472005	0.84533	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.23950	2.7;2.7;2.67;2.69;1.88	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000001	T	0.51432	0.1674	M	0.71581	2.175	0.58432	D	0.999991	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.85130	0.997;0.994;0.997;0.997	T	0.43702	-0.9375	10	0.52906	T	0.07	-13.6682	16.1635	0.81734	0.0:1.0:0.0:0.0	.	368;363;368;368	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	F	363;368;368;368;368	ENSP00000263801:V363F;ENSP00000371475:V368F;ENSP00000371470:V368F;ENSP00000393497:V368F;ENSP00000388028:V368F	ENSP00000263801:V363F	V	-	1	0	TP53BP1	41554241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.639000	0.46570	2.894000	0.99253	0.655000	0.94253	GTT	TP53BP1	-	NULL	ENSG00000067369		0.398	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	25	0.00	0	C			43766949	43766949	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	A
TPTE2P5	100616668	genome.wustl.edu	37	13	41400715	41400715	+	RNA	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr13:41400715C>T	ENST00000432905.1	-	0	515									transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 5																		TGCTCTGTTTCAGTGTCATGA	0.348																																						dbGAP											0																																										-	-	-			0					13q14.11	2012-06-20			ENSG00000168852	ENSG00000168852			42356	pseudogene	pseudogene							Standard	NR_038258		Approved		uc001uxo.2		OTTHUMG00000016779		13.37:g.41400715C>T				Splice_Site	SNP	-	NULL	ENST00000432905.1	37	c.NULL		13																																																																																			TPTE2P5	-	-	ENSG00000168852		0.348	TPTE2P5-003	KNOWN	basic	processed_transcript	TPTE2P5	HGNC	pseudogene	OTTHUMT00000044650.1	29	0.00	0	C			41400715	41400715	-1	no_coding_region:pseudogene	ENST00000458118	ensembl	human	known	69_37n	splice_site	26	21.21	7	SNP	0.002	T
TTLL5	23093	genome.wustl.edu	37	14	76238123	76238123	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr14:76238123C>T	ENST00000298832.9	+	21	2267	c.2062C>T	c.(2062-2064)Caa>Taa	p.Q688*	TTLL5_ENST00000557636.1_Nonsense_Mutation_p.Q702*|TTLL5_ENST00000554510.1_Nonsense_Mutation_p.Q197*|TTLL5_ENST00000556893.1_Nonsense_Mutation_p.Q239*|TTLL5_ENST00000555422.1_3'UTR	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	688					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		CCAGCATGTTCAAATTCGCCT	0.433																																						dbGAP											0													164.0	157.0	159.0					14																	76238123		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2062C>T	14.37:g.76238123C>T	ENSP00000298832:p.Gln688*		B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Nonsense_Mutation	SNP	pfam_Tub_tyr_ligase	p.Q688*	ENST00000298832.9	37	c.2062	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	C	41	8.932242	0.99008	.	.	ENSG00000119685	ENST00000418433;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	.	.	.	4.91	4.91	0.64330	.	0.062036	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.2856	0.82720	0.0:1.0:0.0:0.0	.	.	.	.	X	375;702;688;239;239;197	.	ENSP00000298832:Q688X	Q	+	1	0	TTLL5	75307876	1.000000	0.71417	0.945000	0.38365	0.992000	0.81027	6.516000	0.73755	2.269000	0.75478	0.557000	0.71058	CAA	TTLL5	-	NULL	ENSG00000119685		0.433	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	51	0.00	0	C	NM_015072		76238123	76238123	+1	no_errors	ENST00000298832	ensembl	human	known	69_37n	nonsense	43	12.24	6	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	145157645	145157645	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr6:145157645C>T	ENST00000367545.3	+	70	10033	c.10033C>T	c.(10033-10035)Cag>Tag	p.Q3345*	UTRN_ENST00000367526.4_Nonsense_Mutation_p.Q900*	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3345					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCTGGAGTCTCAGCTCCACCG	0.532																																						dbGAP											0													41.0	39.0	40.0					6																	145157645		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.10033C>T	6.37:g.145157645C>T	ENSP00000356515:p.Gln3345*		Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q3345*	ENST00000367545.3	37	c.10033	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	44	10.790415	0.99468	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	.	.	.	5.91	5.91	0.95273	.	0.000000	0.51477	D	0.000091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2963	0.98556	0.0:1.0:0.0:0.0	.	.	.	.	X	3345;900	.	ENSP00000356496:Q900X	Q	+	1	0	UTRN	145199338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.813000	0.96785	0.655000	0.94253	CAG	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.532	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	24	0.00	0	C			145157645	145157645	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	nonsense	14	26.32	5	SNP	1.000	T
XIRP1	165904	genome.wustl.edu	37	3	39228407	39228407	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr3:39228407C>T	ENST00000340369.3	-	2	2758	c.2530G>A	c.(2530-2532)Ggg>Agg	p.G844R	XIRP1_ENST00000396251.1_Missense_Mutation_p.G844R|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	844					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		ACCAGCAGCCCCTGCTGGTCC	0.592																																						dbGAP											0													42.0	41.0	41.0					3																	39228407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2530G>A	3.37:g.39228407C>T	ENSP00000343140:p.Gly844Arg		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.G844R	ENST00000340369.3	37	c.2530	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637328	0.67130	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05319	3.46;3.82	4.89	3.94	0.45596	.	0.311979	0.30109	U	0.010395	T	0.19366	0.0465	L	0.60455	1.87	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.76071	0.922;0.987	T	0.00175	-1.1954	10	0.54805	T	0.06	.	12.667	0.56848	0.0:0.8324:0.1676:0.0	.	844;844	Q702N8;Q702N8-2	XIRP1_HUMAN;.	R	844	ENSP00000379550:G844R;ENSP00000343140:G844R	ENSP00000343140:G844R	G	-	1	0	XIRP1	39203411	0.835000	0.29415	1.000000	0.80357	0.986000	0.74619	2.033000	0.41136	2.442000	0.82660	0.655000	0.94253	GGG	XIRP1	-	NULL	ENSG00000168334		0.592	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	39	0.00	0	C	XM_093522		39228407	39228407	-1	no_errors	ENST00000340369	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	T
XPO5	57510	genome.wustl.edu	37	6	43494425	43494425	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr6:43494425T>A	ENST00000265351.7	-	27	3191	c.2981A>T	c.(2980-2982)gAc>gTc	p.D994V	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	994					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TCACTTACCGTCTCCATCTGC	0.507																																						dbGAP											0													100.0	95.0	97.0					6																	43494425		2030	4196	6226	-	-	-	SO:0001583	missense	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.2981A>T	6.37:g.43494425T>A	ENSP00000265351:p.Asp994Val		Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.D994V	ENST00000265351.7	37	c.2981	CCDS47430.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.59|15.59	2.878759|2.878759	0.51801|0.51801	.|.	.|.	ENSG00000124571|ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000372258;ENST00000439465|ENST00000455285	T|.	0.32988|.	1.43|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Armadillo-type fold (1);|.	0.309807|.	0.34700|.	N|.	0.003755|.	T|T	0.62672|0.62672	0.2447|0.2447	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B|.	0.23735|.	0.09|.	B|.	0.21708|.	0.036|.	T|T	0.63453|0.63453	-0.6634|-0.6634	10|5	0.34782|.	T|.	0.22|.	-16.3082|-16.3082	14.1646|14.1646	0.65469|0.65469	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	994|.	Q9HAV4|.	XPO5_HUMAN|.	V|S	994;699;534;622|98	ENSP00000265351:D994V|.	ENSP00000265351:D994V|.	D|T	-|-	2|1	0|0	XPO5|XPO5	43602403|43602403	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.995000|0.995000	0.86356|0.86356	4.674000|4.674000	0.61612|0.61612	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	GAC|ACG	XPO5	-	superfamily_ARM-type_fold	ENSG00000124571		0.507	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	29	0.00	0	T	NM_020750		43494425	43494425	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.995	A
XYLT2	64132	genome.wustl.edu	37	17	48433485	48433485	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr17:48433485G>A	ENST00000017003.2	+	7	1394	c.1345G>A	c.(1345-1347)Gag>Aag	p.E449K	XYLT2_ENST00000507602.1_Missense_Mutation_p.E449K	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	449					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					CCTGGCCTGTGAGACCCTCGT	0.617																																						dbGAP											0													75.0	70.0	72.0					17																	48433485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1345G>A	17.37:g.48433485G>A	ENSP00000017003:p.Glu449Lys		Q6UY41|Q86V00	Missense_Mutation	SNP	pfam_XylT_met,pfam_Glyco_trans_14	p.E449K	ENST00000017003.2	37	c.1345	CCDS11563.1	17	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360550	0.41801	.	.	ENSG00000015532	ENST00000017003;ENST00000507602	T;T	0.11385	2.78;2.78	4.54	2.37	0.29283	.	0.433919	0.26304	N	0.025159	T	0.09202	0.0227	L	0.31664	0.95	0.31018	N	0.718432	B	0.20459	0.045	B	0.29176	0.099	T	0.07290	-1.0780	10	0.46703	T	0.11	-17.5065	10.3339	0.43839	0.0855:0.1407:0.7738:0.0	.	449	Q9H1B5	XYLT2_HUMAN	K	449	ENSP00000017003:E449K;ENSP00000426501:E449K	ENSP00000017003:E449K	E	+	1	0	XYLT2	45788484	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	6.508000	0.73721	1.126000	0.42016	0.563000	0.77884	GAG	XYLT2	-	pfam_Glyco_trans_14	ENSG00000015532		0.617	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT2	HGNC	protein_coding	OTTHUMT00000367046.1	52	0.00	0	G	NM_022167		48433485	48433485	+1	no_errors	ENST00000017003	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.999	A
ZNF529	57711	genome.wustl.edu	37	19	37038799	37038799	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:37038799G>T	ENST00000591340.1	-	5	819	c.661C>A	c.(661-663)Cat>Aat	p.H221N	ZNF529_ENST00000334116.7_Missense_Mutation_p.H116N	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					ACACCAGTATGAATATTCAGT	0.289																																						dbGAP											0													61.0	57.0	58.0					19																	37038799		1819	4079	5898	-	-	-	SO:0001583	missense	0			AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.661C>A	19.37:g.37038799G>T	ENSP00000465578:p.His221Asn		K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H221N	ENST00000591340.1	37	c.661	CCDS54256.1	19	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304139	0.81136	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.36	-0.377	0.12501	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47414	0.1444	M	0.88031	2.925	0.24619	N	0.993681	B;B	0.30851	0.297;0.197	B;B	0.27170	0.077;0.035	T	0.50566	-0.8813	8	0.87932	D	0	.	3.4229	0.07400	0.1026:0.1678:0.5571:0.1725	.	116;188	Q6P280-2;Q6P280	.;ZN529_HUMAN	N	221	.	ENSP00000334695:H221N	H	-	1	0	ZNF529	41730639	.	.	0.001000	0.08648	0.990000	0.78478	.	.	-0.194000	0.10399	0.591000	0.81541	CAT	ZNF529	-	pfscan_Znf_C2H2	ENSG00000186020		0.289	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF529	HGNC	protein_coding	OTTHUMT00000452730.1	27	0.00	0	G	NM_020951		37038799	37038799	-1	no_errors	ENST00000591340	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.983	T
ZNF420	147923	genome.wustl.edu	37	19	37620968	37620968	+	3'UTR	SNP	G	G	A			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr19:37620968G>A	ENST00000337995.3	+	0	3290				ZNF420_ENST00000304239.7_Missense_Mutation_p.D481N|ZNF420_ENST00000586540.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF585A_ENST00000588723.1_Intron	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGATAGAAGTGATATTTATAT	0.378																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.*1008G>A	19.37:g.37620968G>A			B2RDY6|Q96ML5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D481N	ENST00000337995.3	37	c.1441	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014045	0.19277	.	.	ENSG00000197050	ENST00000304239	T	0.06528	3.29	4.12	-2.5	0.06384	.	.	.	.	.	T	0.06781	0.0173	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38950	-0.9637	6	0.72032	D	0.01	.	4.5767	0.12238	0.4864:0.0:0.3605:0.1531	.	.	.	.	N	481	ENSP00000306102:D481N	ENSP00000306102:D481N	D	+	1	0	ZNF420	42312808	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.031000	0.13710	-0.268000	0.09312	-0.977000	0.02584	GAT	ZNF420	-	NULL	ENSG00000197050		0.378	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	HGNC	protein_coding	OTTHUMT00000109587.3	63	0.00	0	G	NM_144689		37620968	37620968	+1	no_errors	ENST00000304239	ensembl	human	putative	69_37n	missense	68	10.53	8	SNP	0.000	A
ZNF718	255403	genome.wustl.edu	37	4	155278	155278	+	lincRNA	SNP	C	C	T			TCGA-EW-A3E8-01B-11D-A243-09	TCGA-EW-A3E8-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5fa6274a-0c87-4648-8902-6fd01fcc8e23	2032db41-2068-4ac4-935a-36a3a8a6093b	g.chr4:155278C>T	ENST00000510175.1	+	0	713							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		AACCAATCCTCAACCCTTAAT	0.358																																						dbGAP											0													40.0	46.0	44.0					4																	155278		2087	4236	6323	-	-	-			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155278C>T			Q3SXZ4|Q3SXZ5	RNA	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			ZNF718	-	-	ENSG00000250312		0.358	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	32	0.00	0	C	NM_001039127		155278	155278	+1	no_errors	ENST00000400172	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.000	T
