#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD15	116236	genome.wustl.edu	37	17	27893598	27893598	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr17:27893598C>A	ENST00000307201.4	-	1	557	c.387G>T	c.(385-387)ttG>ttT	p.L129F	TP53I13_ENST00000584522.1_3'UTR|RP11-68I3.4_ENST00000579050.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA|TP53I13_ENST00000301057.7_5'Flank	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	129						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						CATCGTCCGCCAACTGCAGGT	0.701																																						dbGAP											0													29.0	26.0	27.0					17																	27893598		2197	4291	6488	-	-	-	SO:0001583	missense	0			AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.387G>T	17.37:g.27893598C>A	ENSP00000302657:p.Leu129Phe		Q96EC5	Missense_Mutation	SNP	pirsf_AB-Hydro_YheT	p.L129F	ENST00000307201.4	37	c.387	CCDS32602.1	17	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749028	0.49257	.	.	ENSG00000168792	ENST00000307201	T	0.72505	-0.66	4.19	3.22	0.36961	.	0.000000	0.64402	D	0.000011	T	0.63177	0.2489	L	0.46157	1.445	0.80722	D	1	P	0.47350	0.894	B	0.43950	0.437	T	0.63594	-0.6602	10	0.62326	D	0.03	-8.4427	7.5307	0.27681	0.0:0.7351:0.1685:0.0964	.	129	Q6UXT9	ABH15_HUMAN	F	129	ENSP00000302657:L129F	ENSP00000302657:L129F	L	-	3	2	ABHD15	24917724	0.310000	0.24527	1.000000	0.80357	0.998000	0.95712	0.831000	0.27476	0.965000	0.38133	0.563000	0.77884	TTG	ABHD15	-	pirsf_AB-Hydro_YheT	ENSG00000168792		0.701	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD15	HGNC	protein_coding	OTTHUMT00000447796.2	37	0.00	0	C	NM_198147		27893598	27893598	-1	no_errors	ENST00000307201	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	0.999	A
ABCC3	8714	genome.wustl.edu	37	17	48750363	48750363	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr17:48750363G>A	ENST00000285238.8	+	18	2353	c.2273G>A	c.(2272-2274)cGg>cAg	p.R758Q		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	758	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CAGCGGCAGCGGGTCAGTCTG	0.592																																						dbGAP											0													48.0	41.0	43.0					17																	48750363		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2273G>A	17.37:g.48750363G>A	ENSP00000285238:p.Arg758Gln		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.R758Q	ENST00000285238.8	37	c.2273	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360441	0.61403	.	.	ENSG00000108846	ENST00000285238	D	0.93426	-3.22	4.72	4.72	0.59763	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000001	D	0.97990	0.9338	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99338	1.0911	10	0.87932	D	0	-32.763	18.5715	0.91137	0.0:0.0:1.0:0.0	.	758	O15438	MRP3_HUMAN	Q	758	ENSP00000285238:R758Q	ENSP00000285238:R758Q	R	+	2	0	ABCC3	46105362	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	9.738000	0.98835	2.558000	0.86282	0.561000	0.74099	CGG	ABCC3	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.592	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	95	0.00	0	G	NM_020038		48750363	48750363	+1	no_errors	ENST00000285238	ensembl	human	known	69_37n	missense	42	45.45	35	SNP	1.000	A
ACVR2A	92	genome.wustl.edu	37	2	148657136	148657136	+	Splice_Site	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:148657136C>T	ENST00000241416.7	+	3	1009	c.373C>T	c.(373-375)Ccc>Tcc	p.P125S	ACVR2A_ENST00000404590.1_Splice_Site_p.P125S|AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000535787.1_Splice_Site_p.P17S	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	125					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AGTCACACAGCGTAAGTTCAC	0.368																																						dbGAP											0													150.0	159.0	156.0					2																	148657136		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.373+1C>T	2.37:g.148657136C>T			B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.P125S	ENST00000241416.7	37	c.373	CCDS33301.1	2	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738934	0.49045	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.84442	-1.85;-1.7;-1.85	5.56	5.56	0.83823	.	0.110758	0.64402	D	0.000002	T	0.76723	0.4027	L	0.28115	0.83	0.44462	D	0.997395	B	0.21071	0.051	B	0.11329	0.006	T	0.70868	-0.4755	10	0.11182	T	0.66	.	18.0658	0.89390	0.0:1.0:0.0:0.0	.	125	P27037	AVR2A_HUMAN	S	125;17;125	ENSP00000241416:P125S;ENSP00000439988:P17S;ENSP00000384338:P125S	ENSP00000241416:P125S	P	+	1	0	ACVR2A	148373606	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.370000	0.52372	2.771000	0.95319	0.650000	0.86243	CCC	ACVR2A	-	NULL	ENSG00000121989		0.368	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2A	HGNC	protein_coding	OTTHUMT00000319051.1	120	0.00	0	C	NM_001616	Missense_Mutation	148657136	148657136	+1	no_errors	ENST00000241416	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	1.000	T
ADAM3A	1587	genome.wustl.edu	37	8	39358477	39358477	+	RNA	SNP	A	A	G	rs9643842	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:39358477A>G	ENST00000490268.2	-	0	579					NR_073423.1				ADAM metallopeptidase domain 3A (pseudogene)																		CTCAACTGCAACTGCCACCGT	0.299													A|||	2166	0.432508	0.7269	0.2378	5008	,	,		10070	0.5278		0.2008	False		,,,				2504	0.3129					dbGAP											0																																										-	-	-			0			X89657		8p11.22	2012-06-11	2012-06-11		ENSG00000197475	ENSG00000197475		"""ADAM metallopeptidase domain containing"""	209	pseudogene	pseudogene			"""cyritestin 1"", ""a disintegrin and metalloproteinase domain 3a (cyritestin 1)"", ""ADAM metallopeptidase domain 3A, pseudogene"", ""ADAM metallopeptidase domain 3A"""	CYRN1		9502432, 11439107	Standard	NR_024107		Approved	ADAM3, tMDCI	uc003xnf.4		OTTHUMG00000154991		8.37:g.39358477A>G				RNA	SNP	-	NULL	ENST00000490268.2	37	NULL		8																																																																																			ADAM3A	-	-	ENSG00000197475		0.299	ADAM3A-005	KNOWN	basic	processed_transcript	ADAM3A	HGNC	pseudogene	OTTHUMT00000337953.1	40	0.00	0	A	NR_001569		39358477	39358477	-1	no_errors	ENST00000460383	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.011	G
ADAM2	2515	genome.wustl.edu	37	8	39627085	39627085	+	Silent	SNP	A	A	G			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:39627085A>G	ENST00000265708.4	-	12	1141	c.1038T>C	c.(1036-1038)agT>agC	p.S346S	ADAM2_ENST00000379853.2_Silent_p.S220S|ADAM2_ENST00000347580.4_Silent_p.S327S|ADAM2_ENST00000521880.1_Silent_p.S346S	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	346	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TCTTCACACCACTGAAATGAC	0.378																																						dbGAP											0													72.0	64.0	67.0					8																	39627085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1038T>C	8.37:g.39627085A>G			P78326|Q9UQQ8	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S346	ENST00000265708.4	37	c.1038	CCDS34884.1	8																																																																																			ADAM2	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000104755		0.378	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	51	0.00	0	A	NM_001464		39627085	39627085	-1	no_errors	ENST00000265708	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	1.000	G
ADCY3	109	genome.wustl.edu	37	2	25141736	25141736	+	Silent	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:25141736G>T	ENST00000260600.5	-	1	972	c.121C>A	c.(121-123)Cgg>Agg	p.R41R		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	41					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CCCGAGTTCCGGACCGAGATT	0.637																																						dbGAP											0													25.0	30.0	28.0					2																	25141736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.121C>A	2.37:g.25141736G>T			B3KT86|Q53T54|Q9UDB1	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R41	ENST00000260600.5	37	c.121	CCDS1715.1	2																																																																																			ADCY3	-	NULL	ENSG00000138031		0.637	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	38	0.00	0	G			25141736	25141736	-1	no_errors	ENST00000260600	ensembl	human	known	69_37n	silent	29	11.76	4	SNP	1.000	T
ADM2	79924	genome.wustl.edu	37	22	50921694	50921694	+	3'UTR	SNP	C	C	T	rs2236031	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:50921694C>T	ENST00000395738.2	+	0	1101				ADM2_ENST00000362068.2_Silent_p.L187L	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)			breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGAGGCTGAACTGGCCAGAAG	0.627													T|||	1129	0.225439	0.4228	0.2032	5008	,	,		19075	0.129		0.172	False		,,,				2504	0.1288					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.*362C>T	22.37:g.50921694C>T			Q3LFQ0	Silent	SNP	NULL	p.L187	ENST00000395738.2	37	c.559	CCDS33682.1	22																																																																																			ADM2	-	NULL	ENSG00000128165		0.627	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADM2	HGNC	protein_coding	OTTHUMT00000316816.1	47	0.00	0	C	NM_024866		50921694	50921694	+1	no_errors	ENST00000362068	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	0.000	T
ANKRD33B	651746	genome.wustl.edu	37	5	10624866	10624866	+	Intron	SNP	T	T	G	rs10062687	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:10624866T>G	ENST00000296657.5	+	2	496				ANKRD33B-AS1_ENST00000506304.1_RNA	NM_001164440.1	NP_001157912.1	A6NCL7	AN33B_HUMAN	ankyrin repeat domain 33B																		GGGCATAGTTTCCTTAGACAC	0.522													G|||	674	0.134585	0.1596	0.1441	5008	,	,		18767	0.0397		0.2197	False		,,,				2504	0.1043					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS47191.1	5p15.2	2013-01-10			ENSG00000164236	ENSG00000164236		"""Ankyrin repeat domain containing"""	35240	protein-coding gene	gene with protein product							Standard	NM_001164440		Approved		uc021xwp.1	A6NCL7	OTTHUMG00000162050	ENST00000296657.5:c.496+6292T>G	5.37:g.10624866T>G				Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.S176A	ENST00000296657.5	37	c.526	CCDS47191.1	5																																																																																			ANKRD33B	-	NULL	ENSG00000164236		0.522	ANKRD33B-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	ANKRD33B	HGNC	protein_coding	OTTHUMT00000367037.3	65	0.00	0	T	XM_001130634		10624866	10624866	+1	no_errors	ENST00000504806	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	0.000	G
ANKRD33B	651746	genome.wustl.edu	37	5	10624887	10624887	+	Intron	SNP	T	T	C	rs1531839	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:10624887T>C	ENST00000296657.5	+	2	496				ANKRD33B-AS1_ENST00000506304.1_RNA	NM_001164440.1	NP_001157912.1	A6NCL7	AN33B_HUMAN	ankyrin repeat domain 33B																		TGGCTCCCAATCTTGCGCCTC	0.552													C|||	2561	0.511382	0.4705	0.3559	5008	,	,		18311	0.6419		0.4871	False		,,,				2504	0.5675					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS47191.1	5p15.2	2013-01-10			ENSG00000164236	ENSG00000164236		"""Ankyrin repeat domain containing"""	35240	protein-coding gene	gene with protein product							Standard	NM_001164440		Approved		uc021xwp.1	A6NCL7	OTTHUMG00000162050	ENST00000296657.5:c.496+6313T>C	5.37:g.10624887T>C				Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.S183P	ENST00000296657.5	37	c.547	CCDS47191.1	5																																																																																			ANKRD33B	-	NULL	ENSG00000164236		0.552	ANKRD33B-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	ANKRD33B	HGNC	protein_coding	OTTHUMT00000367037.3	68	0.00	0	T	XM_001130634		10624887	10624887	+1	no_errors	ENST00000504806	ensembl	human	known	69_37n	missense	37	22.92	11	SNP	0.000	C
ARHGAP25	9938	genome.wustl.edu	37	2	69002760	69002760	+	Intron	SNP	C	C	T	rs10445945	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:69002760C>T	ENST00000295381.3	+	2	680				ARHGAP25_ENST00000544262.1_Intron|ARHGAP25_ENST00000409202.3_Intron|ARHGAP25_ENST00000456116.2_Intron|ARHGAP25_ENST00000467265.1_Intron|ARHGAP25_ENST00000409220.1_Intron|ARHGAP25_ENST00000497079.1_Intron|ARHGAP25_ENST00000409030.3_Intron	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						AGCACCAGGACGGGCACTGTG	0.488													T|||	1588	0.317093	0.2247	0.3271	5008	,	,		20204	0.3135		0.3608	False		,,,				2504	0.3937					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.261+208C>T	2.37:g.69002760C>T			A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	NULL	p.T67M	ENST00000295381.3	37	c.200		2																																																																																			ARHGAP25	-	NULL	ENSG00000163219		0.488	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		62	0.00	0	C	NM_014882		69002760	69002760	+1	no_errors	ENST00000473986	ensembl	human	known	69_37n	missense	39	11.11	5	SNP	0.000	T
ARHGEF38	54848	genome.wustl.edu	37	4	106580340	106580340	+	Missense_Mutation	SNP	A	A	G	rs13147012	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr4:106580340A>G	ENST00000420470.2	+	10	1507	c.1363A>G	c.(1363-1365)Acg>Gcg	p.T455A	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	455	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GCAGCGATCAACGGGAGAGGA	0.552													G|||	1783	0.35603	0.8427	0.2637	5008	,	,		20716	0.1081		0.2386	False		,,,				2504	0.1401					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1363A>G	4.37:g.106580340A>G	ENSP00000416125:p.Thr455Ala		C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.T455A	ENST00000420470.2	37	c.1363	CCDS56338.1	4	745	0.3411172161172161	408	0.8292682926829268	103	0.2845303867403315	60	0.1048951048951049	174	0.22955145118733508	G	0.010	-1.756002	0.00663	.	.	ENSG00000236699	ENST00000420470	T	0.61980	0.06	5.66	5.66	0.87406	.	.	.	.	.	T	0.00012	0.0000	N	0.00483	-1.445	0.80722	P	0.0	.	.	.	.	.	.	T	0.37103	-0.9720	6	0.07990	T	0.79	-2.8555	8.0988	0.30844	0.1366:0.2317:0.6318:0.0	rs13147012;rs17327590;rs52828309;rs13147012	.	.	.	A	455	ENSP00000416125:T455A	ENSP00000416125:T455A	T	+	1	0	ARHGEF38	106799789	0.031000	0.19500	0.069000	0.20011	0.178000	0.23041	0.693000	0.25497	1.535000	0.49220	-0.154000	0.13518	ACG	ARHGEF38	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000236699		0.552	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	73	0.00	0	A	NM_017700		106580340	106580340	+1	no_errors	ENST00000420470	ensembl	human	putative	69_37n	missense	59	13.24	9	SNP	0.001	G
AUTS2	26053	genome.wustl.edu	37	7	69364484	69364484	+	Splice_Site	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr7:69364484G>A	ENST00000342771.4	+	2	843	c.522G>A	c.(520-522)caG>caA	p.Q174Q	AUTS2_ENST00000406775.2_Splice_Site_p.Q174Q|AUTS2_ENST00000403018.2_Splice_Site_p.Q174Q	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	174										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CACTCAGACAGGTGAGGAAGC	0.512																																						dbGAP											0													60.0	60.0	60.0					7																	69364484		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.522+1G>A	7.37:g.69364484G>A			A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.Q174	ENST00000342771.4	37	c.522	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.512	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	35	0.00	0	G		Silent	69364484	69364484	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	1.000	A
MALRD1	340895	genome.wustl.edu	37	10	19678286	19678286	+	Missense_Mutation	SNP	C	C	T	rs10763974	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr10:19678286C>T	ENST00000454679.2	+	13	2750	c.2750C>T	c.(2749-2751)aCg>aTg	p.T917M				Q5VYJ5	MALR1_HUMAN		917	MAM 5. {ECO:0000255|PROSITE- ProRule:PRU00128}.		T -> M (in dbSNP:rs10763974).		cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						TCAGATCATACGAATTGTAAT	0.378													T|||	4159	0.830471	0.9327	0.7334	5008	,	,		20748	0.8264		0.8867	False		,,,				2504	0.7076					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000454679.2:c.2750C>T	10.37:g.19678286C>T	ENSP00000412763:p.Thr917Met		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_MAM_dom	p.T917M	ENST00000454679.2	37	c.2750		10	1880	0.8608058608058609	452	0.9186991869918699	277	0.7651933701657458	480	0.8391608391608392	671	0.8852242744063324	T	2.924	-0.222624	0.06061	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	T;T	0.03272	3.99;3.99	4.96	-4.23	0.03789	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.53688	P	2.2999999999995246E-5	.	.	.	.	.	.	T	0.09164	-1.0687	4	.	.	.	.	2.0259	0.03519	0.1218:0.2297:0.3753:0.2733	rs10763974;rs10763974	.	.	.	M	930;917	ENSP00000366477:T930M;ENSP00000412763:T917M	.	T	+	2	0	C10orf112	19718292	0.754000	0.28360	0.001000	0.08648	0.030000	0.12068	-0.077000	0.11394	-1.284000	0.02390	-0.254000	0.11334	ACG	C10orf112	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl	ENSG00000204740		0.378	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		53	0.00	0	C			19678286	19678286	+1	no_errors	ENST00000454679	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.002	T
C19orf38	255809	genome.wustl.edu	37	19	10973866	10973866	+	Silent	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:10973866C>T	ENST00000397820.4	+	6	633	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	C19orf38_ENST00000592854.1_Silent_p.L176L	NM_001136482.1	NP_001129954.1	A8MVS5	HIDE1_HUMAN	chromosome 19 open reading frame 38	176						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2						CGATAACTCCCTGTTTACCGT	0.572																																						dbGAP											0													166.0	149.0	154.0					19																	10973866		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS45970.1	19p13.2	2011-08-02	2008-04-14		ENSG00000214212	ENSG00000214212			34073	protein-coding gene	gene with protein product	"""Highly expressed in immature dendritic cell transcript 1"""						Standard	NM_001136482		Approved	HIDE1	uc010dxm.1	A8MVS5		ENST00000397820.4:c.526C>T	19.37:g.10973866C>T			B2RXI3	Silent	SNP	NULL	p.L176	ENST00000397820.4	37	c.526	CCDS45970.1	19																																																																																			C19orf38	-	NULL	ENSG00000214212		0.572	C19orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf38	HGNC	protein_coding	OTTHUMT00000452622.1	65	0.00	0	C	NM_001136482		10973866	10973866	+1	no_errors	ENST00000397820	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	0.874	T
C1orf174	339448	genome.wustl.edu	37	1	3807204	3807204	+	Missense_Mutation	SNP	C	C	T	rs367965839		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:3807204C>T	ENST00000361605.3	-	3	645	c.547G>A	c.(547-549)Gtc>Atc	p.V183I	C1orf174_ENST00000486765.1_5'UTR	NM_207356.2	NP_997239.2	Q8IYL3	CA174_HUMAN	chromosome 1 open reading frame 174	183						nucleus (GO:0005634)				endometrium(1)|large_intestine(5)|lung(4)|prostate(1)	11	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		TCTAGAAAGACGCTGTTGTCC	0.547																																						dbGAP											0													107.0	97.0	100.0					1																	3807204		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035643	CCDS53.1	1p36.32	2012-07-25			ENSG00000198912	ENSG00000198912			27915	protein-coding gene	gene with protein product						12477932	Standard	NM_207356		Approved	RP13-531C17.2	uc001alf.3	Q8IYL3	OTTHUMG00000003739	ENST00000361605.3:c.547G>A	1.37:g.3807204C>T	ENSP00000355306:p.Val183Ile		A8K0C8|A8MUG9|Q5SR20|Q6NX36	Missense_Mutation	SNP	NULL	p.V183I	ENST00000361605.3	37	c.547	CCDS53.1	1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214165	0.01555	.	.	ENSG00000198912	ENST00000361605	T	0.24723	1.84	5.28	-5.26	0.02772	.	1.541420	0.03478	N	0.214647	T	0.16300	0.0392	L	0.28344	0.845	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.24368	-1.0162	10	0.16420	T	0.52	-13.0517	10.2171	0.43175	0.0:0.4494:0.0884:0.4622	.	183	Q8IYL3	CA174_HUMAN	I	183	ENSP00000355306:V183I	ENSP00000355306:V183I	V	-	1	0	C1orf174	3797064	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.002000	0.12924	-0.951000	0.03654	-1.475000	0.01000	GTC	C1orf174	-	NULL	ENSG00000198912		0.547	C1orf174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf174	HGNC	protein_coding	OTTHUMT00000010539.1	58	0.00	0	C	NM_207356		3807204	3807204	-1	no_errors	ENST00000361605	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.000	T
C1orf109	54955	genome.wustl.edu	37	1	38148123	38148124	+	3'UTR	DNP	TG	TG	GA	rs539585|rs35605341|rs670692	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:38148123_38148124TG>GA	ENST00000358011.4	-	0	1472_1473				C1orf109_ENST00000609516.1_5'UTR	NM_017850.1	NP_060320.1	Q9NX04	CA109_HUMAN	chromosome 1 open reading frame 109											lung(2)|prostate(2)	4		Myeloproliferative disorder(586;0.0393)				AAAAAACTCCTGTCATTTTAGG	0.495											OREG0013382	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000515	CCDS423.1	1p34.3	2012-06-21			ENSG00000116922	ENSG00000116922			26039	protein-coding gene	gene with protein product		614799				22548824	Standard	XM_005270979		Approved	FLJ20508	uc001cbp.3	Q9NX04	OTTHUMG00000004323	ENST00000358011.4:c.610_610delinsGA	1.37:g.38148123_38148124delinsGA		876	D3DPT1|Q8WVD1	RNA	SNP	-	NULL	ENST00000358011.4	37	NULL	CCDS423.1	1																																																																																			C1orf109	-	-	ENSG00000116922		0.495	C1orf109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf109	HGNC	protein_coding	OTTHUMT00000012486.1	46|45	0.00	0	T|G	NM_017850		38148123|38148124	38148123|38148124	-1	no_errors	ENST00000494120	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	G|A
C1orf101	257044	genome.wustl.edu	37	1	244773862	244773862	+	Intron	SNP	T	T	C	rs6698264	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:244773862T>C	ENST00000366534.4	+	19	2544				C1orf101_ENST00000473875.1_3'UTR|C1orf101_ENST00000366533.4_Intron|C1orf101_ENST00000366531.3_Intron	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101							CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AATATGTGTTTGCAGATTATT	0.313													T|||	3003	0.599641	0.5174	0.634	5008	,	,		17947	0.5248		0.7604	False		,,,				2504	0.5982					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2490+234T>C	1.37:g.244773862T>C			B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	RNA	SNP	-	NULL	ENST00000366534.4	37	NULL	CCDS44340.1	1																																																																																			C1orf101	-	-	ENSG00000179397		0.313	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	93	0.00	0	T	NM_173807		244773862	244773862	+1	no_errors	ENST00000473875	ensembl	human	known	69_37n	rna	68	10.53	8	SNP	0.004	C
B3GALT5	10317	genome.wustl.edu	37	21	40969621	40969621	+	Intron	SNP	C	C	T	rs661650	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr21:40969621C>T	ENST00000380620.4	+	2	69				C21orf88_ENST00000489821.1_5'UTR|C21orf88_ENST00000380612.4_3'UTR			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				atggaagaggcgggagagagt	0.562													C|||	1027	0.205072	0.2557	0.1643	5008	,	,		18542	0.0357		0.2614	False		,,,				2504	0.2822					dbGAP											0													45.0	56.0	53.0					21																	40969621		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-7400C>T	21.37:g.40969621C>T			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-	ENSG00000184809		0.562	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	46	0.00	0	C	NM_033170		40969621	40969621	-1	no_errors	ENST00000489821	ensembl	human	known	69_37n	rna	34	12.82	5	SNP	0.021	T
C6orf100	729583	genome.wustl.edu	37	6	28911802	28911802	+	Splice_Site	SNP	G	G	A	rs2071790	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:28911802G>A	ENST00000377186.3	+	1	149	c.122G>A	c.(121-123)gGa>gAa	p.G41E						chromosome 6 open reading frame 100																		GGATTCCAGGGAGTAAGCCTC	0.527													A|||	3394	0.677716	0.9206	0.5793	5008	,	,		20514	0.6627		0.498	False		,,,				2504	0.6196					dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0					6p22.1	2011-11-25			ENSG00000204709	ENSG00000204709			21195	protein-coding gene	gene with protein product							Standard	NR_103538		Approved	dJ25J6.5		Q5JQF7	OTTHUMG00000031148	ENST00000377186.3:c.123+1G>A	6.37:g.28911802G>A				Missense_Mutation	SNP	NULL	p.G41E	ENST00000377186.3	37	c.122		6	1393	0.6378205128205128	448	0.9105691056910569	208	0.574585635359116	379	0.6625874125874126	358	0.47229551451187335	A	5.344	0.248742	0.10130	.	.	ENSG00000204709	ENST00000377186	T	0.62941	-0.01	2.9	0.945	0.19543	.	.	.	.	.	T	0.47930	0.1472	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45934	-0.9227	5	0.87932	D	0	.	7.3323	0.26590	0.2589:0.0:0.7411:0.0	rs2071790;rs6456873;rs17735920;rs52814887;rs61462548;rs2071790	.	.	.	E	41	ENSP00000366391:G41E	ENSP00000366391:G41E	G	+	2	0	C6orf100	29019781	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.577000	0.02127	-0.019000	0.14055	-0.834000	0.03071	GGA	C6orf100	-	NULL	ENSG00000204709		0.527	C6orf100-001	KNOWN	basic|appris_principal	protein_coding	C6orf100	HGNC	protein_coding	OTTHUMT00000076270.1	42	0.00	0	G		Missense_Mutation	28911802	28911802	+1	no_errors	ENST00000377186	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.000	A
C9orf72	203228	genome.wustl.edu	37	9	27547313	27547313	+	3'UTR	SNP	G	G	T	rs3739526	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:27547313G>T	ENST00000380003.3	-	0	2430				C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72						autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TAATCTCAGAGTTGCAATGAT	0.333													g|||	1042	0.208067	0.0953	0.268	5008	,	,		16693	0.2917		0.161	False		,,,				2504	0.2802					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.*921C>A	9.37:g.27547313G>T			A8K5W0|D3DRK6|G8I0B6|Q6NUS9	RNA	SNP	-	NULL	ENST00000380003.3	37	NULL	CCDS6522.1	9																																																																																			C9orf72	-	-	ENSG00000147894		0.333	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf72	HGNC	protein_coding	OTTHUMT00000051969.1	54	0.00	0	G	NM_018325		27547313	27547313	-1	no_errors	ENST00000488117	ensembl	human	known	69_37n	rna	29	21.62	8	SNP	0.000	T
CCDC162P	221262	genome.wustl.edu	37	6	109615603	109615603	+	RNA	SNP	G	G	T	rs9487048	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:109615603G>T	ENST00000422819.1	+	0	98							A2VCL2	CC162_HUMAN	coiled-coil domain containing 162, pseudogene																		TTCCTCAATTGATGGTTCATA	0.453													T|||	1414	0.282348	0.3593	0.2795	5008	,	,		19329	0.127		0.4284	False		,,,				2504	0.1902					dbGAP											0																																										-	-	-			0					6q21	2011-04-28	2011-04-28	2011-04-28	ENSG00000203799	ENSG00000203799			21565	pseudogene	pseudogene			"""chromosome 6 open reading frame 184"", ""chromosome 6 open reading frame 185"""	C6orf184, C6orf185, CCDC162			Standard	NR_028595		Approved	bA425D10.7, bA425D10.3	uc003ptb.1	A2VCL2	OTTHUMG00000015342		6.37:g.109615603G>T			A1A4V1|A4QMU0|Q5JSU0|Q5JSU7	RNA	SNP	-	NULL	ENST00000422819.1	37	NULL		6																																																																																			CCDC162P	-	-	ENSG00000203799		0.453	CCDC162P-002	KNOWN	basic	processed_transcript	CCDC162P	HGNC	pseudogene	OTTHUMT00000365631.1	134	0.74	1	G	NR_028595		109615603	109615603	+1	no_errors	ENST00000422819	ensembl	human	known	69_37n	rna	69	13.75	11	SNP	1.000	T
CEP152	22995	genome.wustl.edu	37	15	49036477	49036477	+	Silent	SNP	T	T	C			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr15:49036477T>C	ENST00000380950.2	-	24	3982	c.3795A>G	c.(3793-3795)gaA>gaG	p.E1265E	CEP152_ENST00000399334.3_Silent_p.E1209E|CEP152_ENST00000325747.5_Silent_p.E1172E	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1265					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GCCCACGAAGTTCTTCCAAGG	0.373																																						dbGAP											0													60.0	56.0	57.0					15																	49036477		1804	4067	5871	-	-	-	SO:0001819	synonymous_variant	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3795A>G	15.37:g.49036477T>C			E7ER66|Q17RV1|Q6NTA0	Silent	SNP	NULL	p.E1265	ENST00000380950.2	37	c.3795	CCDS58361.1	15																																																																																			CEP152	-	NULL	ENSG00000103995		0.373	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	94	0.00	0	T	NM_014985		49036477	49036477	-1	no_errors	ENST00000380950	ensembl	human	known	69_37n	silent	34	37.04	20	SNP	1.000	C
CES1P1	51716	genome.wustl.edu	37	16	55806409	55806409	+	RNA	SNP	T	T	C	rs28366434	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr16:55806409T>C	ENST00000571348.1	+	0	711					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										GGAGGGTCAGTGGGAGGAGAA	0.567													.|||	3251	0.649161	0.7337	0.7003	5008	,	,		16158	0.372		0.7823	False		,,,				2504	0.6472					dbGAP											0																																										-	-	-			0			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55806409T>C			A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-	ENSG00000228695		0.567	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	112	0.00	0	T	NR_003276		55806409	55806409	+1	no_errors	ENST00000571348	ensembl	human	known	69_37n	rna	66	13.16	10	SNP	1.000	C
CPVL	54504	genome.wustl.edu	37	7	29186256	29186256	+	Intron	SNP	A	A	G	rs245880	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr7:29186256A>G	ENST00000409850.1	-	6	637				CPVL_ENST00000488891.2_Intron|CPVL_ENST00000396276.3_5'Flank|CPVL_ENST00000265394.5_5'Flank|CHN2_ENST00000539406.1_Silent_p.P19P			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like							extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						TCCTGGTCCCAGAAACCTGGC	0.567													A|||	2891	0.577276	0.6354	0.5648	5008	,	,		16059	0.6944		0.4125	False		,,,				2504	0.5562					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.10-25569T>C	7.37:g.29186256A>G			A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	NULL	p.Q15R	ENST00000409850.1	37	c.44	CCDS5419.1	7																																																																																			CHN2	-	NULL	ENSG00000106069		0.567	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHN2	HGNC	protein_coding	OTTHUMT00000328305.1	113	0.88	1	A	NM_019029		29186256	29186256	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000474070	ensembl	human	known	69_37n	missense	53	15.62	10	SNP	0.000	G
CKAP2L	150468	genome.wustl.edu	37	2	113513758	113513758	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:113513758C>G	ENST00000302450.6	-	4	1268	c.1190G>C	c.(1189-1191)aGa>aCa	p.R397T	CKAP2L_ENST00000541405.1_Missense_Mutation_p.R232T|CKAP2L_ENST00000481732.1_5'Flank	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	397						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						TCCATTTGGTCTTATGCTAGG	0.418																																						dbGAP											0													199.0	194.0	196.0					2																	113513758		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1190G>C	2.37:g.113513758C>G	ENSP00000305204:p.Arg397Thr		A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.R397T	ENST00000302450.6	37	c.1190	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330838	0.24167	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.12672	2.66;3.31	4.69	0.83	0.18854	.	0.266604	0.28420	N	0.015413	T	0.06234	0.0161	N	0.25890	0.77	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.42498	-0.9448	10	0.02654	T	1	-8.1494	5.1888	0.15199	0.0:0.4599:0.3534:0.1867	.	397	Q8IYA6	CKP2L_HUMAN	T	232;397	ENSP00000438763:R232T;ENSP00000305204:R397T	ENSP00000305204:R397T	R	-	2	0	CKAP2L	113230229	0.000000	0.05858	0.001000	0.08648	0.306000	0.27790	0.094000	0.15107	0.138000	0.18790	0.585000	0.79938	AGA	CKAP2L	-	NULL	ENSG00000169607		0.418	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	137	0.00	0	C	NM_152515		113513758	113513758	-1	no_errors	ENST00000302450	ensembl	human	known	69_37n	missense	69	28.87	28	SNP	0.001	G
CROCCP3	114819	genome.wustl.edu	37	1	16816216	16816216	+	RNA	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:16816216C>T	ENST00000263511.4	-	0	1155					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GACCAGCCGCCGGAACCCCAC	0.582																																						dbGAP											0																																										-	-	-			0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16816216C>T			Q96PW6	RNA	SNP	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			CROCCP3	-	-	ENSG00000080947		0.582	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	HGNC	pseudogene	OTTHUMT00000458172.1	37	0.00	0	C	XM_057040		16816216	16816216	-1	no_errors	ENST00000591348	ensembl	human	known	69_37n	rna	20	25.93	7	SNP	0.979	T
CYB5R1	51706	genome.wustl.edu	37	1	202936400	202936400	+	5'UTR	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:202936400C>T	ENST00000367249.4	-	0	8				CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1						sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	cggggcgggtcggagggcggg	0.736																																						dbGAP											0													7.0	7.0	7.0					1																	202936400		686	1571	2257	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.-67G>A	1.37:g.202936400C>T			A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	RNA	SNP	-	NULL	ENST00000367249.4	37	NULL	CCDS1431.1	1																																																																																			CYB5R1	-	-	ENSG00000159348		0.736	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	51	0.00	0	C	NM_016243		202936400	202936400	-1	no_errors	ENST00000473599	ensembl	human	known	69_37n	rna	18	21.74	5	SNP	0.001	T
D2HGDH	728294	genome.wustl.edu	37	2	242688292	242688292	+	Intron	SNP	C	C	T	rs34767042	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:242688292C>T	ENST00000321264.4	+	7	1062				D2HGDH_ENST00000537090.1_Missense_Mutation_p.P289L|D2HGDH_ENST00000403782.1_Intron|D2HGDH_ENST00000342518.6_Missense_Mutation_p.P289L	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase						2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		ACCTGTGTGCCGCCCGCCTGT	0.622													C|||	2784	0.555911	0.8585	0.549	5008	,	,		15199	0.3641		0.4553	False		,,,				2504	0.453					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.854-1274C>T	2.37:g.242688292C>T			B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	p.P289L	ENST00000321264.4	37	c.866	CCDS33426.1	2	1150	0.5265567765567766	400	0.8130081300813008	194	0.5359116022099447	215	0.3758741258741259	341	0.449868073878628	C	6.519	0.463907	0.12402	.	.	ENSG00000180902	ENST00000537090;ENST00000342518;ENST00000417686	D;D	0.87571	-2.23;-2.27	0.862	-0.0699	0.13750	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.36065	-0.9763	5	0.59425	D	0.04	.	3.345	0.07132	0.0:0.6947:0.0:0.3053	rs34767042;rs62192018	.	.	.	L	289;289;143	ENSP00000442796:P289L;ENSP00000339536:P289L	ENSP00000339536:P289L	P	+	2	0	D2HGDH	242336965	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.192000	0.09587	-0.050000	0.13356	-0.362000	0.07510	CCG	D2HGDH	-	NULL	ENSG00000180902		0.622	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	D2HGDH	HGNC	protein_coding	OTTHUMT00000322794.2	101	0.98	1	C	NM_152783		242688292	242688292	+1	no_errors	ENST00000537090	ensembl	human	known	69_37n	missense	51	13.33	8	SNP	0.001	T
DIAPH1	1729	genome.wustl.edu	37	5	140958163	140958163	+	Silent	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:140958163G>A	ENST00000398557.4	-	10	1103	c.963C>T	c.(961-963)ctC>ctT	p.L321L	DIAPH1_ENST00000398566.3_Silent_p.L312L|DIAPH1_ENST00000518047.1_Silent_p.L312L|DIAPH1_ENST00000253811.6_Silent_p.L321L|DIAPH1_ENST00000389054.3_Silent_p.L321L|DIAPH1_ENST00000398562.2_Silent_p.L312L|DIAPH1_ENST00000389057.5_Silent_p.L312L|DIAPH1_ENST00000520569.1_Silent_p.L267L	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	321	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGTGATGAGAGCATTGA	0.423																																						dbGAP											0													114.0	110.0	111.0					5																	140958163		1989	4170	6159	-	-	-	SO:0001819	synonymous_variant	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.963C>T	5.37:g.140958163G>A			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Silent	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.L321	ENST00000398557.4	37	c.963	CCDS43374.1	5																																																																																			DIAPH1	-	pfam_Drf_FH3,superfamily_ARM-type_fold	ENSG00000131504		0.423	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		41	0.00	0	G	NM_005219		140958163	140958163	-1	no_errors	ENST00000253811	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	1.000	A
EFCAB5	374786	genome.wustl.edu	37	17	28268766	28268766	+	5'UTR	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr17:28268766G>T	ENST00000394835.3	+	0	144				EFCAB5_ENST00000320856.5_5'UTR|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000536908.2_Intron|EFCAB5_ENST00000378738.3_5'UTR|EFCAB5_ENST00000394832.2_5'UTR|EFCAB5_ENST00000534836.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5								calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ATTAATACTGGTCTAGTAATA	0.383																																						dbGAP											0													38.0	37.0	37.0					17																	28268766		1815	4079	5894	-	-	-	SO:0001623	5_prime_UTR_variant	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.-49G>T	17.37:g.28268766G>T			B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	RNA	SNP	-	NULL	ENST00000394835.3	37	NULL	CCDS11254.2	17																																																																																			EFCAB5	-	-	ENSG00000176927		0.383	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4	22	0.00	0	G	NM_198529		28268766	28268766	+1	no_errors	ENST00000421238	ensembl	human	known	69_37n	rna	12	20.00	3	SNP	0.002	T
LYSMD4	145748	genome.wustl.edu	37	15	100256618	100256618	+	Missense_Mutation	SNP	A	A	C	rs325380	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr15:100256618A>C	ENST00000378904.2	-	1	1411	c.385T>G	c.(385-387)Ttc>Gtc	p.F129V	MEF2A_ENST00000557942.1_3'UTR|MEF2A_ENST00000453228.2_3'UTR|LYSMD4_ENST00000604213.1_5'UTR|MEF2A_ENST00000338042.6_3'UTR|MEF2A_ENST00000354410.5_3'UTR																							CAAATGGTGAAGACAATGCTA	0.358													A|||	1772	0.353834	0.0696	0.428	5008	,	,		18990	0.3115		0.5527	False		,,,				2504	0.5245					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000378904.2:c.385T>G	15.37:g.100256618A>C	ENSP00000368184:p.Phe129Val			Missense_Mutation	SNP	NULL	p.F129V	ENST00000378904.2	37	c.385		15	832	0.38095238095238093	49	0.09959349593495935	167	0.4613259668508287	188	0.32867132867132864	428	0.5646437994722955	A	15.18	2.757603	0.49468	.	.	ENSG00000214397	ENST00000378904	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.49399	-0.8944	4	0.87932	D	0	.	16.3789	0.83431	1.0:0.0:0.0:0.0	rs325380;rs60137538;rs325380	.	.	.	V	129	.	ENSP00000368184:F129V	F	-	1	0	AC022692.1	98074141	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.915000	0.69973	2.267000	0.75376	0.533000	0.62120	TTC	AC022692.1	-	NULL	ENSG00000214397		0.358	DKFZP779J2370-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000214397	Clone_based_ensembl_gene	protein_coding		57	0.00	0	A			100256618	100256618	-1	no_errors	ENST00000378904	ensembl	human	known	69_37n	missense	39	13.04	6	SNP	1.000	C
FAM86DP	692099	genome.wustl.edu	37	3	75471889	75471889	+	RNA	SNP	A	A	T	rs3763578	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr3:75471889A>T	ENST00000459803.1	-	0	1252					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		CATGTCTGATATATGGTGATT	0.448													.|||	983	0.196286	0.4236	0.1772	5008	,	,		19607	0.0218		0.1839	False		,,,				2504	0.0951					dbGAP											0																																										-	-	-			0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471889A>T				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.448	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	74	0.00	0	A	NR_024241		75471889	75471889	-1	no_errors	ENST00000459803	ensembl	human	known	69_37n	rna	42	14.29	7	SNP	0.000	T
FGFBP2	83888	genome.wustl.edu	37	4	15964208	15964208	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr4:15964208G>C	ENST00000259989.6	-	1	651	c.545C>G	c.(544-546)aCa>aGa	p.T182R	FGFBP2_ENST00000509331.1_Intron	NM_031950.3	NP_114156.1	Q9BYJ0	FGFP2_HUMAN	fibroblast growth factor binding protein 2	182						extracellular region (GO:0005576)				central_nervous_system(1)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						AGGTTTGGCTGTGGGTCGGGT	0.582																																						dbGAP											0													129.0	128.0	128.0					4																	15964208		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB021123	CCDS3419.1	4p15.32	2008-07-16			ENSG00000137441	ENSG00000137441			29451	protein-coding gene	gene with protein product	"""killer-specific secretory protein of 37 kDa"""	607713				11342666, 12322897	Standard	NM_031950		Approved	KSP37	uc003gon.3	Q9BYJ0	OTTHUMG00000128513	ENST00000259989.6:c.545C>G	4.37:g.15964208G>C	ENSP00000259989:p.Thr182Arg			Missense_Mutation	SNP	pfam_FGF1-bd	p.T182R	ENST00000259989.6	37	c.545	CCDS3419.1	4	.	.	.	.	.	.	.	.	.	.	G	9.731	1.162243	0.21538	.	.	ENSG00000137441	ENST00000259989	T	0.13420	2.59	2.73	1.85	0.25348	.	1.030060	0.07858	U	0.965818	T	0.13628	0.0330	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	D	0.69824	0.966	T	0.36335	-0.9752	10	0.17369	T	0.5	-4.4225	3.9932	0.09546	0.3304:0.0:0.6696:0.0	.	182	Q9BYJ0	FGFP2_HUMAN	R	182	ENSP00000259989:T182R	ENSP00000259989:T182R	T	-	2	0	FGFBP2	15573306	0.000000	0.05858	0.028000	0.17463	0.012000	0.07955	0.024000	0.13555	1.033000	0.39918	0.655000	0.94253	ACA	FGFBP2	-	pfam_FGF1-bd	ENSG00000137441		0.582	FGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFBP2	HGNC	protein_coding	OTTHUMT00000250324.1	295	0.00	0	G	NM_031950		15964208	15964208	-1	no_errors	ENST00000259989	ensembl	human	known	69_37n	missense	116	24.18	37	SNP	0.021	C
FKBP9P1	360132	genome.wustl.edu	37	7	55750390	55750390	+	RNA	SNP	A	A	G	rs11238374	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr7:55750390A>G	ENST00000455909.1	-	0	827					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5						TAAATTCCTCAGCTGTGACCT	0.498													G|||	3759	0.750599	0.8971	0.6729	5008	,	,		19004	0.7738		0.674	False		,,,				2504	0.6626					dbGAP											0													143.0	138.0	139.0					7																	55750390		692	1591	2283	-	-	-			0																															7.37:g.55750390A>G			B2R7H1	RNA	SNP	-	NULL	ENST00000455909.1	37	NULL		7																																																																																			FKBP9L	-	-	ENSG00000176826		0.498	FKBP9L-002	KNOWN	basic	processed_transcript	FKBP9L	HGNC	pseudogene	OTTHUMT00000251473.2	207	0.48	1	A			55750390	55750390	-1	no_errors	ENST00000455909	ensembl	human	known	69_37n	rna	121	11.03	15	SNP	0.679	G
LINC01597	400841	genome.wustl.edu	37	20	29516369	29516369	+	lincRNA	SNP	A	A	C	rs6057529	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr20:29516369A>C	ENST00000380888.3	-	0	540																											acgcagcctgactgccaggag	0.637													.|||	1227	0.245008	0.2852	0.196	5008	,	,		14619	0.2252		0.2356	False		,,,				2504	0.2556					dbGAP											0																																										-	-	-			0																															20.37:g.29516369A>C				RNA	SNP	-	NULL	ENST00000380888.3	37	NULL		20																																																																																			RP4-610C12.4	-	-	ENSG00000205611		0.637	RP4-610C12.4-001	KNOWN	basic	lincRNA	FLJ45832	Clone_based_vega_gene	lincRNA	OTTHUMT00000256907.1	63	0.00	0	A			29516369	29516369	-1	no_errors	ENST00000380888	ensembl	human	known	69_37n	rna	42	10.64	5	SNP	0.004	C
FNDC5	252995	genome.wustl.edu	37	1	33328165	33328165	+	3'UTR	SNP	G	G	A	rs3480	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:33328165G>A	ENST00000373471.3	-	0	2435				FNDC5_ENST00000609187.1_3'UTR|FNDC5_ENST00000481487.1_5'UTR	NM_001171940.1|NM_153756.2	NP_001165411.2|NP_715637.2	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5						positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGCGGTCATTGGGTGATGGCT	0.532													G|||	2922	0.583466	0.4599	0.6081	5008	,	,		19684	0.7341		0.5885	False		,,,				2504	0.5726					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000373471.3:c.*1730C>T	1.37:g.33328165G>A			A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	RNA	SNP	-	NULL	ENST00000373471.3	37	NULL		1																																																																																			FNDC5	-	-	ENSG00000160097		0.532	FNDC5-001	KNOWN	non_ATG_start|basic	protein_coding	FNDC5	HGNC	protein_coding	OTTHUMT00000011467.3	140	0.00	0	G	NM_153756		33328165	33328165	-1	no_errors	ENST00000481487	ensembl	human	known	69_37n	rna	82	12.63	12	SNP	0.141	A
GLDC	2731	genome.wustl.edu	37	9	6535975	6535975	+	Intron	SNP	G	G	T	rs3765555	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:6535975G>T	ENST00000321612.6	-	23	2989					NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	ATCATCCTCAGTTGAGAGTTC	0.423													G|||	923	0.184305	0.0484	0.2795	5008	,	,		23834	0.1687		0.2515	False		,,,				2504	0.2474					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2838+88C>A	9.37:g.6535975G>T			Q2M2F8	RNA	SNP	-	NULL	ENST00000321612.6	37	NULL	CCDS34987.1	9																																																																																			GLDC	-	-	ENSG00000178445		0.423	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	49	0.00	0	G	NM_000170		6535975	6535975	-1	no_errors	ENST00000477960	ensembl	human	known	69_37n	rna	36	11.90	5	SNP	0.000	T
ERO1LB	56605	genome.wustl.edu	37	1	236385165	236385165	+	Intron	SNP	G	G	C	rs2463189	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:236385165G>C	ENST00000354619.5	-	14	1411				GPR137B_ENST00000477559.1_3'UTR	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)						4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	AAAAAGCTTGGACTCAGTGGA	0.313													C|||	2851	0.569289	0.4803	0.5821	5008	,	,		16614	0.8849		0.4006	False		,,,				2504	0.5286					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.1209+58C>G	1.37:g.236385165G>C			B4DF57|Q5T1H4|Q8IZ11|Q9NR62	RNA	SNP	-	NULL	ENST00000354619.5	37	NULL	CCDS31064.1	1																																																																																			GPR137B	-	-	ENSG00000077585		0.313	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137B	HGNC	protein_coding	OTTHUMT00000096371.1	32	0.00	0	G	NM_019891		236385165	236385165	+1	no_errors	ENST00000477559	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.002	C
GSN	2934	genome.wustl.edu	37	9	124044995	124044995	+	Intron	SNP	C	C	T	rs3810942	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:124044995C>T	ENST00000373823.3	+	9	896				GSN_ENST00000436847.1_Intron|GSN_ENST00000449733.1_Intron|GSN-AS1_ENST00000414544.1_RNA|GSN_ENST00000341272.2_Intron|RP11-477J21.6_ENST00000437135.1_RNA|GSN_ENST00000412819.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000394353.2_Intron			P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						ACTTGAGGGCCGGGTCTTGGC	0.512													C|||	2021	0.403554	0.0265	0.4193	5008	,	,		18961	0.627		0.4553	False		,,,				2504	0.6186					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373823.3:c.-10+1155C>T	9.37:g.124044995C>T			A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	SNP	-	NULL	ENST00000373823.3	37	NULL	CCDS6829.1	9																																																																																			GSN-AS1	-	-	ENSG00000235865		0.512	GSN-013	KNOWN	basic|appris_principal|CCDS	protein_coding	GSN-AS1	HGNC	protein_coding	OTTHUMT00000254323.3	75	0.00	0	C	NM_000177		124044995	124044995	-1	no_errors	ENST00000414544	ensembl	human	known	69_37n	rna	47	14.55	8	SNP	0.000	T
GSN	2934	genome.wustl.edu	37	9	124047237	124047237	+	Intron	SNP	T	T	C	rs7046030	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:124047237T>C	ENST00000373823.3	+	9	896				GSN_ENST00000436847.1_Intron|GSN_ENST00000449733.1_Intron|GSN-AS1_ENST00000414544.1_RNA|GSN_ENST00000341272.2_Intron|GSN_ENST00000545652.1_5'Flank|RP11-477J21.6_ENST00000437135.1_RNA|GSN_ENST00000412819.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000394353.2_Intron			P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						CTCTGTTCGGTTATCCCCGAA	0.572													T|||	964	0.192492	0.3835	0.1297	5008	,	,		19624	0.0605		0.1948	False		,,,				2504	0.1125					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373823.3:c.-10+3397T>C	9.37:g.124047237T>C			A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	SNP	-	NULL	ENST00000373823.3	37	NULL	CCDS6829.1	9																																																																																			GSN-AS1	-	-	ENSG00000235865		0.572	GSN-013	KNOWN	basic|appris_principal|CCDS	protein_coding	GSN-AS1	HGNC	protein_coding	OTTHUMT00000254323.3	166	0.00	0	T	NM_000177		124047237	124047237	-1	no_errors	ENST00000414544	ensembl	human	known	69_37n	rna	86	10.42	10	SNP	0.000	C
GSTA3	2940	genome.wustl.edu	37	6	52768488	52768488	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:52768488C>T	ENST00000211122.3	-	3	190	c.125G>A	c.(124-126)gGa>gAa	p.G42E	GSTA3_ENST00000370968.1_5'UTR	NM_000847.4	NP_000838.3	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	42	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)	10	Lung NSC(77;0.0912)				Glutathione(DB00143)	TCTTAACTTTCCCAAATCTTC	0.373																																						dbGAP											0													122.0	118.0	119.0					6																	52768488		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF020919	CCDS4947.1	6p12.2	2012-06-21	2008-11-26		ENSG00000174156	ENSG00000174156	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4628	protein-coding gene	gene with protein product		605449	"""glutathione S-transferase A3"""			8307579, 9480897	Standard	NM_000847		Approved		uc003pbb.3	Q16772	OTTHUMG00000014865	ENST00000211122.3:c.125G>A	6.37:g.52768488C>T	ENSP00000211122:p.Gly42Glu		O43468|Q068V6|Q8WWA8|Q9H415	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_alpha	p.G42E	ENST00000211122.3	37	c.125	CCDS4947.1	6	.	.	.	.	.	.	.	.	.	.	c	0.026	-1.371572	0.01225	.	.	ENSG00000174156	ENST00000211122	T	0.07327	3.2	3.94	1.39	0.22231	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.528179	0.20675	N	0.087766	T	0.00356	0.0011	N	0.00190	-1.885	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38351	-0.9665	10	0.02654	T	1	.	5.4029	0.16306	0.0:0.1654:0.147:0.6875	.	42	Q16772	GSTA3_HUMAN	E	42	ENSP00000211122:G42E	ENSP00000211122:G42E	G	-	2	0	GSTA3	52876447	0.009000	0.17119	0.001000	0.08648	0.051000	0.14879	0.164000	0.16542	-0.090000	0.12462	-0.275000	0.10095	GGA	GSTA3	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold	ENSG00000174156		0.373	GSTA3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA3	HGNC	protein_coding	OTTHUMT00000040933.1	73	0.00	0	C			52768488	52768488	-1	no_errors	ENST00000211122	ensembl	human	known	69_37n	missense	46	24.19	15	SNP	0.306	T
GSTM2	2946	genome.wustl.edu	37	1	110212293	110212293	+	Intron	SNP	C	C	A	rs3819350	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:110212293C>A	ENST00000241337.4	+	5	410				GSTM2_ENST00000460717.3_Intron|GSTM2_ENST00000369831.2_Intron|GSTM2_ENST00000369829.2_Intron|GSTM2_ENST00000414179.2_Intron|GSTM2_ENST00000369827.3_Intron|GSTM2_ENST00000464206.1_3'UTR|GSTM2_ENST00000442650.1_Intron	NM_000848.3	NP_000839.1	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 (muscle)						cellular detoxification of nitrogen compound (GO:0070458)|cellular response to caffeine (GO:0071313)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|nitrobenzene metabolic process (GO:0018916)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|relaxation of cardiac muscle (GO:0055119)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			kidney(1)|large_intestine(2)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	11		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	ctggtgagttcttggtcttgc	0.507													c|||	1862	0.371805	0.1097	0.5447	5008	,	,		17349	0.6498		0.3489	False		,,,				2504	0.3405					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M63509	CCDS808.1, CCDS44192.1	1p13.3	2012-06-21	2008-11-26		ENSG00000213366	ENSG00000213366	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4634	protein-coding gene	gene with protein product		138380	"""glutathione S-transferase M2 (muscle)"""			2034681, 2345169	Standard	NM_000848		Approved	GST4		P28161	OTTHUMG00000011638	ENST00000241337.4:c.360+100C>A	1.37:g.110212293C>A			B4DRY4|E9PEM9|Q2M318|Q5TZY5|Q8WWE1	RNA	SNP	-	NULL	ENST00000241337.4	37	NULL	CCDS808.1	1																																																																																			GSTM2	-	-	ENSG00000213366		0.507	GSTM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM2	HGNC	protein_coding	OTTHUMT00000032167.2	14	0.00	0	C	NM_000848		110212293	110212293	+1	no_errors	ENST00000464206	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.456	A
HLA-F	3134	genome.wustl.edu	37	6	29694570	29694570	+	IGR	SNP	A	A	G	rs3734813	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:29694570A>G	ENST00000376861.1	+	0	1544				HLA-F_ENST00000475996.1_Intron|HLA-F_ENST00000440587.2_Intron|HLA-F_ENST00000259951.7_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						AATGTCACAAACTTCTTCACA	0.448													G|||	1156	0.230831	0.2632	0.1628	5008	,	,		18459	0.2917		0.1183	False		,,,				2504	0.2883					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29694570A>G			Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	RNA	SNP	-	NULL	ENST00000376861.1	37	NULL	CCDS43438.1	6																																																																																			HLA-F-AS1	-	-	ENSG00000214922		0.448	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F-AS1	HGNC	protein_coding	OTTHUMT00000195083.1	56	0.00	0	A	NM_018950		29694570	29694570	-1	no_errors	ENST00000399247	ensembl	human	known	69_37n	rna	26	16.13	5	SNP	1.000	G
HCG9	10255	genome.wustl.edu	37	6	29943269	29943269	+	lincRNA	SNP	G	G	A	rs1128306	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:29943269G>A	ENST00000376800.3	+	0	381									HLA complex group 9 (non-protein coding)																		TGGTTTGTCCGAAAAGTGAGA	0.602													G|||	1168	0.233227	0.3404	0.2637	5008	,	,		17318	0.1478		0.164	False		,,,				2504	0.226					dbGAP											0																																										-	-	-			0			AB088085		6p21.3	2012-10-16	2011-04-11		ENSG00000204625	ENSG00000204625		"""Long non-coding RNAs"""	21243	non-coding RNA	RNA, long non-coding		615797	"""HLA complex group 9"""			10727083, 10557312	Standard	NR_028032		Approved	PERB11, HCGIX, HCGIX4, HCGIX-4	uc003rth.3		OTTHUMG00000031119		6.37:g.29943269G>A				RNA	SNP	-	NULL	ENST00000376800.3	37	NULL		6																																																																																			HCG9	-	-	ENSG00000204625		0.602	HCG9-001	KNOWN	basic	lincRNA	HCG9	HGNC	lincRNA	OTTHUMT00000076199.4	94	0.00	0	G	NR_028032		29943269	29943269	+1	no_errors	ENST00000376800	ensembl	human	known	69_37n	rna	48	12.50	7	SNP	0.001	A
HMCN1	83872	genome.wustl.edu	37	1	186023072	186023072	+	Silent	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:186023072G>A	ENST00000271588.4	+	44	7045	c.6816G>A	c.(6814-6816)tcG>tcA	p.S2272S	HMCN1_ENST00000367492.2_Silent_p.S2272S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2272	Ig-like C2-type 20.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTGTGGCGTCGAATGTTGCTG	0.403																																						dbGAP											0													111.0	109.0	110.0					1																	186023072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6816G>A	1.37:g.186023072G>A			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S2272	ENST00000271588.4	37	c.6816	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000143341		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	132	0.00	0	G	NM_031935		186023072	186023072	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	silent	108	20.44	28	SNP	0.276	A
HMGN2P46	283651	genome.wustl.edu	37	15	45848865	45848865	+	lincRNA	DEL	C	C	-			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr15:45848865delC	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							CCATGTCCTGCCCAAAATACC	0.368																																						dbGAP											0																																										-	-	-			0																															15.37:g.45848865delC				RNA	DEL	-	NULL	ENST00000557965.1	37	NULL		15																																																																																			HMGN2P46	-	-	ENSG00000179362		0.368	RP11-96O20.2-001	KNOWN	basic	lincRNA	HMGN2P46	HGNC	lincRNA	OTTHUMT00000416553.1	37	0.00	0	C			45848865	45848865	+1	no_errors	ENST00000409454	ensembl	human	known	69_37n	rna	8	20.00	2	DEL	0.668	-
HYDIN	54768	genome.wustl.edu	37	16	70972595	70972595	+	Missense_Mutation	SNP	T	T	C	rs2502726	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr16:70972595T>C	ENST00000393567.2	-	44	7067	c.6917A>G	c.(6916-6918)gAa>gGa	p.E2306G		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2306			E -> G (in dbSNP:rs2502726).		cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCATCATATTCTTCCTCATC	0.552													T|||	2273	0.453874	0.205	0.4597	5008	,	,		19914	0.4365		0.7445	False		,,,				2504	0.5051					dbGAP											0													88.0	79.0	82.0					16																	70972595		1905	4129	6034	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6917A>G	16.37:g.70972595T>C	ENSP00000377197:p.Glu2306Gly		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.E2305G	ENST00000393567.2	37	c.6914	CCDS59269.1	16	1116	0.510989010989011	100	0.2032520325203252	184	0.5082872928176796	258	0.45104895104895104	574	0.7572559366754618	T	28.1	4.886630	0.91814	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01887	4.58	5.6	5.6	0.85130	.	0.000000	0.33040	U	0.005343	T	0.00012	0.0000	L	0.36672	1.1	0.09310	P	1.0	D	0.89917	1.0	D	0.87578	0.998	T	0.00277	-1.1854	9	0.72032	D	0.01	.	15.4913	0.75607	0.0:0.0:0.0:1.0	rs2502726;rs4451953;rs59602564	2305	F8WD23	.	G	2306;2305	ENSP00000377197:E2306G	ENSP00000313052:E2305G	E	-	2	0	HYDIN	69530096	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	6.226000	0.72277	2.148000	0.66965	0.491000	0.48974	GAA	HYDIN	-	NULL	ENSG00000157423		0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	146	0.00	0	T			70972595	70972595	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	1.000	C
IDH1	3417	genome.wustl.edu	37	2	209108313	209108313	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:209108313G>T	ENST00000415913.1	-	6	917	c.536C>A	c.(535-537)gCc>gAc	p.A179D	IDH1_ENST00000446179.1_Missense_Mutation_p.A179D|IDH1_ENST00000345146.2_Missense_Mutation_p.A179D	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	179					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		CATCCCCATGGCAACACCACC	0.413			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	dbGAP		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	0													73.0	68.0	70.0					2																	209108313		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.536C>A	2.37:g.209108313G>T	ENSP00000390265:p.Ala179Asp		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP_euk-typ,tigrfam_Isocitrate_DH_NADP_euk-typ	p.A179D	ENST00000415913.1	37	c.536	CCDS2381.1	2	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021617	0.93462	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	T;T;T	0.65364	-0.15;-0.15;-0.15	5.52	5.52	0.82312	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.85885	0.5801	H	0.97564	4.03	0.80722	D	1	D	0.64830	0.994	P	0.60236	0.871	D	0.90568	0.4520	10	0.87932	D	0	-13.4945	19.7971	0.96490	0.0:0.0:1.0:0.0	.	179	O75874	IDHC_HUMAN	D	179	ENSP00000260985:A179D;ENSP00000410513:A179D;ENSP00000390265:A179D	ENSP00000260985:A179D	A	-	2	0	IDH1	208816558	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.669000	0.83911	2.762000	0.94881	0.484000	0.47621	GCC	IDH1	-	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP_euk-typ,tigrfam_Isocitrate_DH_NADP_euk-typ	ENSG00000138413		0.413	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IDH1	HGNC	protein_coding	OTTHUMT00000336672.1	40	0.00	0	G			209108313	209108313	-1	no_errors	ENST00000345146	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	T
IGLV1-50	28821	genome.wustl.edu	37	22	22681721	22681721	+	RNA	SNP	T	T	C	rs12484322	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:22681721T>C	ENST00000390291.2	+	0	64									immunoglobulin lambda variable 1-50 (non-functional)																		GGCCTGGTCTTCTCTCCTCCT	0.567													.|||	973	0.194289	0.1717	0.2709	5008	,	,		19315	0.1458		0.2147	False		,,,				2504	0.1994					dbGAP											0																																										-	-	-			0			M94112		22q11.2	2012-02-08	2008-09-15		ENSG00000211645	ENSG00000211645		"""Immunoglobulins / IGL locus"""	5881	other	immunoglobulin gene			"""immunoglobulin lambda variable 1-50"""				Standard	NG_000002		Approved				OTTHUMG00000151051		22.37:g.22681721T>C				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S5P	ENST00000390291.2	37	c.13		22																																																																																			IGLV1-50	-	NULL	ENSG00000211645		0.567	IGLV1-50-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV1-50	HGNC	IG_V_gene	OTTHUMT00000321111.3	67	0.00	0	T	NG_000002		22681721	22681721	+1	no_stop_codon	ENST00000390291	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.012	C
IGLL5	100423062	genome.wustl.edu	37	22	23230300	23230300	+	Missense_Mutation	SNP	C	C	T	rs382768	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:23230300C>T	ENST00000526893.1	+	1	341	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C	IGLL5_ENST00000532223.2_Missense_Mutation_p.R23C|IGLL5_ENST00000531372.1_Missense_Mutation_p.R23C|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	23						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TCCCAGGCAGCGCTGGCCCCT	0.672													C|||	379	0.0756789	0.2027	0.0476	5008	,	,		12770	0.0		0.0348	False		,,,				2504	0.044					dbGAP											0																																										-	-	-	SO:0001583	missense	0			M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.67C>T	22.37:g.23230300C>T	ENSP00000431254:p.Arg23Cys			Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.R23C	ENST00000526893.1	37	c.67	CCDS54506.1	22	115	0.052655677655677656	76	0.15447154471544716	14	0.03867403314917127	0	0.0	25	0.032981530343007916	C	7.897	0.733599	0.15574	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00569	6.52;6.52	3.25	-6.5	0.01884	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44452	-0.9327	8	0.62326	D	0.03	.	3.5729	0.07923	0.1077:0.2861:0.1068:0.4995	rs382768	23	B9A064	IGLL5_HUMAN	C	23	ENSP00000436353:R23C;ENSP00000431254:R23C	ENSP00000431254:R23C	R	+	1	0	IGLL5	21560300	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.259000	0.00536	-2.722000	0.00388	-1.790000	0.00627	CGC	IGLL5	-	NULL	ENSG00000254709		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	IGLL5	HGNC	protein_coding	OTTHUMT00000385699.1	169	0.59	1	C	NM_001178126		23230300	23230300	+1	no_errors	ENST00000532223	ensembl	human	known	69_37n	missense	60	10.45	7	SNP	0.000	T
KIRREL3	84623	genome.wustl.edu	37	11	126873592	126873592	+	5'Flank	SNP	C	C	T	rs494442	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:126873592C>T	ENST00000525144.2	-	0	0				KIRREL3_ENST00000525704.2_5'Flank|KIRREL3_ENST00000533026.2_5'Flank|KIRREL3-AS3_ENST00000525678.1_RNA	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)						hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGCAAGCCGGCGGGATGCCAG	0.632											OREG0021489	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	2682	0.535543	0.8192	0.402	5008	,	,		13971	0.5724		0.4215	False		,,,				2504	0.3262					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831		11.37:g.126873592C>T	Exception_encountered	1552	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	RNA	SNP	-	NULL	ENST00000525144.2	37	NULL	CCDS53723.1	11																																																																																			KIRREL3-AS3	-	-	ENSG00000218109		0.632	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3-AS3	HGNC	protein_coding	OTTHUMT00000386479.2	128	0.78	1	C	NM_032531		126873592	126873592	+1	no_errors	ENST00000525678	ensembl	human	known	69_37n	rna	46	14.81	8	SNP	0.553	T
JUP	3728	genome.wustl.edu	37	17	39795768	39795768	+	Intron	SNP	T	T	C	rs6416918	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr17:39795768T>C	ENST00000540235.1	-	5	909							P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CCCCCTCAGATTGGGGGCTCC	0.557													c|||	3156	0.630192	0.8707	0.5014	5008	,	,		20359	0.6677		0.4294	False		,,,				2504	0.5644				Colon(16;42 520 6044 17852 28530)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-16484A>G	17.37:g.39795768T>C			Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-	ENSG00000214514		0.557	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		28	0.00	0	T			39795768	39795768	-1	no_errors	ENST00000398469	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.000	C
LINC00238	440184	genome.wustl.edu	37	14	66965200	66965200	+	lincRNA	SNP	G	G	A	rs1055136	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr14:66965200G>A	ENST00000556874.1	-	0	498				LINC00238_ENST00000389594.3_RNA																							gcaggctttcgctccatttgc	0.423													G|||	552	0.110224	0.0741	0.1196	5008	,	,		16142	0.0556		0.1859	False		,,,				2504	0.1309					dbGAP											0																																										-	-	-			0																															14.37:g.66965200G>A				RNA	SNP	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			LINC00238	-	-	ENSG00000196553		0.423	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	38	0.00	0	G			66965200	66965200	+1	no_errors	ENST00000359454	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.628	A
LINC00488	677779	genome.wustl.edu	37	3	108897116	108897116	+	lincRNA	SNP	G	G	A	rs11552473	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr3:108897116G>A	ENST00000494582.1	+	0	105				RP11-59E19.4_ENST00000562158.1_lincRNA	NR_026767.1				long intergenic non-protein coding RNA 488																		TCAGTCGTGTGGAAATCGATG	0.483													A|||	383	0.0764776	0.0787	0.1816	5008	,	,		19901	0.0694		0.0408	False		,,,				2504	0.0429					dbGAP											0																																										-	-	-			0			AK123226		3q13.13	2012-10-12	2011-09-14	2011-09-14	ENSG00000214381	ENSG00000214381		"""Long non-coding RNAs"""	32675	non-coding RNA	RNA, long non-coding			"""chromosome 3 open reading frame 66"""	C3orf66			Standard	NR_026767		Approved	FLJ41232	uc003dxn.4		OTTHUMG00000159206		3.37:g.108897116G>A				RNA	SNP	-	NULL	ENST00000494582.1	37	NULL		3																																																																																			LINC00488	-	-	ENSG00000214381		0.483	LINC00488-001	KNOWN	basic	lincRNA	LINC00488	HGNC	lincRNA	OTTHUMT00000353835.1	69	0.00	0	G	NR_026767		108897116	108897116	+1	no_errors	ENST00000494582	ensembl	human	known	69_37n	rna	37	13.95	6	SNP	0.000	A
LRP2	4036	genome.wustl.edu	37	2	170115633	170115633	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:170115633G>T	ENST00000263816.3	-	17	2700	c.2415C>A	c.(2413-2415)taC>taA	p.Y805*	LRP2_ENST00000443831.1_Nonsense_Mutation_p.Y668*	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	805					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGATACTCTTGTAATGAGAGT	0.408																																						dbGAP											0													141.0	140.0	140.0					2																	170115633		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2415C>A	2.37:g.170115633G>T	ENSP00000263816:p.Tyr805*		O00711|Q16215	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Y805*	ENST00000263816.3	37	c.2415	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.647294	0.98409	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	.	.	.	5.77	-4.67	0.03319	.	0.408600	0.28442	N	0.015324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.1599	0.06516	0.4673:0.1543:0.2798:0.0985	.	.	.	.	X	805;668	.	ENSP00000263816:Y805X	Y	-	3	2	LRP2	169823879	0.951000	0.32395	0.000000	0.03702	0.670000	0.39368	0.039000	0.13884	-1.090000	0.03069	0.591000	0.81541	TAC	LRP2	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.408	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	70	0.00	0	G	NM_004525		170115633	170115633	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	nonsense	31	13.51	5	SNP	0.250	T
MAST2	23139	genome.wustl.edu	37	1	46495024	46495024	+	3'UTR	SNP	G	G	A	rs3795318	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:46495024G>A	ENST00000477968.1	+	0	188				MAST2_ENST00000361297.2_Intron|MAST2_ENST00000372009.2_Intron					microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GCTTTCAGGGGCTCCAGGCTG	0.517													G|||	584	0.116613	0.0446	0.1383	5008	,	,		19289	0.0169		0.2773	False		,,,				2504	0.136					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000477968.1:c.*185G>A	1.37:g.46495024G>A				RNA	SNP	-	NULL	ENST00000477968.1	37	NULL		1																																																																																			MAST2	-	-	ENSG00000086015		0.517	MAST2-011	KNOWN	basic	processed_transcript	MAST2	HGNC	protein_coding	OTTHUMT00000021987.1	39	0.00	0	G	NM_015112		46495024	46495024	+1	no_errors	ENST00000477968	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.000	A
MGST3	4259	genome.wustl.edu	37	1	165630698	165630698	+	Missense_Mutation	SNP	A	A	G	rs6667681	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:165630698A>G	ENST00000367888.4	+	6	443	c.355A>G	c.(355-357)Act>Gct	p.T119A	Y_RNA_ENST00000384263.1_RNA			O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3	0					glutathione derivative biosynthetic process (GO:1901687)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|peroxidase activity (GO:0004601)			endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	cctgggccacactggaagaag	0.398													A|||	4125	0.823682	0.8079	0.7738	5008	,	,		17283	0.994		0.6918	False		,,,				2504	0.8405					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF026977	CCDS1249.1	1q23	2012-06-21			ENSG00000143198	ENSG00000143198	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7064	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase III"", ""microsomal GST-3"", ""microsomal GST-III"""	604564				9278457	Standard	NM_004528		Approved	GST-III	uc001gdf.3	O14880	OTTHUMG00000034627	ENST00000367888.4:c.355A>G	1.37:g.165630698A>G	ENSP00000356863:p.Thr119Ala		B2R592|Q6ICN4	Missense_Mutation	SNP	pfam_Membr-assoc_MAPEG	p.T119A	ENST00000367888.4	37	c.355		1	1740	0.7967032967032966	391	0.7947154471544715	259	0.7154696132596685	568	0.993006993006993	522	0.6886543535620053	A	6.897	0.535058	0.13188	.	.	ENSG00000143198	ENST00000367888	T	0.62639	0.01	0.566	0.566	0.17317	.	.	.	.	.	T	0.47875	0.1469	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	T	0.45190	-0.9278	4	0.51188	T	0.08	.	.	.	.	rs6667681;rs60199455	.	.	.	A	119	ENSP00000356863:T119A	ENSP00000356863:T119A	T	+	1	0	MGST3	163897322	.	.	0.101000	0.21167	0.123000	0.20343	.	.	0.466000	0.27193	0.254000	0.18369	ACT	MGST3	-	NULL	ENSG00000143198		0.398	MGST3-005	PUTATIVE	basic	protein_coding	MGST3	HGNC	protein_coding	OTTHUMT00000083877.1	75	0.00	0	A	NM_004528		165630698	165630698	+1	no_errors	ENST00000367888	ensembl	human	putative	69_37n	missense	61	10.29	7	SNP	0.136	G
MUC19	283463	genome.wustl.edu	37	12	40938751	40938751	+	Intron	SNP	A	A	G	rs7304329	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr12:40938751A>G	ENST00000454784.4	+	55	17711							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ATCTCCTCTGAAAATCTTTGT	0.333													G|||	999	0.199481	0.3207	0.1657	5008	,	,		18721	0.1706		0.1899	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10890+66A>G	12.37:g.40938751A>G			Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.333	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	94	0.00	0	A	XM_003403524		40938751	40938751	+1	no_errors	ENST00000492952	ensembl	human	known	69_37n	rna	50	10.71	6	SNP	0.002	G
MUC5AC	4586	genome.wustl.edu	37	11	1213075	1213075	+	3'UTR	SNP	C	C	G	rs370003600		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:1213075C>G	ENST00000358378.6	+	0	316							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		TGGAACTACTCCCAGCCCTGT	0.587																																						dbGAP											0													93.0	87.0	88.0					11																	1213075		875	1990	2865	-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*313C>G	11.37:g.1213075C>G			O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	SNP	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			MUC5AC	-	-	ENSG00000215182		0.587	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2	476	0.00	0	C	XM_001130382		1213075	1213075	+1	no_errors	ENST00000358378	ensembl	human	putative	69_37n	rna	177	12.20	25	SNP	0.000	G
MXI1	4601	genome.wustl.edu	37	10	112046150	112046150	+	3'UTR	SNP	T	T	C	rs17658	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr10:112046150T>C	ENST00000239007.7	+	0	2310				MXI1_ENST00000485566.1_3'UTR|MXI1_ENST00000332674.5_3'UTR|MXI1_ENST00000361248.4_3'UTR	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein						cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CAAGGTTCCCTTGTGGCCCTC	0.393													C|||	3732	0.745208	0.6067	0.755	5008	,	,		17666	0.9137		0.7058	False		,,,				2504	0.7924					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.*1405T>C	10.37:g.112046150T>C			B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	RNA	SNP	-	NULL	ENST00000239007.7	37	NULL	CCDS7564.2	10																																																																																			MXI1	-	-	ENSG00000119950		0.393	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	MXI1	HGNC	protein_coding	OTTHUMT00000050316.1	120	0.83	1	T	NM_130439		112046150	112046150	+1	no_errors	ENST00000485566	ensembl	human	known	69_37n	rna	64	14.67	11	SNP	0.000	C
MYH14	79784	genome.wustl.edu	37	19	50804948	50804948	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:50804948G>A	ENST00000596571.1	+	37	5377	c.5377G>A	c.(5377-5379)Gag>Aag	p.E1793K	MYH14_ENST00000440075.2_Missense_Mutation_p.E1834K|MYH14_ENST00000425460.1_Missense_Mutation_p.E1801K|MYH14_ENST00000376970.2_Missense_Mutation_p.E1826K|MYH14_ENST00000601313.1_Missense_Mutation_p.E1834K|MYH14_ENST00000598205.1_Missense_Mutation_p.E1801K|MYH14_ENST00000262269.8_Missense_Mutation_p.E1834K			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1793					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCTGTCAGCTGAGCGCAGTTT	0.612																																						dbGAP											0													40.0	45.0	43.0					19																	50804948		2059	4226	6285	-	-	-	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5377G>A	19.37:g.50804948G>A	ENSP00000472819:p.Glu1793Lys		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1834K	ENST00000596571.1	37	c.5500	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.080637	0.94050	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68	4.08	4.08	0.47627	Myosin tail (1);	.	.	.	.	D	0.95636	0.8581	M	0.88450	2.955	0.52099	D	0.999949	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96279	0.9205	9	0.87932	D	0	.	14.1423	0.65327	0.0:0.0:1.0:0.0	.	1834;1793;1801	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	K	1834;1826;1801;1577;1834	ENSP00000406273:E1834K;ENSP00000366169:E1826K;ENSP00000407879:E1801K;ENSP00000262269:E1834K	ENSP00000262269:E1834K	E	+	1	0	MYH14	55496760	1.000000	0.71417	0.988000	0.46212	0.952000	0.60782	9.426000	0.97469	2.274000	0.75844	0.591000	0.81541	GAG	MYH14	-	pfam_Myosin_tail	ENSG00000105357		0.612	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	59	0.00	0	G	NM_024729		50804948	50804948	+1	no_errors	ENST00000262269	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	1.000	A
N4BP1	9683	genome.wustl.edu	37	16	48580088	48580088	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr16:48580088delT	ENST00000262384.3	-	6	2539	c.2303delA	c.(2302-2304)gagfs	p.E769fs	N4BP1_ENST00000565423.1_Intron	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	769					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AAGAAACTCCTCTAATCGAGG	0.423																																						dbGAP											0													105.0	101.0	103.0					16																	48580088		1895	4109	6004	-	-	-	SO:0001589	frameshift_variant	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2303delA	16.37:g.48580088delT	ENSP00000262384:p.Glu769fs		A7MD49|Q2YDX1	Frame_Shift_Del	DEL	pfam_RNase_Zc3h12	p.E768fs	ENST00000262384.3	37	c.2303	CCDS45479.1	16																																																																																			N4BP1	-	pfam_RNase_Zc3h12	ENSG00000102921		0.423	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	45	0.00	0	T	NM_014664		48580088	48580088	-1	no_errors	ENST00000262384	ensembl	human	known	69_37n	frame_shift_del	10	62.96	17	DEL	1.000	-
NFKBIZ	64332	genome.wustl.edu	37	3	101571041	101571042	+	Missense_Mutation	DNP	TT	TT	GG			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr3:101571041_101571042TT>GG	ENST00000326172.5	+	2	517_518	c.402_403TT>GG	c.(400-405)gcTTct>gcGGct	p.S135A	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.S135A|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.S35A	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	135					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						AACAGAAGGCTTCTGGCCAAGC	0.47																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	Exception_encountered	3.37:g.101571041_101571042delinsGG	ENSP00000325663:p.Ser135Ala		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Silent|Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A134|p.S135A	ENST00000326172.5	37	c.402|c.403	CCDS2946.1	3																																																																																			NFKBIZ	-	NULL	ENSG00000144802		0.470	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	85|84	0.00	0	T	NM_031419		101571041|101571042	101571041|101571042	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	silent|missense	26|27	44.68|42.55	21|20	SNP	0.977|0.978	G
NTRK1	4914	genome.wustl.edu	37	1	156836739	156836739	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:156836739A>G	ENST00000524377.1	+	4	438	c.397A>G	c.(397-399)Aaa>Gaa	p.K133E	NTRK1_ENST00000392302.2_Missense_Mutation_p.K103E|NTRK1_ENST00000368196.3_Missense_Mutation_p.K133E|NTRK1_ENST00000358660.3_Missense_Mutation_p.K133E	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	133					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	TCTCTCCTGGAAAACTGTGCA	0.577			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																												dbGAP		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0													95.0	87.0	90.0					1																	156836739		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.397A>G	1.37:g.156836739A>G	ENSP00000431418:p.Lys133Glu		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.K133E	ENST00000524377.1	37	c.397	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659672	0.67586	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	4.51	4.51	0.55191	.	0.582854	0.16428	N	0.214823	T	0.17195	0.0413	N	0.02865	-0.47	0.43522	D	0.995796	B;B;B;B	0.33964	0.093;0.053;0.104;0.434	B;B;B;B	0.36959	0.143;0.049;0.031;0.237	T	0.14364	-1.0475	10	0.62326	D	0.03	.	10.1385	0.42721	1.0:0.0:0.0:0.0	.	133;133;133;103	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	E	103;133;133;133	ENSP00000376120:K103E;ENSP00000357179:K133E;ENSP00000431418:K133E;ENSP00000351486:K133E	ENSP00000351486:K133E	K	+	1	0	NTRK1	155103363	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	4.517000	0.60503	1.903000	0.55091	0.379000	0.24179	AAA	NTRK1	-	NULL	ENSG00000198400		0.577	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	HGNC	protein_coding	OTTHUMT00000392279.1	97	0.00	0	A	NM_002529		156836739	156836739	+1	no_errors	ENST00000524377	ensembl	human	known	69_37n	missense	104	14.05	17	SNP	1.000	G
OR52K1	390036	genome.wustl.edu	37	11	4510827	4510827	+	Missense_Mutation	SNP	C	C	A	rs148398771		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:4510827C>A	ENST00000307632.3	+	1	719	c.697C>A	c.(697-699)Cag>Aag	p.Q233K		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		GCTTGCCTCTCAGGAGGCCCG	0.502																																						dbGAP											0													333.0	281.0	299.0					11																	4510827		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.697C>A	11.37:g.4510827C>A	ENSP00000302422:p.Gln233Lys		B9EH54|Q6IFK5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q233K	ENST00000307632.3	37	c.697	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.570368	0.00895	.	.	ENSG00000196778	ENST00000307632	T	0.00069	8.77	4.5	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.545074	0.15653	N	0.251307	T	0.00073	0.0002	N	0.05280	-0.08	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.08006	-1.0743	10	0.10111	T	0.7	.	7.3119	0.26479	0.1708:0.7359:0.0:0.0932	.	233	Q8NGK4	O52K1_HUMAN	K	233	ENSP00000302422:Q233K	ENSP00000302422:Q233K	Q	+	1	0	OR52K1	4467403	0.000000	0.05858	1.000000	0.80357	0.682000	0.39822	-0.349000	0.07731	2.487000	0.83934	0.411000	0.27672	CAG	OR52K1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196778		0.502	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1	135	0.00	0	C	NM_001005171		4510827	4510827	+1	no_errors	ENST00000307632	ensembl	human	known	69_37n	missense	76	24.00	24	SNP	0.037	A
OR4C11	219429	genome.wustl.edu	37	11	55371242	55371242	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:55371242G>T	ENST00000302231.4	-	1	632	c.608C>A	c.(607-609)gCa>gAa	p.A203E		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						TGAGCAAATTGCCCCACTGTT	0.398																																						dbGAP											0													87.0	72.0	78.0					11																	55371242		2179	4012	6191	-	-	-	SO:0001583	missense	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.608C>A	11.37:g.55371242G>T	ENSP00000306651:p.Ala203Glu		B9EIL4|Q8NGL8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A203E	ENST00000302231.4	37	c.608	CCDS31503.1	11	.	.	.	.	.	.	.	.	.	.	G	8.663	0.901110	0.17760	.	.	ENSG00000172188	ENST00000302231	T	0.38240	1.15	4.34	0.186	0.15105	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	U	0.000184	T	0.29028	0.0721	L	0.59967	1.855	0.09310	N	1	P	0.42161	0.772	B	0.43018	0.405	T	0.17653	-1.0362	10	0.52906	T	0.07	.	0.6945	0.00897	0.2468:0.1829:0.3829:0.1874	.	203	Q6IEV9	OR4CB_HUMAN	E	203	ENSP00000306651:A203E	ENSP00000306651:A203E	A	-	2	0	OR4C11	55127818	0.000000	0.05858	0.006000	0.13384	0.011000	0.07611	-1.028000	0.03589	0.195000	0.20347	-0.349000	0.07799	GCA	OR4C11	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172188		0.398	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	28	0.00	0	G	NM_001004700		55371242	55371242	-1	no_errors	ENST00000302231	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	T
PAPLN	89932	genome.wustl.edu	37	14	73720533	73720533	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr14:73720533G>A	ENST00000554301.1	+	11	1329	c.1166G>A	c.(1165-1167)tGc>tAc	p.C389Y	PAPLN_ENST00000340738.5_Missense_Mutation_p.C362Y|PAPLN_ENST00000381166.3_Missense_Mutation_p.C389Y|PAPLN_ENST00000427855.1_Missense_Mutation_p.C389Y|PAPLN_ENST00000555445.1_Missense_Mutation_p.C389Y			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	389	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		TCCGTGTACTGCATCTCGTCT	0.672																																						dbGAP											0													49.0	51.0	51.0					14																	73720533		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1166G>A	14.37:g.73720533G>A	ENSP00000451803:p.Cys389Tyr		B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_inh_Kunz-m,pfam_PLAC,superfamily_Prot_inh_Kunz-m,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Prot_inh_Kunz-m,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,prints_Peptidase_M12B_ADAM-TS,prints_Prot_inh_Kunz-m,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like	p.C389Y	ENST00000554301.1	37	c.1166		14	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506143	0.64410	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	4.57	4.57	0.56435	.	.	.	.	.	D	0.89438	0.6715	H	0.98901	4.365	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.93991	0.7267	9	0.87932	D	0	.	17.5437	0.87855	0.0:0.0:1.0:0.0	.	389;389;362	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	Y	362;389;389;389;389	ENSP00000345395:C362Y;ENSP00000403403:C389Y;ENSP00000370558:C389Y;ENSP00000451803:C389Y;ENSP00000451729:C389Y	ENSP00000216658:C389Y	C	+	2	0	PAPLN	72790286	1.000000	0.71417	0.940000	0.37924	0.433000	0.31745	9.315000	0.96313	2.385000	0.81259	0.462000	0.41574	TGC	PAPLN	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000100767		0.672	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	PAPLN	HGNC	protein_coding	OTTHUMT00000413182.1	135	0.00	0	G	NM_173462		73720533	73720533	+1	no_errors	ENST00000427855	ensembl	human	known	69_37n	missense	64	28.09	25	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	119093538	119093538	+	Missense_Mutation	SNP	G	G	T	rs368875459		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:119093538G>T	ENST00000328252.3	+	11	3532	c.3163G>T	c.(3163-3165)Gtg>Ttg	p.V1055L	PAPPA_ENST00000534838.1_Missense_Mutation_p.V93L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1055					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1055L(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCGAACCAAGGTGATAGATCT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											100.0	92.0	95.0					9																	119093538		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3163G>T	9.37:g.119093538G>T	ENSP00000330658:p.Val1055Leu		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.V1055L	ENST00000328252.3	37	c.3163	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155461	0.38021	.	.	ENSG00000182752	ENST00000328252;ENST00000443904;ENST00000534838	T;T	0.03745	4.6;3.82	6.06	6.06	0.98353	.	0.050939	0.85682	D	0.000000	T	0.13157	0.0319	L	0.52011	1.625	0.80722	D	1	D;P;P	0.67145	0.996;0.934;0.925	D;P;P	0.77557	0.99;0.624;0.48	T	0.26189	-1.0110	10	0.11485	T	0.65	-16.8715	18.8014	0.92018	0.0:0.0:1.0:0.0	.	93;499;1055	F5GZ19;E7EMD3;Q13219	.;.;PAPP1_HUMAN	L	1055;499;93	ENSP00000330658:V1055L;ENSP00000441461:V93L	ENSP00000330658:V1055L	V	+	1	0	PAPPA	118133359	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.079000	0.89508	2.882000	0.98803	0.655000	0.94253	GTG	PAPPA	-	NULL	ENSG00000182752		0.418	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	49	0.00	0	G	NM_002581		119093538	119093538	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	1.000	T
PARPBP	55010	genome.wustl.edu	37	12	102517753	102517753	+	Silent	SNP	T	T	C	rs2036772	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr12:102517753T>C	ENST00000358383.5	+	2	132	c.87T>C	c.(85-87)acT>acC	p.T29T	PARPBP_ENST00000327680.2_5'UTR|PARPBP_ENST00000543784.1_Silent_p.T29T|PARPBP_ENST00000392911.2_5'UTR|PARPBP_ENST00000378128.3_Silent_p.T29T|PARPBP_ENST00000537257.1_Silent_p.T29T|PARPBP_ENST00000541394.1_Silent_p.T29T			Q9NWS1	PARI_HUMAN	PARP1 binding protein	29					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						CTGAGAGAACTACTCTATGTG	0.388													T|||	813	0.16234	0.0076	0.1427	5008	,	,		17886	0.2113		0.1799	False		,,,				2504	0.317					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.87T>C	12.37:g.102517753T>C			B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Silent	SNP	NULL	p.T29	ENST00000358383.5	37	c.87	CCDS9090.2	12																																																																																			PARPBP	-	NULL	ENSG00000185480		0.388	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	80	0.00	0	T	NM_017915		102517753	102517753	+1	no_errors	ENST00000358383	ensembl	human	known	69_37n	silent	33	10.26	4	SNP	0.794	C
PBX2P1	5088	genome.wustl.edu	37	3	142896705	142896705	+	RNA	SNP	T	T	G	rs7616505	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr3:142896705T>G	ENST00000560287.1	+	0	1579									pre-B-cell leukemia homeobox 2 pseudogene 1																		CCTCTCTCGCTTTCTTTCTTA	0.493													-|||	1515	0.302516	0.4871	0.1729	5008	,	,		16947	0.1667		0.1928	False		,,,				2504	0.3978					dbGAP											0																																										-	-	-			0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142896705T>G				RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.493	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	27	0.00	0	T	NG_002434		142896705	142896705	+1	no_errors	ENST00000560287	ensembl	human	known	69_37n	rna	9	25.00	3	SNP	0.227	G
PCBP1-AS1	400960	genome.wustl.edu	37	2	70223947	70223947	+	RNA	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:70223947C>T	ENST00000435880.2	-	0	724				PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000594376.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000601431.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000598586.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA	NR_033872.1				PCBP1 antisense RNA 1																		TGTCCCTAACCGGAGGTGCTG	0.493																																						dbGAP											0																																										-	-	-			0					2p13.3	2012-10-12	2012-08-15		ENSG00000179818	ENSG00000179818		"""Long non-coding RNAs"""	42948	non-coding RNA	RNA, long non-coding			"""PCBP1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033872		Approved		uc002sga.3		OTTHUMG00000153728		2.37:g.70223947C>T				RNA	SNP	-	NULL	ENST00000435880.2	37	NULL		2																																																																																			PCBP1-AS1	-	-	ENSG00000179818		0.493	PCBP1-AS1-001	KNOWN	basic	antisense	PCBP1-AS1	HGNC	antisense	OTTHUMT00000329414.2	102	0.00	0	C	NR_033872		70223947	70223947	-1	no_errors	ENST00000413436	ensembl	human	known	69_37n	rna	42	29.51	18	SNP	0.000	T
PCDH19	57526	genome.wustl.edu	37	X	99663147	99663147	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chrX:99663147A>G	ENST00000373034.4	-	1	2124	c.449T>C	c.(448-450)cTg>cCg	p.L150P	PCDH19_ENST00000255531.7_Missense_Mutation_p.L150P|PCDH19_ENST00000420881.2_Missense_Mutation_p.L150P	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	150	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGCGCTGTCCAGCGGGATGCG	0.622																																						dbGAP											0													80.0	79.0	79.0					X																	99663147		2120	4216	6336	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.449T>C	X.37:g.99663147A>G	ENSP00000362125:p.Leu150Pro		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L150P	ENST00000373034.4	37	c.449	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622047	0.66787	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.52754	0.65;0.65;0.65	5.7	5.7	0.88788	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000001	T	0.79799	0.4508	H	0.97516	4.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.87022	0.2129	10	0.87932	D	0	.	14.5681	0.68194	1.0:0.0:0.0:0.0	.	150;150;150	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	P	150	ENSP00000400327:L150P;ENSP00000362125:L150P;ENSP00000255531:L150P	ENSP00000255531:L150P	L	-	2	0	PCDH19	99549803	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	9.281000	0.95811	1.906000	0.55180	0.441000	0.28932	CTG	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165194		0.622	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	59	0.00	0	A	NM_020766		99663147	99663147	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	G
PCDHA1	56147	genome.wustl.edu	37	5	140167486	140167486	+	Silent	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:140167486G>A	ENST00000504120.2	+	1	1611	c.1611G>A	c.(1609-1611)gcG>gcA	p.A537A	PCDHA1_ENST00000378133.3_Silent_p.A537A|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	537	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGAGCGCGCGGGATGCGG	0.677																																						dbGAP											0													60.0	66.0	64.0					5																	140167486		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1611G>A	5.37:g.140167486G>A			O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A537	ENST00000504120.2	37	c.1611	CCDS54913.1	5																																																																																			PCDHA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204970		0.677	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	225	0.44	1	G	NM_018900		140167486	140167486	+1	no_errors	ENST00000504120	ensembl	human	known	69_37n	silent	72	30.77	32	SNP	0.022	A
PCDHB18	54660	genome.wustl.edu	37	5	140615269	140615269	+	RNA	SNP	A	A	G	rs2907307	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:140615269A>G	ENST00000526308.1	+	0	1332					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						ATGGGAGAACAGTTTGCTCAA	0.488													G|||	1161	0.231829	0.4773	0.1527	5008	,	,		16658	0.0942		0.162	False		,,,				2504	0.1697					dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615269A>G			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.488	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	86	0.00	0	A			140615269	140615269	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	0.000	G
PDE4DIP	9659	genome.wustl.edu	37	1	145039922	145039922	+	5'UTR	SNP	G	G	C	rs55747750	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:145039922G>C	ENST00000313382.9	-	0	80				PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000493130.2_5'Flank|PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000478649.2_5'Flank	NM_001198832.1	NP_001185761	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGCCCGGGCGGCGGTGCGCG	0.701			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000313382.9:c.-313C>G	1.37:g.145039922G>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000313382.9	37	NULL	CCDS55628.1	1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.701	PDE4DIP-001	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038856.2	10	0.00	0	G	NM_022359		145039922	145039922	-1	no_errors	ENST00000497529	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.016	C
PCNXL2	80003	genome.wustl.edu	37	1	233394471	233394471	+	Silent	SNP	C	C	T	rs549669481		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:233394471C>T	ENST00000258229.9	-	5	1371	c.1137G>A	c.(1135-1137)acG>acA	p.T379T	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	379						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TACTGCTCATCGTGATAACAA	0.493																																						dbGAP											0													78.0	78.0	78.0					1																	233394471		1941	4139	6080	-	-	-	SO:0001819	synonymous_variant	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1137G>A	1.37:g.233394471C>T			O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.T379	ENST00000258229.9	37	c.1137	CCDS44335.1	1																																																																																			PCNXL2	-	NULL	ENSG00000135749		0.493	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	94	0.00	0	C	NM_014801		233394471	233394471	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	silent	66	22.09	19	SNP	0.780	T
PDHA1	5160	genome.wustl.edu	37	X	19377881	19377881	+	3'UTR	SNP	C	C	T	rs709610	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chrX:19377881C>T	ENST00000422285.2	+	0	1388				PDHA1_ENST00000379804.1_3'UTR|PDHA1_ENST00000478795.1_3'UTR|PDHA1_ENST00000540249.1_3'UTR|MAP3K15_ENST00000518578.1_5'Flank|PDHA1_ENST00000545074.1_3'UTR|PDHA1_ENST00000379806.5_3'UTR			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1						acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					TTCTTGGAAACTTCCATTAAG	0.363													C|||	932	0.246887	0.559	0.072	3775	,	,		10295	0.005		0.0268	False		,,,				2504	0.1135					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.*110C>T	X.37:g.19377881C>T			A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	RNA	SNP	-	NULL	ENST00000422285.2	37	NULL	CCDS14192.1	X																																																																																			PDHA1	-	-	ENSG00000131828		0.363	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDHA1	HGNC	protein_coding	OTTHUMT00000055977.1	32	0.00	0	C			19377881	19377881	+1	no_errors	ENST00000478795	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	0.002	T
PDLIM5	10611	genome.wustl.edu	37	4	95505975	95505975	+	Intron	SNP	C	C	T	rs12639887	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr4:95505975C>T	ENST00000317968.4	+	6	846				PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000380180.3_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000542407.1_Intron|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000380176.3_3'UTR|PDLIM5_ENST00000514743.1_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5						regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ATCTGTGTTTCGTATGGCATA	0.313													C|||	2005	0.400359	0.0598	0.5259	5008	,	,		16167	0.4623		0.4394	False		,,,				2504	0.6677					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.711-741C>T	4.37:g.95505975C>T			A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	RNA	SNP	-	NULL	ENST00000317968.4	37	NULL	CCDS3641.1	4																																																																																			PDLIM5	-	-	ENSG00000163110		0.313	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	69	0.00	0	C			95505975	95505975	+1	no_errors	ENST00000380176	ensembl	human	known	69_37n	rna	58	12.12	8	SNP	0.000	T
PHC2	1912	genome.wustl.edu	37	1	33789520	33789520	+	3'UTR	SNP	C	C	A	rs5861	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:33789520C>A	ENST00000257118.5	-	0	3576				PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373422.3_3'UTR|PHC2_ENST00000431992.1_3'UTR|RP11-415J8.3_ENST00000588828.1_RNA|PHC2_ENST00000373418.3_3'UTR|RP11-415J8.3_ENST00000457957.2_RNA|A3GALT2_ENST00000442999.3_5'Flank|RP11-415J8.3_ENST00000587696.1_RNA	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)						multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TTCCCCTTAGCAGTTCTCTGA	0.562													A|||	3620	0.722843	0.8873	0.4885	5008	,	,		17144	0.751		0.6312	False		,,,				2504	0.7321					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.*946G>T	1.37:g.33789520C>A			A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	RNA	SNP	-	NULL	ENST00000257118.5	37	NULL	CCDS378.1	1																																																																																			PHC2	-	-	ENSG00000134686		0.562	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	18	0.00	0	C	NM_198040		33789520	33789520	-1	no_errors	ENST00000485928	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	71	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	41	38.81	26	SNP	1.000	A
PITPNM1	9600	genome.wustl.edu	37	11	67263648	67263648	+	Splice_Site	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:67263648C>T	ENST00000534749.1	-	14	2506		c.e14+1		PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000356404.3_Splice_Site|PITPNM1_ENST00000436757.2_Splice_Site			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1						brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TGGGGGCGTACCCAGCAGCAG	0.617																																					GBM(28;144 709 4607 5525)	dbGAP											0													28.0	30.0	29.0					11																	67263648		2199	4292	6491	-	-	-	SO:0001630	splice_region_variant	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2317+1G>A	11.37:g.67263648C>T			A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Splice_Site	SNP	-	e14+1	ENST00000534749.1	37	c.2317+1	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506445	0.44558	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7502	0.57304	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PITPNM1	67020224	1.000000	0.71417	1.000000	0.80357	0.359000	0.29487	7.574000	0.82434	2.471000	0.83476	0.561000	0.74099	.	PITPNM1	-	-	ENSG00000110697		0.617	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	56	0.00	0	C	NM_004910	Intron	67263648	67263648	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	splice_site	17	39.29	11	SNP	1.000	T
PLEKHA2	59339	genome.wustl.edu	37	8	38809739	38809739	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:38809739G>T	ENST00000521746.1	+	7	776	c.542G>T	c.(541-543)aGg>aTg	p.R181M	PLEKHA2_ENST00000420274.1_Missense_Mutation_p.R181M|PLEKHA2_ENST00000388745.4_3'UTR			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	181					positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			ATCCTTCGAAGGTCTCAGAGT	0.582																																						dbGAP											0													69.0	78.0	75.0					8																	38809739		2117	4221	6338	-	-	-	SO:0001583	missense	0			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.542G>T	8.37:g.38809739G>T	ENSP00000430938:p.Arg181Met			Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R181M	ENST00000521746.1	37	c.542		8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276657	0.80580	.	.	ENSG00000169499	ENST00000521746;ENST00000420274;ENST00000535929	T;T	0.11930	2.73;2.73	5.71	5.71	0.89125	.	0.048550	0.85682	D	0.000000	T	0.41880	0.1178	M	0.77313	2.365	0.54753	D	0.999989	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.993	T	0.23190	-1.0195	10	0.72032	D	0.01	.	18.6277	0.91347	0.0:0.0:1.0:0.0	.	181;181	Q9HB19;A8K727	PKHA2_HUMAN;.	M	181;181;131	ENSP00000430938:R181M;ENSP00000393860:R181M	ENSP00000393860:R181M	R	+	2	0	PLEKHA2	38928896	1.000000	0.71417	0.999000	0.59377	0.701000	0.40568	5.604000	0.67626	2.704000	0.92352	0.511000	0.50034	AGG	PLEKHA2	-	NULL	ENSG00000169499		0.582	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	HGNC	protein_coding	OTTHUMT00000377068.1	44	0.00	0	G	NM_021623		38809739	38809739	+1	no_errors	ENST00000420274	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
PLEKHH3	79990	genome.wustl.edu	37	17	40824270	40824270	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr17:40824270G>T	ENST00000591022.1	-	7	1297	c.910C>A	c.(910-912)Ctc>Atc	p.L304I	PLEKHH3_ENST00000412503.1_Missense_Mutation_p.L304I|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.L304I|PLEKHH3_ENST00000456950.2_Intron	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	304	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		TGCAGGAAGAGTTCATCCCGG	0.706																																						dbGAP											0													15.0	15.0	15.0					17																	40824270		2034	3954	5988	-	-	-	SO:0001583	missense	0			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.910C>A	17.37:g.40824270G>T	ENSP00000468678:p.Leu304Ile		C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_FERM_central,pfam_Ras-assoc,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.L304I	ENST00000591022.1	37	c.910	CCDS11434.1	17	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705983	0.68615	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	D;D	0.91011	-2.77;-2.77	5.41	5.41	0.78517	MyTH4 domain (2);	0.000000	0.44902	D	0.000410	T	0.79661	0.4484	N	0.10707	0.03	0.38976	D	0.958857	P;P	0.42296	0.734;0.775	B;B	0.43658	0.301;0.426	T	0.77542	-0.2549	10	0.08837	T	0.75	-14.9953	9.0602	0.36429	0.0:0.1368:0.6607:0.2025	.	304;304	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	I	304	ENSP00000293349:L304I;ENSP00000411885:L304I	ENSP00000293349:L304I	L	-	1	0	PLEKHH3	38077796	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.479000	0.35453	2.808000	0.96608	0.655000	0.94253	CTC	PLEKHH3	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000068137		0.706	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHH3	HGNC	protein_coding	OTTHUMT00000452332.1	70	0.00	0	G	NM_024927		40824270	40824270	-1	no_errors	ENST00000591022	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	T
ZNHIT1	10467	genome.wustl.edu	37	7	100861213	100861213	+	5'UTR	SNP	T	T	C	rs17319250	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr7:100861213T>C	ENST00000305105.2	+	0	265				PLOD3_ENST00000223127.3_5'Flank	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1						negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					TAAGATTTCTTGTAAGAACAC	0.488													C|||	1202	0.240016	0.233	0.2161	5008	,	,		16920	0.1746		0.2505	False		,,,				2504	0.3231					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.-264T>C	7.37:g.100861213T>C			Q6IB12	Missense_Mutation	SNP	NULL	p.Q13R	ENST00000305105.2	37	c.38	CCDS5716.1	7	490	0.22435897435897437	120	0.24390243902439024	91	0.2513812154696133	98	0.17132867132867133	181	0.23878627968337732	C	9.760	1.169774	0.21621	.	.	ENSG00000106397	ENST00000414785	T	0.14640	2.49	2.91	1.99	0.26369	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.51233	P	8.799999999997699E-5	.	.	.	.	.	.	T	0.44802	-0.9304	5	0.34782	T	0.22	.	4.6442	0.12563	0.0:0.6675:0.0:0.3325	rs17319250;rs59328141;rs17319250	.	.	.	R	13	ENSP00000407551:Q13R	ENSP00000407551:Q13R	Q	-	2	0	PLOD3	100647933	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.404000	0.20999	0.258000	0.21686	-0.355000	0.07637	CAA	PLOD3	-	NULL	ENSG00000106397		0.488	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347488.1	69	0.00	0	T	NM_006349		100861213	100861213	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000414785	ensembl	human	putative	69_37n	missense	29	12.12	4	SNP	0.000	C
POM121L1P	25812	genome.wustl.edu	37	22	22985443	22985443	+	RNA	SNP	G	G	C	rs71316770	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:22985443G>C	ENST00000402027.1	-	0	1501					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		GCAGCTGCAGGAGCAGAAGTG	0.627													.|||	728	0.145367	0.0893	0.072	5008	,	,		15954	0.1567		0.1918	False		,,,				2504	0.2137					dbGAP											0																																										-	-	-			0					22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22985443G>C				Missense_Mutation	SNP	NULL	p.P372A	ENST00000402027.1	37	c.1114		22	254	0.1163003663003663	39	0.07926829268292683	19	0.052486187845303865	73	0.12762237762237763	123	0.16226912928759896	G	6.200	0.405097	0.11754	.	.	ENSG00000183169	ENST00000402027	.	.	.	.	.	.	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.37524	P	0.08236100000000002	.	.	.	.	.	.	T	0.26815	-1.0092	2	0.09590	T	0.72	.	.	.	.	.	.	.	.	A	372	.	ENSP00000385643:P372A	P	-	1	0	POM121L1P	21315443	0.997000	0.39634	0.000000	0.03702	0.000000	0.00434	-0.180000	0.09754	-0.000000	0.14550	0.000000	0.15137	CCT	POM121L1P	-	NULL	ENSG00000183169		0.627	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	POM121L1P	HGNC	pseudogene	OTTHUMT00000468457.1	121	0.00	0	G	NR_024591		22985443	22985443	-1	no_errors	ENST00000402027	ensembl	human	putative	69_37n	missense	50	12.28	7	SNP	0.996	C
POMGNT1	55624	genome.wustl.edu	37	1	46657651	46657651	+	Intron	SNP	T	T	C	rs7521880	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:46657651T>C	ENST00000371984.3	-	17	1697				POMGNT1_ENST00000371986.3_Intron|POMGNT1_ENST00000535522.1_Intron|POMGNT1_ENST00000396420.3_Intron|POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000371992.1_Intron	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					aaaaataggatagctctttcc	0.502													T|||	1671	0.333666	0.3343	0.3963	5008	,	,		22022	0.1726		0.3549	False		,,,				2504	0.4325					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1539+118A>G	1.37:g.46657651T>C			D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	RNA	SNP	-	NULL	ENST00000371984.3	37	NULL	CCDS531.1	1																																																																																			POMGNT1	-	-	ENSG00000085998		0.502	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	47	0.00	0	T	NM_017739		46657651	46657651	-1	no_errors	ENST00000463030	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	C
PRDM13	59336	genome.wustl.edu	37	6	100062278	100062278	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:100062278G>T	ENST00000369215.4	+	4	2072	c.1767G>T	c.(1765-1767)aaG>aaT	p.K589N		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	589					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		ATGGGCTCAAGATCCACATGC	0.642																																						dbGAP											0													35.0	43.0	40.0					6																	100062278		2116	4226	6342	-	-	-	SO:0001583	missense	0			AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.1767G>T	6.37:g.100062278G>T	ENSP00000358217:p.Lys589Asn		Q5TGC1|Q5TGC2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.K599N	ENST00000369215.4	37	c.1797	CCDS43487.1	6	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403269	0.62288	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	T;T	0.08102	3.13;3.13	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000536	T	0.09774	0.0240	L	0.33137	0.985	0.48975	D	0.999733	D	0.89917	1.0	D	0.81914	0.995	T	0.01657	-1.1302	10	0.72032	D	0.01	-19.2196	7.967	0.30104	0.0827:0.0:0.7569:0.1604	.	589	Q9H4Q3	PRD13_HUMAN	N	589;599	ENSP00000358217:K589N;ENSP00000358216:K599N	ENSP00000358216:K599N	K	+	3	2	PRDM13	100168999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.824000	0.55723	2.463000	0.83235	0.561000	0.74099	AAG	PRDM13	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000112238		0.642	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM13	HGNC	protein_coding	OTTHUMT00000041619.2	92	0.00	0	G			100062278	100062278	+1	no_errors	ENST00000369214	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
PRR21	643905	genome.wustl.edu	37	2	240982116	240982116	+	Missense_Mutation	SNP	C	C	A	rs72993513	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:240982116C>A	ENST00000408934.1	-	1	283	c.284G>T	c.(283-285)cGg>cTg	p.R95L		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	95	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GACGAAGGGCCGTGGGTGAAG	0.617													-|||	1424	0.284345	0.357	0.196	5008	,	,		15582	0.2401		0.2823	False		,,,				2504	0.2965					dbGAP											0													105.0	100.0	102.0					2																	240982116		2135	4263	6398	-	-	-	SO:0001583	missense	0			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.284G>T	2.37:g.240982116C>A	ENSP00000386166:p.Arg95Leu			Missense_Mutation	SNP	NULL	p.R95L	ENST00000408934.1	37	c.284	CCDS33417.1	2	530	0.24267399267399267	149	0.30284552845528456	71	0.19613259668508287	115	0.20104895104895104	195	0.25725593667546176	-	8.811	0.935251	0.18206	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.28454	1.61;1.61	1.79	-2.88	0.05682	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.41041	0.736	B	0.40256	0.324	T	0.33059	-0.9883	8	0.49607	T	0.09	.	3.7903	0.08718	0.0:0.4733:0.1957:0.331	.	95	Q8WXC7	PRR21_HUMAN	L	95	ENSP00000386166:R95L;ENSP00000418240:R95L	ENSP00000386166:R95L	R	-	2	0	PRR21	240630789	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.289000	0.02780	-0.793000	0.04475	-0.438000	0.05819	CGG	PRR21	-	NULL	ENSG00000221961		0.617	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR21	HGNC	protein_coding		29	0.00	0	C	NM_001080835		240982116	240982116	-1	no_errors	ENST00000408934	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.000	A
PRRC2C	23215	genome.wustl.edu	37	1	171557613	171557613	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:171557613C>T	ENST00000338920.4	+	33	8399	c.8162C>T	c.(8161-8163)aCa>aTa	p.T2721I	PRRC2C_ENST00000367742.3_Missense_Mutation_p.T2723I|PRRC2C_ENST00000426496.2_Missense_Mutation_p.T2656I|PRRC2C_ENST00000392078.3_Missense_Mutation_p.T2723I	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2721					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GTGAGAATGACACAACCATTT	0.413																																						dbGAP											0													82.0	84.0	83.0					1																	171557613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.8162C>T	1.37:g.171557613C>T	ENSP00000343629:p.Thr2721Ile		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.T2723I	ENST00000338920.4	37	c.8168	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.05|16.05	3.013365|3.013365	0.54468|0.54468	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000495585|ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.|T;T;T;T	.|0.02525	.|4.33;4.27;4.26;4.26	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.896444	.|0.09056	.|N	.|0.855067	T|T	0.01454|0.01454	0.0047|0.0047	N|N	0.19112|0.19112	0.55|0.55	0.23298|0.23298	N|N	0.997951|0.997951	.|B;P	.|0.41188	.|0.023;0.741	.|B;B	.|0.39258	.|0.021;0.295	T|T	0.51474|0.51474	-0.8701|-0.8701	5|10	.|0.59425	.|D	.|0.04	.|.	16.0307|16.0307	0.80574|0.80574	0.0:0.8665:0.1335:0.0|0.0:0.8665:0.1335:0.0	.|.	.|2656;2721	.|B7WNZ6;Q9Y520-4	.|.;.	Y|I	1204|2723;2675;2656;2723;2721;2478	.|ENSP00000375928:T2723I;ENSP00000410219:T2656I;ENSP00000356716:T2723I;ENSP00000343629:T2721I	.|ENSP00000343629:T2721I	H|T	+|+	1|2	0|0	PRRC2C|PRRC2C	169824236|169824236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.484000|4.484000	0.60271|0.60271	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CAC|ACA	PRRC2C	-	NULL	ENSG00000117523		0.413	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	90	0.00	0	C	NM_015172		171557613	171557613	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	85	24.11	27	SNP	1.000	T
PRSS51	346702	genome.wustl.edu	37	8	10356183	10356183	+	RNA	SNP	C	C	T	rs12334382	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:10356183C>T	ENST00000523024.1	-	0	291				PRSS51_ENST00000521149.1_RNA					protease, serine, 51																		TAAGATTGAGCCTCCACAGAG	0.488													C|||	370	0.0738818	0.1543	0.0562	5008	,	,		21239	0.001		0.0934	False		,,,				2504	0.0327					dbGAP											0																																										-	-	-			0					8p23.1	2013-01-16			ENSG00000253649	ENSG00000253649			37321	other	unknown							Standard			Approved				OTTHUMG00000163805		8.37:g.10356183C>T				RNA	SNP	-	NULL	ENST00000523024.1	37	NULL		8																																																																																			PRSS51	-	-	ENSG00000253649		0.488	PRSS51-002	KNOWN	basic	antisense	PRSS51	HGNC	antisense	OTTHUMT00000375669.1	64	0.00	0	C			10356183	10356183	-1	no_errors	ENST00000523024	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	1.000	T
RBM14	10432	genome.wustl.edu	37	11	66384361	66384361	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:66384361G>T	ENST00000310137.4	+	1	309	c.170G>T	c.(169-171)gGc>gTc	p.G57V	RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.G57V|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.G57V|RBM14-RBM4_ENST00000511114.1_3'UTR|RBM14_ENST00000393979.3_Missense_Mutation_p.G57V|RBM14_ENST00000409372.1_Missense_Mutation_p.G57V|RBM4_ENST00000503028.2_5'UTR|RBM14_ENST00000409738.4_Missense_Mutation_p.G57V|RNU4-39P_ENST00000362455.1_RNA|RBM14_ENST00000443702.1_Missense_Mutation_p.G57V|RBM4_ENST00000514361.3_Missense_Mutation_p.G57V	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	57	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GCCCTGCACGGCCACGAGCTG	0.652																																						dbGAP											0													33.0	39.0	37.0					11																	66384361		2188	4281	6469	-	-	-	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.170G>T	11.37:g.66384361G>T	ENSP00000311747:p.Gly57Val		B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G57V	ENST00000310137.4	37	c.170	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220134	0.79464	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74	5.06	4.14	0.48551	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000001	T	0.60753	0.2293	H	0.95294	3.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.996;0.984	D;D;D;P	0.97110	1.0;1.0;0.979;0.899	T	0.71636	-0.4533	10	0.87932	D	0	-5.827	11.6351	0.51198	0.0903:0.0:0.9097:0.0	.	57;57;57;57	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	V	57	ENSP00000311747:G57V;ENSP00000377548:G57V;ENSP00000386518:G57V;ENSP00000414650:G57V;ENSP00000386995:G57V;ENSP00000388552:G57V;ENSP00000421279:G57V	ENSP00000311747:G57V	G	+	2	0	RBM14;RBM14-RBM4	66140937	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	4.435000	0.59941	2.367000	0.80283	0.462000	0.41574	GGC	RBM14	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000239306		0.652	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	73	0.00	0	G	NM_006328		66384361	66384361	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
RAD9A	5883	genome.wustl.edu	37	11	67165622	67165622	+	3'UTR	SNP	C	C	T	rs150420957	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr11:67165622C>T	ENST00000307980.2	+	0	1861				RAD9A_ENST00000535644.1_3'UTR|RNU6-1238P_ENST00000517215.1_RNA|PPP1CA_ENST00000532446.1_5'Flank	NM_001243224.1|NM_004584.2	NP_001230153.1|NP_004575.1	Q99638	RAD9A_HUMAN	RAD9 homolog A (S. pombe)						cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|enzyme binding (GO:0019899)|exodeoxyribonuclease III activity (GO:0008853)|histone deacetylase binding (GO:0042826)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			lung(7)|upper_aerodigestive_tract(1)	8			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			AGCTGCCAGGCAGTGTCTTAG	0.597								Other conserved DNA damage response genes					C|||	24	0.00479233	0.0	0.0043	5008	,	,		17325	0.0		0.0129	False		,,,				2504	0.0082					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U53174	CCDS8159.1	11q13.1-q13.2	2008-02-05	2003-07-21	2003-07-23	ENSG00000172613	ENSG00000172613			9827	protein-coding gene	gene with protein product		603761	"""RAD9 (S. pombe) homolog"""	RAD9		8943031	Standard	NM_004584		Approved		uc001okr.3	Q99638	OTTHUMG00000167670	ENST00000307980.2:c.*592C>T	11.37:g.67165622C>T			B2RCZ8|Q6FI29|Q96C41	RNA	SNP	-	NULL	ENST00000307980.2	37	NULL	CCDS8159.1	11																																																																																			RAD9A	-	-	ENSG00000172613		0.597	RAD9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD9A	HGNC	protein_coding	OTTHUMT00000395481.2	67	0.00	0	C	NM_004584		67165622	67165622	+1	no_errors	ENST00000535644	ensembl	human	known	69_37n	rna	57	12.31	8	SNP	0.180	T
RFPL2	10739	genome.wustl.edu	37	22	32587023	32587023	+	Silent	SNP	C	C	G	rs55974778	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:32587023C>G	ENST00000400237.1	-	5	1808	c.873G>C	c.(871-873)acG>acC	p.T291T	RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Silent_p.T230T|RFPL2_ENST00000248983.4_Silent_p.T201T|RFPL2_ENST00000400236.3_Silent_p.T201T			O75678	RFPL2_HUMAN	ret finger protein-like 2	291	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TCAGCGGCACCGTGGTGGCAG	0.527													.|||	2424	0.484026	0.8631	0.3804	5008	,	,		19287	0.1498		0.493	False		,,,				2504	0.3804					dbGAP											0													45.0	68.0	60.0					22																	32587023		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.873G>C	22.37:g.32587023C>G				Silent	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.T291	ENST00000400237.1	37	c.873	CCDS43009.2	22																																																																																			RFPL2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000128253		0.527	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	212	0.47	1	C	NM_006605		32587023	32587023	-1	no_errors	ENST00000400237	ensembl	human	known	69_37n	silent	83	13.54	13	SNP	0.003	G
RFPL4A	342931	genome.wustl.edu	37	19	56274213	56274213	+	Missense_Mutation	SNP	T	T	A	rs147035425	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:56274213T>A	ENST00000434937.2	+	3	707	c.536T>A	c.(535-537)gTg>gAg	p.V179E		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	179	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GGGAAGATTGTGCTTTCTTCA	0.562																																						dbGAP											0													77.0	63.0	67.0					19																	56274213		682	1500	2182	-	-	-	SO:0001583	missense	0				CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.536T>A	19.37:g.56274213T>A	ENSP00000392936:p.Val179Glu			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.V179E	ENST00000434937.2	37	c.536	CCDS46201.1	19	.	.	.	.	.	.	.	.	.	.	t	0	-2.587598	0.00128	.	.	ENSG00000223638	ENST00000434937	T	0.68025	-0.3	2.64	-5.28	0.02755	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.47340	0.1440	L	0.48986	1.54	0.09310	N	1	B	0.12630	0.006	B	0.17433	0.018	T	0.42413	-0.9453	9	0.02654	T	1	-32.2432	4.0023	0.09585	0.6027:0.0836:0.1858:0.1278	.	179	A6NLU0	RFPLA_HUMAN	E	179	ENSP00000392936:V179E	ENSP00000392936:V179E	V	+	2	0	RFPL4A	60966025	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.893000	0.00708	-5.132000	0.00021	-3.038000	0.00071	GTG	RFPL4A	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000223638		0.562	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RFPL4A	HGNC	protein_coding	OTTHUMT00000384184.1	51	0.00	0	T	XM_292796		56274213	56274213	+1	no_errors	ENST00000434937	ensembl	human	novel	69_37n	missense	19	13.64	3	SNP	0.000	A
C15orf52	388115	genome.wustl.edu	37	15	40623824	40623824	+	IGR	SNP	A	A	G	rs1129264	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr15:40623824A>G	ENST00000559313.1	-	0	3022				RNA5SP392_ENST00000516905.1_RNA|C15orf52_ENST00000397536.2_3'UTR	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52								poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		gagattaggcacgttcagggt	0.463													G|||	3146	0.628195	0.7269	0.5764	5008	,	,		18737	0.8611		0.333	False		,,,				2504	0.5951					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981		15.37:g.40623824A>G			B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	RNA	SNP	-	NULL	ENST00000559313.1	37	NULL	CCDS10055.2	15																																																																																			RNA5SP392	-	-	ENSG00000252714		0.463	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNA5SP392	HGNC	protein_coding	OTTHUMT00000319567.2	26	0.00	0	A	NM_207380		40623824	40623824	-1	no_errors	ENST00000516905	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.000	G
LRRC23	10233	genome.wustl.edu	37	12	6993653	6993653	+	Intron	SNP	G	G	A	rs2269359	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr12:6993653G>A	ENST00000433346.1	+	2	429				RPL13P5_ENST00000412023.1_RNA|SPSB2_ENST00000437851.1_Intron|DSTNP2_ENST00000602547.1_RNA|LRRC23_ENST00000449039.1_Intron			Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23											NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						CAGAGTCATCGCTGACTAGGA	0.502													A|||	1931	0.385583	0.6641	0.2723	5008	,	,		19904	0.2242		0.3032	False		,,,				2504	0.3405					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000433346.1:c.-50+570G>A	12.37:g.6993653G>A			A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	RNA	SNP	-	NULL	ENST00000433346.1	37	NULL		12																																																																																			RPL13P5	-	-	ENSG00000240370		0.502	LRRC23-011	PUTATIVE	basic	protein_coding	RPL13P5	HGNC	protein_coding	OTTHUMT00000345224.1	29	0.00	0	G	NM_006992		6993653	6993653	+1	no_errors	ENST00000412023	ensembl	human	known	69_37n	rna	20	23.08	6	SNP	1.000	A
SECISBP2	79048	genome.wustl.edu	37	9	91965711	91965711	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr9:91965711T>C	ENST00000375807.3	+	14	2128	c.2057T>C	c.(2056-2058)cTc>cCc	p.L686P	SECISBP2_ENST00000339901.4_Missense_Mutation_p.L613P|SECISBP2_ENST00000534113.2_Missense_Mutation_p.L618P	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	686	RNA-binding. {ECO:0000255}.				translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CACCTGAAGCTCAAAAAACTG	0.463																																						dbGAP											0													123.0	117.0	119.0					9																	91965711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.2057T>C	9.37:g.91965711T>C	ENSP00000364965:p.Leu686Pro		F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.L686P	ENST00000375807.3	37	c.2057	CCDS6683.1	9	.	.	.	.	.	.	.	.	.	.	T	21.8	4.195986	0.78902	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.76578	-1.03;-1.03;-1.03	4.84	4.84	0.62591	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	D	0.88040	0.6330	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.89706	0.3908	10	0.72032	D	0.01	-15.1467	14.8721	0.70465	0.0:0.0:0.0:1.0	.	693;613;686	Q59H19;Q96T21-2;Q96T21	.;.;SEBP2_HUMAN	P	686;692;613;618	ENSP00000364965:L686P;ENSP00000364959:L613P;ENSP00000436650:L618P	ENSP00000364959:L613P	L	+	2	0	SECISBP2	91155531	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.519000	0.81809	2.169000	0.68431	0.459000	0.35465	CTC	SECISBP2	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	ENSG00000187742		0.463	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	HGNC	protein_coding	OTTHUMT00000052990.3	70	0.00	0	T	NM_024077		91965711	91965711	+1	no_errors	ENST00000375807	ensembl	human	known	69_37n	missense	25	30.77	12	SNP	1.000	C
SERINC5	256987	genome.wustl.edu	37	5	79439630	79439630	+	Intron	SNP	G	G	A	rs12652646	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:79439630G>A	ENST00000507668.2	-	11	1389				SERINC5_ENST00000509193.1_Intron|CTC-458I2.2_ENST00000511484.1_RNA|SERINC5_ENST00000512721.1_Silent_p.Y414Y|SERINC5_ENST00000512972.2_Intron	NM_001174071.1|NM_178276.5	NP_001167542.1|NP_840060.1	Q86VE9	SERC5_HUMAN	serine incorporator 5						myelination (GO:0042552)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(3)|kidney(1)|lung(3)|ovary(1)	8		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		TGGCACTTTCGTAGCTGTGGA	0.463													G|||	638	0.127396	0.0386	0.0994	5008	,	,		16478	0.2659		0.1103	False		,,,				2504	0.1421					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF498273	CCDS54874.1	5q14.1	2014-01-28	2005-10-14	2005-10-14		ENSG00000164300			18825	protein-coding gene	gene with protein product		614551	"""chromosome 5 open reading frame 12"""	C5orf12		12688535	Standard	NM_178276		Approved	TPO1	uc011ctj.2	Q86VE9		ENST00000507668.2:c.1238+2282C>T	5.37:g.79439630G>A			B4DMH7|Q495A4|Q495A6	Silent	SNP	pfam_TMS_TDE	p.Y414	ENST00000507668.2	37	c.1242	CCDS54873.1	5																																																																																			SERINC5	-	pfam_TMS_TDE	ENSG00000164300		0.463	SERINC5-201	KNOWN	basic|CCDS	protein_coding	SERINC5	HGNC	protein_coding		29	0.00	0	G	NM_178276		79439630	79439630	-1	no_errors	ENST00000512721	ensembl	human	novel	69_37n	silent	18	18.18	4	SNP	0.984	A
SH3BP4	23677	genome.wustl.edu	37	2	235951482	235951482	+	Missense_Mutation	SNP	G	G	T	rs376165917		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:235951482G>T	ENST00000409212.1	+	4	2576	c.2069G>T	c.(2068-2070)cGg>cTg	p.R690L	SH3BP4_ENST00000392011.2_Missense_Mutation_p.R690L|SH3BP4_ENST00000344528.4_Missense_Mutation_p.R690L			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	690					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.R690Q(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		AGCGAGGAGCGGGTCAGGCTC	0.612																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											48.0	48.0	48.0					2																	235951482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.2069G>T	2.37:g.235951482G>T	ENSP00000386862:p.Arg690Leu		O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_ZU5,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.R690L	ENST00000409212.1	37	c.2069	CCDS2513.1	2	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624576	0.28889	.	.	ENSG00000130147	ENST00000392011;ENST00000409212;ENST00000344528	T;T;T	0.08008	3.14;3.14;3.14	5.26	4.24	0.50183	Variant SH3 (1);	0.103551	0.64402	D	0.000004	T	0.03434	0.0099	N	0.08118	0	0.37624	D	0.921412	P;P	0.37781	0.608;0.608	B;B	0.31495	0.131;0.131	T	0.48080	-0.9066	10	0.62326	D	0.03	-19.4125	4.0672	0.09866	0.7589:0.0:0.2411:0.0	.	690;690	A8K594;Q9P0V3	.;SH3B4_HUMAN	L	690	ENSP00000375867:R690L;ENSP00000386862:R690L;ENSP00000340237:R690L	ENSP00000340237:R690L	R	+	2	0	SH3BP4	235616221	1.000000	0.71417	0.800000	0.32199	0.525000	0.34531	4.237000	0.58681	1.048000	0.40298	0.655000	0.94253	CGG	SH3BP4	-	pfam_SH3_2	ENSG00000130147		0.612	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	HGNC	protein_coding	OTTHUMT00000329763.1	35	0.00	0	G			235951482	235951482	+1	no_errors	ENST00000344528	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	1.000	T
SIGLEC16	400709	genome.wustl.edu	37	19	50472930	50472930	+	RNA	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:50472930C>T	ENST00000602139.1	+	0	1							A6NMB1	SIG16_HUMAN	sialic acid binding Ig-like lectin 16 (gene/pseudogene)						cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|lung(6)	10						CAGATGGTCCCGGGACAGGCC	0.701																																						dbGAP											0																																										-	-	-			0			BC030222		19q13.33	2014-03-20	2008-08-04	2008-08-04	ENSG00000161643	ENSG00000161643		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24851	protein-coding gene	gene with protein product			"""sialic acid binding Ig-like lectin, pseudogene 16"""	SIGLECP16		11986327, 18629938	Standard	NR_002825		Approved	Siglec-P16	uc002prf.3	A6NMB1	OTTHUMG00000183074		19.37:g.50472930C>T				Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P3L	ENST00000602139.1	37	c.8		19	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.230295	0.00280	.	.	ENSG00000161643	ENST00000417280	.	.	.	1.64	-2.51	0.06365	.	.	.	.	.	T	0.12092	0.0294	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31138	-0.9954	5	0.02654	T	1	.	6.7156	0.23302	0.0:0.4176:0.0:0.5824	.	.	.	.	L	3	.	ENSP00000396157:P3L	P	+	2	0	SIGLEC16	55164742	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.398000	0.00484	-1.103000	0.03019	-1.917000	0.00517	CCG	SIGLEC16	-	NULL	ENSG00000161643		0.701	SIGLEC16-001	KNOWN	basic	processed_transcript	SIGLEC16	HGNC	pseudogene	OTTHUMT00000464979.1	31	0.00	0	C	NR_002825		50472930	50472930	+1	no_stop_codon	ENST00000417280	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45242260	45242260	+	Silent	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr20:45242260G>A	ENST00000279027.4	-	2	234	c.216C>T	c.(214-216)ttC>ttT	p.F72F	SLC13A3_ENST00000290317.5_Silent_p.F25F|SLC13A3_ENST00000495082.1_Silent_p.F25F|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000417157.2_Silent_p.F25F|SLC13A3_ENST00000396360.1_Silent_p.F25F|SLC13A3_ENST00000472148.1_Silent_p.F25F|SLC13A3_ENST00000413164.2_Silent_p.F72F|SLC13A3_ENST00000372121.1_Silent_p.F72F|SLC13A3_ENST00000339636.3_Silent_p.F72F	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	72					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	AGATGCCCATGAAGGGGAAGA	0.607																																						dbGAP											0													72.0	53.0	59.0					20																	45242260		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.216C>T	20.37:g.45242260G>A			B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.F72	ENST00000279027.4	37	c.216	CCDS13400.1	20																																																																																			SLC13A3	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000158296		0.607	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	46	0.00	0	G			45242260	45242260	-1	no_errors	ENST00000279027	ensembl	human	known	69_37n	silent	32	19.51	8	SNP	0.890	A
SLC35F5	80255	genome.wustl.edu	37	2	114483094	114483094	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:114483094G>T	ENST00000245680.2	-	12	1524	c.1111C>A	c.(1111-1113)Ctg>Atg	p.L371M	SLC35F5_ENST00000470204.2_5'UTR	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	371	Poly-Leu.				transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						AAGAGCAGCAGATTAAACAAA	0.294																																						dbGAP											0													69.0	70.0	69.0					2																	114483094		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.1111C>A	2.37:g.114483094G>T	ENSP00000245680:p.Leu371Met		Q9H6P8|Q9H7D8	Missense_Mutation	SNP	pfam_DMT	p.L371M	ENST00000245680.2	37	c.1111	CCDS2119.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.51|15.51	2.854848|2.854848	0.51376|0.51376	.|.	.|.	ENSG00000115084|ENSG00000115084	ENST00000245680;ENST00000409106|ENST00000447673	T;T|.	0.55052|.	0.54;0.55|.	5.95|5.95	3.14|3.14	0.36123|0.36123	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.54549|0.54549	0.1865|0.1865	L|L	0.42632|0.42632	1.34|1.34	0.80722|0.80722	D|D	1|1	P|.	0.47841|.	0.901|.	B|.	0.40825|.	0.341|.	T|T	0.43360|0.43360	-0.9396|-0.9396	10|5	0.51188|.	T|.	0.08|.	-8.237|-8.237	9.6476|9.6476	0.39877|0.39877	0.2849:0.0:0.7151:0.0|0.2849:0.0:0.7151:0.0	.|.	371|.	Q8WV83|.	S35F5_HUMAN|.	M|Y	371;365|133	ENSP00000245680:L371M;ENSP00000386754:L365M|.	ENSP00000245680:L371M|.	L|S	-|-	1|2	2|0	SLC35F5|SLC35F5	114199564|114199564	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	3.653000|3.653000	0.54446|0.54446	0.388000|0.388000	0.25054|0.25054	0.563000|0.563000	0.77884|0.77884	CTG|TCT	SLC35F5	-	NULL	ENSG00000115084		0.294	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F5	HGNC	protein_coding	OTTHUMT00000254150.1	35	0.00	0	G	NM_025181		114483094	114483094	-1	no_errors	ENST00000245680	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
SLC39A14	23516	genome.wustl.edu	37	8	22272415	22272415	+	Splice_Site	SNP	G	G	C			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:22272415G>C	ENST00000381237.1	+	5	869	c.750G>C	c.(748-750)gaG>gaC	p.E250D	SLC39A14_ENST00000289952.5_Splice_Site_p.E250D|SLC39A14_ENST00000359741.5_Splice_Site_p.E250D|SLC39A14_ENST00000240095.6_Splice_Site_p.E250D	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	250					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		AGAAAAATGAGGTGAGGCCCA	0.408																																						dbGAP											0													62.0	61.0	61.0					8																	22272415		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.750+1G>C	8.37:g.22272415G>C			A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	pfam_ZIP	p.E250D	ENST00000381237.1	37	c.750	CCDS47823.1	8	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470839	0.63625	.	.	ENSG00000104635	ENST00000359741;ENST00000240095;ENST00000381237;ENST00000289952;ENST00000517370	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.66	5.66	0.87406	.	0.660393	0.17117	N	0.186384	T	0.45756	0.1358	N	0.22421	0.69	0.51482	D	0.99992	P;P;P	0.41080	0.551;0.607;0.737	B;B;P	0.46685	0.268;0.395;0.524	T	0.28839	-1.0031	10	0.32370	T	0.25	-26.4113	18.5343	0.91004	0.0:0.0:1.0:0.0	.	250;250;250	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	D	250;250;250;250;73	ENSP00000352779:E250D;ENSP00000240095:E250D;ENSP00000370635:E250D;ENSP00000289952:E250D;ENSP00000427981:E73D	ENSP00000240095:E250D	E	+	3	2	SLC39A14	22328360	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.583000	0.74053	2.653000	0.90120	0.563000	0.77884	GAG	SLC39A14	-	pfam_ZIP	ENSG00000104635		0.408	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A14	HGNC	protein_coding	OTTHUMT00000215039.2	99	0.00	0	G	XM_046677	Missense_Mutation	22272415	22272415	+1	no_errors	ENST00000359741	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	1.000	C
SOS2	6655	genome.wustl.edu	37	14	50623685	50623685	+	Intron	SNP	A	A	G	rs553167605	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr14:50623685A>G	ENST00000216373.5	-	12	2332				SOS2_ENST00000555794.1_5'UTR|SOS2_ENST00000543680.1_Intron	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)						apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					atatgtgtatatatatatata	0.313													A|||	524	0.104633	0.2716	0.0778	5008	,	,		11444	0.0		0.0934	False		,,,				2504	0.0174					dbGAP											0													11.0	10.0	11.0					14																	50623685		1796	3374	5170	-	-	-	SO:0001627	intron_variant	0			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2057+31T>C	14.37:g.50623685A>G			B7ZKT6|D3DSB4|Q15503|Q17RN1	RNA	SNP	-	NULL	ENST00000216373.5	37	NULL	CCDS9697.1	14																																																																																			SOS2	-	-	ENSG00000100485		0.313	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	156	0.64	1	A			50623685	50623685	-1	no_errors	ENST00000555794	ensembl	human	known	69_37n	rna	52	10.34	6	SNP	0.002	G
SPRED2	200734	genome.wustl.edu	37	2	65561392	65561392	+	Intron	SNP	C	C	T	rs4671658	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:65561392C>T	ENST00000356388.4	-	3	563				SPRED2_ENST00000474228.1_5'UTR|SPRED2_ENST00000443619.2_Intron	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2						inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						AGAATCCATTCTCTACTTCTG	0.507													C|||	1798	0.359026	0.0598	0.3919	5008	,	,		18575	0.6796		0.2982	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.373+346G>A	2.37:g.65561392C>T			A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	pfam_EVH1,pfscan_EVH1	p.E86	ENST00000356388.4	37	c.258	CCDS33211.1	2																																																																																			SPRED2	-	NULL	ENSG00000198369		0.507	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	HGNC	protein_coding	OTTHUMT00000327632.1	25	0.00	0	C			65561392	65561392	-1	no_start_codon	ENST00000426832	ensembl	human	known	69_37n	silent	29	17.14	6	SNP	0.254	T
NPEPL1	79716	genome.wustl.edu	37	20	57266134	57266134	+	5'Flank	SNP	G	G	A	rs6015338	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr20:57266134G>A	ENST00000356091.6	+	0	0				STX16-NPEPL1_ENST00000530122.1_Silent_p.L306L|NPEPL1_ENST00000525817.1_Intron|NPEPL1_ENST00000525967.1_Intron	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			ctcttcgcctgtggaagtcct	0.532													G|||	979	0.195487	0.4811	0.1383	5008	,	,		17173	0.0357		0.1143	False		,,,				2504	0.0982					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060		20.37:g.57266134G>A	Exception_encountered		A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L306	ENST00000356091.6	37	c.918	CCDS46621.1	20																																																																																			STX16-NPEPL1	-	NULL	ENSG00000254995		0.532	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX16-NPEPL1	HGNC	protein_coding	OTTHUMT00000080402.6	65	0.00	0	G	NM_024663		57266134	57266134	+1	no_errors	ENST00000530122	ensembl	human	known	69_37n	silent	48	11.11	6	SNP	0.019	A
TDH	157739	genome.wustl.edu	37	8	11222474	11222474	+	RNA	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:11222474G>A	ENST00000534302.1	+	0	891									L-threonine dehydrogenase (pseudogene)																		CACATACAACGTGGATGCCGT	0.547																																						dbGAP											0																																										-	-	-			0			AJ301562		8p23.1	2013-09-26	2013-09-26		ENSG00000154316	ENSG00000154316		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	15547	pseudogene	pseudogene	"""short chain dehydrogenase/reductase family 14E, member 1 (pseudogene)"""	615174	"""L-threonine dehydrogenase"""			11896452, 12361482, 19027726	Standard	NR_001578		Approved	FLJ25033, SDR14E1P	uc003wtq.1	Q8IZJ6	OTTHUMG00000165365		8.37:g.11222474G>A				RNA	SNP	-	NULL	ENST00000534302.1	37	NULL		8																																																																																			TDH	-	-	ENSG00000154316		0.547	TDH-002	KNOWN	basic	processed_transcript	TDH	HGNC	pseudogene	OTTHUMT00000385807.1	63	0.00	0	G	NM_152566		11222474	11222474	+1	no_errors	ENST00000525246	ensembl	human	known	69_37n	rna	26	31.58	12	SNP	0.974	A
THNSL2	55258	genome.wustl.edu	37	2	88482535	88482535	+	Silent	SNP	C	C	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:88482535C>T	ENST00000324166.5	+	6	2711	c.1020C>T	c.(1018-1020)ctC>ctT	p.L340L	THNSL2_ENST00000377254.3_Silent_p.L340L|THNSL2_ENST00000343544.4_Silent_p.L340L|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000358591.2_Silent_p.L340L|THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000402102.1_Silent_p.L340L	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	340					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CAAGAGCCCTCATGGAGCAGT	0.532																																						dbGAP											0													83.0	76.0	78.0					2																	88482535		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1020C>T	2.37:g.88482535C>T			B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Silent	SNP	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	p.L340	ENST00000324166.5	37	c.1020	CCDS2002.2	2																																																																																			THNSL2	-	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000144115		0.532	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	95	0.00	0	C	NM_018271		88482535	88482535	+1	no_errors	ENST00000324166	ensembl	human	known	69_37n	silent	31	29.55	13	SNP	1.000	T
THOC2	57187	genome.wustl.edu	37	X	122766800	122766800	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chrX:122766800C>A	ENST00000245838.8	-	21	2259	c.2228G>T	c.(2227-2229)tGt>tTt	p.C743F	THOC2_ENST00000355725.4_Missense_Mutation_p.C743F|THOC2_ENST00000491737.1_Missense_Mutation_p.C628F	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	743					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CATAAGCAGACAGAGAGGAAG	0.428																																						dbGAP											0													163.0	135.0	144.0					X																	122766800		1863	4093	5956	-	-	-	SO:0001583	missense	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2228G>T	X.37:g.122766800C>A	ENSP00000245838:p.Cys743Phe		A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.C743F	ENST00000245838.8	37	c.2228	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	C	17.02	3.282801	0.59867	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.68979	0.3060	M	0.64676	1.99	0.80722	D	1	B;B	0.29552	0.121;0.248	B;B	0.34093	0.068;0.175	T	0.67593	-0.5631	9	0.48119	T	0.1	-9.4338	18.9144	0.92499	0.0:1.0:0.0:0.0	.	668;743	B4DKZ6;Q8NI27	.;THOC2_HUMAN	F	743;743;628;668	.	ENSP00000245838:C743F	C	-	2	0	THOC2	122594481	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.802000	0.85969	2.414000	0.81942	0.538000	0.68166	TGT	THOC2	-	NULL	ENSG00000125676		0.428	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	89	0.00	0	C			122766800	122766800	-1	no_errors	ENST00000245838	ensembl	human	known	69_37n	missense	44	39.73	29	SNP	1.000	A
TMEM247	388946	genome.wustl.edu	37	2	46707884	46707884	+	Missense_Mutation	SNP	A	A	G	rs201742486		TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr2:46707884A>G	ENST00000434431.1	+	2	458	c.458A>G	c.(457-459)cAa>cGa	p.Q153R		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	153						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CAGCTGCAGCAAGAGGCGGCG	0.677																																						dbGAP											0													16.0	21.0	19.0					2																	46707884		690	1589	2279	-	-	-	SO:0001583	missense	0				CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.458A>G	2.37:g.46707884A>G	ENSP00000388684:p.Gln153Arg			Missense_Mutation	SNP	NULL	p.Q153R	ENST00000434431.1	37	c.458	CCDS56117.1	2	.	.	.	.	.	.	.	.	.	.	A	0.156	-1.086034	0.01873	.	.	ENSG00000187600	ENST00000434431	.	.	.	2.03	0.734	0.18294	.	.	.	.	.	T	0.12987	0.0315	N	0.08118	0	.	.	.	B	0.10296	0.003	B	0.06405	0.002	T	0.33599	-0.9862	7	0.07175	T	0.84	.	2.5803	0.04816	0.5369:0.2887:0.1744:0.0	.	153	A6NEH6	YB028_HUMAN	R	153	.	ENSP00000388684:Q153R	Q	+	2	0	AC018682.6	46561388	0.002000	0.14202	0.158000	0.22627	0.001000	0.01503	-0.138000	0.10374	0.052000	0.16007	-0.609000	0.04063	CAA	TMEM247	-	NULL	ENSG00000187600		0.677	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	TMEM247	HGNC	protein_coding	OTTHUMT00000329726.1	25	0.00	0	A	NM_001145051		46707884	46707884	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000434431	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.238	G
TNFRSF14	8764	genome.wustl.edu	37	1	2494785	2494785	+	3'UTR	SNP	G	G	A	rs8725	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr1:2494785G>A	ENST00000355716.4	+	0	1224					NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14						cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		CCACCTGGCGGAACCACCGGA	0.677			"""Mis, N, F"""		follicular lymphoma								G|||	3165	0.631989	0.7776	0.5591	5008	,	,		15061	0.5734		0.493	False		,,,				2504	0.6902					dbGAP		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.*73G>A	1.37:g.2494785G>A			B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	RNA	SNP	-	NULL	ENST00000355716.4	37	NULL	CCDS44046.1	1																																																																																			TNFRSF14	-	-	ENSG00000157873		0.677	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF14	HGNC	protein_coding	OTTHUMT00000002088.1	17	0.00	0	G			2494785	2494785	+1	no_errors	ENST00000480305	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.000	A
TTC3	7267	genome.wustl.edu	37	21	38460338	38460338	+	Intron	SNP	T	T	A	rs2835584	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr21:38460338T>A	ENST00000399017.2	+	4	2934				TTC3_ENST00000355666.1_Intron|TTC3_ENST00000479930.1_Intron|TTC3_ENST00000354749.2_Intron|TTC3_ENST00000399010.1_Intron|TTC3_ENST00000540756.1_Intron	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				ATAGAGTTTTTGCCAGCACTT	0.289													A|||	2036	0.40655	0.3608	0.3818	5008	,	,		15909	0.379		0.5258	False		,,,				2504	0.3916				Ovarian(38;194 1649 35661)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.188-158T>A	21.37:g.38460338T>A			A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	RNA	SNP	-	NULL	ENST00000399017.2	37	NULL	CCDS13651.1	21																																																																																			TTC3	-	-	ENSG00000182670		0.289	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	31	0.00	0	T			38460338	38460338	+1	no_errors	ENST00000484047	ensembl	human	known	69_37n	rna	18	17.39	4	SNP	0.001	A
UBL5	59286	genome.wustl.edu	37	19	9939519	9939519	+	Silent	SNP	G	G	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:9939519G>A	ENST00000358666.3	+	4	331	c.147G>A	c.(145-147)acG>acA	p.T49T	UBL5_ENST00000586895.1_Silent_p.T49T|UBL5_ENST00000593087.1_Missense_Mutation_p.R20Q|UBL5_ENST00000590068.1_Silent_p.T49T|UBL5_ENST00000589960.1_Intron|FBXL12_ENST00000585379.1_5'Flank	NM_024292.3	NP_077268.1	Q9BZL1	UBL5_HUMAN	ubiquitin-like 5	49	Ubiquitin-like.					cytoplasm (GO:0005737)				kidney(1)|lung(1)	2						TTAGGTACACGATTTTTAAGG	0.458																																						dbGAP											0													187.0	169.0	175.0					19																	9939519		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12219.1	19p13.2	2012-11-23			ENSG00000198258	ENSG00000198258			13736	protein-coding gene	gene with protein product		606849					Standard	NM_024292		Approved		uc002mmi.2	Q9BZL1	OTTHUMG00000180214	ENST00000358666.3:c.147G>A	19.37:g.9939519G>A			Q2NL89	Missense_Mutation	SNP	NULL	p.R20Q	ENST00000358666.3	37	c.59	CCDS12219.1	19																																																																																			UBL5	-	NULL	ENSG00000198258		0.458	UBL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL5	HGNC	protein_coding	OTTHUMT00000450279.1	99	0.00	0	G	NM_024292		9939519	9939519	+1	no_errors	ENST00000593087	ensembl	human	putative	69_37n	missense	41	39.71	27	SNP	0.994	A
UPF3B	65109	genome.wustl.edu	37	X	118975127	118975129	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chrX:118975127_118975129delTCT	ENST00000276201.2	-	7	786_788	c.717_719delAGA	c.(715-720)gaagag>gag	p.239_240EE>E	UPF3B_ENST00000345865.2_In_Frame_Del_p.239_240EE>E|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	239	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						ttttcgtttctcttcttctttcc	0.34																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.717_719delAGA	X.37:g.118975133_118975135delTCT	ENSP00000276201:p.Glu240del		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	In_Frame_Del	DEL	pfam_Nonsense_mediated_decay_UPF3	p.E240in_frame_del	ENST00000276201.2	37	c.719_717	CCDS14588.1	X																																																																																			UPF3B	-	NULL	ENSG00000125351		0.340	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	160	0.00	0	TCT			118975127	118975129	-1	no_errors	ENST00000276201	ensembl	human	known	69_37n	in_frame_del	95	21.49	26	DEL	1.000:0.998:0.916	-
USP41	373856	genome.wustl.edu	37	22	20723832	20723832	+	Missense_Mutation	SNP	T	T	C	rs75178771	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:20723832T>C	ENST00000454608.2	-	8	513	c.514A>G	c.(514-516)Atg>Gtg	p.M172V	USP41_ENST00000486536.2_5'UTR			Q3LFD5	UBP41_HUMAN	ubiquitin specific peptidase 41	172	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(1)|kidney(1)|lung(2)|skin(1)	5						GAGTCCTTCATCCGGATCATA	0.532													T|||	74	0.0147764	0.025	0.0115	5008	,	,		17082	0.0		0.0298	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ586979		22q11.22	2011-01-31	2005-08-08		ENSG00000161133	ENSG00000161133		"""Ubiquitin-specific peptidases"""	20070	protein-coding gene	gene with protein product			"""ubiquitin specific protease 41"""			12838346	Standard	XM_006710116		Approved		uc011ahq.1	Q3LFD5	OTTHUMG00000151317	ENST00000454608.2:c.514A>G	22.37:g.20723832T>C	ENSP00000414922:p.Met172Val		A8MXD0|Q70BM7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.M172V	ENST00000454608.2	37	c.514		22	64	0.029304029304029304	11	0.022357723577235773	6	0.016574585635359115	6	0.01048951048951049	41	0.05408970976253298	N	0.006	-2.019547	0.00418	.	.	ENSG00000161133	ENST00000454608	T	0.28454	1.61	.	.	.	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.930396	0.09186	N	0.836810	T	0.01421	0.0046	N	0.01464	-0.85	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.32824	-0.9892	7	0.23302	T	0.38	.	.	.	.	.	172	Q3LFD5	UBP41_HUMAN	V	172	ENSP00000414922:M172V	ENSP00000414922:M172V	M	-	1	0	USP41	19053832	0.010000	0.17322	0.425000	0.26659	0.433000	0.31745	-0.916000	0.04029	0.229000	0.21039	0.227000	0.17789	ATG	USP41	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000161133		0.532	USP41-201	KNOWN	basic|appris_candidate_longest	protein_coding	USP41	HGNC	protein_coding		90	0.00	0	T	XM_036729		20723832	20723832	-1	no_stop_codon	ENST00000454608	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.500	C
VASN	114990	genome.wustl.edu	37	16	4431228	4431228	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr16:4431228A>G	ENST00000304735.3	+	2	505	c.350A>G	c.(349-351)aAt>aGt	p.N117S	CORO7_ENST00000574025.1_Intron|CORO7_ENST00000423908.2_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000537233.2_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	117				Missing (in Ref. 2; AAQ88665). {ECO:0000305}.	cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						GAAATCACCAATGAGACCTTC	0.637																																						dbGAP											0													30.0	30.0	30.0					16																	4431228		2196	4299	6495	-	-	-	SO:0001583	missense	0			AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.350A>G	16.37:g.4431228A>G	ENSP00000306864:p.Asn117Ser		Q6UXL4|Q6UXL5|Q96CX1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.N117S	ENST00000304735.3	37	c.350	CCDS10514.1	16	.	.	.	.	.	.	.	.	.	.	A	10.42	1.345312	0.24426	.	.	ENSG00000168140	ENST00000304735	T	0.79247	-1.25	5.78	5.78	0.91487	.	0.246898	0.41712	D	0.000825	T	0.57460	0.2055	N	0.02120	-0.675	0.40205	D	0.977567	D	0.57571	0.98	P	0.49752	0.621	T	0.61623	-0.7025	10	0.09843	T	0.71	-21.5694	11.3103	0.49360	0.8479:0.152:0.0:0.0	.	117	Q6EMK4	VASN_HUMAN	S	117	ENSP00000306864:N117S	ENSP00000306864:N117S	N	+	2	0	VASN	4371229	0.996000	0.38824	0.999000	0.59377	0.317000	0.28152	3.567000	0.53813	2.205000	0.71048	0.528000	0.53228	AAT	VASN	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000168140		0.637	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASN	HGNC	protein_coding	OTTHUMT00000251632.1	132	0.00	0	A	NM_138440		4431228	4431228	+1	no_errors	ENST00000304735	ensembl	human	known	69_37n	missense	79	20.00	20	SNP	0.999	G
VPS52	6293	genome.wustl.edu	37	6	33232055	33232055	+	Intron	SNP	G	G	A	rs213202	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr6:33232055G>A	ENST00000445902.2	-	14	1743				VPS52_ENST00000478934.1_Intron|VPS52_ENST00000436044.2_Intron|VPS52_ENST00000482399.1_Intron	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)						ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TGCTCATAGCGTGGCCCATGA	0.542													G|||	2062	0.411741	0.3321	0.379	5008	,	,		20589	0.5794		0.3847	False		,,,				2504	0.3978					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1524+95C>T	6.37:g.33232055G>A			A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	RNA	SNP	-	NULL	ENST00000445902.2	37	NULL	CCDS4770.2	6																																																																																			VPS52	-	-	ENSG00000223501		0.542	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	50	0.00	0	G	NM_022553		33232055	33232055	-1	no_errors	ENST00000493674	ensembl	human	putative	69_37n	rna	32	15.79	6	SNP	0.000	A
YLPM1	56252	genome.wustl.edu	37	14	75265389	75265390	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr14:75265389_75265390insT	ENST00000325680.7	+	5	3513_3514	c.3389_3390insT	c.(3388-3393)agtagafs	p.R1131fs	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Frame_Shift_Ins_p.R936fs	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	936	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AGGGCTGGGAGTAGAGAGAGAA	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3390dupT	14.37:g.75265390_75265390dupT	ENSP00000324463:p.Arg1131fs		P49752|Q96I64|Q9P1V7	Frame_Shift_Ins	INS	superfamily_FH2_actin-bd	p.R1131fs	ENST00000325680.7	37	c.3389_3390	CCDS45135.1	14																																																																																			YLPM1	-	NULL	ENSG00000119596		0.619	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	39	0.00	0	-	NM_019589		75265389	75265390	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	frame_shift_ins	18	25.00	6	INS	1.000:0.998	T
ZDHHC8P1	150244	genome.wustl.edu	37	22	23734930	23734930	+	RNA	SNP	G	G	A	rs1807113	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr22:23734930G>A	ENST00000255890.4	-	0	1263									zinc finger, DHHC-type containing 8 pseudogene 1																		CCAGGGGCAGGGGGTAGTGGG	0.617													.|||	1889	0.377196	0.0817	0.3761	5008	,	,		14668	0.7619		0.4553	False		,,,				2504	0.3006					dbGAP											0																																										-	-	-			0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23734930G>A				RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.617	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	89	0.00	0	G	NR_003950		23734930	23734930	-1	no_errors	ENST00000420968	ensembl	human	known	69_37n	rna	22	21.43	6	SNP	0.002	A
ZNF251	90987	genome.wustl.edu	37	8	145947639	145947639	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:145947639G>T	ENST00000292562.7	-	5	1681	c.1406C>A	c.(1405-1407)gCt>gAt	p.A469D	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		CTGGCTGAAAGCTTTCCCACA	0.547																																						dbGAP											0													62.0	69.0	67.0					8																	145947639		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1406C>A	8.37:g.145947639G>T	ENSP00000292562:p.Ala469Asp		Q2M219	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A469D	ENST00000292562.7	37	c.1406	CCDS47944.1	8	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971243	0.34754	.	.	ENSG00000198169	ENST00000292562	T	0.37411	1.2	2.15	2.15	0.27550	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38719	0.1051	L	0.28608	0.87	0.27382	N	0.955386	D	0.65815	0.995	P	0.58130	0.833	T	0.13710	-1.0499	9	0.72032	D	0.01	-6.6544	7.862	0.29516	0.0:0.4419:0.5581:0.0	.	469	Q9BRH9	ZN251_HUMAN	D	469	ENSP00000292562:A469D	ENSP00000292562:A469D	A	-	2	0	ZNF251	145918448	0.000000	0.05858	1.000000	0.80357	0.521000	0.34408	-1.241000	0.02911	1.521000	0.48983	0.563000	0.77884	GCT	ZNF251	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198169		0.547	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	43	0.00	0	G	NM_138367		145947639	145947639	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.998	T
ZNF300P1	134466	genome.wustl.edu	37	5	150311080	150311080	+	RNA	SNP	T	T	A	rs10875561	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr5:150311080T>A	ENST00000520773.1	-	0	2241									zinc finger protein 300 pseudogene 1 (functional)																		TTTTCCCCAGTGTGAACTCTC	0.403																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150311080T>A				RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.403	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	68	0.00	0	T	NR_026867		150311080	150311080	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	39	11.36	5	SNP	0.855	A
ZNF705G	100131980	genome.wustl.edu	37	8	7217172	7217172	+	Missense_Mutation	SNP	G	G	A	rs56023905	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:7217172G>A	ENST00000400156.4	-	6	568	c.287C>T	c.(286-288)aCc>aTc	p.T96I	ZNF705G_ENST00000400078.2_Missense_Mutation_p.T96I			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						GTCTTTTCTGGTGATAGGATG	0.328																																						dbGAP											0													267.0	292.0	285.0					8																	7217172		675	1591	2266	-	-	-	SO:0001583	missense	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.287C>T	8.37:g.7217172G>A	ENSP00000383020:p.Thr96Ile			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T96I	ENST00000400156.4	37	c.287		8	.	.	.	.	.	.	.	.	.	.	g	0.017	-1.497823	0.01001	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	T;T	0.06218	3.33;3.33	0.803	-1.61	0.08399	.	.	.	.	.	T	0.01905	0.0060	N	0.02539	-0.55	0.80722	P	0.0	.	.	.	.	.	.	T	0.46721	-0.9171	6	0.19147	T	0.46	.	4.108	0.10045	0.2387:0.2826:0.4787:0.0	rs56023905	.	.	.	I	96	ENSP00000383020:T96I;ENSP00000445477:T96I	ENSP00000445477:T96I	T	-	2	0	ZNF705G	7204582	0.000000	0.05858	0.009000	0.14445	0.060000	0.15804	-1.638000	0.02013	-0.636000	0.05524	-1.490000	0.00973	ACC	ZNF705G	-	NULL	ENSG00000215372		0.328	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	HGNC	protein_coding	OTTHUMT00000383776.1	292	0.34	1	G	XM_001720517		7217172	7217172	-1	no_errors	ENST00000400078	ensembl	human	known	69_37n	missense	185	11.06	23	SNP	0.010	A
ZNF705G	100131980	genome.wustl.edu	37	8	7218752	7218752	+	Missense_Mutation	SNP	G	G	C	rs3989697	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr8:7218752G>C	ENST00000400156.4	-	4	300	c.19C>G	c.(19-21)Ctg>Gtg	p.L7V	ZNF705G_ENST00000400078.2_Missense_Mutation_p.L7V			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						TCAAAAGTCAGTTTCTTCTAA	0.418																																						dbGAP											0													77.0	114.0	103.0					8																	7218752		670	1591	2261	-	-	-	SO:0001583	missense	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.19C>G	8.37:g.7218752G>C	ENSP00000383020:p.Leu7Val			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L7V	ENST00000400156.4	37	c.19		8	596	0.27289377289377287	179	0.3638211382113821	115	0.31767955801104975	119	0.20804195804195805	183	0.24142480211081793	C	0.001	-3.595236	0.00008	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	T;T	0.00682	5.86;5.86	1.24	1.24	0.21308	.	.	.	.	.	T	0.00012	0.0000	N	0.00389	-1.56	0.80722	P	0.0	.	.	.	.	.	.	T	0.35624	-0.9781	6	0.02654	T	1	.	2.8338	0.05508	0.0:0.4936:0.3045:0.2019	rs3989697;rs60933631	.	.	.	V	7	ENSP00000383020:L7V;ENSP00000445477:L7V	ENSP00000445477:L7V	L	-	1	2	ZNF705G	7206162	0.049000	0.20398	0.114000	0.21550	0.005000	0.04900	0.023000	0.13533	0.119000	0.18210	-2.074000	0.00383	CTG	ZNF705G	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000215372		0.418	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	HGNC	protein_coding	OTTHUMT00000383776.1	296	0.34	1	G	XM_001720517		7218752	7218752	-1	no_errors	ENST00000400078	ensembl	human	known	69_37n	missense	187	13.30	29	SNP	0.747	C
ZNF711	7552	genome.wustl.edu	37	X	84525714	84525715	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chrX:84525714_84525715insA	ENST00000373165.3	+	9	1472_1473	c.1166_1167insA	c.(1165-1170)acaaaafs	p.TK389fs	ZNF711_ENST00000395402.1_Frame_Shift_Ins_p.TK397fs|ZNF711_ENST00000360700.4_Frame_Shift_Ins_p.TK435fs|ZNF711_ENST00000542798.1_Frame_Shift_Ins_p.TK231fs|ZNF711_ENST00000276123.3_Frame_Shift_Ins_p.TK389fs	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	389					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						CATATTTGCACAAAAAAGTTTA	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1172dupA	X.37:g.84525720_84525720dupA	ENSP00000362260:p.Thr389fs		B4DSV4|Q6NX42|Q9Y4J6	Frame_Shift_Ins	INS	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F400fs	ENST00000373165.3	37	c.1190_1191	CCDS35344.1	X																																																																																			ZNF711	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000147180		0.356	ZNF711-001	KNOWN	basic|CCDS	protein_coding	ZNF711	HGNC	protein_coding	OTTHUMT00000057388.2	53	0.00	0	-	NM_021998		84525714	84525715	+1	no_errors	ENST00000395402	ensembl	human	known	69_37n	frame_shift_ins	38	26.92	14	INS	1.000:0.997	A
ZNF90	7643	genome.wustl.edu	37	19	20235929	20235929	+	3'UTR	SNP	G	G	A	rs1654280	byFrequency	TCGA-GM-A3NY-01A-11D-A21Q-09	TCGA-GM-A3NY-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	557eca26-6d1f-4df9-9b50-c1a73bd5e38b	41d20e34-7c68-4855-bc43-d8141c29b2d9	g.chr19:20235929G>A	ENST00000474284.1	+	0	353				CTC-260E6.6_ENST00000590606.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA			Q03938	ZNF90_HUMAN	zinc finger protein 90						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						GCGCACTGCAGACGCGGCAAT	0.607													a|||	1903	0.379992	0.6581	0.2795	5008	,	,		16718	0.4444		0.16	False		,,,				2504	0.2352					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000474284.1:c.*350G>A	19.37:g.20235929G>A			B9EH87	RNA	SNP	-	NULL	ENST00000474284.1	37	NULL		19																																																																																			ZNF90	-	-	ENSG00000213988		0.607	ZNF90-003	KNOWN	basic	processed_transcript	ZNF90	HGNC	protein_coding	OTTHUMT00000350103.2	67	0.00	0	G	NM_007138		20235929	20235929	+1	no_errors	ENST00000474284	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	1.000	A
