#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BDP1	55814	genome.wustl.edu	37	5	70793121	70793121	+	Silent	SNP	T	T	C			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr5:70793121T>C	ENST00000358731.4	+	13	2087	c.1824T>C	c.(1822-1824)gtT>gtC	p.V608V	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	608					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CAGAAAATGTTAAACCAATGT	0.363																																						dbGAP											0													71.0	68.0	69.0					5																	70793121		1822	4081	5903	-	-	-	SO:0001819	synonymous_variant	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1824T>C	5.37:g.70793121T>C			Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.V608	ENST00000358731.4	37	c.1824	CCDS43328.1	5																																																																																			BDP1	-	NULL	ENSG00000145734		0.363	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	18	0.00	0	T	NM_018429		70793121	70793121	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	silent	13	41.67	10	SNP	0.568	C
CALHM2	51063	genome.wustl.edu	37	10	105207212	105207212	+	Nonsense_Mutation	SNP	G	G	C			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr10:105207212G>C	ENST00000260743.5	-	4	1192	c.669C>G	c.(667-669)taC>taG	p.Y223*	RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000369788.3_Nonsense_Mutation_p.Y223*|CALHM2_ENST00000494180.1_5'Flank	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	223					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						CATTGGCGCGGTACTGCGCCC	0.622																																						dbGAP											0													54.0	52.0	52.0					10																	105207212		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.669C>G	10.37:g.105207212G>C	ENSP00000260743:p.Tyr223*		D3DR94|O95893|Q6ZUV9	Nonsense_Mutation	SNP	NULL	p.Y223*	ENST00000260743.5	37	c.669	CCDS7549.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.564439	0.98361	.	.	ENSG00000138172	ENST00000369788;ENST00000260743	.	.	.	5.37	4.47	0.54385	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-39.7056	10.3668	0.44028	0.1506:0.0:0.8494:0.0	.	.	.	.	X	223	.	ENSP00000260743:Y223X	Y	-	3	2	CALHM2	105197202	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.907000	0.56348	1.274000	0.44362	0.561000	0.74099	TAC	CALHM2	-	NULL	ENSG00000138172		0.622	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM2	HGNC	protein_coding	OTTHUMT00000050159.1	97	0.00	0	G	NM_015916		105207212	105207212	-1	no_errors	ENST00000260743	ensembl	human	known	69_37n	nonsense	59	16.90	12	SNP	1.000	C
CDH1	999	genome.wustl.edu	37	16	68845663	68845664	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr16:68845663_68845664insA	ENST00000261769.5	+	7	1100_1101	c.909_910insA	c.(910-912)atcfs	p.I304fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.I304fs|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	304	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TCGCTTACACCATCCTCAGCCA	0.52			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Unknown(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.910dupA	16.37:g.68845664_68845664dupA	ENSP00000261769:p.Ile304fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I303fs	ENST00000261769.5	37	c.909_910	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.520	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	89	0.00	0	-	NM_004360		68845663	68845664	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	49	30.99	22	INS	0.036:0.887	A
DENND4B	9909	genome.wustl.edu	37	1	153913077	153913077	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr1:153913077G>C	ENST00000361217.4	-	10	1750	c.1332C>G	c.(1330-1332)atC>atG	p.I444M		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	444	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCAGTGGGAAGATCATCTGAA	0.587																																						dbGAP											0													35.0	38.0	37.0					1																	153913077		2134	4244	6378	-	-	-	SO:0001583	missense	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.1332C>G	1.37:g.153913077G>C	ENSP00000354597:p.Ile444Met		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.I444M	ENST00000361217.4	37	c.1332	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287656	0.59976	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.11604	2.76;2.76	4.94	4.02	0.46733	DENN (3);	0.267927	0.35936	N	0.002883	T	0.11110	0.0271	L	0.38733	1.17	0.37978	D	0.933493	D	0.65815	0.995	D	0.63597	0.916	T	0.07309	-1.0779	10	0.35671	T	0.21	-14.8788	12.6854	0.56944	0.0821:0.0:0.9179:0.0	.	444	O75064	DEN4B_HUMAN	M	444;455	ENSP00000354597:I444M;ENSP00000357635:I455M	ENSP00000354597:I444M	I	-	3	3	DENND4B	152179701	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.126000	0.31344	1.286000	0.44565	0.655000	0.94253	ATC	DENND4B	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000198837		0.587	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	26	0.00	0	G	XM_375806		153913077	153913077	-1	no_errors	ENST00000361217	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	C
DLL4	54567	genome.wustl.edu	37	15	41227213	41227213	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr15:41227213C>T	ENST00000249749.5	+	8	1414	c.1138C>T	c.(1138-1140)Cgc>Tgc	p.R380C		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	380	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTGCCGGGAGCGCAACCAGGG	0.612																																						dbGAP											0													49.0	53.0	52.0					15																	41227213		2002	4181	6183	-	-	-	SO:0001583	missense	0			AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.1138C>T	15.37:g.41227213C>T	ENSP00000249749:p.Arg380Cys		Q3KP23|Q9NQT9	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,superfamily_Growth_fac_rcpt,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_DSL,pfscan_EG-like_dom	p.R380C	ENST00000249749.5	37	c.1138	CCDS45232.1	15	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391516	0.83011	.	.	ENSG00000128917	ENST00000249749	D	0.92446	-3.04	5.96	5.96	0.96718	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.293237	0.42053	D	0.000766	D	0.91945	0.7449	L	0.35542	1.07	0.50039	D	0.999845	D	0.76494	0.999	P	0.57846	0.828	D	0.91789	0.5442	10	0.56958	D	0.05	.	13.3096	0.60371	0.2596:0.7404:0.0:0.0	.	380	Q9NR61	DLL4_HUMAN	C	380	ENSP00000249749:R380C	ENSP00000249749:R380C	R	+	1	0	DLL4	39014505	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.670000	0.68088	2.833000	0.97629	0.650000	0.86243	CGC	DLL4	-	pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000128917		0.612	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLL4	HGNC	protein_coding	OTTHUMT00000418859.1	71	0.00	0	C			41227213	41227213	+1	no_errors	ENST00000249749	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	T
MVB12B	89853	genome.wustl.edu	37	9	129265489	129265489	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr9:129265489G>A	ENST00000361171.3	+	10	988	c.907G>A	c.(907-909)Gcc>Acc	p.A303T	MVB12B_ENST00000485886.1_3'UTR|MVB12B_ENST00000436593.3_Missense_Mutation_p.A288T	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B	303	UMA. {ECO:0000255|PROSITE- ProRule:PRU00830}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										GCAGAGCGCAGCCGCCAGGCT	0.672																																						dbGAP											0													20.0	20.0	20.0					9																	129265489		2031	3969	6000	-	-	-	SO:0001583	missense	0			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.907G>A	9.37:g.129265489G>A	ENSP00000354772:p.Ala303Thr		Q8N6S7	Missense_Mutation	SNP	pfam_FAM125	p.A303T	ENST00000361171.3	37	c.907	CCDS35142.1	9	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359922	0.82353	.	.	ENSG00000196814	ENST00000361171;ENST00000436593	T;T	0.55930	0.49;0.51	4.99	4.99	0.66335	UMA domain (1);	0.000000	0.85682	D	0.000000	T	0.70404	0.3220	M	0.66939	2.045	0.80722	D	1	P;D;D	0.63880	0.58;0.993;0.993	B;D;D	0.74674	0.185;0.984;0.971	T	0.73395	-0.3996	10	0.62326	D	0.03	0.0658	16.0728	0.80946	0.0:0.0:1.0:0.0	.	288;172;303	B7Z1P9;Q9H7N7;Q9H7P6	.;.;F125B_HUMAN	T	303;288	ENSP00000354772:A303T;ENSP00000401379:A288T	ENSP00000354772:A303T	A	+	1	0	FAM125B	128305310	1.000000	0.71417	0.140000	0.22221	0.734000	0.41952	6.131000	0.71670	2.301000	0.77427	0.655000	0.94253	GCC	FAM125B	-	NULL	ENSG00000196814		0.672	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM125B	HGNC	protein_coding	OTTHUMT00000054110.1	34	0.00	0	G	XM_088525		129265489	129265489	+1	no_errors	ENST00000361171	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	0.904	A
FAM86B1	85002	genome.wustl.edu	37	8	12040541	12040541	+	3'UTR	SNP	G	G	A	rs200848108	byFrequency	TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr8:12040541G>A	ENST00000448228.2	-	0	1514				FAM86B1_ENST00000533852.2_3'UTR|AC145124.1_ENST00000579282.1_RNA	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1											kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		CCTTTCTGCCGTGTTCCTAAC	0.542													g|||	2298	0.458866	0.3192	0.5663	5008	,	,		23550	0.4742		0.502	False		,,,				2504	0.5112					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.*574C>T	8.37:g.12040541G>A				RNA	SNP	-	NULL	ENST00000448228.2	37	NULL	CCDS59512.1	8																																																																																			FAM86B1	-	-	ENSG00000186523		0.542	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	12	0.00	0	G	NM_032916		12040541	12040541	-1	no_errors	ENST00000529146	ensembl	human	known	69_37n	rna	6	53.85	7	SNP	0.002	A
FRG2B	441581	genome.wustl.edu	37	10	135439803	135439803	+	Silent	SNP	C	C	T	rs202189720		TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr10:135439803C>T	ENST00000425520.1	-	2	235	c.183G>A	c.(181-183)tcG>tcA	p.S61S	FRG2B_ENST00000443774.1_Silent_p.S62S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	61						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GATTGGGCTCCGATCCTGCTG	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	135439803		23	64	87	-	-	-	SO:0001819	synonymous_variant	0			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.183G>A	10.37:g.135439803C>T			Q5VSQ1	Silent	SNP	NULL	p.S62	ENST00000425520.1	37	c.186	CCDS44502.1	10																																																																																			FRG2B	-	NULL	ENSG00000225899		0.488	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	14	0.00	0	C	NM_001080998		135439803	135439803	-1	no_errors	ENST00000443774	ensembl	human	known	69_37n	silent	6	57.14	8	SNP	0.213	T
PLPPR2	64748	genome.wustl.edu	37	19	11467547	11467547	+	5'UTR	SNP	A	A	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr19:11467547A>G	ENST00000251473.5	+	0	257				DKFZP761J1410_ENST00000586431.1_3'UTR|DKFZP761J1410_ENST00000591608.1_5'UTR	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					cagtttccacatctgcacaat	0.622																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0																														ENST00000251473.5:c.-120A>G	19.37:g.11467547A>G				RNA	SNP	-	NULL	ENST00000251473.5	37	NULL	CCDS12258.1	19																																																																																			LPPR2	-	-	ENSG00000105520		0.622	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458779.1	44	0.00	0	A			11467547	11467547	+1	no_errors	ENST00000586431	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.008	G
MEAF6	64769	genome.wustl.edu	37	1	37959690	37959690	+	3'UTR	SNP	A	A	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr1:37959690A>G	ENST00000296214.5	-	0	613				MEAF6_ENST00000373075.2_3'UTR|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000373073.4_Intron|MEAF6_ENST00000373074.1_3'UTR	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						CTTCTGCACTAATGTGTCTTC	0.428																																						dbGAP											0													106.0	114.0	111.0					1																	37959690		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.*10T>C	1.37:g.37959690A>G			B1AK64|Q4F967|Q7Z311|Q86WE3	RNA	SNP	-	NULL	ENST00000296214.5	37	NULL	CCDS59196.1	1																																																																																			MEAF6	-	-	ENSG00000163875		0.428	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEAF6	HGNC	protein_coding	OTTHUMT00000012161.1	14	0.00	0	A	NM_022756		37959690	37959690	-1	no_errors	ENST00000475828	ensembl	human	known	69_37n	rna	20	33.33	10	SNP	0.271	G
MON2	23041	genome.wustl.edu	37	12	62959110	62959110	+	Nonsense_Mutation	SNP	C	C	T	rs201309945		TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr12:62959110C>T	ENST00000393632.2	+	27	4517	c.4126C>T	c.(4126-4128)Cag>Tag	p.Q1376*	MON2_ENST00000393630.3_Nonsense_Mutation_p.Q1377*|MON2_ENST00000546600.1_Nonsense_Mutation_p.Q1376*|MON2_ENST00000393629.2_Nonsense_Mutation_p.Q1376*|MON2_ENST00000552738.1_Nonsense_Mutation_p.Q1353*|MON2_ENST00000280379.6_Nonsense_Mutation_p.Q1377*	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1376					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TAAACCTCCACAGTATGGACA	0.328																																						dbGAP											0													148.0	147.0	147.0					12																	62959110		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4126C>T	12.37:g.62959110C>T	ENSP00000377252:p.Gln1376*		A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Nonsense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.Q1377*	ENST00000393632.2	37	c.4129	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	C	47	13.147862	0.99723	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	.	.	.	5.66	5.66	0.87406	.	0.110120	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.4494	20.1115	0.97913	0.0:1.0:0.0:0.0	.	.	.	.	X	1376;1377;1377;1376;1353;1376	.	.	Q	+	1	0	MON2	61245377	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.845000	0.69437	2.814000	0.96858	0.655000	0.94253	CAG	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.328	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	63	0.00	0	C	NM_015026		62959110	62959110	+1	no_errors	ENST00000393630	ensembl	human	known	69_37n	nonsense	60	20.00	15	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9072872	9072872	+	Silent	SNP	T	T	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr19:9072872T>G	ENST00000397910.4	-	3	14777	c.14574A>C	c.(14572-14574)acA>acC	p.T4858T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4860	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATTTGGAGATGTGACTTTAG	0.433																																						dbGAP											0													188.0	177.0	181.0					19																	9072872		2045	4192	6237	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14574A>C	19.37:g.9072872T>G			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T4858	ENST00000397910.4	37	c.14574	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.433	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	194	0.00	0	T	NM_024690		9072872	9072872	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	156	19.59	38	SNP	0.000	G
MYH9	4627	genome.wustl.edu	37	22	36708257	36708257	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr22:36708257G>A	ENST00000216181.5	-	14	1795	c.1565C>T	c.(1564-1566)cCg>cTg	p.P522L		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	522	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CAGAATGCCCGGGGGGCCTGC	0.642			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													51.0	48.0	49.0					22																	36708257		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1565C>T	22.37:g.36708257G>A	ENSP00000216181:p.Pro522Leu		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.P522L	ENST00000216181.5	37	c.1565	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426497	0.83667	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.69806	-0.43	4.44	4.44	0.53790	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	T	0.69842	0.3156	N	0.16016	0.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76895	-0.2790	10	0.87932	D	0	.	17.0598	0.86544	0.0:0.0:1.0:0.0	.	522	P35579	MYH9_HUMAN	L	386;522	ENSP00000216181:P522L	ENSP00000216181:P522L	P	-	2	0	MYH9	35038203	1.000000	0.71417	0.964000	0.40570	0.717000	0.41224	9.869000	0.99810	2.188000	0.69820	0.462000	0.41574	CCG	MYH9	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000100345		0.642	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	49	0.00	0	G	NM_002473		36708257	36708257	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	missense	35	31.37	16	SNP	1.000	A
NCAN	1463	genome.wustl.edu	37	19	19339131	19339131	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr19:19339131C>T	ENST00000252575.6	+	8	2801	c.2702C>T	c.(2701-2703)cCa>cTa	p.P901L	NCAN_ENST00000538881.1_Missense_Mutation_p.P352L	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	901					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CACCCAGAGCCAGAGGATCAG	0.612																																						dbGAP											0													80.0	85.0	84.0					19																	19339131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2702C>T	19.37:g.19339131C>T	ENSP00000252575:p.Pro901Leu		Q9UPK6	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like	p.P901L	ENST00000252575.6	37	c.2702	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814239	0.32053	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.86164	-1.94;-2.08	3.99	0.752	0.18398	.	0.414357	0.17899	N	0.158244	T	0.72301	0.3443	N	0.17082	0.46	0.09310	N	0.999998	B;B	0.15719	0.014;0.005	B;B	0.12837	0.008;0.004	T	0.57051	-0.7877	10	0.27082	T	0.32	.	5.7463	0.18122	0.0:0.6581:0.0:0.3419	.	915;901	Q4LE67;O14594	.;NCAN_HUMAN	L	915;901;352	ENSP00000252575:P901L;ENSP00000442202:P352L	ENSP00000252575:P901L	P	+	2	0	NCAN	19200131	0.000000	0.05858	0.043000	0.18650	0.456000	0.32438	-0.442000	0.06871	0.275000	0.22094	-0.339000	0.08088	CCA	NCAN	-	NULL	ENSG00000130287		0.612	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	HGNC	protein_coding	OTTHUMT00000460111.2	82	0.00	0	C	NM_004386		19339131	19339131	+1	no_errors	ENST00000252575	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	0.040	T
NIPBL	25836	genome.wustl.edu	37	5	36984780	36984780	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr5:36984780A>G	ENST00000282516.8	+	10	1997	c.1498A>G	c.(1498-1500)Aag>Gag	p.K500E	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.K500E	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	500					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AATTTCAGATAAGCCTTTGAA	0.353																																						dbGAP											0													50.0	57.0	55.0					5																	36984780		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1498A>G	5.37:g.36984780A>G	ENSP00000282516:p.Lys500Glu		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.K500E	ENST00000282516.8	37	c.1498	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	A	17.60	3.428740	0.62844	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.96716	-4.08;-4.1	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.96470	0.8848	L	0.32530	0.975	0.51233	D	0.999912	D;D	0.67145	0.993;0.996	D;D	0.76071	0.971;0.987	D	0.95911	0.8923	10	0.32370	T	0.25	.	15.6742	0.77303	1.0:0.0:0.0:0.0	.	500;500	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	E	500	ENSP00000282516:K500E;ENSP00000406266:K500E	ENSP00000282516:K500E	K	+	1	0	NIPBL	37020537	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.446000	0.90329	2.103000	0.63969	0.528000	0.53228	AAG	NIPBL	-	NULL	ENSG00000164190		0.353	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	26	0.00	0	A	NM_015384		36984780	36984780	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	G
NLRX1	79671	genome.wustl.edu	37	11	119050480	119050480	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr11:119050480C>T	ENST00000409109.1	+	7	2337	c.1750C>T	c.(1750-1752)Cga>Tga	p.R584*	NLRX1_ENST00000292199.2_Nonsense_Mutation_p.R584*|NLRX1_ENST00000409991.1_Nonsense_Mutation_p.R584*|NLRX1_ENST00000409265.4_Nonsense_Mutation_p.R584*|NLRX1_ENST00000525863.1_Nonsense_Mutation_p.R584*	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	584	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGAGATGTTTCGAGAGGAGGA	0.612																																						dbGAP											0													114.0	117.0	116.0					11																	119050480		2200	4295	6495	-	-	-	SO:0001587	stop_gained	0			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1750C>T	11.37:g.119050480C>T	ENSP00000387334:p.Arg584*		A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Nonsense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.R584*	ENST00000409109.1	37	c.1750	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	C	43	10.049638	0.99325	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	.	.	.	5.33	3.25	0.37280	.	0.198407	0.31897	N	0.006886	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4558	0.67416	0.2284:0.7716:0.0:0.0	.	.	.	.	X	584	.	ENSP00000292199:R584X	R	+	1	2	NLRX1	118555690	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	2.254000	0.43214	2.503000	0.84419	0.561000	0.74099	CGA	NLRX1	-	NULL	ENSG00000160703		0.612	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	90	0.00	0	C	NM_170722		119050480	119050480	+1	no_errors	ENST00000292199	ensembl	human	known	69_37n	nonsense	75	19.35	18	SNP	1.000	T
OR2C3	81472	genome.wustl.edu	37	1	247695329	247695329	+	Missense_Mutation	SNP	G	G	A	rs562326145	byFrequency	TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr1:247695329G>A	ENST00000366487.3	-	2	846	c.485C>T	c.(484-486)aCg>aTg	p.T162M	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527084.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CATGGTGAGCGTGGAGCCCAC	0.557																																						dbGAP											0													57.0	54.0	55.0					1																	247695329		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.485C>T	1.37:g.247695329G>A	ENSP00000355443:p.Thr162Met		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T162M	ENST00000366487.3	37	c.485	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.679234	0.29783	.	.	ENSG00000196242	ENST00000366487	T	0.36878	1.23	3.89	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.193330	0.25146	U	0.032788	T	0.28599	0.0708	L	0.59912	1.85	0.09310	N	1	P	0.38767	0.646	B	0.28638	0.092	T	0.23297	-1.0192	10	0.62326	D	0.03	.	9.709	0.40233	0.1052:0.0:0.8948:0.0	.	162	Q8N628	OR2C3_HUMAN	M	162	ENSP00000355443:T162M	ENSP00000355443:T162M	T	-	2	0	OR2C3	245761952	0.000000	0.05858	0.664000	0.29753	0.861000	0.49209	-0.037000	0.12164	0.959000	0.37980	0.650000	0.86243	ACG	OR2C3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196242		0.557	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2	38	0.00	0	G	NM_198074		247695329	247695329	-1	no_errors	ENST00000366487	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	0.043	A
PCDHB14	56122	genome.wustl.edu	37	5	140604476	140604476	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr5:140604476G>T	ENST00000239449.4	+	1	1399	c.1399G>T	c.(1399-1401)Gcc>Tcc	p.A467S	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A314S	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	467	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACAGCCCCGCCCTGCACAT	0.627																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											0													107.0	114.0	111.0					5																	140604476		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1399G>T	5.37:g.140604476G>T	ENSP00000239449:p.Ala467Ser		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A467S	ENST00000239449.4	37	c.1399	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	18.26	3.583983	0.65992	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.60040	0.22;0.22	4.5	4.5	0.54988	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.63260	0.2496	L	0.28740	0.885	0.26419	N	0.976132	D	0.61697	0.99	P	0.57720	0.826	T	0.60475	-0.7256	9	0.87932	D	0	.	17.2613	0.87070	0.0:0.0:1.0:0.0	.	467	Q9Y5E9	PCDBE_HUMAN	S	314;467	ENSP00000444518:A314S;ENSP00000239449:A467S	ENSP00000239449:A467S	A	+	1	0	PCDHB14	140584660	0.925000	0.31364	1.000000	0.80357	0.987000	0.75469	4.349000	0.59385	2.235000	0.73313	0.556000	0.70494	GCC	PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000120327		0.627	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	206	0.00	0	G	NM_018934		140604476	140604476	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	missense	133	25.56	46	SNP	0.989	T
PTP4A2	8073	genome.wustl.edu	37	1	32384642	32384642	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr1:32384642T>G	ENST00000602725.1	-	1	442	c.25A>C	c.(25-27)Atc>Ctc	p.I9L	RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000356536.3_Missense_Mutation_p.I9L|PTP4A2_ENST00000344035.6_Missense_Mutation_p.I9L|PTP4A2_ENST00000526960.1_5'Flank|PTP4A2_ENST00000470404.1_Missense_Mutation_p.I9L|PTP4A2_ENST00000457805.2_Missense_Mutation_p.I9L			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2	9					peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				TCATAGGAGATCTCCACAGGG	0.413																																						dbGAP											0													122.0	110.0	114.0					1																	32384642		2203	4300	6503	-	-	-	SO:0001583	missense	0			L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.25A>C	1.37:g.32384642T>G	ENSP00000473259:p.Ile9Leu		A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.I9L	ENST00000602725.1	37	c.25	CCDS348.1	1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852743	0.71719	.	.	ENSG00000184007	ENST00000344035;ENST00000356536;ENST00000457805;ENST00000470404;ENST00000468531;ENST00000534796	D;D	0.95756	-3.8;-3.6	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.95017	0.8387	M	0.67397	2.05	0.80722	D	1	B;P;B	0.35700	0.001;0.516;0.001	B;B;B	0.42030	0.012;0.373;0.007	D	0.94691	0.7874	10	0.46703	T	0.11	-23.2611	14.2896	0.66268	0.0:0.0:0.0:1.0	.	9;9;9	E9PGJ6;Q12974-2;Q12974	.;.;TP4A2_HUMAN	L	9	ENSP00000344909:I9L;ENSP00000409260:I9L	ENSP00000344909:I9L	I	-	1	0	PTP4A2	32157229	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.220000	0.72237	1.919000	0.55581	0.528000	0.53228	ATC	PTP4A2	-	NULL	ENSG00000184007		0.413	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding	OTTHUMT00000468092.1	71	0.00	0	T	NM_080391		32384642	32384642	-1	no_errors	ENST00000344035	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	1.000	G
RABEP2	79874	genome.wustl.edu	37	16	28916828	28916828	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr16:28916828G>A	ENST00000358201.4	-	12	2086	c.1498C>T	c.(1498-1500)Ctc>Ttc	p.L500F	RABEP2_ENST00000544477.1_Missense_Mutation_p.L429F|RABEP2_ENST00000357573.6_Missense_Mutation_p.L464F	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	500					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						AGGTCTGGGAGCTGGGCCTGC	0.657																																					Pancreas(66;639 1284 10093 31061 49099)	dbGAP											0													28.0	32.0	31.0					16																	28916828		2061	4197	6258	-	-	-	SO:0001583	missense	0			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.1498C>T	16.37:g.28916828G>A	ENSP00000350934:p.Leu500Phe			Missense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.L500F	ENST00000358201.4	37	c.1498	CCDS42140.1	16	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175846	0.57692	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.58358	0.34;0.34;0.34	5.25	4.29	0.51040	Rabaptin, GTPase-Rab5 binding (1);	0.084806	0.46758	D	0.000278	T	0.68485	0.3006	M	0.66939	2.045	0.50313	D	0.99986	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.991	T	0.71279	-0.4640	10	0.87932	D	0	-15.7831	11.3927	0.49824	0.0:0.0:0.8186:0.1814	.	429;464;500	B4DHR0;Q9H5N1-2;Q9H5N1	.;.;RABE2_HUMAN	F	500;464;429	ENSP00000350934:L500F;ENSP00000350186:L464F;ENSP00000442798:L429F	ENSP00000350186:L464F	L	-	1	0	RABEP2	28824329	0.998000	0.40836	1.000000	0.80357	0.469000	0.32828	3.095000	0.50235	1.242000	0.43836	-0.325000	0.08501	CTC	RABEP2	-	pfam_Rabaptin_Rab5-bd_dom	ENSG00000177548		0.657	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	HGNC	protein_coding	OTTHUMT00000432691.1	54	0.00	0	G	NM_024816		28916828	28916828	-1	no_errors	ENST00000358201	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	1.000	A
RYR1	6261	genome.wustl.edu	37	19	38942506	38942506	+	Silent	SNP	C	C	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr19:38942506C>T	ENST00000359596.3	+	12	1225	c.1225C>T	c.(1225-1227)Cta>Tta	p.L409L	RYR1_ENST00000360985.3_Silent_p.L409L|RYR1_ENST00000355481.4_Silent_p.L409L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	409					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CACCAATGGCCTATACAACCA	0.612																																						dbGAP											0													142.0	94.0	110.0					19																	38942506		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1225C>T	19.37:g.38942506C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.L409	ENST00000359596.3	37	c.1225	CCDS33011.1	19																																																																																			RYR1	-	NULL	ENSG00000196218		0.612	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	68	0.00	0	C			38942506	38942506	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	1.000	T
SERPINA12	145264	genome.wustl.edu	37	14	94953739	94953739	+	Silent	SNP	G	G	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr14:94953739G>T	ENST00000341228.2	-	6	1941	c.1146C>A	c.(1144-1146)ctC>ctA	p.L382L	SERPINA12_ENST00000556881.1_Silent_p.L382L	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	382	RCL.				negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TCTTGACGACGAGTGGTGTCT	0.512																																						dbGAP											0													127.0	105.0	112.0					14																	94953739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.1146C>A	14.37:g.94953739G>T				Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.L382	ENST00000341228.2	37	c.1146	CCDS9926.1	14																																																																																			SERPINA12	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000165953		0.512	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA12	HGNC	protein_coding	OTTHUMT00000413097.1	30	0.00	0	G	NM_173850		94953739	94953739	-1	no_errors	ENST00000341228	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.000	T
SPANXD	64648	genome.wustl.edu	37	X	140785800	140785800	+	Missense_Mutation	SNP	G	G	A	rs145377089		TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chrX:140785800G>A	ENST00000370515.3	-	2	449	c.116C>T	c.(115-117)cCg>cTg	p.P39L		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	39						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P39L(1)|p.P39Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					TAGTTTTTTCGGAGCAGGTTG	0.488													-|||	1	0.000264901	0.0	0.0	3775	,	,		18478	0.001		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	lung(1)|kidney(1)											252.0	174.0	200.0					X																	140785800		2198	4257	6455	-	-	-	SO:0001583	missense	0			AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.116C>T	X.37:g.140785800G>A	ENSP00000359546:p.Pro39Leu		Q5JWI1	Missense_Mutation	SNP	pfam_SPANX_prot	p.P39L	ENST00000370515.3	37	c.116	CCDS14675.1	X	.	.	.	.	.	.	.	.	.	.	N	1.318	-0.600289	0.03744	.	.	ENSG00000196406	ENST00000370515	T	0.05081	3.5	.	.	.	.	.	.	.	.	T	0.09247	0.0228	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.07328	-1.0778	6	0.02654	T	1	.	.	.	.	.	39	Q9BXN6	SPNXD_HUMAN	L	39	ENSP00000359546:P39L	ENSP00000359546:P39L	P	-	2	0	SPANXD	140613466	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	-0.484000	0.06528	0.431000	0.26258	0.068000	0.15388	CCG	SPANXD	-	pfam_SPANX_prot	ENSG00000196406		0.488	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXD	HGNC	protein_coding	OTTHUMT00000058598.1	181	0.00	0	G			140785800	140785800	-1	no_errors	ENST00000370515	ensembl	human	known	69_37n	missense	181	23.31	55	SNP	0.001	A
SYN3	8224	genome.wustl.edu	37	22	33402387	33402387	+	Silent	SNP	A	A	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr22:33402387A>G	ENST00000358763.2	-	2	503	c.261T>C	c.(259-261)atT>atC	p.I87I	SYN3_ENST00000332840.5_Silent_p.I87I	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	87	B; linker.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GTCTTTGAACAATGGGCGTGG	0.557																																						dbGAP											0													112.0	109.0	110.0					22																	33402387		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.261T>C	22.37:g.33402387A>G			B1B1F9	Silent	SNP	pfam_Synapsin_ATP-bd_dom,pfam_Synapsin_pre-ATP-grasp_dom,pfam_Synapsin_P_site,pfam_ATP-grasp_RimK-type,superfamily_PreATP-grasp_fold,prints_Synapsin	p.I87	ENST00000358763.2	37	c.261	CCDS13908.1	22																																																																																			SYN3	-	NULL	ENSG00000185666		0.557	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYN3	HGNC	protein_coding	OTTHUMT00000075892.4	103	0.00	0	A			33402387	33402387	-1	no_errors	ENST00000332840	ensembl	human	known	69_37n	silent	71	20.22	18	SNP	0.005	G
TBX5	6910	genome.wustl.edu	37	12	114841721	114841721	+	5'UTR	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr12:114841721G>A	ENST00000310346.4	-	0	649				TBX5_ENST00000405440.2_5'UTR|TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000526441.1_5'Flank|TBX5_ENST00000349716.5_Intron	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5						apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CCAGGGCCCTGTGCCCGCGCA	0.622																																					NSCLC(152;1358 1980 4050 23898 40356)	dbGAP											0													17.0	19.0	19.0					12																	114841721		2201	4296	6497	-	-	-	SO:0001623	5_prime_UTR_variant	0			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.-18C>T	12.37:g.114841721G>A			A6ND77|O15301|Q96TB0|Q9Y4I2	RNA	SNP	-	NULL	ENST00000310346.4	37	NULL	CCDS9173.1	12																																																																																			TBX5	-	-	ENSG00000089225		0.622	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	HGNC	protein_coding	OTTHUMT00000388297.1	133	0.00	0	G	NM_080717		114841721	114841721	-1	no_errors	ENST00000552726	ensembl	human	known	69_37n	rna	81	29.57	34	SNP	1.000	A
TES	26136	genome.wustl.edu	37	7	115890285	115890285	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr7:115890285G>A	ENST00000358204.4	+	4	652	c.437G>A	c.(436-438)cGg>cAg	p.R146Q	TES_ENST00000537767.1_Intron|AC002066.1_ENST00000446355.2_RNA|AC073130.3_ENST00000444244.1_RNA|TES_ENST00000393481.2_Missense_Mutation_p.R137Q	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	146	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			GCACAGTACCGGAAGAAGCAG	0.552																																						dbGAP											0													92.0	86.0	88.0					7																	115890285		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.437G>A	7.37:g.115890285G>A	ENSP00000350937:p.Arg146Gln		A4D0U6|Q9GZQ1|Q9HAJ9	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R146Q	ENST00000358204.4	37	c.437	CCDS5763.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.581366	0.96565	.	.	ENSG00000135269	ENST00000358204;ENST00000455989;ENST00000257721;ENST00000393481	D;D;D	0.91237	-2.81;-2.81;-2.81	5.49	5.49	0.81192	PET domain (2);	0.000000	0.64402	D	0.000007	D	0.96153	0.8746	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96322	0.9237	10	0.87932	D	0	-2.6814	19.7347	0.96198	0.0:0.0:1.0:0.0	.	146	Q9UGI8	TES_HUMAN	Q	146;61;146;137	ENSP00000350937:R146Q;ENSP00000413002:R61Q;ENSP00000377121:R137Q	ENSP00000257721:R146Q	R	+	2	0	TES	115677521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.568000	0.98166	2.746000	0.94184	0.655000	0.94253	CGG	TES	-	pfam_PET_domain	ENSG00000135269		0.552	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	46	0.00	0	G	NM_015641		115890285	115890285	+1	no_errors	ENST00000358204	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	A
TNRC6B	23112	genome.wustl.edu	37	22	40662032	40662032	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr22:40662032T>C	ENST00000454349.2	+	5	2009	c.1798T>C	c.(1798-1800)Tgt>Cgt	p.C600R	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.C600R|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	600	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						ACATCCTGATTGTCAGGCTGT	0.512																																						dbGAP											0													110.0	112.0	111.0					22																	40662032		1980	4158	6138	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1798T>C	22.37:g.40662032T>C	ENSP00000401946:p.Cys600Arg		B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.C600R	ENST00000454349.2	37	c.1798	CCDS54533.1	22	.	.	.	.	.	.	.	.	.	.	T	4.937	0.174177	0.09391	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	T;T	0.10668	2.85;2.85	5.53	4.41	0.53225	.	0.316481	0.39615	N	0.001317	T	0.04770	0.0129	N	0.08118	0	0.54753	D	0.999983	P;B;B	0.39216	0.664;0.054;0.09	B;B;B	0.33690	0.168;0.015;0.053	T	0.51631	-0.8681	10	0.15952	T	0.53	-5.2838	11.2727	0.49148	0.2249:0.0:0.0:0.7751	.	600;600;600	Q9UPQ9;A8MYY3;Q9UPQ9-1	TNR6B_HUMAN;.;.	R	600	ENSP00000401946:C600R;ENSP00000338371:C600R	ENSP00000338371:C600R	C	+	1	0	TNRC6B	38991978	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.019000	0.41001	2.107000	0.64212	0.454000	0.30748	TGT	TNRC6B	-	NULL	ENSG00000100354		0.512	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		57	0.00	0	T			40662032	40662032	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.999	C
CFAP70	118491	genome.wustl.edu	37	10	75113464	75113464	+	Nonsense_Mutation	SNP	G	G	A	rs199587364		TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr10:75113464G>A	ENST00000310715.3	-	3	220	c.100C>T	c.(100-102)Cga>Tga	p.R34*	TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000340329.3_Nonsense_Mutation_p.R34*|TTC18_ENST00000394865.1_Nonsense_Mutation_p.R34*|TTC18_ENST00000401621.2_Nonsense_Mutation_p.R34*	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		34						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					AATTCTGCTCGAATAAAGGTA	0.363													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18745	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													96.0	88.0	91.0					10																	75113464		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000310715.3:c.100C>T	10.37:g.75113464G>A	ENSP00000310829:p.Arg34*		C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R34*	ENST00000310715.3	37	c.100	CCDS7324.3	10	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	32	5.168465	0.94768	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000372928;ENST00000394865;ENST00000394862	.	.	.	5.25	5.25	0.73442	.	0.119206	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.034	11.4439	0.50112	0.0:0.0:0.8199:0.1801	.	.	.	.	X	34	.	ENSP00000310829:R34X	R	-	1	2	TTC18	74783470	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.099000	0.57755	2.430000	0.82344	0.561000	0.74099	CGA	TTC18	-	NULL	ENSG00000156042		0.363	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		48	0.00	0	G			75113464	75113464	-1	no_errors	ENST00000310715	ensembl	human	known	69_37n	nonsense	51	10.53	6	SNP	1.000	A
UHRF1BP1	54887	genome.wustl.edu	37	6	34824168	34824168	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr6:34824168C>G	ENST00000192788.5	+	10	1444	c.1273C>G	c.(1273-1275)Ctc>Gtc	p.L425V	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.L425V	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	425							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						AGTAGACTCTCTCTTTCGGAG	0.478																																						dbGAP											0													107.0	110.0	109.0					6																	34824168		1903	4127	6030	-	-	-	SO:0001583	missense	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1273C>G	6.37:g.34824168C>G	ENSP00000192788:p.Leu425Val		Q9NXE0	Missense_Mutation	SNP	NULL	p.L425V	ENST00000192788.5	37	c.1273	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	C	6.941	0.543399	0.13250	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.07567	3.18;3.18	5.88	1.09	0.20402	.	0.343905	0.31381	N	0.007758	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48305	-0.9047	10	0.27785	T	0.31	-3.5845	9.4711	0.38842	0.0:0.661:0.0:0.339	.	425	Q6BDS2	URFB1_HUMAN	V	425	ENSP00000192788:L425V;ENSP00000400628:L425V	ENSP00000192788:L425V	L	+	1	0	UHRF1BP1	34932146	0.009000	0.17119	0.511000	0.27724	0.335000	0.28730	0.639000	0.24690	0.409000	0.25649	0.591000	0.81541	CTC	UHRF1BP1	-	NULL	ENSG00000065060		0.478	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	50	0.00	0	C	NM_017754		34824168	34824168	+1	no_errors	ENST00000192788	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.154	G
WDFY4	57705	genome.wustl.edu	37	10	49998813	49998813	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr10:49998813G>T	ENST00000325239.5	+	22	4135	c.4108G>T	c.(4108-4110)Gac>Tac	p.D1370Y	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1370						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CAGCAGCCTGGACTTCATTGG	0.542																																						dbGAP											0													78.0	67.0	70.0					10																	49998813		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.4108G>T	10.37:g.49998813G>T	ENSP00000320563:p.Asp1370Tyr		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1370Y	ENST00000325239.5	37	c.4108	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.87|17.87	3.494022|3.494022	0.64186|0.64186	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	T|.	0.58210|.	0.35|.	5.18|5.18	4.03|4.03	0.46877|0.46877	.|.	0.253808|.	0.36409|.	N|.	0.002608|.	T|T	0.43634|0.43634	0.1256|0.1256	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D|.	0.56521|.	0.976|.	P|.	0.47744|.	0.556|.	T|T	0.27739|0.27739	-1.0065|-1.0065	9|5	.|.	.|.	.|.	.|.	5.1166|5.1166	0.14838|0.14838	0.2078:0.0:0.7922:0.0|0.2078:0.0:0.7922:0.0	.|.	1370|.	Q6ZS81|.	WDFY4_HUMAN|.	Y|V	1370|460	ENSP00000320563:D1370Y|.	.|.	D|G	+|+	1|2	0|0	WDFY4|WDFY4	49668819|49668819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.488000|4.488000	0.60300|0.60300	2.567000|2.567000	0.86603|0.86603	0.557000|0.557000	0.71058|0.71058	GAC|GGA	WDFY4	-	NULL	ENSG00000128815		0.542	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		88	0.00	0	G	XM_033379		49998813	49998813	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	55	30.86	25	SNP	1.000	T
ZFR2	23217	genome.wustl.edu	37	19	3806016	3806016	+	Silent	SNP	T	T	C			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr19:3806016T>C	ENST00000262961.4	-	19	2761	c.2751A>G	c.(2749-2751)ggA>ggG	p.G917G		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	917	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CCTCGCCAGGTCCCCGTTGCC	0.716																																						dbGAP											0													7.0	9.0	9.0					19																	3806016		1839	4008	5847	-	-	-	SO:0001819	synonymous_variant	0			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2751A>G	19.37:g.3806016T>C				Silent	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.G917	ENST00000262961.4	37	c.2751	CCDS45921.1	19																																																																																			ZFR2	-	NULL	ENSG00000105278		0.716	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	22	0.00	0	T	NM_015174		3806016	3806016	-1	no_errors	ENST00000262961	ensembl	human	known	69_37n	silent	7	30.00	3	SNP	0.568	C
ZNF469	84627	genome.wustl.edu	37	16	88494089	88494089	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr16:88494089G>A	ENST00000437464.1	+	1	211	c.211G>A	c.(211-213)Ggg>Agg	p.G71R	ZNF469_ENST00000565624.1_Missense_Mutation_p.G71R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	71	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GGCCAGGGACGGGGAGCTCAA	0.726																																						dbGAP											0													5.0	9.0	7.0					16																	88494089		650	1505	2155	-	-	-	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.211G>A	16.37:g.88494089G>A	ENSP00000402343:p.Gly71Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G71R	ENST00000437464.1	37	c.211	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093391	0.36952	.	.	ENSG00000225614	ENST00000437464	T	0.19105	2.17	3.84	0.0621	0.14343	.	.	.	.	.	T	0.07954	0.0199	N	0.14661	0.345	0.09310	N	1	P	0.48640	0.913	B	0.29663	0.105	T	0.25117	-1.0141	9	0.72032	D	0.01	.	5.385	0.16213	0.5879:0.0:0.4121:0.0	.	71	Q96JG9	ZN469_HUMAN	R	71	ENSP00000402343:G71R	ENSP00000402343:G71R	G	+	1	0	ZNF469	87021590	0.137000	0.22531	0.001000	0.08648	0.129000	0.20672	1.338000	0.33873	0.131000	0.18576	0.313000	0.20887	GGG	ZNF469	-	NULL	ENSG00000225614		0.726	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		19	0.00	0	G	NG_012236		88494089	88494089	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	missense	4	42.86	3	SNP	0.088	A
ZNF648	127665	genome.wustl.edu	37	1	182025619	182025619	+	Silent	SNP	G	G	A			TCGA-GM-A5PX-01A-12D-A28B-09	TCGA-GM-A5PX-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0212e1a1-d848-4b05-9a51-2dbe17cdd8b8	1f1936a1-2c70-4dd9-845c-44d8262ac43d	g.chr1:182025619G>A	ENST00000339948.3	-	2	1734	c.1527C>T	c.(1525-1527)tgC>tgT	p.C509C		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGGCCCTGCCGCACTCGGCAC	0.622																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0													96.0	80.0	85.0					1																	182025619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1527C>T	1.37:g.182025619G>A			B2RP16	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C509	ENST00000339948.3	37	c.1527	CCDS30952.1	1																																																																																			ZNF648	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179930		0.622	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	97	0.00	0	G	XM_060597		182025619	182025619	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	silent	107	13.60	17	SNP	0.993	A
