#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAD10	80724	genome.wustl.edu	37	12	112174710	112174710	+	Missense_Mutation	SNP	T	T	C			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr12:112174710T>C	ENST00000313698.4	+	12	1771	c.1616T>C	c.(1615-1617)aTg>aCg	p.M539T	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.M539T|ACAD10_ENST00000392636.2_Missense_Mutation_p.M141T|ACAD10_ENST00000455480.2_Missense_Mutation_p.M570T	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	539						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TGTCTCCAAATGGGGCTCCCT	0.483																																						dbGAP											0													136.0	121.0	126.0					12																	112174710		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1616T>C	12.37:g.112174710T>C	ENSP00000325137:p.Met539Thr		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Dehalogen-like_hydro,superfamily_AcylCoA_DH/oxidase,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_Haloacid_DH/epoxide_hydro,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA_v3	p.M570T	ENST00000313698.4	37	c.1709	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	T	0.993	-0.693491	0.03303	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.29	0.836	0.18891	Protein kinase-like domain (1);	0.457119	0.24940	N	0.034398	T	0.11324	0.0276	N	0.05330	-0.07	0.34296	D	0.683785	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.005;0.002;0.003	T	0.30909	-0.9962	10	0.07990	T	0.79	.	6.1957	0.20548	0.0:0.094:0.2883:0.6177	.	570;539;539	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	T	141;539;539;570;539	ENSP00000376411:M141T;ENSP00000446959:M539T;ENSP00000389813:M570T;ENSP00000325137:M539T	ENSP00000325137:M539T	M	+	2	0	ACAD10	110659093	1.000000	0.71417	0.733000	0.30861	0.152000	0.21847	2.312000	0.43726	0.193000	0.20303	0.459000	0.35465	ATG	ACAD10	-	superfamily_Kinase-like_dom	ENSG00000111271		0.483	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	HGNC	protein_coding	OTTHUMT00000368307.1	75	0.00	0	T	NM_025247		112174710	112174710	+1	no_errors	ENST00000455480	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.903	C
ASPDH	554235	genome.wustl.edu	37	19	51017028	51017028	+	Splice_Site	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr19:51017028C>T	ENST00000389208.4	-	1	114		c.e1+1		ASPDH_ENST00000597030.1_Intron|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Intron|JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing						NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGGACTCACCGAGGCGGCC	0.642																																						dbGAP											0													62.0	72.0	69.0					19																	51017028		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0				CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.52+1G>A	19.37:g.51017028C>T			Q6NZ37	Splice_Site	SNP	-	e1+1	ENST00000389208.4	37	c.52+1	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470230	0.43942	.	.	ENSG00000204653	ENST00000389208	.	.	.	3.76	1.37	0.22104	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7738	0.08652	0.2408:0.626:0.0:0.1331	.	.	.	.	.	-1	.	.	.	-	.	.	ASPDH	55708840	0.994000	0.37717	0.789000	0.31954	0.936000	0.57629	2.819000	0.48049	0.705000	0.31890	0.462000	0.41574	.	ASPDH	-	-	ENSG00000204653		0.642	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	HGNC	protein_coding	OTTHUMT00000464861.1	144	0.00	0	C	NM_001024656	Intron	51017028	51017028	-1	no_errors	ENST00000389208	ensembl	human	known	69_37n	splice_site	59	48.70	56	SNP	0.737	T
BCL6	604	genome.wustl.edu	37	3	187446261	187446261	+	Missense_Mutation	SNP	G	G	A	rs535108808		TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr3:187446261G>A	ENST00000406870.2	-	6	1793	c.1427C>T	c.(1426-1428)aCg>aTg	p.T476M	BCL6_ENST00000450123.2_Missense_Mutation_p.T476M|RP11-211G3.3_ENST00000449623.1_Intron|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.T476M	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	476					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GCCGCAGGACGTGCACTTCGG	0.612			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																	dbGAP		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	0													70.0	61.0	64.0					3																	187446261		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1427C>T	3.37:g.187446261G>A	ENSP00000384371:p.Thr476Met		A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T476M	ENST00000406870.2	37	c.1427	CCDS3289.1	3	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901294	0.33535	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.08282	3.11;3.11;3.11	5.09	3.03	0.35002	.	0.337636	0.34314	N	0.004067	T	0.04092	0.0114	N	0.19112	0.55	0.27579	N	0.949638	B;P	0.43024	0.431;0.798	B;B	0.35182	0.107;0.197	T	0.33059	-0.9883	10	0.72032	D	0.01	.	3.1687	0.06545	0.104:0.235:0.5168:0.1443	.	476;476	B8PSA7;P41182	.;BCL6_HUMAN	M	476	ENSP00000384371:T476M;ENSP00000232014:T476M;ENSP00000413122:T476M	ENSP00000232014:T476M	T	-	2	0	BCL6	188928955	0.998000	0.40836	0.964000	0.40570	0.845000	0.48019	3.022000	0.49659	1.372000	0.46190	-0.367000	0.07326	ACG	BCL6	-	NULL	ENSG00000113916		0.612	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6	HGNC	protein_coding	OTTHUMT00000344202.1	35	0.00	0	G	NM_138931		187446261	187446261	-1	no_errors	ENST00000232014	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.825	A
CCAR1	55749	genome.wustl.edu	37	10	70509314	70509317	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	AGAA	AGAA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr10:70509314_70509317delAGAA	ENST00000265872.6	+	10	1109_1112	c.990_993delAGAA	c.(988-993)agagaafs	p.RE330fs	CCAR1_ENST00000535016.1_Frame_Shift_Del_p.RE315fs|CCAR1_ENST00000543719.1_Frame_Shift_Del_p.RE315fs	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	330	Arg-rich.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						GTAGATCGAGAGAAAGATCACCTC	0.417																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.990_993delAGAA	10.37:g.70509314_70509317delAGAA	ENSP00000265872:p.Arg330fs		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Frame_Shift_Del	DEL	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.E331fs	ENST00000265872.6	37	c.990_993	CCDS7282.1	10																																																																																			CCAR1	-	NULL	ENSG00000060339		0.417	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	40	0.00	0	AGAA	NM_018237		70509314	70509317	+1	no_errors	ENST00000265872	ensembl	human	known	69_37n	frame_shift_del	9	47.06	8	DEL	1.000:1.000:1.000:1.000	-
CCDC168	643677	genome.wustl.edu	37	13	103387378	103387378	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr13:103387378G>T	ENST00000322527.2	-	1	1781	c.1782C>A	c.(1780-1782)agC>agA	p.S594R		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	594																	ATATTGGTATGCTTTCCTCCT	0.433																																						dbGAP											0													153.0	127.0	135.0					13																	103387378		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.1782C>A	13.37:g.103387378G>T	ENSP00000320232:p.Ser594Arg		Q8N800	Missense_Mutation	SNP	NULL	p.S594R	ENST00000322527.2	37	c.1782		13	.	.	.	.	.	.	.	.	.	.	G	9.085	1.000297	0.19121	.	.	ENSG00000175820	ENST00000322527	T	0.04015	3.73	3.98	0.483	0.16820	.	1.309990	0.05443	N	0.547968	T	0.03136	0.0092	N	0.19112	0.55	0.09310	N	1	B	0.23650	0.089	B	0.22152	0.038	T	0.46331	-0.9199	10	0.11794	T	0.64	.	3.2423	0.06784	0.1726:0.0:0.3825:0.4449	.	594	Q8NDH2	CC168_HUMAN	R	594	ENSP00000320232:S594R	ENSP00000320232:S594R	S	-	3	2	CCDC168	102185379	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	0.151000	0.16283	0.044000	0.15775	0.557000	0.71058	AGC	CCDC168	-	NULL	ENSG00000175820		0.433	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		32	0.00	0	G	NM_001146197		103387378	103387378	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.001	T
CHTF18	63922	genome.wustl.edu	37	16	847930	847930	+	Silent	SNP	C	C	T	rs17851634		TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr16:847930C>T	ENST00000262315.9	+	22	2946	c.2883C>T	c.(2881-2883)gtC>gtT	p.V961V	CHTF18_ENST00000317063.6_Silent_p.V1170V|CHTF18_ENST00000455171.2_Silent_p.V989V	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	961					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				ACGAGGGTGTCTCCAACGCCG	0.667																																						dbGAP											0													33.0	40.0	38.0					16																	847930		2122	4233	6355	-	-	-	SO:0001819	synonymous_variant	0			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2883C>T	16.37:g.847930C>T			B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.V1170	ENST00000262315.9	37	c.3510	CCDS45371.1	16																																																																																			CHTF18	-	NULL	ENSG00000127586		0.667	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	HGNC	protein_coding	OTTHUMT00000109061.3	37	0.00	0	C	NM_022092		847930	847930	+1	no_errors	ENST00000317063	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.993	T
CNPY2	10330	genome.wustl.edu	37	12	56708704	56708704	+	Silent	SNP	C	C	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr12:56708704C>A	ENST00000273308.4	-	3	675	c.135G>T	c.(133-135)gtG>gtT	p.V45V	RP11-977G19.10_ENST00000549318.1_Silent_p.V45V|CNPY2_ENST00000551720.1_5'UTR|PAN2_ENST00000549090.1_5'Flank|RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.11_ENST00000549860.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	45	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						TCTTGGGGTCCACCTGGGCAA	0.532																																						dbGAP											0													124.0	110.0	115.0					12																	56708704		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.135G>T	12.37:g.56708704C>A			B2R7B9|Q9UHE9	Nonsense_Mutation	SNP	pfam_DUF3456	p.G17*	ENST00000273308.4	37	c.49	CCDS8914.1	12																																																																																			CNPY2	-	pfam_DUF3456	ENSG00000257727		0.532	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY2	HGNC	protein_coding	OTTHUMT00000408546.1	52	0.00	0	C	NM_014255		56708704	56708704	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553191	ensembl	human	known	69_37n	nonsense	30	47.37	27	SNP	0.998	A
DDX51	317781	genome.wustl.edu	37	12	132625824	132625824	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr12:132625824C>T	ENST00000397333.3	-	8	1284	c.1246G>A	c.(1246-1248)Gcc>Acc	p.A416T		NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	416	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		GGATACCTGGCGGCTGTCACA	0.677																																						dbGAP											0													40.0	49.0	46.0					12																	132625824		2030	4176	6206	-	-	-	SO:0001583	missense	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1246G>A	12.37:g.132625824C>T	ENSP00000380495:p.Ala416Thr		A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A416T	ENST00000397333.3	37	c.1246	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	C	19.38	3.816269	0.70912	.	.	ENSG00000185163	ENST00000397333	T	0.01933	4.55	4.79	4.79	0.61399	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.02807	0.0084	N	0.19112	0.55	0.80722	D	1	P	0.43826	0.818	B	0.43478	0.421	T	0.62248	-0.6894	10	0.59425	D	0.04	.	15.3469	0.74346	0.0:1.0:0.0:0.0	.	416	Q8N8A6	DDX51_HUMAN	T	416	ENSP00000380495:A416T	ENSP00000380495:A416T	A	-	1	0	DDX51	131191777	1.000000	0.71417	0.944000	0.38274	0.256000	0.26092	6.806000	0.75195	2.208000	0.71279	0.591000	0.81541	GCC	DDX51	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000185163		0.677	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	59	0.00	0	C	NM_175066		132625824	132625824	-1	no_errors	ENST00000397333	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	0.999	T
ERCC6L	54821	genome.wustl.edu	37	X	71427063	71427063	+	Silent	SNP	T	T	C			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chrX:71427063T>C	ENST00000334463.3	-	2	1689	c.1554A>G	c.(1552-1554)aaA>aaG	p.K518K	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Silent_p.K395K	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	518	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AGTTAATTCTTTTTTCTCGTT	0.378																																						dbGAP											0													100.0	91.0	94.0					X																	71427063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1554A>G	X.37:g.71427063T>C			Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K518	ENST00000334463.3	37	c.1554	CCDS35329.1	X																																																																																			ERCC6L	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000186871		0.378	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2	60	0.00	0	T	NM_017669		71427063	71427063	-1	no_errors	ENST00000334463	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	0.993	C
F13B	2165	genome.wustl.edu	37	1	197024886	197024886	+	Missense_Mutation	SNP	C	C	T	rs192220037		TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr1:197024886C>T	ENST00000367412.1	-	8	1356	c.1313G>A	c.(1312-1314)cGt>cAt	p.R438H		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	438	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.R438H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TTGTTCGCAACGAGATATTTT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		16038	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											137.0	132.0	134.0					1																	197024886		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1313G>A	1.37:g.197024886C>T	ENSP00000356382:p.Arg438His		A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R438H	ENST00000367412.1	37	c.1313	CCDS1388.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	1.468	-0.560719	0.03939	.	.	ENSG00000143278	ENST00000367412	T	0.64438	-0.1	5.84	-2.74	0.05932	Complement control module (2);Sushi/SCR/CCP (3);	0.812933	0.10027	N	0.725233	T	0.30916	0.0780	N	0.05574	-0.02	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.18524	-1.0334	10	0.13108	T	0.6	.	3.4685	0.07558	0.3708:0.2214:0.0:0.4078	.	438	P05160	F13B_HUMAN	H	438	ENSP00000356382:R438H	ENSP00000356382:R438H	R	-	2	0	F13B	195291509	0.003000	0.15002	0.015000	0.15790	0.032000	0.12392	-0.152000	0.10159	-0.376000	0.07943	-0.469000	0.05056	CGT	F13B	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143278		0.413	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	27	0.00	0	C	NM_001994		197024886	197024886	-1	no_errors	ENST00000367412	ensembl	human	known	69_37n	missense	29	40.82	20	SNP	0.000	T
HAUS8	93323	genome.wustl.edu	37	19	17163685	17163686	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr19:17163685_17163686insA	ENST00000253669.5	-	10	1068_1069	c.878_879insT	c.(877-879)ttafs	p.L293fs	HAUS8_ENST00000593360.1_Frame_Shift_Ins_p.L232fs|CTD-2528A14.3_ENST00000598893.1_RNA|HAUS8_ENST00000448593.2_Frame_Shift_Ins_p.L292fs			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	293					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						GTTCGCTCAGTAAGTCCAGCAC	0.54											OREG0025339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.879dupT	19.37:g.17163687_17163687dupA	ENSP00000253669:p.Leu293fs	715	B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Frame_Shift_Ins	INS	NULL	p.L293fs	ENST00000253669.5	37	c.879_878	CCDS32948.1	19																																																																																			HAUS8	-	NULL	ENSG00000131351		0.540	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HAUS8	HGNC	protein_coding	OTTHUMT00000463015.1	48	0.00	0	-	NM_001011699		17163685	17163686	-1	no_errors	ENST00000253669	ensembl	human	known	69_37n	frame_shift_ins	29	39.58	19	INS	0.005:0.005	A
HCFC1	3054	genome.wustl.edu	37	X	153220825	153220825	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chrX:153220825C>T	ENST00000310441.7	-	17	3991	c.3025G>A	c.(3025-3027)Gtc>Atc	p.V1009I	HCFC1_ENST00000369984.4_Missense_Mutation_p.V1009I|HCFC1_ENST00000354233.3_Missense_Mutation_p.V940I	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1009					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCAAGGTGACAGTGCCAGGC	0.617																																						dbGAP											0													83.0	85.0	84.0					X																	153220825		2187	4252	6439	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.3025G>A	X.37:g.153220825C>T	ENSP00000309555:p.Val1009Ile		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.V1009I	ENST00000310441.7	37	c.3025	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491014	0.84962	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03831	3.84;3.84;3.79	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.15392	0.0371	L	0.52573	1.65	0.47778	D	0.99951	P	0.44690	0.841	P	0.58820	0.846	T	0.00282	-1.1850	10	0.59425	D	0.04	.	16.2902	0.82747	0.0:1.0:0.0:0.0	.	1009	P51610	HCFC1_HUMAN	I	1009;1009;940	ENSP00000309555:V1009I;ENSP00000359001:V1009I;ENSP00000346174:V940I	ENSP00000309555:V1009I	V	-	1	0	HCFC1	152874019	1.000000	0.71417	0.751000	0.31187	0.645000	0.38454	6.987000	0.76206	2.098000	0.63641	0.436000	0.28706	GTC	HCFC1	-	NULL	ENSG00000172534		0.617	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	92	0.00	0	C	NM_005334		153220825	153220825	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	46	45.88	39	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141526899	141526899	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr2:141526899G>A	ENST00000389484.3	-	35	6612	c.5641C>T	c.(5641-5643)Ctt>Ttt	p.L1881F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1881					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAGTACATAAGAAATGATTCT	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													61.0	61.0	61.0					2																	141526899		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5641C>T	2.37:g.141526899G>A	ENSP00000374135:p.Leu1881Phe		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L1881F	ENST00000389484.3	37	c.5641	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183495	0.78677	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94232	-3.38	5.59	4.68	0.58851	.	0.174576	0.38663	N	0.001618	D	0.95056	0.8399	M	0.91872	3.25	0.49130	D	0.999756	P	0.52577	0.954	P	0.48454	0.578	D	0.94642	0.7831	10	0.66056	D	0.02	.	9.5257	0.39162	0.0791:0.0:0.7805:0.1405	.	1881	Q9NZR2	LRP1B_HUMAN	F	1881;1819	ENSP00000374135:L1881F	ENSP00000374135:L1881F	L	-	1	0	LRP1B	141243369	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.947000	0.56652	1.282000	0.44496	0.655000	0.94253	CTT	LRP1B	-	NULL	ENSG00000168702		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	70	0.00	0	G	NM_018557		141526899	141526899	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	42	39.13	27	SNP	1.000	A
IFIH1	64135	genome.wustl.edu	37	2	163130442	163130442	+	Missense_Mutation	SNP	C	C	T	rs201472224		TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr2:163130442C>T	ENST00000263642.2	-	12	2712	c.2317G>A	c.(2317-2319)Gaa>Aaa	p.E773K		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	773	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CTAATGACTTCTTTTTGTTCA	0.294																																						dbGAP											0													92.0	88.0	89.0					2																	163130442		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2317G>A	2.37:g.163130442C>T	ENSP00000263642:p.Glu773Lys		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_DEATH-like,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E773K	ENST00000263642.2	37	c.2317	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933347	0.92458	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.75938	-0.98	5.63	5.63	0.86233	Helicase, C-terminal (3);	0.141476	0.64402	D	0.000005	T	0.71745	0.3376	L	0.38175	1.15	0.53005	D	0.999969	P	0.51057	0.941	P	0.48425	0.577	T	0.71265	-0.4644	10	0.38643	T	0.18	-22.1524	15.1809	0.72956	0.0:0.8594:0.1406:0.0	.	773	Q9BYX4	IFIH1_HUMAN	K	773	ENSP00000263642:E773K	ENSP00000263642:E773K	E	-	1	0	IFIH1	162838688	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.851000	0.62896	2.636000	0.89361	0.655000	0.94253	GAA	IFIH1	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000115267		0.294	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2	74	0.00	0	C	NM_022168		163130442	163130442	-1	no_errors	ENST00000263642	ensembl	human	known	69_37n	missense	33	37.74	20	SNP	1.000	T
MRPS28	28957	genome.wustl.edu	37	8	80831317	80831317	+	Silent	SNP	C	C	G			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr8:80831317C>G	ENST00000276585.4	-	3	484	c.462G>C	c.(460-462)ctG>ctC	p.L154L	MRPS28_ENST00000521605.1_3'UTR|MRPS28_ENST00000521434.1_Silent_p.L92L	NM_014018.2	NP_054737.1	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S28	154						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)|skin(1)	5	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)			TTGTTGCTCCCAGGAACCTAG	0.383																																						dbGAP											0													139.0	138.0	138.0					8																	80831317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061209	CCDS6226.1	8q21.1-q21.2	2012-09-13			ENSG00000147586	ENSG00000147586		"""Mitochondrial ribosomal proteins / small subunits"""	14513	protein-coding gene	gene with protein product		611990				11279123, 11042152	Standard	NM_014018		Approved	MRP-S28, HSPC007, MRPS35	uc003ybp.3	Q9Y2Q9	OTTHUMG00000164642	ENST00000276585.4:c.462G>C	8.37:g.80831317C>G			B2RDZ7|Q96Q21	Missense_Mutation	SNP	pfam_Ribosomal_S28_mit,superfamily_NA-bd_OB-fold-like	p.G110R	ENST00000276585.4	37	c.328	CCDS6226.1	8	.	.	.	.	.	.	.	.	.	.	C	8.946	0.967082	0.18659	.	.	ENSG00000147586	ENST00000519386	.	.	.	5.78	4.0	0.46444	.	.	.	.	.	T	0.62332	0.2419	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58725	-0.7586	4	.	.	.	.	11.2475	0.49006	0.0:0.8503:0.0:0.1497	.	.	.	.	R	110	.	.	G	-	1	0	MRPS28	80993872	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.543000	0.36147	0.792000	0.33850	0.650000	0.86243	GGG	MRPS28	-	pfam_Ribosomal_S28_mit,superfamily_NA-bd_OB-fold-like	ENSG00000147586		0.383	MRPS28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS28	HGNC	protein_coding	OTTHUMT00000379526.1	81	0.00	0	C	NM_014018		80831317	80831317	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519386	ensembl	human	putative	69_37n	missense	45	25.81	16	SNP	1.000	G
MUC12	10071	genome.wustl.edu	37	7	100639153	100639153	+	Missense_Mutation	SNP	C	C	T	rs202107976	byFrequency	TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr7:100639153C>T	ENST00000379442.3	+	5	5738	c.5738C>T	c.(5737-5739)aCg>aTg	p.T1913M	MUC12_ENST00000536621.1_Missense_Mutation_p.T1770M			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1913	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAGAATCTACGGCGTACCAC	0.552													-|||	2299	0.459065	0.3177	0.3617	5008	,	,		10874	0.6071		0.506	False		,,,				2504	0.5184					dbGAP											0													5.0	4.0	4.0					7																	100639153		678	1506	2184	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5738C>T	7.37:g.100639153C>T	ENSP00000368755:p.Thr1913Met		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.T1913M	ENST00000379442.3	37	c.5738		7	.	.	.	.	.	.	.	.	.	.	-	0.755	-0.771290	0.02951	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12255	2.7;2.7	0.918	-0.258	0.12975	.	.	.	.	.	T	0.06872	0.0175	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.30937	-0.9961	6	0.66056	D	0.02	.	4.5809	0.12259	0.0:0.5867:0.4133:0.0	.	.	.	.	M	1913;1770	ENSP00000368755:T1913M;ENSP00000441929:T1770M	ENSP00000368755:T1913M	T	+	2	0	MUC12	100425873	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.239000	0.18023	-0.078000	0.12730	0.173000	0.16961	ACG	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	26	0.00	0	C	XM_379904		100639153	100639153	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.000	T
MUC12	10071	genome.wustl.edu	37	7	100647652	100647652	+	Missense_Mutation	SNP	C	C	T	rs111660528	byFrequency	TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr7:100647652C>T	ENST00000379442.3	+	5	14237	c.14237C>T	c.(14236-14238)aCg>aTg	p.T4746M	MUC12_ENST00000536621.1_Missense_Mutation_p.T4603M			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4746	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.T4603M(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAGAATCTACGGCGTACCAC	0.552													-|||	2344	0.468051	0.3411	0.3646	5008	,	,		9440	0.6081		0.5139	False		,,,				2504	0.5215					dbGAP											1	Substitution - Missense(1)	stomach(1)											11.0	9.0	10.0					7																	100647652		691	1543	2234	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.14237C>T	7.37:g.100647652C>T	ENSP00000368755:p.Thr4746Met		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.T4746M	ENST00000379442.3	37	c.14237		7	1003	0.4592490842490842	195	0.39634146341463417	131	0.36187845303867405	327	0.5716783216783217	350	0.46174142480211083	-	0.573	-0.840319	0.02692	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12255	2.7;2.7	0.851	-0.418	0.12344	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.33523	-0.9865	6	0.56958	D	0.05	.	2.9267	0.05786	0.3031:0.3947:0.3022:0.0	.	.	.	.	M	4746;4603	ENSP00000368755:T4746M;ENSP00000441929:T4603M	ENSP00000368755:T4746M	T	+	2	0	MUC12	100434372	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.169000	0.09911	-0.095000	0.12351	0.064000	0.15345	ACG	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	31	0.00	0	C	XM_379904		100647652	100647652	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.001	T
NLRP11	204801	genome.wustl.edu	37	19	56320768	56320768	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr19:56320768C>T	ENST00000589093.1	-	3	1301	c.1208G>A	c.(1207-1209)gGa>gAa	p.G403E	NLRP11_ENST00000592953.1_Missense_Mutation_p.G304E|NLRP11_ENST00000589824.2_Missense_Mutation_p.G403E|NLRP11_ENST00000443188.1_Missense_Mutation_p.G403E|NLRP11_ENST00000360133.3_Missense_Mutation_p.G403E			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	403	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AAACAGTCCTCCTGCAGCCAG	0.493																																						dbGAP											0													71.0	72.0	72.0					19																	56320768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1208G>A	19.37:g.56320768C>T	ENSP00000466285:p.Gly403Glu		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.G403E	ENST00000589093.1	37	c.1208	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.181415	0.00308	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.70631	-0.5;-0.42	2.2	1.16	0.20824	.	.	.	.	.	T	0.24392	0.0591	N	0.00223	-1.815	0.09310	N	1	B;B	0.15719	0.008;0.014	B;B	0.12156	0.003;0.007	T	0.40887	-0.9539	9	0.02654	T	1	.	3.5945	0.08001	0.0:0.2159:0.0:0.7841	.	403;403	P59045;P59045-2	NAL11_HUMAN;.	E	403	ENSP00000409898:G403E;ENSP00000353251:G403E	ENSP00000353251:G403E	G	-	2	0	NLRP11	61012580	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.253000	0.18296	0.304000	0.22809	-0.302000	0.09304	GGA	NLRP11	-	NULL	ENSG00000179873		0.493	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	32	0.00	0	C	NM_145007		56320768	56320768	-1	no_errors	ENST00000443188	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.001	T
PPP1R15B	84919	genome.wustl.edu	37	1	204379009	204379009	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr1:204379009C>G	ENST00000367188.4	-	1	1910	c.1531G>C	c.(1531-1533)Gag>Cag	p.E511Q	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	511					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			AAATCCTTCTCTGAATCAGAA	0.468																																						dbGAP											0													56.0	60.0	59.0					1																	204379009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1531G>C	1.37:g.204379009C>G	ENSP00000356156:p.Glu511Gln		Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15B_N,pfam_Prot_Pase1_reg-su15A/B_C	p.E511Q	ENST00000367188.4	37	c.1531	CCDS1445.1	1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914438	0.52546	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.28069	1.63	5.38	3.48	0.39840	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.804103	0.11484	N	0.559396	T	0.35422	0.0931	M	0.70595	2.14	0.09310	N	1	B	0.34103	0.437	B	0.36885	0.235	T	0.22695	-1.0209	10	0.51188	T	0.08	-1.3218	9.0975	0.36647	0.0:0.7749:0.1467:0.0784	.	511	Q5SWA1	PR15B_HUMAN	Q	511;421	ENSP00000356156:E511Q	ENSP00000356156:E511Q	E	-	1	0	PPP1R15B	202645632	0.003000	0.15002	0.001000	0.08648	0.845000	0.48019	1.274000	0.33132	0.618000	0.30179	0.655000	0.94253	GAG	PPP1R15B	-	pfam_Prot_Pase1_reg-su15A/B_C	ENSG00000158615		0.468	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	HGNC	protein_coding	OTTHUMT00000087974.1	32	0.00	0	C	NM_032833		204379009	204379009	-1	no_errors	ENST00000367188	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.005	G
PPP2R5B	5526	genome.wustl.edu	37	11	64693374	64693374	+	Silent	SNP	G	G	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr11:64693374G>A	ENST00000164133.2	+	2	790	c.168G>A	c.(166-168)caG>caA	p.Q56Q		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	56					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						AGAGCAACCAGCAAGAGCTCA	0.692																																						dbGAP											0													21.0	21.0	21.0					11																	64693374		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.168G>A	11.37:g.64693374G>A			Q13853	Silent	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.Q56	ENST00000164133.2	37	c.168	CCDS8085.1	11																																																																																			PPP2R5B	-	pirsf_PP2A_B56	ENSG00000068971		0.692	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	29	0.00	0	G	NM_006244		64693374	64693374	+1	no_errors	ENST00000164133	ensembl	human	known	69_37n	silent	3	86.36	19	SNP	1.000	A
PTCHD4	442213	genome.wustl.edu	37	6	48035986	48035986	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr6:48035986G>A	ENST00000339488.4	-	1	439	c.406C>T	c.(406-408)Cga>Tga	p.R136*	PTCHD4_ENST00000543600.1_Nonsense_Mutation_p.R119*	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	136						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AGCACGGCTCGGTGGGTCTGC	0.512																																						dbGAP											0													87.0	92.0	91.0					6																	48035986		1871	4110	5981	-	-	-	SO:0001587	stop_gained	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.406C>T	6.37:g.48035986G>A	ENSP00000341914:p.Arg136*		B0QZ29|B4DRK3|Q5T884	Nonsense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.R136*	ENST00000339488.4	37	c.406	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.679017|5.679017	0.96764|0.96764	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000398738|ENST00000339488;ENST00000543600	.|.	.|.	.|.	5.13|5.13	4.27|4.27	0.50696|0.50696	.|.	.|0.862163	.|0.10207	.|N	.|0.702624	T|.	0.27765|.	0.0683|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.08576|.	-1.0715|.	3|.	.|0.12766	.|T	.|0.61	.|.	13.8513|13.8513	0.63499|0.63499	0.0743:0.0:0.9257:0.0|0.0743:0.0:0.9257:0.0	.|.	.|.	.|.	.|.	L|X	135|136;119	.|.	.|ENSP00000341914:R136X	P|R	-|-	2|1	0|2	C6orf138|C6orf138	48143945|48143945	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.531000|3.531000	0.53546|0.53546	1.161000|1.161000	0.42604|0.42604	-0.214000|-0.214000	0.12660|0.12660	CCG|CGA	PTCHD4	-	NULL	ENSG00000244694		0.512	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	55	0.00	0	G	NM_001013732		48035986	48035986	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	nonsense	32	27.27	12	SNP	1.000	A
RUNX1T1	862	genome.wustl.edu	37	8	93003894	93003894	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr8:93003894C>T	ENST00000523629.1	-	7	1418	c.964G>A	c.(964-966)Gac>Aac	p.D322N	RUNX1T1_ENST00000518844.1_Missense_Mutation_p.D295N|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.D285N|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.D295N|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.D285N|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.D285N|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.D322N|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.D333N	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	322					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCCCTGAGGTCCCTGTGGCTG	0.522																																						dbGAP											0													184.0	171.0	175.0					8																	93003894		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.964G>A	8.37:g.93003894C>T	ENSP00000428543:p.Asp322Asn		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.D333N	ENST00000523629.1	37	c.997	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923132	0.73213	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.32753	1.45;1.49;1.45;1.49;1.49;1.49;1.44;1.49	6.17	6.17	0.99709	.	0.041485	0.85682	D	0.000000	T	0.27594	0.0678	L	0.29908	0.895	0.80722	D	1	B;B;B	0.33549	0.417;0.177;0.27	B;B;B	0.32211	0.142;0.141;0.102	T	0.01688	-1.1295	10	0.34782	T	0.22	-26.9707	20.4745	0.99168	0.0:1.0:0.0:0.0	.	333;322;295	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	N	322;295;322;285;285;285;333;295	ENSP00000428543:D322N;ENSP00000379520:D295N;ENSP00000265814:D322N;ENSP00000353504:D285N;ENSP00000390137:D285N;ENSP00000428742:D285N;ENSP00000402257:D333N;ENSP00000430728:D295N	ENSP00000265814:D322N	D	-	1	0	RUNX1T1	93073070	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GAC	RUNX1T1	-	NULL	ENSG00000079102		0.522	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	218	0.00	0	C	NM_004349, NM_175635		93003894	93003894	-1	no_errors	ENST00000436581	ensembl	human	known	69_37n	missense	179	15.17	32	SNP	1.000	T
RUNX1T1	862	genome.wustl.edu	37	8	93003921	93003921	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr8:93003921C>A	ENST00000523629.1	-	7	1391	c.937G>T	c.(937-939)Gac>Tac	p.D313Y	RUNX1T1_ENST00000518844.1_Missense_Mutation_p.D286Y|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.D276Y|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.D286Y|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.D276Y|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.D276Y|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.D313Y|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.D324Y	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	313					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CGATAGGAGTCCCTGTAGTGG	0.547																																						dbGAP											0													212.0	179.0	190.0					8																	93003921		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.937G>T	8.37:g.93003921C>A	ENSP00000428543:p.Asp313Tyr		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.D324Y	ENST00000523629.1	37	c.970	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.167707	0.94768	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	M	0.70595	2.14	0.80722	D	1	P;D;D	0.64830	0.93;0.99;0.994	P;P;D	0.68483	0.496;0.905;0.958	T	0.54899	-0.8224	10	0.42905	T	0.14	-26.9707	20.4745	0.99168	0.0:1.0:0.0:0.0	.	324;313;286	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	Y	313;286;313;276;276;276;324;286	ENSP00000428543:D313Y;ENSP00000379520:D286Y;ENSP00000265814:D313Y;ENSP00000353504:D276Y;ENSP00000390137:D276Y;ENSP00000428742:D276Y;ENSP00000402257:D324Y;ENSP00000430728:D286Y	ENSP00000265814:D313Y	D	-	1	0	RUNX1T1	93073097	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GAC	RUNX1T1	-	NULL	ENSG00000079102		0.547	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	195	0.00	0	C	NM_004349, NM_175635		93003921	93003921	-1	no_errors	ENST00000436581	ensembl	human	known	69_37n	missense	171	14.93	30	SNP	1.000	A
SLC9A7P1	121456	genome.wustl.edu	37	12	98850566	98850567	+	RNA	INS	-	-	C			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr12:98850566_98850567insC	ENST00000554295.1	-	0	356_357					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		CCAACGATGAGCCCACAGATCA	0.55																																						dbGAP											0																																										-	-	-			0					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98850569_98850569dupC				RNA	INS	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-	ENSG00000227825		0.550	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	77	0.00	0	-			98850566	98850567	-1	no_errors	ENST00000554295	ensembl	human	putative	69_37n	rna	54	37.21	32	INS	1.000:0.998	C
SSR2	6746	genome.wustl.edu	37	1	155989928	155989928	+	Missense_Mutation	SNP	G	G	C	rs146742067	byFrequency	TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr1:155989928G>C	ENST00000295702.4	-	2	102	c.31C>G	c.(31-33)Cta>Gta	p.L11V	SSR2_ENST00000529008.1_Missense_Mutation_p.L11V|SSR2_ENST00000480567.1_Missense_Mutation_p.L11V|SSR2_ENST00000496742.1_Missense_Mutation_p.L11V	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	11					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACAGCAAATAGAGCCAACACC	0.468																																						dbGAP											0													98.0	90.0	93.0					1																	155989928		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.31C>G	1.37:g.155989928G>C	ENSP00000295702:p.Leu11Val		B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Missense_Mutation	SNP	pfam_TRAP_beta,pirsf_TRAP_beta	p.L11V	ENST00000295702.4	37	c.31	CCDS1126.1	1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211567	0.58343	.	.	ENSG00000163479	ENST00000295702;ENST00000529008;ENST00000496742;ENST00000480567;ENST00000531917;ENST00000526212	.	.	.	5.06	3.16	0.36331	.	0.079346	0.52532	D	0.000061	T	0.21267	0.0512	L	0.33189	0.99	0.40475	D	0.98038	B;B;B	0.19817	0.016;0.039;0.001	B;B;B	0.19946	0.027;0.027;0.002	T	0.07424	-1.0773	9	0.11485	T	0.65	-0.5696	8.5959	0.33714	0.0864:0.1539:0.7597:0.0	.	32;30;11	Q6MZE4;B4DUJ9;P43308	.;.;SSRB_HUMAN	V	11	.	ENSP00000295702:L11V	L	-	1	2	SSR2	154256552	1.000000	0.71417	0.266000	0.24541	0.977000	0.68977	3.136000	0.50554	0.507000	0.28148	0.430000	0.28490	CTA	SSR2	-	pfam_TRAP_beta,pirsf_TRAP_beta	ENSG00000163479		0.468	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSR2	HGNC	protein_coding	OTTHUMT00000046172.2	43	0.00	0	G	NM_003145		155989928	155989928	-1	no_errors	ENST00000295702	ensembl	human	known	69_37n	missense	23	53.06	26	SNP	0.943	C
SSTR1	6751	genome.wustl.edu	37	14	38679347	38679347	+	Silent	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr14:38679347C>T	ENST00000267377.2	+	3	1370	c.753C>T	c.(751-753)cgC>cgT	p.R251R		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	251					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	CTAAGATGCGCATGGTGGCCC	0.577																																						dbGAP											0													54.0	51.0	52.0					14																	38679347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.753C>T	14.37:g.38679347C>T				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt_1,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt,prints_Neuropept_W_rcpt,prints_P2_purnocptor	p.R251	ENST00000267377.2	37	c.753	CCDS9666.1	14																																																																																			SSTR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt,prints_P2_purnocptor	ENSG00000139874		0.577	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR1	HGNC	protein_coding	OTTHUMT00000409930.2	45	0.00	0	C			38679347	38679347	+1	no_errors	ENST00000267377	ensembl	human	known	69_37n	silent	34	25.53	12	SNP	1.000	T
SULT2B1	6820	genome.wustl.edu	37	19	49094928	49094928	+	Silent	SNP	C	C	T			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr19:49094928C>T	ENST00000201586.2	+	4	664	c.486C>T	c.(484-486)atC>atT	p.I162I	SULT2B1_ENST00000323090.4_Silent_p.I147I|SULT2B1_ENST00000594274.1_3'UTR	NM_177973.1	NP_814444.1	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	162					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	alcohol sulfotransferase activity (GO:0004027)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	11		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		ACTCCAAGATCGCCGGGCAGT	0.622																																						dbGAP											0													47.0	41.0	43.0					19																	49094928		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U92314	CCDS12723.1, CCDS12724.1	19q13.3	2008-02-05				ENSG00000088002		"""Sulfotransferases, cytosolic"""	11459	protein-coding gene	gene with protein product		604125				9799594	Standard	NM_177973		Approved	HSST2	uc002pjl.3	O00204		ENST00000201586.2:c.486C>T	19.37:g.49094928C>T			O00205|O75814	Silent	SNP	pfam_Sulfotransferase_dom	p.I162	ENST00000201586.2	37	c.486	CCDS12723.1	19																																																																																			SULT2B1	-	pfam_Sulfotransferase_dom	ENSG00000088002		0.622	SULT2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULT2B1	HGNC	protein_coding	OTTHUMT00000466140.1	66	0.00	0	C	NM_004605		49094928	49094928	+1	no_errors	ENST00000201586	ensembl	human	known	69_37n	silent	24	50.00	25	SNP	0.055	T
TMEM164	84187	genome.wustl.edu	37	X	109246780	109246780	+	5'UTR	SNP	C	C	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chrX:109246780C>A	ENST00000372073.1	+	0	114				TMEM164_ENST00000372068.2_5'UTR|TMEM164_ENST00000372072.3_Intron|TMEM164_ENST00000288381.4_5'UTR			Q5U3C3	TM164_HUMAN	transmembrane protein 164							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						ACTGGAGAAGCGCGGGGGGCT	0.572																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.-223C>A	X.37:g.109246780C>A			B3KSQ8|F5H2P2	RNA	SNP	-	NULL	ENST00000372073.1	37	NULL	CCDS14550.2	X																																																																																			TMEM164	-	-	ENSG00000157600		0.572	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM164	HGNC	protein_coding	OTTHUMT00000057898.1	66	0.00	0	C	NM_032227		109246780	109246780	+1	no_errors	ENST00000497754	ensembl	human	known	69_37n	rna	55	18.84	13	SNP	0.995	A
TTN	7273	genome.wustl.edu	37	2	179614554	179614554	+	Intron	SNP	T	T	A			TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr2:179614554T>A	ENST00000591111.1	-	45	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Silent_p.T4191T|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGAAACCATGTTACAACTG	0.368																																						dbGAP											0													54.0	58.0	56.0					2																	179614554		2199	4296	6495	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3296A>T	2.37:g.179614554T>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T4191	ENST00000591111.1	37	c.12573		2																																																																																			TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	42	0.00	0	T	NM_133378		179614554	179614554	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	silent	36	20.00	9	SNP	0.000	A
ZNF141	7700	genome.wustl.edu	37	4	376653	376653	+	3'UTR	SNP	C	C	T	rs56038510	byFrequency	TCGA-LL-A5YM-01A-11D-A28B-09	TCGA-LL-A5YM-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ad4322ee-f3f7-42de-8510-6b7e64a91662	2453a8b7-bf16-47c9-9452-cecd1c18f2d3	g.chr4:376653C>T	ENST00000579770.1	+	0	410				ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron			Q15928	ZN141_HUMAN	zinc finger protein 141						anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						gggatagttacacaagacacA	0.408													T|||	2153	0.429912	0.6067	0.3199	5008	,	,		18145	0.3185		0.3976	False		,,,				2504	0.4172					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000579770.1:c.*407C>T	4.37:g.376653C>T			Q6DK07	RNA	SNP	-	NULL	ENST00000579770.1	37	NULL		4																																																																																			ZNF141	-	-	ENSG00000131127		0.408	ZNF141-010	KNOWN	basic	processed_transcript	ZNF141	HGNC	protein_coding	OTTHUMT00000446592.1	8	0.00	0	C	NM_003441		376653	376653	+1	no_errors	ENST00000579770	ensembl	human	known	69_37n	rna	5	44.44	4	SNP	0.017	T
