#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169851965	169851965	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr2:169851965G>A	ENST00000263817.6	-	7	629	c.505C>T	c.(505-507)Cgt>Tgt	p.R169C		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	169	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TGTATCTGACGAGCTGCGGCA	0.353																																						dbGAP											0													75.0	70.0	71.0					2																	169851965		1837	4097	5934	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.505C>T	2.37:g.169851965G>A	ENSP00000263817:p.Arg169Cys		Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R169C	ENST00000263817.6	37	c.505	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318686	0.60524	.	.	ENSG00000073734	ENST00000263817	T	0.80123	-1.34	4.94	4.94	0.65067	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.335861	0.33272	N	0.005099	D	0.91676	0.7369	M	0.92122	3.275	0.58432	D	0.999998	D	0.76494	0.999	D	0.64877	0.93	D	0.93897	0.7185	10	0.87932	D	0	-0.5322	18.1785	0.89769	0.0:0.0:1.0:0.0	.	169	O95342	ABCBB_HUMAN	C	169	ENSP00000263817:R169C	ENSP00000263817:R169C	R	-	1	0	ABCB11	169560211	1.000000	0.71417	0.974000	0.42286	0.416000	0.31233	4.587000	0.60991	2.263000	0.75096	0.655000	0.94253	CGT	ABCB11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000073734		0.353	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	37	0.00	0	G	NM_003742		169851965	169851965	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.999	A
ADNP2	22850	genome.wustl.edu	37	18	77895022	77895022	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr18:77895022C>T	ENST00000262198.4	+	4	2181	c.1726C>T	c.(1726-1728)Ctg>Ttg	p.L576L		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	576					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CACCAACATTCTGCCTGTGAA	0.547																																						dbGAP											0													104.0	97.0	99.0					18																	77895022		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1726C>T	18.37:g.77895022C>T			A8K951|O94943|Q9H9P3	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.L576	ENST00000262198.4	37	c.1726	CCDS32853.1	18																																																																																			ADNP2	-	NULL	ENSG00000101544		0.547	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	36	0.00	0	C	NM_014913		77895022	77895022	+1	no_errors	ENST00000262198	ensembl	human	known	69_37n	silent	34	12.82	5	SNP	0.971	T
AFAP1	60312	genome.wustl.edu	37	4	7802238	7802238	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr4:7802238C>T	ENST00000360265.4	-	9	1431	c.1197G>A	c.(1195-1197)ccG>ccA	p.P399P	AFAP1_ENST00000420658.1_Silent_p.P399P|AFAP1_ENST00000513842.1_5'Flank|AFAP1_ENST00000382543.3_Silent_p.P399P|AFAP1_ENST00000358461.2_Silent_p.P399P			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	399	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						AATCCAAACCCGGGATCACCT	0.537																																						dbGAP											0													119.0	104.0	109.0					4																	7802238		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1197G>A	4.37:g.7802238C>T			A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P399	ENST00000360265.4	37	c.1197	CCDS3397.1	4																																																																																			AFAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000196526		0.537	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1	HGNC	protein_coding	OTTHUMT00000246842.2	31	0.00	0	C	NM_021638		7802238	7802238	-1	no_errors	ENST00000420658	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.072	T
AGBL4	84871	genome.wustl.edu	37	1	49119117	49119117	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:49119117A>G	ENST00000371839.1	-	8	847	c.731T>C	c.(730-732)aTt>aCt	p.I244T	AGBL4_ENST00000334103.7_5'UTR|AGBL4_ENST00000371838.1_Missense_Mutation_p.I244T	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	244					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		AAGGAAGTCAATGATCCCTAG	0.463																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.731T>C	1.37:g.49119117A>G	ENSP00000360905:p.Ile244Thr		B3KT26|B4DG37	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14	p.I244T	ENST00000371839.1	37	c.731	CCDS44137.1	1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.362613	0.82353	.	.	ENSG00000186094	ENST00000371839;ENST00000411952;ENST00000371838	T;T	0.13901	2.55;2.55	5.84	5.84	0.93424	Peptidase M14, carboxypeptidase A (1);	0.000000	0.85682	D	0.000000	T	0.46034	0.1372	M	0.89715	3.055	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.996;0.996	D;D;D;D	0.83275	0.939;0.996;0.985;0.978	T	0.54820	-0.8236	9	.	.	.	-25.2262	15.3978	0.74812	1.0:0.0:0.0:0.0	.	59;256;89;244	A0AVJ2;Q5VU57-2;B1AMW2;Q5VU57	.;.;.;CBPC6_HUMAN	T	244;238;244	ENSP00000360905:I244T;ENSP00000360904:I244T	.	I	-	2	0	AGBL4	48891704	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.948000	0.93006	2.231000	0.72958	0.533000	0.62120	ATT	AGBL4	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000186094		0.463	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL4	HGNC	protein_coding	OTTHUMT00000021346.4	42	0.00	0	A	NM_032785		49119117	49119117	-1	no_errors	ENST00000371839	ensembl	human	known	69_37n	missense	30	37.50	18	SNP	1.000	G
PHYKPL	85007	genome.wustl.edu	37	5	177641822	177641822	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr5:177641822C>T	ENST00000308158.5	-	10	1381	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	383						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GCAGCCTCTTCAGTTGCTGGT	0.512																																						dbGAP											0													100.0	93.0	95.0					5																	177641822		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1147G>A	5.37:g.177641822C>T	ENSP00000310978:p.Glu383Lys		A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E383K	ENST00000308158.5	37	c.1147	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668588	0.29604	.	.	ENSG00000175309	ENST00000308158	T	0.20069	2.1	5.45	3.64	0.41730	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.224065	0.46442	D	0.000291	T	0.14787	0.0357	L	0.39633	1.23	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.10450	0.003;0.005	T	0.06826	-1.0805	10	0.13470	T	0.59	-25.9543	8.5242	0.33296	0.0:0.7574:0.1576:0.0851	.	383;383	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	K	383	ENSP00000310978:E383K	ENSP00000310978:E383K	E	-	1	0	AGXT2L2	177574428	0.991000	0.36638	0.890000	0.34922	0.819000	0.46315	3.013000	0.49582	1.270000	0.44297	0.561000	0.74099	GAA	AGXT2L2	-	superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000175309		0.512	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	40	0.00	0	C	NM_032921		177641822	177641822	-1	no_errors	ENST00000308158	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.991	T
AKAP13	11214	genome.wustl.edu	37	15	86284594	86284594	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr15:86284594G>C	ENST00000394518.2	+	35	8021	c.7926G>C	c.(7924-7926)caG>caC	p.Q2642H	AKAP13_ENST00000394510.2_Missense_Mutation_p.Q887H|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.Q2646H|RP11-158M2.3_ENST00000558375.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2642	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						AGCTCCAGCAGAAGAAGGGCA	0.662																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													48.0	44.0	45.0					15																	86284594		2199	4298	6497	-	-	-	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7926G>C	15.37:g.86284594G>C	ENSP00000378026:p.Gln2642His		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.Q2646H	ENST00000394518.2	37	c.7938	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448375	0.26074	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.22539	1.95;1.95;1.95	5.47	2.46	0.29980	.	.	.	.	.	T	0.15132	0.0365	L	0.28556	0.865	0.18873	N	0.999984	B;B	0.11235	0.003;0.004	B;B	0.14023	0.005;0.01	T	0.25882	-1.0119	9	0.27082	T	0.32	.	10.0735	0.42347	0.073:0.4088:0.5183:0.0	.	2642;2646	Q12802;Q12802-2	AKP13_HUMAN;.	H	2646;2642;2645;2621;887	ENSP00000354718:Q2646H;ENSP00000378026:Q2642H;ENSP00000378018:Q887H	ENSP00000354718:Q2646H	Q	+	3	2	AKAP13	84085598	0.002000	0.14202	0.600000	0.28864	0.818000	0.46254	1.227000	0.32576	0.629000	0.30376	0.655000	0.94253	CAG	AKAP13	-	NULL	ENSG00000170776		0.662	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	38	0.00	0	G	NM_007200		86284594	86284594	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	27	12.50	4	SNP	0.163	C
ARFRP1	10139	genome.wustl.edu	37	20	62337726	62337726	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr20:62337726G>A	ENST00000359715.5	-	3	813	c.247C>T	c.(247-249)Cag>Tag	p.Q83*	ARFRP1_ENST00000440854.1_Nonsense_Mutation_p.Q83*|ARFRP1_ENST00000607873.1_Nonsense_Mutation_p.Q36*|ZGPAT_ENST00000328969.5_5'Flank|ZGPAT_ENST00000369967.3_5'Flank|ZGPAT_ENST00000448100.2_5'Flank|ARFRP1_ENST00000324228.2_Nonsense_Mutation_p.Q83*|ZGPAT_ENST00000355969.6_5'Flank|ARFRP1_ENST00000609142.1_Nonsense_Mutation_p.Q83*|RP4-583P15.15_ENST00000490623.2_5'Flank|ZGPAT_ENST00000357119.4_5'Flank			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	83					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			CACAAAGACTGCAGCTCTTCC	0.602																																						dbGAP											0													140.0	117.0	125.0					20																	62337726		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.247C>T	20.37:g.62337726G>A	ENSP00000352746:p.Gln83*		B7ZKX7|E1P5J9|Q6IBQ0	Nonsense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_Gprotein_alpha_su,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.Q83*	ENST00000359715.5	37	c.247	CCDS13533.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.841637	0.97016	.	.	ENSG00000101246	ENST00000440854;ENST00000359715;ENST00000324228;ENST00000424545;ENST00000303260	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-27.9493	15.5282	0.75928	0.0:0.0:1.0:0.0	.	.	.	.	X	83;83;83;52;72	.	ENSP00000304287:Q72X	Q	-	1	0	ARFRP1	61808170	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.840000	0.92125	2.329000	0.79093	0.462000	0.41574	CAG	ARFRP1	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_Gprotein_alpha_su,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000101246		0.602	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARFRP1	HGNC	protein_coding	OTTHUMT00000472024.1	32	0.00	0	G			62337726	62337726	-1	no_errors	ENST00000324228	ensembl	human	known	69_37n	nonsense	26	25.71	9	SNP	1.000	A
ATP5A1	498	genome.wustl.edu	37	18	43675009	43675009	+	Intron	SNP	A	A	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr18:43675009A>C	ENST00000398752.6	-	2	261				ATP5A1_ENST00000590665.1_Intron|ATP5A1_ENST00000593152.2_Intron|ATP5A1_ENST00000282050.2_Intron|ATP5A1_ENST00000591267.1_5'UTR	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle						ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						ACTGAGAAATAATAACTTACC	0.363																																						dbGAP											0													79.0	78.0	78.0					18																	43675009		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.139+9T>G	18.37:g.43675009A>C			A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Nonsense_Mutation	SNP	NULL	p.L50*	ENST00000398752.6	37	c.149	CCDS11927.1	18																																																																																			ATP5A1	-	NULL	ENSG00000152234		0.363	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	HGNC	protein_coding	OTTHUMT00000255884.1	53	0.00	0	A	NM_004046		43675009	43675009	-1	no_errors	ENST00000590156	ensembl	human	known	69_37n	nonsense	33	35.29	18	SNP	0.010	C
B3GNT6	192134	genome.wustl.edu	37	11	76751717	76751717	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr11:76751717C>T	ENST00000533140.1	+	2	1260	c.1122C>T	c.(1120-1122)ccC>ccT	p.P374P	B3GNT6_ENST00000354301.5_Silent_p.P373P|B3GNT6_ENST00000421061.1_Silent_p.P252P			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						TGCACAGCCCCGCGCTCAGCT	0.652																																						dbGAP											0													16.0	18.0	17.0					11																	76751717		2154	4254	6408	-	-	-	SO:0001819	synonymous_variant	0			AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.1122C>T	11.37:g.76751717C>T			Q4TTN0	Silent	SNP	pfam_Glyco_trans_31	p.P374	ENST00000533140.1	37	c.1122	CCDS53681.1	11																																																																																			B3GNT6	-	NULL	ENSG00000198488		0.652	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	B3GNT6	HGNC	protein_coding	OTTHUMT00000382740.2	63	0.00	0	C	NM_138706		76751717	76751717	+1	no_errors	ENST00000533140	ensembl	human	known	69_37n	silent	42	10.64	5	SNP	0.000	T
BSN	8927	genome.wustl.edu	37	3	49698153	49698153	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr3:49698153C>T	ENST00000296452.4	+	6	8989	c.8875C>T	c.(8875-8877)Cgc>Tgc	p.R2959C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2959					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CACCAAACTGCGCAAGAAGCA	0.602																																						dbGAP											0													29.0	29.0	29.0					3																	49698153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.8875C>T	3.37:g.49698153C>T	ENSP00000296452:p.Arg2959Cys		O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.R2959C	ENST00000296452.4	37	c.8875	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379737	0.24944	.	.	ENSG00000164061	ENST00000296452	T	0.51071	0.72	4.4	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72824	-0.4176	10	0.87932	D	0	-12.2497	14.8715	0.70462	0.1539:0.8461:0.0:0.0	.	2959	Q9UPA5	BSN_HUMAN	C	2959	ENSP00000296452:R2959C	ENSP00000296452:R2959C	R	+	1	0	BSN	49673157	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.581000	0.36558	1.985000	0.57927	0.561000	0.74099	CGC	BSN	-	NULL	ENSG00000164061		0.602	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	46	0.00	0	C	NM_003458		49698153	49698153	+1	no_errors	ENST00000296452	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	1.000	T
C1orf168	199920	genome.wustl.edu	37	1	57285049	57285049	+	5'Flank	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:57285049C>G	ENST00000343433.6	-	0	0				C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168											NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TCCTCTGTCTCTGCTAGCCAG	0.627																																						dbGAP											0													78.0	83.0	82.0					1																	57285049		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281		1.37:g.57285049C>G	Exception_encountered		Q63HM3|Q6ZUY6	RNA	SNP	-	NULL	ENST00000343433.6	37	NULL	CCDS30729.1	1																																																																																			C1orf168	-	-	ENSG00000187889		0.627	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	HGNC	protein_coding	OTTHUMT00000022751.2	33	0.00	0	C	NM_001004303		57285049	57285049	-1	no_errors	ENST00000484327	ensembl	human	known	69_37n	rna	44	12.00	6	SNP	0.000	G
CDH1	999	genome.wustl.edu	37	16	68842603	68842603	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr16:68842603delC	ENST00000261769.5	+	5	730	c.539delC	c.(538-540)tccfs	p.S180fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.S180fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	180	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CAGATCAAATCCAACAAAGAC	0.418			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Unknown(2)	breast(2)											46.0	46.0	46.0					16																	68842603		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.539delC	16.37:g.68842603delC	ENSP00000261769:p.Ser180fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N181fs	ENST00000261769.5	37	c.539	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.418	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	34	0.00	0	C	NM_004360		68842603	68842603	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	10	33.33	5	DEL	1.000	-
CEP128	145508	genome.wustl.edu	37	14	81259238	81259238	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr14:81259238C>G	ENST00000555265.1	-	14	1801	c.1426G>C	c.(1426-1428)Gag>Cag	p.E476Q	CEP128_ENST00000281129.3_Missense_Mutation_p.E476Q			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	476						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTCCTCTTCTCCGCCTCCTCT	0.512																																						dbGAP											0													172.0	154.0	160.0					14																	81259238		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1426G>C	14.37:g.81259238C>G	ENSP00000451162:p.Glu476Gln		B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.E476Q	ENST00000555265.1	37	c.1426	CCDS32130.1	14	.	.	.	.	.	.	.	.	.	.	C	17.49	3.401716	0.62288	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619	T;T	0.35605	1.3;1.3	5.47	5.47	0.80525	.	0.385428	0.26442	N	0.024355	T	0.53674	0.1811	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.67548	0.952	T	0.43940	-0.9360	10	0.35671	T	0.21	.	19.3184	0.94226	0.0:1.0:0.0:0.0	.	476	Q6ZU80	CE128_HUMAN	Q	476	ENSP00000281129:E476Q;ENSP00000451162:E476Q	ENSP00000281129:E476Q	E	-	1	0	CEP128	80328991	1.000000	0.71417	0.963000	0.40424	0.610000	0.37248	5.989000	0.70587	2.562000	0.86427	0.650000	0.86243	GAG	CEP128	-	NULL	ENSG00000100629		0.512	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	76	0.00	0	C	NM_152446		81259238	81259238	-1	no_errors	ENST00000281129	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	0.998	G
CHERP	10523	genome.wustl.edu	37	19	16652789	16652789	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:16652789C>G	ENST00000198939.6	-	2	127	c.91G>C	c.(91-93)Gag>Cag	p.E31Q	CTD-3222D19.7_ENST00000595909.1_lincRNA|RN7SL146P_ENST00000472338.2_RNA|CHERP_ENST00000546361.2_Missense_Mutation_p.E31Q|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						GTCATCTTCTCAAACTCGGGC	0.542																																						dbGAP											0													97.0	113.0	108.0					19																	16652789		1940	4126	6066	-	-	-	SO:0001583	missense	0			U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.91G>C	19.37:g.16652789C>G	ENSP00000198939:p.Glu31Gln			Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,pfam_RNA_pol_II-bd,superfamily_Surp,superfamily_ENTH_VHS,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.E31Q	ENST00000198939.6	37	c.91		19	.	.	.	.	.	.	.	.	.	.	C	34	5.381743	0.95967	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	T;T	0.61859	0.07;0.07	4.46	4.46	0.54185	SWAP/Surp (3);	.	.	.	.	D	0.83193	0.5201	H	0.96048	3.76	0.58432	D	0.999999	D	0.69078	0.997	D	0.79108	0.992	D	0.89363	0.3669	9	0.87932	D	0	-22.9691	16.1266	0.81400	0.0:1.0:0.0:0.0	.	31	Q8IWX8	CHERP_HUMAN	Q	31	ENSP00000439856:E31Q;ENSP00000198939:E31Q	ENSP00000198939:E31Q	E	-	1	0	CHERP	16513789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.242000	0.78210	2.026000	0.59711	0.511000	0.50034	GAG	CHERP	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	ENSG00000085872		0.542	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CHERP	HGNC	protein_coding	OTTHUMT00000403372.1	59	0.00	0	C	NM_006387		16652789	16652789	-1	no_errors	ENST00000546361	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	1.000	G
COIL	8161	genome.wustl.edu	37	17	55023818	55023818	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr17:55023818G>C	ENST00000240316.4	-	5	1577	c.1543C>G	c.(1543-1545)Ctt>Gtt	p.L515V		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	515	2 X 4 AA repeats of S-L-P-A.|Tudor; atypical.					Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					AAGGATGAAAGAATTTCTATA	0.328																																						dbGAP											0													125.0	128.0	127.0					17																	55023818		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.1543C>G	17.37:g.55023818G>C	ENSP00000240316:p.Leu515Val		B2R931	Missense_Mutation	SNP	NULL	p.L515V	ENST00000240316.4	37	c.1543	CCDS11592.1	17	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423207	0.62733	.	.	ENSG00000121058	ENST00000240316	T	0.33216	1.42	5.73	5.73	0.89815	.	0.063063	0.64402	D	0.000003	T	0.40322	0.1112	L	0.57536	1.79	0.45528	D	0.998488	P	0.43231	0.801	P	0.46237	0.508	T	0.19745	-1.0296	10	0.72032	D	0.01	-13.8944	15.7506	0.77983	0.0:0.0:1.0:0.0	.	515	P38432	COIL_HUMAN	V	515	ENSP00000240316:L515V	ENSP00000240316:L515V	L	-	1	0	COIL	52378817	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	4.662000	0.61525	2.861000	0.98227	0.655000	0.94253	CTT	COIL	-	NULL	ENSG00000121058		0.328	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COIL	HGNC	protein_coding	OTTHUMT00000440618.1	48	0.00	0	G			55023818	55023818	-1	no_errors	ENST00000240316	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	1.000	C
CPXM1	56265	genome.wustl.edu	37	20	2779433	2779433	+	Silent	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr20:2779433G>A	ENST00000380605.2	-	2	343	c.279C>T	c.(277-279)gcC>gcT	p.A93A		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	93					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CAAGGGGCCCGGCAGTCACCA	0.572																																						dbGAP											0													98.0	106.0	103.0					20																	2779433		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.279C>T	20.37:g.2779433G>A			Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.A93	ENST00000380605.2	37	c.279	CCDS13033.1	20																																																																																			CPXM1	-	NULL	ENSG00000088882		0.572	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	37	0.00	0	G	NM_019609		2779433	2779433	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.000	A
CSMD1	64478	genome.wustl.edu	37	8	2975988	2975988	+	Silent	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr8:2975988G>A	ENST00000520002.1	-	43	6921	c.6366C>T	c.(6364-6366)ggC>ggT	p.G2122G	CSMD1_ENST00000537824.1_Silent_p.G2121G|CSMD1_ENST00000602723.1_Silent_p.G2122G|CSMD1_ENST00000400186.3_Silent_p.G2122G|CSMD1_ENST00000542608.1_Silent_p.G2121G|CSMD1_ENST00000602557.1_Silent_p.G2122G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2122	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGACAGGATGGCCTATTAGAA	0.458																																						dbGAP											0													142.0	140.0	141.0					8																	2975988		2020	4180	6200	-	-	-	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6366C>T	8.37:g.2975988G>A			Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.P1602S	ENST00000520002.1	37	c.4804		8	.	.	.	.	.	.	.	.	.	.	G	0.327	-0.958393	0.02267	.	.	ENSG00000183117	ENST00000335551	.	.	.	4.85	1.91	0.25777	.	.	.	.	.	T	0.45756	0.1358	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24190	-1.0167	4	.	.	.	.	3.3809	0.07254	0.1559:0.4064:0.3117:0.1261	.	.	.	.	S	1602	.	.	P	-	1	0	CSMD1	2963395	0.104000	0.21937	0.415000	0.26534	0.036000	0.12997	-0.582000	0.05814	0.148000	0.19059	0.563000	0.77884	CCA	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.458	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	80	0.00	0	G	NM_033225		2975988	2975988	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000335551	ensembl	human	novel	69_37n	missense	89	25.21	30	SNP	0.916	A
CTTN	2017	genome.wustl.edu	37	11	70279792	70279792	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr11:70279792T>G	ENST00000301843.8	+	17	1690	c.1484T>G	c.(1483-1485)aTc>aGc	p.I495S	CTTN_ENST00000538675.1_Missense_Mutation_p.I179S|CTTN_ENST00000346329.3_Missense_Mutation_p.I458S|CTTN_ENST00000376561.3_Missense_Mutation_p.I458S	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	495	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.			I -> Y (in Ref. 1; AAA58455). {ECO:0000305}.	negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GATCTGGGGATCACAGCCGTC	0.557																																						dbGAP											0													138.0	133.0	135.0					11																	70279792		2200	4294	6494	-	-	-	SO:0001583	missense	0			AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.1484T>G	11.37:g.70279792T>G	ENSP00000301843:p.Ile495Ser		Q8N707|Q96H99	Missense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.I495S	ENST00000301843.8	37	c.1484	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	T	17.68	3.448300	0.63178	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561;ENST00000538675;ENST00000529736	T;T;T;T;T	0.35048	1.45;1.45;1.33;1.71;1.75	4.96	4.96	0.65561	Src homology-3 domain (4);	0.262826	0.37136	N	0.002221	T	0.44498	0.1296	N	0.17594	0.5	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.968;0.986	D;D;P;P	0.83275	0.996;0.98;0.805;0.816	T	0.51340	-0.8718	10	0.72032	D	0.01	-18.2333	14.6516	0.68800	0.0:0.0:0.0:1.0	.	179;458;495;458	B4E358;Q96H99;Q14247;Q8N707	.;.;SRC8_HUMAN;.	S	458;495;458;179;152	ENSP00000317189:I458S;ENSP00000301843:I495S;ENSP00000365745:I458S;ENSP00000439762:I179S;ENSP00000431421:I152S	ENSP00000301843:I495S	I	+	2	0	CTTN	69957440	1.000000	0.71417	0.686000	0.30086	0.455000	0.32408	4.223000	0.58587	1.856000	0.53863	0.529000	0.55759	ATC	CTTN	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000085733		0.557	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	HGNC	protein_coding	OTTHUMT00000259233.2	60	0.00	0	T	NM_138565		70279792	70279792	+1	no_errors	ENST00000301843	ensembl	human	known	69_37n	missense	51	27.14	19	SNP	0.998	G
CUBN	8029	genome.wustl.edu	37	10	16990571	16990571	+	Silent	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr10:16990571G>A	ENST00000377833.4	-	35	5180	c.5115C>T	c.(5113-5115)atC>atT	p.I1705I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1705	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAAGGATGTGATAGGATGGG	0.507																																						dbGAP											0													98.0	85.0	89.0					10																	16990571		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5115C>T	10.37:g.16990571G>A			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.I1705	ENST00000377833.4	37	c.5115	CCDS7113.1	10																																																																																			CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.507	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	41	0.00	0	G	NM_001081		16990571	16990571	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	1.000	A
DCC	1630	genome.wustl.edu	37	18	50451672	50451672	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr18:50451672G>A	ENST00000442544.2	+	5	1533	c.917G>A	c.(916-918)gGa>gAa	p.G306E	DCC_ENST00000412726.1_Missense_Mutation_p.G154E	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	306	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GATGACAGTGGAATGTATACC	0.393																																						dbGAP											0													140.0	138.0	138.0					18																	50451672		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.917G>A	18.37:g.50451672G>A	ENSP00000389140:p.Gly306Glu			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G306E	ENST00000442544.2	37	c.917	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723299	0.48728	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.80909	-1.43;-1.43	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.94879	0.8345	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96908	0.9665	10	0.87932	D	0	.	18.7641	0.91865	0.0:0.0:1.0:0.0	.	154;306	E7EQM8;P43146	.;DCC_HUMAN	E	306;239;154	ENSP00000389140:G306E;ENSP00000397322:G154E	ENSP00000304146:G239E	G	+	2	0	DCC	48705670	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.302000	0.78861	2.729000	0.93468	0.467000	0.42956	GGA	DCC	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000187323		0.393	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	54	0.00	0	G	NM_005215		50451672	50451672	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	1.000	A
FCRL5	83416	genome.wustl.edu	37	1	157514053	157514053	+	Splice_Site	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:157514053C>G	ENST00000361835.3	-	5	1000	c.843G>C	c.(841-843)caG>caC	p.Q281H	FCRL5_ENST00000356953.4_Splice_Site_p.Q281H|FCRL5_ENST00000368190.3_Splice_Site_p.Q281H|FCRL5_ENST00000368189.3_Splice_Site_p.Q281H|FCRL5_ENST00000368191.3_Splice_Site_p.Q196H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	281					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AACACTTACTCTGCACCTGTA	0.502																																						dbGAP											0													127.0	124.0	125.0					1																	157514053		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.844+1G>C	1.37:g.157514053C>G			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q281H	ENST00000361835.3	37	c.843	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190842	0.38707	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.49720	0.77;0.79;0.77;1.05;1.09	4.06	-8.12	0.01078	.	.	.	.	.	T	0.31575	0.0801	M	0.69358	2.11	0.09310	N	1	P;P;P;P;P;D	0.61080	0.907;0.88;0.88;0.788;0.858;0.989	B;P;P;B;P;D	0.65140	0.396;0.66;0.71;0.286;0.465;0.932	T	0.43702	-0.9375	9	0.08179	T	0.78	.	8.09	0.30795	0.0:0.242:0.1329:0.6251	.	312;196;281;281;281;281	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	H	281;281;281;196;281	ENSP00000354691:Q281H;ENSP00000349434:Q281H;ENSP00000357173:Q281H;ENSP00000357174:Q196H;ENSP00000357172:Q281H	ENSP00000349434:Q281H	Q	-	3	2	FCRL5	155780677	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.491000	0.02302	-1.944000	0.01038	-0.253000	0.11424	CAG	FCRL5	-	smart_Ig_sub	ENSG00000143297		0.502	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	31	0.00	0	C	NM_031281	Missense_Mutation	157514053	157514053	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.000	G
GLP1R	2740	genome.wustl.edu	37	6	39046890	39046890	+	Silent	SNP	G	G	A	rs374281194		TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr6:39046890G>A	ENST00000373256.4	+	10	1000	c.957G>A	c.(955-957)gtG>gtA	p.V319V		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	319					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	CCCCGCAGGTGAACTTCCTCA	0.552																																						dbGAP											0													123.0	124.0	124.0					6																	39046890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.957G>A	6.37:g.39046890G>A			Q2M229|Q99669	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GLP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.V319	ENST00000373256.4	37	c.957	CCDS4839.1	6																																																																																			GLP1R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000112164		0.552	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP1R	HGNC	protein_coding	OTTHUMT00000040443.1	27	0.00	0	G			39046890	39046890	+1	no_errors	ENST00000373256	ensembl	human	known	69_37n	silent	51	12.07	7	SNP	0.997	A
GPR97	222487	genome.wustl.edu	37	16	57719564	57719564	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr16:57719564C>T	ENST00000333493.4	+	11	1427	c.1266C>T	c.(1264-1266)ttC>ttT	p.F422F	GPR97_ENST00000327655.6_Silent_p.F212F|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Silent_p.F302F	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	422					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GATGCTGGTTCCGTGAAGGGA	0.587																																						dbGAP											0													148.0	135.0	139.0					16																	57719564		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1266C>T	16.37:g.57719564C>T			Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.F422	ENST00000333493.4	37	c.1266	CCDS10786.1	16																																																																																			GPR97	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000182885		0.587	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	HGNC	protein_coding	OTTHUMT00000257333.2	77	0.00	0	C	NM_170776		57719564	57719564	+1	no_errors	ENST00000333493	ensembl	human	known	69_37n	silent	55	19.12	13	SNP	0.687	T
GVINP1	387751	genome.wustl.edu	37	11	6740407	6740407	+	RNA	SNP	A	A	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr11:6740407A>G	ENST00000526769.3	-	0	2797					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TGCAGGAAATAGAAGGGAAGC	0.403																																						dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6740407A>G			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.403	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	42	0.00	0	A	NR_003945		6740407	6740407	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	32	30.43	14	SNP	0.885	G
HDAC11	79885	genome.wustl.edu	37	3	13544400	13544400	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr3:13544400G>A	ENST00000295757.3	+	8	752	c.569G>A	c.(568-570)cGa>cAa	p.R190Q	HDAC11_ENST00000405025.1_Intron|HDAC11_ENST00000437379.2_Missense_Mutation_p.R162Q|HDAC11_ENST00000402259.1_Intron|HDAC11_ENST00000404040.1_Missense_Mutation_p.R90Q|HDAC11_ENST00000404548.1_Intron|HDAC11_ENST00000495099.2_3'UTR|HDAC11_ENST00000522202.1_Missense_Mutation_p.R139Q|HDAC11_ENST00000446613.2_5'UTR|HDAC11_ENST00000433119.1_Missense_Mutation_p.E148K|HDAC11_ENST00000402271.1_Missense_Mutation_p.R111Q	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	190	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GGGCATGAGCGAGACTTCATG	0.612																																						dbGAP											0													210.0	202.0	204.0					3																	13544400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.569G>A	3.37:g.13544400G>A	ENSP00000295757:p.Arg190Gln		B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	pfam_His_deacetylse_dom,prints_His_deacetylse	p.R190Q	ENST00000295757.3	37	c.569	CCDS2615.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.1|20.1	3.939402|3.939402	0.73557|0.73557	.|.	.|.	ENSG00000163517|ENSG00000163517	ENST00000433119;ENST00000434848|ENST00000295757;ENST00000402271;ENST00000404040;ENST00000405478;ENST00000522202;ENST00000455904;ENST00000437379	.|T;T;T;T;T;T;T	.|0.69435	.|-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.03|5.03	4.12|4.12	0.48240|0.48240	.|Histone deacetylase domain (2);	.|0.275780	.|0.32608	.|N	.|0.005867	T|T	0.79082|0.79082	0.4386|0.4386	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	B|D;D	0.28880|0.67145	0.226|0.996;0.996	B|D;D	0.17098|0.65874	0.017|0.939;0.939	T|T	0.82006|0.82006	-0.0671|-0.0671	8|10	0.87932|0.87932	D|D	0|0	-0.0329|-0.0329	13.2719|13.2719	0.60165|0.60165	0.0:0.1594:0.8406:0.0|0.0:0.1594:0.8406:0.0	.|.	148|139;190	Q658J9|B4DDK1;Q96DB2	.|.;HDA11_HUMAN	K|Q	148;156|190;111;90;162;139;162;162	.|ENSP00000295757:R190Q;ENSP00000384123:R111Q;ENSP00000385475:R90Q;ENSP00000385252:R162Q;ENSP00000429794:R139Q;ENSP00000396122:R162Q;ENSP00000395188:R162Q	ENSP00000412514:E148K|ENSP00000295757:R190Q	E|R	+|+	1|2	0|0	HDAC11|HDAC11	13519400|13519400	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.313000|0.313000	0.28021|0.28021	6.629000|6.629000	0.74267|0.74267	2.349000|2.349000	0.79799|0.79799	0.561000|0.561000	0.74099|0.74099	GAG|CGA	HDAC11	-	pfam_His_deacetylse_dom	ENSG00000163517		0.612	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC11	HGNC	protein_coding	OTTHUMT00000252028.5	50	0.00	0	G	NM_024827		13544400	13544400	+1	no_errors	ENST00000295757	ensembl	human	known	69_37n	missense	37	35.09	20	SNP	1.000	A
HHIPL2	79802	genome.wustl.edu	37	1	222717464	222717464	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:222717464G>T	ENST00000343410.6	-	2	447	c.389C>A	c.(388-390)cCg>cAg	p.P130Q		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	130					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCAGAGGCCCGGGAGATTCCG	0.582																																						dbGAP											0													87.0	100.0	96.0					1																	222717464		1955	4143	6098	-	-	-	SO:0001583	missense	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.389C>A	1.37:g.222717464G>T	ENSP00000342118:p.Pro130Gln		Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.P130Q	ENST00000343410.6	37	c.389	CCDS1530.2	1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300865	0.60195	.	.	ENSG00000143512	ENST00000343410	T	0.55760	0.5	5.59	5.59	0.84812	Folate receptor-like (1);	0.052237	0.85682	D	0.000000	T	0.79787	0.4506	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84087	0.0388	10	0.87932	D	0	-19.8876	19.1777	0.93609	0.0:0.0:1.0:0.0	.	130	Q6UWX4	HIPL2_HUMAN	Q	130	ENSP00000342118:P130Q	ENSP00000342118:P130Q	P	-	2	0	HHIPL2	220784087	1.000000	0.71417	0.806000	0.32338	0.005000	0.04900	9.310000	0.96267	2.606000	0.88127	0.591000	0.81541	CCG	HHIPL2	-	pfam_Folate_rcpt-like,superfamily_Saposin-like	ENSG00000143512		0.582	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	27	0.00	0	G	NM_024746		222717464	222717464	-1	no_errors	ENST00000343410	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	T
HIF3A	64344	genome.wustl.edu	37	19	46825083	46825083	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:46825083G>A	ENST00000377670.4	+	10	1226	c.1195G>A	c.(1195-1197)Gag>Aag	p.E399K	HIF3A_ENST00000472815.1_Missense_Mutation_p.E330K|HIF3A_ENST00000339613.2_Missense_Mutation_p.E343K|HIF3A_ENST00000244303.6_Missense_Mutation_p.E330K|HIF3A_ENST00000420102.2_Missense_Mutation_p.E348K|HIF3A_ENST00000600383.1_Missense_Mutation_p.E330K|HIF3A_ENST00000300862.3_Missense_Mutation_p.E397K|AC007193.10_ENST00000596807.1_RNA	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	399					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TTCCCTGAGCGAGGCTGCCCT	0.682																																						dbGAP											0													43.0	52.0	49.0					19																	46825083		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1195G>A	19.37:g.46825083G>A	ENSP00000366898:p.Glu399Lys		B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.E399K	ENST00000377670.4	37	c.1195	CCDS12681.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.47|15.47	2.842810|2.842810	0.51057|0.51057	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|.	0.68181|.	0.45;-0.3;0.33;0.45;-0.31|.	4.45|4.45	4.45|4.45	0.53987|0.53987	.|.	0.000000|.	0.45126|.	D|.	0.000392|.	T|T	0.40322|0.40322	0.1112|0.1112	N|N	0.24115|0.24115	0.695|0.695	0.32540|0.32540	N|N	0.533797|0.533797	D;D;D;D;D;D;D|.	0.76494|.	0.998;0.999;0.998;0.999;0.997;0.997;0.993|.	P;D;P;D;P;P;P|.	0.71184|.	0.742;0.972;0.742;0.972;0.557;0.557;0.46|.	T|T	0.47459|0.47459	-0.9116|-0.9116	10|5	0.18710|.	T|.	0.47|.	.|.	12.8047|12.8047	0.57607|0.57607	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	348;330;397;348;343;399;399|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	K|Q	399;399;330;343;343;397;348|371	ENSP00000366898:E399K;ENSP00000244303:E330K;ENSP00000341877:E343K;ENSP00000300862:E397K;ENSP00000407771:E348K|.	ENSP00000244302:E399K|.	E|R	+|+	1|2	0|0	HIF3A|HIF3A	51516923|51516923	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.784000|0.784000	0.44337|0.44337	4.637000|4.637000	0.61346|0.61346	2.484000|2.484000	0.83849|0.83849	0.655000|0.655000	0.94253|0.94253	GAG|CGA	HIF3A	-	NULL	ENSG00000124440		0.682	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	72	0.00	0	G			46825083	46825083	+1	no_errors	ENST00000377670	ensembl	human	known	69_37n	missense	88	11.11	11	SNP	1.000	A
HIST1H3G	8355	genome.wustl.edu	37	6	26271219	26271219	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr6:26271219G>A	ENST00000305910.3	-	1	393	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	132					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CTCTCCCCACGAATGCGGCGA	0.502																																						dbGAP											0													68.0	70.0	69.0					6																	26271219		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.394C>T	6.37:g.26271219G>A	ENSP00000439660:p.Arg132Cys		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R132C	ENST00000305910.3	37	c.394	CCDS4602.1	6	.	.	.	.	.	.	.	.	.	.	.	18.88	3.716923	0.68844	.	.	ENSG00000256018	ENST00000305910	T	0.70164	-0.46	4.42	4.42	0.53409	.	.	.	.	.	T	0.72334	0.3447	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	T	0.75342	-0.3351	6	0.52906	T	0.07	.	16.4001	0.83637	0.0:0.0:1.0:0.0	.	.	.	.	C	132	ENSP00000439660:R132C	ENSP00000439660:R132C	R	-	1	0	HIST1H3G	26379198	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.727000	0.84838	2.183000	0.69458	0.563000	0.77884	CGT	HIST1H3G	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000256018		0.502	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3G	HGNC	protein_coding	OTTHUMT00000040099.2	44	0.00	0	G	NM_003534		26271219	26271219	-1	no_errors	ENST00000305910	ensembl	human	known	69_37n	missense	60	15.49	11	SNP	1.000	A
HMGXB3	22993	genome.wustl.edu	37	5	149406614	149406614	+	Silent	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr5:149406614G>A	ENST00000502717.1	+	9	2132	c.1668G>A	c.(1666-1668)ctG>ctA	p.L556L	HMGXB3_ENST00000503427.1_Silent_p.L524L|snoU13_ENST00000458810.1_RNA	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	802					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						CTTGTGGTCTGAAGCCAAGCA	0.527																																						dbGAP											0													77.0	72.0	73.0					5																	149406614		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.1668G>A	5.37:g.149406614G>A			G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.L556	ENST00000502717.1	37	c.1668	CCDS54935.1	5																																																																																			HMGXB3	-	NULL	ENSG00000113716		0.527	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	46	0.00	0	G	XM_001717202		149406614	149406614	+1	no_errors	ENST00000502717	ensembl	human	known	69_37n	silent	37	17.78	8	SNP	1.000	A
IGFBP5	3488	genome.wustl.edu	37	2	217543752	217543752	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr2:217543752C>T	ENST00000233813.4	-	2	1137	c.388G>A	c.(388-390)Gag>Aag	p.E130K		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	130					cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGTAGGTCTCCTCGGCCATC	0.622																																						dbGAP											0													89.0	80.0	83.0					2																	217543752		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.388G>A	2.37:g.217543752C>T	ENSP00000233813:p.Glu130Lys		Q5U0A3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-5	p.E130K	ENST00000233813.4	37	c.388	CCDS2405.1	2	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480241	0.63849	.	.	ENSG00000115461	ENST00000233813;ENST00000449583	T;T	0.75260	-0.92;1.93	5.07	5.07	0.68467	.	0.329691	0.24102	N	0.041531	T	0.61236	0.2331	L	0.47716	1.5	0.43824	D	0.996399	P	0.37781	0.608	B	0.29942	0.109	T	0.58457	-0.7633	10	0.16896	T	0.51	-11.0281	11.0938	0.48132	0.0:0.9164:0.0:0.0836	.	130	P24593	IBP5_HUMAN	K	130;175	ENSP00000233813:E130K;ENSP00000413474:E175K	ENSP00000233813:E130K	E	-	1	0	IGFBP5	217251997	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.681000	0.68175	2.653000	0.90120	0.561000	0.74099	GAG	IGFBP5	-	NULL	ENSG00000115461		0.622	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFBP5	HGNC	protein_coding	OTTHUMT00000256674.2	109	0.91	1	C	NM_000599		217543752	217543752	-1	no_errors	ENST00000233813	ensembl	human	known	69_37n	missense	119	14.39	20	SNP	1.000	T
INO80B	83444	genome.wustl.edu	37	2	74683376	74683376	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr2:74683376G>A	ENST00000233331.7	+	4	611	c.517G>A	c.(517-519)Gag>Aag	p.E173K	INO80B_ENST00000469849.1_3'UTR|INO80B_ENST00000409917.1_Missense_Mutation_p.E173K|WBP1_ENST00000409737.1_5'Flank|WBP1_ENST00000233615.2_5'Flank|WBP1_ENST00000393972.3_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	173					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						GGAGATCAATGAGCGGCTGCT	0.512																																						dbGAP											0													153.0	134.0	140.0					2																	74683376		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.517G>A	2.37:g.74683376G>A	ENSP00000233331:p.Glu173Lys			Missense_Mutation	SNP	pfam_PAPA1,pfam_Znf_HIT	p.E173K	ENST00000233331.7	37	c.517	CCDS1942.2	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812442	0.90707	.	.	ENSG00000115274	ENST00000233331;ENST00000431187;ENST00000409917;ENST00000409493	T;T;T;T	0.49139	0.79;0.82;0.79;0.79	5.65	5.65	0.86999	.	0.104777	0.64402	D	0.000003	T	0.61502	0.2352	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.69078	0.997;0.993;0.993;0.988	D;D;D;D	0.75020	0.985;0.968;0.956;0.981	T	0.55062	-0.8199	10	0.29301	T	0.29	-24.6514	15.2215	0.73313	0.0:0.0:1.0:0.0	.	191;158;173;173	B4DJ31;B4DJ22;Q9C086;B8ZZ93	.;.;IN80B_HUMAN;.	K	173;158;173;178	ENSP00000233331:E173K;ENSP00000389887:E158K;ENSP00000387267:E173K;ENSP00000386937:E178K	ENSP00000233331:E173K	E	+	1	0	INO80B	74536884	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.964000	0.93389	2.666000	0.90696	0.555000	0.69702	GAG	INO80B	-	NULL	ENSG00000115274		0.512	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80B	HGNC	protein_coding	OTTHUMT00000252223.2	51	0.00	0	G	NM_031288		74683376	74683376	+1	no_errors	ENST00000452361	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	A
IHH	3549	genome.wustl.edu	37	2	219920403	219920403	+	Silent	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr2:219920403C>G	ENST00000295731.6	-	3	761	c.762G>C	c.(760-762)ctG>ctC	p.L254L		NM_002181.3	NP_002172.2	Q14623	IHH_HUMAN	indian hedgehog	254					bone resorption (GO:0045453)|camera-type eye photoreceptor cell fate commitment (GO:0060220)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|chondrocyte proliferation (GO:0035988)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint development (GO:0072498)|epithelial cell morphogenesis (GO:0003382)|epithelial cell-cell adhesion (GO:0090136)|head morphogenesis (GO:0060323)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intein-mediated protein splicing (GO:0016539)|maternal process involved in female pregnancy (GO:0060135)|multicellular organism growth (GO:0035264)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of eye pigmentation (GO:0048074)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell differentiation in thymus (GO:0033085)|neuron development (GO:0048666)|osteoblast differentiation (GO:0001649)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of growth (GO:0040008)|response to estradiol (GO:0032355)|retinal pigment epithelium development (GO:0003406)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|somite development (GO:0061053)|vitelline membrane formation (GO:0030704)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|patched binding (GO:0005113)|peptidase activity (GO:0008233)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAAGGCTCTCAGCCTGTGAG	0.652																																						dbGAP											0													54.0	57.0	56.0					2																	219920403		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L38517	CCDS33380.1	2q33-q35	2013-02-15	2013-02-15		ENSG00000163501	ENSG00000163501			5956	protein-coding gene	gene with protein product		600726	"""Indian hedgehog (Drosophila) homolog"", ""Indian hedgehog homolog (Drosophila)"""			7590746, 14770182	Standard	NM_002181		Approved	HHG2, BDA1	uc002vjo.2	Q14623	OTTHUMG00000154631	ENST00000295731.6:c.762G>C	2.37:g.219920403C>G			B9EGM5|O43322|Q8N4B9	Silent	SNP	pirsf_Hedgehog,pfam_Hedgehog_signaling_dom,pfam_Hint_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,smart_Hint_dom_N,smart_Hint_dom_C,pfscan_Intein_splice_site,prints_Hedgehog	p.L254	ENST00000295731.6	37	c.762	CCDS33380.1	2																																																																																			IHH	-	pirsf_Hedgehog,pfam_Hint_dom,smart_Hint_dom_N,pfscan_Intein_splice_site	ENSG00000163501		0.652	IHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IHH	HGNC	protein_coding	OTTHUMT00000336408.2	70	0.00	0	C	NM_002181		219920403	219920403	-1	no_errors	ENST00000295731	ensembl	human	known	69_37n	silent	71	10.13	8	SNP	0.003	G
ITGA11	22801	genome.wustl.edu	37	15	68631949	68631949	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr15:68631949C>G	ENST00000315757.7	-	11	1251	c.1165G>C	c.(1165-1167)Gac>Cac	p.D389H	ITGA11_ENST00000423218.2_Missense_Mutation_p.D389H	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	389					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CCATTCCAGTCATAGGCACCG	0.592																																						dbGAP											0													69.0	75.0	73.0					15																	68631949		2031	4182	6213	-	-	-	SO:0001583	missense	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1165G>C	15.37:g.68631949C>G	ENSP00000327290:p.Asp389His		J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D389H	ENST00000315757.7	37	c.1165	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657641	0.88154	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	T;T	0.71579	-0.58;-0.58	5.09	5.09	0.68999	.	0.043142	0.85682	D	0.000000	D	0.86401	0.5924	M	0.88640	2.97	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;D	0.70016	0.967;0.957	D	0.89108	0.3494	10	0.72032	D	0.01	.	17.5593	0.87901	0.0:1.0:0.0:0.0	.	389;389	A8K8T0;Q9UKX5	.;ITA11_HUMAN	H	389;389;24;389	ENSP00000327290:D389H;ENSP00000403392:D389H	ENSP00000327290:D389H	D	-	1	0	ITGA11	66419003	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.818000	0.86416	2.391000	0.81399	0.555000	0.69702	GAC	ITGA11	-	NULL	ENSG00000137809		0.592	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		32	0.00	0	C	NM_012211		68631949	68631949	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	G
ISLR	3671	genome.wustl.edu	37	15	74467586	74467586	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr15:74467586G>A	ENST00000249842.3	+	2	744	c.387G>A	c.(385-387)atG>atA	p.M129I	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.M129I	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	129					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						TGCTCAAGATGGACAGCAACG	0.592																																						dbGAP											0													105.0	100.0	102.0					15																	74467586		2198	4297	6495	-	-	-	SO:0001583	missense	0			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.387G>A	15.37:g.74467586G>A	ENSP00000249842:p.Met129Ile			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub2,pfscan_Ig-like	p.M129I	ENST00000249842.3	37	c.387	CCDS10260.1	15	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525675	0.64860	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.51574	0.7;0.7	4.05	4.05	0.47172	.	0.088668	0.45126	U	0.000397	T	0.35480	0.0933	N	0.05177	-0.1	0.58432	D	0.999996	P	0.46859	0.885	P	0.48770	0.589	T	0.44483	-0.9325	10	0.59425	D	0.04	.	13.5941	0.61979	0.0:0.1565:0.8435:0.0	.	129	O14498	ISLR_HUMAN	I	129	ENSP00000249842:M129I;ENSP00000378550:M129I	ENSP00000249842:M129I	M	+	3	0	ISLR	72254639	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.815000	0.86186	1.822000	0.53115	0.313000	0.20887	ATG	ISLR	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000129009		0.592	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR	HGNC	protein_coding	OTTHUMT00000269044.1	69	0.00	0	G	NM_005545		74467586	74467586	+1	no_errors	ENST00000249842	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	1.000	A
KLC4	89953	genome.wustl.edu	37	6	43034052	43034052	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr6:43034052G>T	ENST00000394056.2	+	6	1075	c.580G>T	c.(580-582)Ggt>Tgt	p.G194C	KLC4_ENST00000259708.3_Missense_Mutation_p.G212C|KLC4_ENST00000453940.2_Missense_Mutation_p.G117C|KLC4_ENST00000479388.1_Missense_Mutation_p.G194C|KLC4_ENST00000347162.5_Missense_Mutation_p.G194C|KLC4_ENST00000458460.2_Missense_Mutation_p.G194C|KLC4_ENST00000394058.1_Missense_Mutation_p.G194C			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	194						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			AGTGTCCCGTGGTCAAGGTGC	0.527																																						dbGAP											0													207.0	177.0	187.0					6																	43034052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.580G>T	6.37:g.43034052G>T	ENSP00000377620:p.Gly194Cys		B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.G212C	ENST00000394056.2	37	c.634	CCDS4883.1	6	.	.	.	.	.	.	.	.	.	.	G	15.06	2.719891	0.48728	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000479632;ENST00000470728;ENST00000458460;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T;T;T;T	0.43688	0.94;0.97;0.94;0.94;0.94;0.94;0.94;0.94;0.94	3.85	3.85	0.44370	Rabaptin, GTPase-Rab5 binding (1);	0.384249	0.22974	N	0.053396	T	0.43344	0.1243	L	0.50333	1.59	0.32848	D	0.506286	D;D;D;D	0.76494	0.999;0.999;0.989;0.998	D;D;P;D	0.65874	0.934;0.917;0.864;0.939	T	0.40590	-0.9555	10	0.66056	D	0.02	-3.7572	10.2176	0.43177	0.0:0.2623:0.7377:0.0	.	117;212;194;194	B4DME9;Q9NSK0-3;Q9NSK0;Q96EG6	.;.;KLC4_HUMAN;.	C	194;117;107;172;194;212;194;194;194	ENSP00000340221:G194C;ENSP00000395806:G117C;ENSP00000419784:G107C;ENSP00000417652:G172C;ENSP00000410358:G194C;ENSP00000259708:G212C;ENSP00000418031:G194C;ENSP00000377620:G194C;ENSP00000377622:G194C	ENSP00000259708:G212C	G	+	1	0	KLC4	43142030	0.998000	0.40836	0.999000	0.59377	0.324000	0.28378	1.257000	0.32932	2.437000	0.82529	0.650000	0.86243	GGT	KLC4	-	pfam_Rabaptin_Rab5-bd_dom	ENSG00000137171		0.527	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLC4	HGNC	protein_coding	OTTHUMT00000040579.2	92	0.00	0	G	NM_138343		43034052	43034052	+1	no_errors	ENST00000259708	ensembl	human	known	69_37n	missense	66	44.07	52	SNP	0.998	T
MAGEB16	139604	genome.wustl.edu	37	X	35820503	35820503	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chrX:35820503G>A	ENST00000399989.1	+	2	469	c.190G>A	c.(190-192)Gtt>Att	p.V64I	MAGEB16_ENST00000399988.1_Missense_Mutation_p.V64I|MAGEB16_ENST00000399992.1_Missense_Mutation_p.V96I|MAGEB16_ENST00000399987.1_Missense_Mutation_p.V64I|MAGEB16_ENST00000399985.1_Missense_Mutation_p.V64I	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	64										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						TCCTCTTGAGGTTCCTCAGAG	0.522																																						dbGAP											0													50.0	47.0	48.0					X																	35820503		1944	4113	6057	-	-	-	SO:0001583	missense	0				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.190G>A	X.37:g.35820503G>A	ENSP00000382871:p.Val64Ile		A8MU30	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.V96I	ENST00000399989.1	37	c.286	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	G	9.952	1.220538	0.22457	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04234	3.67;3.67;3.67;3.67;3.67	3.13	-0.688	0.11317	Melanoma associated antigen, MAGE, N-terminal (1);	2.317750	0.01544	N	0.019370	T	0.03915	0.0110	N	0.08118	0	0.09310	N	1	B	0.22211	0.066	B	0.32393	0.145	T	0.43097	-0.9412	10	0.44086	T	0.13	.	6.2142	0.20646	0.5287:0.0:0.4713:0.0	.	64	A2A368	MAGBG_HUMAN	I	64;96;64;64;64	ENSP00000382870:V64I;ENSP00000382874:V96I;ENSP00000382869:V64I;ENSP00000382871:V64I;ENSP00000382867:V64I	ENSP00000382867:V64I	V	+	1	0	MAGEB16	35730424	0.000000	0.05858	0.000000	0.03702	0.224000	0.24922	-0.290000	0.08354	-0.297000	0.08934	0.521000	0.50471	GTT	MAGEB16	-	pfam_Melanoma_ass_antigen_N	ENSG00000189023		0.522	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	HGNC	protein_coding	OTTHUMT00000251034.1	40	0.00	0	G			35820503	35820503	+1	no_errors	ENST00000399992	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9057901	9057901	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:9057901C>T	ENST00000397910.4	-	3	29748	c.29545G>A	c.(29545-29547)Gtg>Atg	p.V9849M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9851	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTATCGTCCACAGCGGAGGTG	0.473																																						dbGAP											0													156.0	149.0	151.0					19																	9057901		2021	4190	6211	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29545G>A	19.37:g.9057901C>T	ENSP00000381008:p.Val9849Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.V9849M	ENST00000397910.4	37	c.29545	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	3.865	-0.029037	0.07589	.	.	ENSG00000181143	ENST00000397910	T	0.16457	2.34	2.62	-5.25	0.02781	.	.	.	.	.	T	0.05318	0.0141	N	0.03608	-0.345	.	.	.	B	0.21606	0.058	B	0.11329	0.006	T	0.32745	-0.9895	8	0.87932	D	0	.	0.9846	0.01443	0.1583:0.3241:0.16:0.3577	.	9849	B5ME49	.	M	9849	ENSP00000381008:V9849M	ENSP00000381008:V9849M	V	-	1	0	MUC16	8918901	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.024000	0.00311	-1.603000	0.01597	-0.252000	0.11476	GTG	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	91	0.00	0	C	NM_024690		9057901	9057901	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	82	15.46	15	SNP	0.000	T
MYBPC2	4606	genome.wustl.edu	37	19	50945508	50945508	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:50945508C>T	ENST00000357701.5	+	9	891	c.840C>T	c.(838-840)atC>atT	p.I280I		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	280	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TGGTAGAGATCAGCGACCCAG	0.532																																						dbGAP											0													76.0	78.0	78.0					19																	50945508		2042	4187	6229	-	-	-	SO:0001819	synonymous_variant	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.840C>T	19.37:g.50945508C>T			A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I280	ENST00000357701.5	37	c.840	CCDS46152.1	19																																																																																			MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.532	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	31	0.00	0	C	NM_004533		50945508	50945508	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	1.000	T
MYH9	4627	genome.wustl.edu	37	22	36708234	36708234	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr22:36708234C>T	ENST00000216181.5	-	14	1818	c.1588G>A	c.(1588-1590)Gag>Aag	p.E530K		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	530	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.E530K(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CAGCACTCCTCGTCCAGCAGG	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - Missense(1)	prostate(1)											81.0	70.0	73.0					22																	36708234		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1588G>A	22.37:g.36708234C>T	ENSP00000216181:p.Glu530Lys		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E530K	ENST00000216181.5	37	c.1588	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.433500	0.96150	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.80653	-1.4	4.57	4.57	0.56435	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93930	0.8057	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96569	0.9421	10	0.87932	D	0	.	17.3444	0.87306	0.0:1.0:0.0:0.0	.	530	P35579	MYH9_HUMAN	K	394;530	ENSP00000216181:E530K	ENSP00000216181:E530K	E	-	1	0	MYH9	35038180	1.000000	0.71417	0.995000	0.50966	0.939000	0.58152	7.818000	0.86416	2.258000	0.74832	0.561000	0.74099	GAG	MYH9	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000100345		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	49	0.00	0	C	NM_002473		36708234	36708234	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	1.000	T
NBPF3	84224	genome.wustl.edu	37	1	21809855	21809855	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:21809855G>C	ENST00000318249.5	+	15	2228	c.1878G>C	c.(1876-1878)caG>caC	p.Q626H	NBPF3_ENST00000342104.5_Missense_Mutation_p.Q614H|NBPF3_ENST00000454000.2_Missense_Mutation_p.Q556H|NBPF3_ENST00000318220.6_Missense_Mutation_p.Q570H	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	626	NBPF 5. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGGCCTTCCAGATGGGAGTCA	0.473																																						dbGAP											0													25.0	16.0	19.0					1																	21809855		1887	3361	5248	-	-	-	SO:0001583	missense	0			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1878G>C	1.37:g.21809855G>C	ENSP00000316782:p.Gln626His		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	pfam_NBPF_dom	p.Q626H	ENST00000318249.5	37	c.1878	CCDS216.1	1	.	.	.	.	.	.	.	.	.	.	.	0.547	-0.851097	0.02651	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104	T;T;T;T	0.04654	3.58;3.82;3.76;3.78	0.843	-1.44	0.08856	DUF1220 (1);	.	.	.	.	T	0.05640	0.0148	L	0.47716	1.5	0.09310	N	1	B;D;P	0.53462	0.024;0.96;0.932	B;P;B	0.47376	0.012;0.545;0.343	T	0.24404	-1.0161	9	0.54805	T	0.06	.	1.7479	0.02966	0.2482:0.0:0.4263:0.3255	.	556;614;626	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	H	556;570;626;614	ENSP00000415711:Q556H;ENSP00000316739:Q570H;ENSP00000316782:Q626H;ENSP00000340336:Q614H	ENSP00000316739:Q570H	Q	+	3	2	NBPF3	21682442	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.137000	0.03219	-0.553000	0.06158	-1.537000	0.00914	CAG	NBPF3	-	NULL	ENSG00000142794		0.473	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBPF3	HGNC	protein_coding		24	0.00	0	G	NM_032264		21809855	21809855	+1	no_errors	ENST00000318249	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.000	C
NCOA6	23054	genome.wustl.edu	37	20	33364253	33364253	+	Splice_Site	SNP	T	T	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr20:33364253T>A	ENST00000374796.2	-	5	2806		c.e5-2		NCOA6_ENST00000359003.2_Splice_Site			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6						brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TGCTGGACTCTTGATTGTGAA	0.443																																						dbGAP											0													67.0	65.0	66.0					20																	33364253		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.236-2A>T	20.37:g.33364253T>A			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Splice_Site	SNP	-	e2-2	ENST00000374796.2	37	c.236-2	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206617	0.58343	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8895	0.79286	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NCOA6	32827914	1.000000	0.71417	0.984000	0.44739	0.442000	0.32017	5.288000	0.65651	2.207000	0.71202	0.533000	0.62120	.	NCOA6	-	-	ENSG00000198646		0.443	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	20	0.00	0	T	NM_014071	Intron	33364253	33364253	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	splice_site	18	18.18	4	SNP	1.000	A
OR5H2	79310	genome.wustl.edu	37	3	98001967	98001967	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr3:98001967C>T	ENST00000355273.2	+	1	236	c.236C>T	c.(235-237)tCt>tTt	p.S79F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						GCTTGGATATCTTCCACAGTA	0.388																																						dbGAP											0													224.0	214.0	217.0					3																	98001967		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.236C>T	3.37:g.98001967C>T	ENSP00000347418:p.Ser79Phe		Q6IF87	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S79F	ENST00000355273.2	37	c.236	CCDS33801.1	3	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435170	0.25813	.	.	ENSG00000197938	ENST00000355273	T	0.00840	5.63	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32918	U	0.005484	T	0.09512	0.0234	H	0.97340	3.985	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.09596	-1.0667	10	0.87932	D	0	.	12.205	0.54346	0.0:1.0:0.0:0.0	.	79	Q8NGV7	OR5H2_HUMAN	F	79	ENSP00000347418:S79F	ENSP00000347418:S79F	S	+	2	0	OR5H2	99484657	0.000000	0.05858	0.024000	0.17045	0.327000	0.28475	0.048000	0.14078	1.787000	0.52448	0.543000	0.68304	TCT	OR5H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000197938		0.388	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	77	0.00	0	C			98001967	98001967	+1	no_errors	ENST00000355273	ensembl	human	known	69_37n	missense	62	11.43	8	SNP	0.006	T
PCDH11X	27328	genome.wustl.edu	37	X	91133194	91133194	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chrX:91133194C>T	ENST00000373094.1	+	2	2800	c.1955C>T	c.(1954-1956)tCa>tTa	p.S652L	PCDH11X_ENST00000373097.1_Missense_Mutation_p.S652L|PCDH11X_ENST00000395337.2_Missense_Mutation_p.S652L|PCDH11X_ENST00000504220.2_Missense_Mutation_p.S652L|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S652L|PCDH11X_ENST00000406881.1_Missense_Mutation_p.S652L|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S652L|PCDH11X_ENST00000361724.1_Missense_Mutation_p.S652L|PCDH11X_ENST00000298274.8_Missense_Mutation_p.S652L	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGTAGAGTATCACGTTCTTCA	0.373																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													59.0	52.0	55.0					X																	91133194		2202	4281	6483	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1955C>T	X.37:g.91133194C>T	ENSP00000362186:p.Ser652Leu		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S652L	ENST00000373094.1	37	c.1955	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474409	0.43942	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.35	4.43	0.53597	Cadherin (4);Cadherin-like (1);	0.276324	0.36167	N	0.002746	T	0.48484	0.1502	L	0.42581	1.335	0.29349	N	0.865492	P;B;P;P;P;P;P;P	0.42161	0.486;0.431;0.73;0.73;0.73;0.772;0.486;0.486	B;B;P;P;P;P;B;B	0.49192	0.268;0.352;0.467;0.467;0.467;0.602;0.268;0.268	T	0.51872	-0.8650	10	0.87932	D	0	.	10.1408	0.42734	0.3843:0.6157:0.0:0.0	.	652;652;652;652;652;652;652;652	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	L	652	ENSP00000378746:S652L;ENSP00000362186:S652L;ENSP00000362189:S652L;ENSP00000355040:S652L;ENSP00000362180:S652L;ENSP00000423762:S652L;ENSP00000355105:S652L;ENSP00000384758:S652L;ENSP00000298274:S652L	ENSP00000298274:S652L	S	+	2	0	PCDH11X	91019850	0.991000	0.36638	0.971000	0.41717	0.981000	0.71138	2.888000	0.48594	2.212000	0.71576	0.415000	0.27848	TCA	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.373	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	62	0.00	0	C	NM_032969		91133194	91133194	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.951	T
PIK3CA	5290	genome.wustl.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr3:178928079G>A	ENST00000263967.3	+	8	1514	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)											137.0	130.0	132.0					3																	178928079		1829	4090	5919	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>A	3.37:g.178928079G>A	ENSP00000263967:p.Glu453Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E453K	ENST00000263967.3	37	c.1357	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.164616	0.94727	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.68317	2.08	0.80722	D	1	P	0.50528	0.936	P	0.50970	0.655	T	0.72500	-0.4274	10	0.20046	T	0.44	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	K	453	ENSP00000263967:E453K	ENSP00000263967:E453K	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000121879		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	29	0.00	0	G			178928079	178928079	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	A
PSMA2	5683	genome.wustl.edu	37	7	42957235	42957235	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr7:42957235C>T	ENST00000223321.4	-	8	707	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K	PSMA2_ENST00000445517.1_Missense_Mutation_p.E145K|PSMA2_ENST00000442788.1_Missense_Mutation_p.E215K	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	215					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						AATCCAGCTTCATTGCAGATT	0.383																																						dbGAP											0													103.0	87.0	93.0					7																	42957235		2203	4300	6503	-	-	-	SO:0001583	missense	0			D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.643G>A	7.37:g.42957235C>T	ENSP00000223321:p.Glu215Lys		Q6ICS6|Q9BU45	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.E215K	ENST00000223321.4	37	c.643	CCDS5467.1	7	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027247	0.75390	.	.	ENSG00000106588	ENST00000223321;ENST00000445517	T;T	0.37235	1.21;1.21	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	N	0.21282	0.65	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04708	-1.0932	10	0.22706	T	0.39	.	19.8546	0.96752	0.0:1.0:0.0:0.0	.	215	P25787	PSA2_HUMAN	K	215;145	ENSP00000223321:E215K;ENSP00000404858:E145K	ENSP00000223321:E215K	E	-	1	0	PSMA2	42923760	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.697000	0.92050	0.655000	0.94253	GAA	PSMA2	-	NULL	ENSG00000106588		0.383	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA2	HGNC	protein_coding	OTTHUMT00000250816.1	32	0.00	0	C	NM_002787		42957235	42957235	-1	no_errors	ENST00000223321	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	T
RECQL4	9401	genome.wustl.edu	37	8	145739720	145739720	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr8:145739720C>T	ENST00000428558.2	-	11	1772	c.1731G>A	c.(1729-1731)ctG>ctA	p.L577L	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_004260.3	NP_004251.3	O94761	RECQ4_HUMAN	RecQ protein-like 4	577	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|bubble DNA binding (GO:0000405)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GTGTCAGCATCAGCACGTGTA	0.657			"""N, F, S"""			"""osteosarcoma, skin basal and sqamous cell"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Rothmund-Thomson syndrome;RAPADILINO syndrome;Baller-Gerold syndrome																													dbGAP	yes	Rec		Rothmund-Thompson Syndrome	8	8q24.3	9401	RecQ protein-like 4		M	0													27.0	33.0	31.0					8																	145739720		2096	4212	6308	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	RTS, Poikiloderma Atrophicans and Cataract, Congenital Poikiloderma; ;Craniosynostosis with Radial Defects	AB006532	CCDS75804.1	8q24.3	2014-09-17	2014-03-07	2014-03-07		ENSG00000160957			9949	protein-coding gene	gene with protein product		603780				9878247, 15960976	Standard	NM_004260		Approved	RecQ4	uc003zdj.3	O94761		ENST00000428558.2:c.1731G>A	8.37:g.145739720C>T			Q3Y424|Q96DW2|Q96F55	RNA	SNP	-	NULL	ENST00000428558.2	37	NULL		8																																																																																			RECQL4	-	-	ENSG00000160957		0.657	RECQL4-201	KNOWN	basic|appris_principal	protein_coding	RECQL4	HGNC	protein_coding		31	0.00	0	C	NM_004260		145739720	145739720	-1	no_errors	ENST00000428558	ensembl	human	known	69_37n	rna	39	15.22	7	SNP	0.987	T
RYR2	6262	genome.wustl.edu	37	1	237550637	237550637	+	Silent	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr1:237550637C>G	ENST00000366574.2	+	9	950	c.633C>G	c.(631-633)ctC>ctG	p.L211L	RYR2_ENST00000542537.1_Silent_p.L195L|RYR2_ENST00000360064.6_Silent_p.L209L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	211	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCAGACTCTCTGGAGCGTGG	0.517																																						dbGAP											0													112.0	113.0	113.0					1																	237550637		1968	4156	6124	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.633C>G	1.37:g.237550637C>G			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L209	ENST00000366574.2	37	c.627	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ins145_P3_rcpt,smart_MIR_motif	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	35	0.00	0	C	NM_001035		237550637	237550637	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	50	12.28	7	SNP	0.076	G
SCYL2	55681	genome.wustl.edu	37	12	100732630	100732630	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr12:100732630C>T	ENST00000360820.2	+	18	2907	c.2470C>T	c.(2470-2472)Cct>Tct	p.P824S		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	824	Necessary for interaction with AP2 complex and clathrin, interaction with clathrin is necessary for its targeting to the TGN and endosomal membranes.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GAGTGTTCCTCCTGCTGGTGC	0.463																																						dbGAP											0													157.0	164.0	162.0					12																	100732630		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2470C>T	12.37:g.100732630C>T	ENSP00000354061:p.Pro824Ser		A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.P824S	ENST00000360820.2	37	c.2470	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	C	5.041	0.193310	0.09599	.	.	ENSG00000136021	ENST00000360820	T	0.27104	1.69	5.54	4.63	0.57726	.	0.622710	0.16626	N	0.206270	T	0.12305	0.0299	N	0.12182	0.205	0.34408	D	0.695992	B	0.02656	0.0	B	0.04013	0.001	T	0.19516	-1.0303	10	0.12766	T	0.61	-6.1712	7.9823	0.30192	0.1555:0.7251:0.0:0.1194	.	824	Q6P3W7	SCYL2_HUMAN	S	824	ENSP00000354061:P824S	ENSP00000354061:P824S	P	+	1	0	SCYL2	99256761	0.994000	0.37717	0.998000	0.56505	0.321000	0.28281	0.585000	0.23879	2.763000	0.94921	0.650000	0.86243	CCT	SCYL2	-	NULL	ENSG00000136021		0.463	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	81	0.00	0	C	NM_017988		100732630	100732630	+1	no_errors	ENST00000360820	ensembl	human	known	69_37n	missense	54	30.77	24	SNP	0.987	T
SFRP2	6423	genome.wustl.edu	37	4	154709955	154709956	+	In_Frame_Ins	INS	-	-	AGC	rs559360607	byFrequency	TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr4:154709955_154709956insAGC	ENST00000274063.4	-	1	316_317	c.32_33insGCT	c.(31-33)ctc>ctGCTc	p.11_11L>LL		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	11					bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				AGGCGAGGAAGAGCAGCAGCAG	0.708														3	0.000599042	0.0	0.0	5008	,	,		13542	0.0		0.003	False		,,,				2504	0.0					dbGAP											0										6,3904		0,6,1949						-7.4	0.3			11	34,7600		5,24,3788	no	coding	SFRP2	NM_003013.2		5,30,5737	A1A1,A1R,RR		0.4454,0.1535,0.3465				40,11504				-	-	-	SO:0001652	inframe_insertion	0			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.30_32dupGCT	4.37:g.154709962_154709964dupAGC	ENSP00000274063:p.Leu11dup		B3KQR2|O14778|Q9HAP5	In_Frame_Ins	INS	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.12in_frame_insL	ENST00000274063.4	37	c.33_32	CCDS34082.1	4																																																																																			SFRP2	-	NULL	ENSG00000145423		0.708	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP2	HGNC	protein_coding	OTTHUMT00000365296.1	10	0.00	0	-			154709955	154709956	-1	no_errors	ENST00000274063	ensembl	human	known	69_37n	in_frame_ins	14	36.36	8	INS	0.009:0.677	AGC
SLC1A4	6509	genome.wustl.edu	37	2	65237810	65237810	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr2:65237810A>C	ENST00000234256.3	+	4	956	c.713A>C	c.(712-714)aAg>aCg	p.K238T	SLC1A4_ENST00000493121.1_3'UTR|SLC1A4_ENST00000531327.1_Missense_Mutation_p.K18T	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	238					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	GTGGCCTTAAAGAAACTAGGC	0.493																																						dbGAP											0													186.0	170.0	175.0					2																	65237810		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.713A>C	2.37:g.65237810A>C	ENSP00000234256:p.Lys238Thr		B7Z3C0|D6W5F0	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.K238T	ENST00000234256.3	37	c.713	CCDS1879.1	2	.	.	.	.	.	.	.	.	.	.	A	15.57	2.872338	0.51695	.	.	ENSG00000115902	ENST00000531327;ENST00000448784;ENST00000234256	T;T	0.58358	0.34;0.34	6.03	6.03	0.97812	.	0.088254	0.85682	D	0.000000	T	0.40694	0.1127	N	0.02721	-0.515	0.53005	D	0.999967	P;P;P	0.41188	0.741;0.643;0.741	B;P;B	0.47251	0.309;0.542;0.405	T	0.55604	-0.8115	10	0.66056	D	0.02	-19.0638	16.5724	0.84622	1.0:0.0:0.0:0.0	.	238;18;238	P43007;B7Z3C0;B2R7N6	SATT_HUMAN;.;.	T	18;158;238	ENSP00000431942:K18T;ENSP00000234256:K238T	ENSP00000234256:K238T	K	+	2	0	SLC1A4	65091314	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.147000	0.58078	2.313000	0.78055	0.455000	0.32223	AAG	SLC1A4	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	ENSG00000115902		0.493	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A4	HGNC	protein_coding	OTTHUMT00000251726.2	92	0.00	0	A	NM_003038		65237810	65237810	+1	no_errors	ENST00000234256	ensembl	human	known	69_37n	missense	66	21.43	18	SNP	1.000	C
SLC44A2	57153	genome.wustl.edu	37	19	10747167	10747167	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:10747167C>T	ENST00000335757.5	+	15	1778	c.1402C>T	c.(1402-1404)Ctg>Ttg	p.L468L	SLC44A2_ENST00000407327.4_Silent_p.L466L|SLC44A2_ENST00000586078.1_Silent_p.L468L			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	468					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CCAGGTCACGCTGGCCGGGGC	0.667																																						dbGAP											0													64.0	66.0	66.0					19																	10747167		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1402C>T	19.37:g.10747167C>T			B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	pfam_Choline_transptr-like	p.L468	ENST00000335757.5	37	c.1402	CCDS12245.1	19																																																																																			SLC44A2	-	pfam_Choline_transptr-like	ENSG00000129353		0.667	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	56	0.00	0	C			10747167	10747167	+1	no_errors	ENST00000335757	ensembl	human	known	69_37n	silent	46	24.59	15	SNP	0.986	T
SLC46A3	283537	genome.wustl.edu	37	13	29284961	29284961	+	Silent	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr13:29284961G>A	ENST00000266943.6	-	4	1449	c.1080C>T	c.(1078-1080)ttC>ttT	p.F360F	SLC46A3_ENST00000380814.4_Silent_p.F360F	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	360					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		GCACAATAGTGAAAAGGAACG	0.398																																						dbGAP											0													129.0	123.0	125.0					13																	29284961		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1080C>T	13.37:g.29284961G>A			Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F360	ENST00000266943.6	37	c.1080	CCDS9332.1	13																																																																																			SLC46A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000139508		0.398	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	45	0.00	0	G	NM_181785		29284961	29284961	-1	no_errors	ENST00000266943	ensembl	human	known	69_37n	silent	29	25.64	10	SNP	0.007	A
SREK1	140890	genome.wustl.edu	37	5	65466528	65466528	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr5:65466528A>T	ENST00000380918.3	+	10	1549	c.889A>T	c.(889-891)Aaa>Taa	p.K297*	SREK1_ENST00000284041.3_3'UTR|SREK1_ENST00000334121.6_Nonsense_Mutation_p.K413*	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	297	Arg/Glu/Lys/Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						GGAACGGGGTAAAAACAAAGA	0.448																																					GBM(10;31 347 27684 38976 41583)	dbGAP											0													72.0	81.0	78.0					5																	65466528		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.889A>T	5.37:g.65466528A>T	ENSP00000370305:p.Lys297*		A4FTW3|Q2M1J0|Q86X37	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K413*	ENST00000380918.3	37	c.1237	CCDS3991.1	5	.	.	.	.	.	.	.	.	.	.	A	42	9.295422	0.99128	.	.	ENSG00000153914	ENST00000334121;ENST00000537482;ENST00000380918	.	.	.	5.44	5.44	0.79542	.	0.278962	0.29444	N	0.012131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	11.8955	0.52654	1.0:0.0:0.0:0.0	.	.	.	.	X	413;413;297	.	ENSP00000334538:K413X	K	+	1	0	SREK1	65502284	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.998000	0.49465	2.055000	0.61198	0.528000	0.53228	AAA	SREK1	-	NULL	ENSG00000153914		0.448	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	26	0.00	0	A	NM_001077199		65466528	65466528	+1	no_errors	ENST00000334121	ensembl	human	known	69_37n	nonsense	16	23.81	5	SNP	1.000	T
SULT1A3	6818	genome.wustl.edu	37	16	30205935	30205935	+	5'UTR	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr16:30205935C>T	ENST00000355544.5	+	0	116				SLX1A_ENST00000345535.4_Intron|BOLA2B_ENST00000305321.4_5'Flank|SLX1A_ENST00000251303.6_Intron|SULT1A3_ENST00000354723.6_5'UTR|SULT1A3_ENST00000395137.2_5'Flank|SLX1A-SULT1A3_ENST00000565342.1_RNA			P0DMM9	ST1A3_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3						catecholamine metabolic process (GO:0006584)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	aryl sulfotransferase activity (GO:0004062)										CTGAGGTGGGCAGGTGCAGAG	0.682																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U20499	CCDS10674.1	16p11.2	2012-10-08			ENSG00000261052	ENSG00000261052	2.8.2.1	"""Sulfotransferases, cytosolic"""	11455	protein-coding gene	gene with protein product		600641		STM		8117269, 7829089	Standard	NM_177552		Approved	TL-PST	uc002dtb.3	P0DMM9	OTTHUMG00000048083	ENST00000355544.5:c.-834C>T	16.37:g.30205935C>T			B4DNV0|O95603|P50224|Q1ET66|Q6ZWJ5	RNA	SNP	-	NULL	ENST00000355544.5	37	NULL	CCDS10674.1	16																																																																																			SULT1A3	-	-	ENSG00000213599		0.682	SULT1A3-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	SULT1A3	HGNC	protein_coding		13	0.00	0	C	NM_003166		30205935	30205935	+1	no_errors	ENST00000565342	ensembl	human	known	69_37n	rna	27	22.86	8	SNP	0.002	T
TBC1D25	4943	genome.wustl.edu	37	X	48399820	48399820	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chrX:48399820G>C	ENST00000376771.4	+	2	564	c.223G>C	c.(223-225)Gat>Cat	p.D75H	TBC1D25_ENST00000476141.1_3'UTR|TBC1D25_ENST00000537536.1_5'UTR	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	75					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CCGAGCCTTTGATTTGAGTGG	0.527																																						dbGAP											0													142.0	122.0	129.0					X																	48399820		2203	4300	6503	-	-	-	SO:0001583	missense	0			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.223G>C	X.37:g.48399820G>C	ENSP00000365962:p.Asp75His		Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.D75H	ENST00000376771.4	37	c.223	CCDS35242.1	X	.	.	.	.	.	.	.	.	.	.	g	17.81	3.480050	0.63849	.	.	ENSG00000068354	ENST00000376771;ENST00000427713;ENST00000418627	T	0.22336	1.96	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.20373	0.0490	L	0.46157	1.445	0.80722	D	1	P;P	0.49961	0.93;0.93	B;B	0.40982	0.345;0.345	T	0.02059	-1.1221	10	0.56958	D	0.05	-10.362	12.6409	0.56709	0.0:0.0:1.0:0.0	.	79;75	B4DF03;Q3MII6	.;TBC25_HUMAN	H	75;75;91	ENSP00000365962:D75H	ENSP00000365962:D75H	D	+	1	0	TBC1D25	48284764	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.365000	0.90108	2.035000	0.60131	0.452000	0.29995	GAT	TBC1D25	-	NULL	ENSG00000068354		0.527	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D25	HGNC	protein_coding	OTTHUMT00000060764.2	101	0.00	0	G	NM_002536		48399820	48399820	+1	no_errors	ENST00000376771	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	1.000	C
TRIO	7204	genome.wustl.edu	37	5	14507272	14507272	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr5:14507272G>A	ENST00000344204.4	+	56	8678	c.8654G>A	c.(8653-8655)gGa>gAa	p.G2885E	TRIO_ENST00000344135.5_Missense_Mutation_p.G384E|TRIO_ENST00000537187.1_Missense_Mutation_p.G2709E	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2885	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTGCGATGGGGAAGCCTCACT	0.577																																						dbGAP											0													71.0	64.0	66.0					5																	14507272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8654G>A	5.37:g.14507272G>A	ENSP00000339299:p.Gly2885Glu		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.G2885E	ENST00000344204.4	37	c.8654	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535273	0.85812	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000344135	T;T;T	0.44482	0.92;0.92;0.92	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48750	0.1517	N	0.20574	0.59	0.46376	D	0.99901	D	0.56521	0.976	D	0.65987	0.94	T	0.32052	-0.9921	10	0.17832	T	0.49	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	2885	O75962	TRIO_HUMAN	E	2885;2709;384	ENSP00000339299:G2885E;ENSP00000446348:G2709E;ENSP00000339291:G384E	ENSP00000339291:G384E	G	+	2	0	TRIO	14560272	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	2.643000	0.89663	0.655000	0.94253	GGA	TRIO	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000038382		0.577	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	32	0.00	0	G	NM_007118		14507272	14507272	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	A
TSHZ2	128553	genome.wustl.edu	37	20	51872795	51872795	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr20:51872795C>T	ENST00000371497.5	+	2	3685	c.2798C>T	c.(2797-2799)tCc>tTc	p.S933F	TSHZ2_ENST00000603338.2_Missense_Mutation_p.S930F|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.S930F	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	933					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GACTGTGCCTCCCAGTTCAGA	0.488																																						dbGAP											0													71.0	73.0	72.0					20																	51872795		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2798C>T	20.37:g.51872795C>T	ENSP00000360552:p.Ser933Phe		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.S933F	ENST00000371497.5	37	c.2798	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179066	0.78564	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.27890	1.64;1.64	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.58452	0.2123	M	0.70787	2.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59768	-0.7392	10	0.87932	D	0	-23.8409	19.8272	0.96622	0.0:1.0:0.0:0.0	.	933	Q9NRE2	TSH2_HUMAN	F	933;930;459	ENSP00000360552:S933F;ENSP00000333114:S930F	ENSP00000333114:S930F	S	+	2	0	TSHZ2	51306202	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.482000	0.81143	2.685000	0.91497	0.643000	0.83706	TCC	TSHZ2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182463		0.488	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	37	0.00	0	C	NM_173485		51872795	51872795	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	missense	35	12.20	5	SNP	1.000	T
UBA6	55236	genome.wustl.edu	37	4	68492133	68492133	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr4:68492133C>T	ENST00000322244.5	-	28	2522	c.2463G>A	c.(2461-2463)gaG>gaA	p.E821E		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	821				E -> G (in Ref. 5; CAD89959). {ECO:0000305}.	protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTGCATTCCTCTCATCTTCAC	0.303																																						dbGAP											0													101.0	98.0	99.0					4																	68492133		2203	4295	6498	-	-	-	SO:0001819	synonymous_variant	0			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2463G>A	4.37:g.68492133C>T			A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Silent	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.E821	ENST00000322244.5	37	c.2463	CCDS3516.1	4																																																																																			UBA6	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000033178		0.303	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	42	0.00	0	C	NM_018227		68492133	68492133	-1	no_errors	ENST00000322244	ensembl	human	known	69_37n	silent	39	15.22	7	SNP	1.000	T
UBXN7	26043	genome.wustl.edu	37	3	196096354	196096354	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr3:196096354C>G	ENST00000296328.4	-	7	718	c.644G>C	c.(643-645)aGa>aCa	p.R215T	UBXN7_ENST00000535858.1_Missense_Mutation_p.R67T|UBXN7_ENST00000428095.1_Missense_Mutation_p.R53T	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	215						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CTGTATGTATCTCTGACCTTC	0.358																																						dbGAP											0													102.0	97.0	98.0					3																	196096354		1823	4080	5903	-	-	-	SO:0001583	missense	0			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.644G>C	3.37:g.196096354C>G	ENSP00000296328:p.Arg215Thr		D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pirsf_UCP037991_UAS/UBX,pfscan_UBX	p.R215T	ENST00000296328.4	37	c.644	CCDS43191.1	3	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743082	0.89663	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	T;T;T	0.43294	0.95;0.95;0.95	5.45	5.45	0.79879	UAS (1);	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.45352	1.415	0.80722	D	1	D	0.54601	0.967	P	0.53146	0.719	T	0.34950	-0.9808	10	0.37606	T	0.19	-16.7013	19.4672	0.94948	0.0:1.0:0.0:0.0	.	215	O94888	UBXN7_HUMAN	T	215;53;67	ENSP00000296328:R215T;ENSP00000397256:R53T;ENSP00000440716:R67T	ENSP00000296328:R215T	R	-	2	0	UBXN7	197580751	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.459000	0.80802	2.833000	0.97629	0.585000	0.79938	AGA	UBXN7	-	smart_UAS,pirsf_UCP037991_UAS/UBX	ENSG00000163960		0.358	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN7	HGNC	protein_coding	OTTHUMT00000340938.2	32	0.00	0	C	XM_087353		196096354	196096354	-1	no_errors	ENST00000296328	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	G
VSIG10L	147645	genome.wustl.edu	37	19	51840606	51840606	+	Missense_Mutation	SNP	G	G	A	rs530166865		TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:51840606G>A	ENST00000335624.4	-	7	2190	c.2191C>T	c.(2191-2193)Cgg>Tgg	p.R731W		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	731						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						ACGGCTGACCGCTCCTGAGGC	0.647													g|||	1	0.000199681	0.0	0.0	5008	,	,		12063	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													42.0	52.0	49.0					19																	51840606		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2191C>T	19.37:g.51840606G>A	ENSP00000335623:p.Arg731Trp			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R731W	ENST00000335624.4	37	c.2191	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	g	18.07	3.541619	0.65085	.	.	ENSG00000186806	ENST00000335624	T	0.34072	1.38	4.76	3.7	0.42460	.	0.000000	0.42053	D	0.000766	T	0.59932	0.2230	M	0.84219	2.685	0.40594	D	0.981519	D	0.89917	1.0	D	0.87578	0.998	T	0.64411	-0.6414	10	0.66056	D	0.02	-15.2579	10.2488	0.43356	0.0:0.0:0.8017:0.1983	.	731	Q86VR7	VS10L_HUMAN	W	731	ENSP00000335623:R731W	ENSP00000335623:R731W	R	-	1	2	VSIG10L	56532418	0.979000	0.34478	0.556000	0.28293	0.791000	0.44710	3.057000	0.49931	0.954000	0.37851	0.457000	0.33378	CGG	VSIG10L	-	NULL	ENSG00000186806		0.647	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	23	0.00	0	G	NM_001163922		51840606	51840606	-1	no_errors	ENST00000335624	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	0.910	A
WNK1	65125	genome.wustl.edu	37	12	988982	988982	+	Silent	SNP	C	C	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr12:988982C>T	ENST00000315939.6	+	11	3260	c.2617C>T	c.(2617-2619)Ctg>Ttg	p.L873L	WNK1_ENST00000340908.4_Silent_p.L466L|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000530271.2_Silent_p.L1371L|WNK1_ENST00000537687.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	873					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TACTCAGCCTCTGCTCACGTT	0.532																																					Colon(19;451 567 6672 12618 28860)	dbGAP											0													157.0	131.0	140.0					12																	988982		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2617C>T	12.37:g.988982C>T			A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1371	ENST00000315939.6	37	c.4111	CCDS8506.1	12																																																																																			WNK1	-	NULL	ENSG00000060237		0.532	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	57	0.00	0	C	NM_018979		988982	988982	+1	no_errors	ENST00000530271	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	1.000	T
ZCCHC18	644353	genome.wustl.edu	37	X	103360247	103360247	+	3'UTR	SNP	G	G	C			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chrX:103360247G>C	ENST00000537356.3	+	0	2859				ZCCHC18_ENST00000422784.1_3'UTR|SLC25A53_ENST00000357421.4_Intron			P0CG32	ZCC18_HUMAN	zinc finger, CCHC domain containing 18								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										CTATTTCTTTGATGACTTTAT	0.388																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF086548	CCDS65304.1	Xq22.2	2013-01-31	2009-02-03		ENSG00000166707	ENSG00000166707		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	32459	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7B"""		"""zinc finger, CCHC domain containing 12 pseudogene 1"""				Standard	NM_001143978		Approved	SIZN2, PNMA7B	uc011msh.2	P0CG32	OTTHUMG00000022123	ENST00000537356.3:c.*233G>C	X.37:g.103360247G>C				RNA	SNP	-	NULL	ENST00000537356.3	37	NULL		X																																																																																			ZCCHC18	-	-	ENSG00000166707		0.388	ZCCHC18-006	PUTATIVE	basic|appris_principal	protein_coding	ZCCHC18	HGNC	protein_coding	OTTHUMT00000471686.1	49	0.00	0	G	NM_001143978		103360247	103360247	+1	no_errors	ENST00000422784	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.001	C
ZDHHC5	25921	genome.wustl.edu	37	11	57466134	57466134	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr11:57466134C>G	ENST00000287169.3	+	11	2588	c.1226C>G	c.(1225-1227)tCt>tGt	p.S409C	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.S356C	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	409					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						AGCTTCCGTTCTCCTACCTTT	0.577																																						dbGAP											0													112.0	96.0	101.0					11																	57466134		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1226C>G	11.37:g.57466134C>G	ENSP00000287169:p.Ser409Cys		Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.S409C	ENST00000287169.3	37	c.1226	CCDS7965.1	11	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748195	0.69533	.	.	ENSG00000156599	ENST00000527985;ENST00000287169;ENST00000529447	T;T;D	0.83837	0.2;1.2;-1.77	5.28	5.28	0.74379	.	0.544202	0.19975	N	0.101881	D	0.86008	0.5830	L	0.29908	0.895	0.45172	D	0.99818	D	0.69078	0.997	D	0.63192	0.912	D	0.87059	0.2152	10	0.66056	D	0.02	-18.2074	18.6968	0.91604	0.0:1.0:0.0:0.0	.	409	Q9C0B5	ZDHC5_HUMAN	C	356;409;243	ENSP00000432202:S356C;ENSP00000287169:S409C;ENSP00000435722:S243C	ENSP00000287169:S409C	S	+	2	0	ZDHHC5	57222710	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.022000	0.64078	2.758000	0.94735	0.563000	0.77884	TCT	ZDHHC5	-	NULL	ENSG00000156599		0.577	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC5	HGNC	protein_coding	OTTHUMT00000393694.1	80	0.00	0	C	NM_015457		57466134	57466134	+1	no_errors	ENST00000287169	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	1.000	G
ZNF536	9745	genome.wustl.edu	37	19	30934683	30934683	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr19:30934683A>T	ENST00000355537.3	+	2	361	c.214A>T	c.(214-216)Atg>Ttg	p.M72L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	72					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCACGTGCCCATGAGCGGCCA	0.682																																						dbGAP											0													30.0	34.0	32.0					19																	30934683		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.214A>T	19.37:g.30934683A>T	ENSP00000347730:p.Met72Leu		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M72L	ENST00000355537.3	37	c.214	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.885853	0.00532	.	.	ENSG00000198597	ENST00000355537	T	0.06528	3.29	5.67	-2.85	0.05734	.	0.504261	0.23521	N	0.047293	T	0.02304	0.0071	N	0.04880	-0.145	0.27979	N	0.936115	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44467	-0.9326	10	0.02654	T	1	-6.7152	12.4926	0.55909	0.3354:0.6033:0.0613:0.0	.	72;72	A7E228;O15090	.;ZN536_HUMAN	L	72	ENSP00000347730:M72L	ENSP00000347730:M72L	M	+	1	0	ZNF536	35626523	0.950000	0.32346	0.791000	0.31998	0.783000	0.44284	0.478000	0.22212	-0.549000	0.06191	-0.648000	0.03929	ATG	ZNF536	-	NULL	ENSG00000198597		0.682	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	30	0.00	0	A	NM_014717		30934683	30934683	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	0.916	T
ZNF767P	79970	genome.wustl.edu	37	7	149317094	149317094	+	RNA	SNP	C	C	A			TCGA-OL-A5DA-01A-11D-A27P-09	TCGA-OL-A5DA-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	df98fc00-d39c-4d26-a90a-76543158ddca	036cd1a3-6f1d-4099-93c3-125e1b280698	g.chr7:149317094C>A	ENST00000463567.1	-	0	520					NR_027788.1		Q75MW2	ZN767_HUMAN												central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)	5	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)			CTTGTTCAATCTGGGAGAGGA	0.562																																						dbGAP											0													87.0	79.0	82.0					7																	149317094		2203	4300	6503	-	-	-			0																															7.37:g.149317094C>A			D3DWG6|Q86WY4|Q9H9J3	RNA	SNP	-	NULL	ENST00000463567.1	37	NULL		7																																																																																			ZNF767	-	-	ENSG00000133624		0.562	ZNF767-001	KNOWN	basic	processed_transcript	ZNF767	HGNC	pseudogene	OTTHUMT00000352753.2	89	0.00	0	C			149317094	149317094	-1	no_errors	ENST00000463567	ensembl	human	known	69_37n	rna	68	16.05	13	SNP	0.069	A
