#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB5	340273	hgsc.bcm.edu	37	7	20691166	20691166	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr7:20691166C>T	ENST00000404938.2	+	13	2108	c.1456C>T	c.(1456-1458)Cga>Tga	p.R486*	ABCB5_ENST00000258738.6_Nonsense_Mutation_p.R41*|ABCB5_ENST00000443026.2_Nonsense_Mutation_p.R41*|ABCB5_ENST00000406935.1_Nonsense_Mutation_p.R41*|ABCB5_ENST00000477094.1_3'UTR	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	486	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.R41*(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CAAGTATGGACGAGATGATGT	0.438																																					p.R41X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C121T	7						.						271.0	234.0	247.0					7																	20691166		2203	4300	6503	20657691	SO:0001587	stop_gained	340273	exon4			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1456C>T	7.37:g.20691166C>T	ENSP00000384881:p.Arg486*		20657691	NM_178559	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Nonsense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	37	6.001803	0.97189	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	.	.	.	4.2	2.41	0.29592	.	0.117860	0.34110	N	0.004242	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.1696	0.10324	0.2679:0.5425:0.0:0.1896	.	.	.	.	X	486;41;41;41	.	ENSP00000258738:R41X	R	+	1	2	ABCB5	20657691	0.317000	0.24589	0.776000	0.31678	0.329000	0.28539	0.953000	0.29162	0.736000	0.32559	-0.229000	0.12294	CGA		0.438	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
NEUROD6	63974	hgsc.bcm.edu	37	7	31378583	31378583	+	Silent	SNP	G	G	A	rs374292030		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr7:31378583G>A	ENST00000297142.3	-	2	622	c.300C>T	c.(298-300)aaC>aaT	p.N100N		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	100	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.N100N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TCTCGCGCGCGTTCGCTTCCT	0.478																																					p.N100N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C300T	7						.	G		0,4406		0,0,2203	246.0	240.0	242.0		300	-8.6	0.0	7		242	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NEUROD6	NM_022728.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		100/338	31378583	1,13005	2203	4300	6503	31345108	SO:0001819	synonymous_variant	63974	exon2			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.300C>T	7.37:g.31378583G>A			31345108	NM_022728	Q548T9|Q9H3H6	Silent	SNP	ENST00000297142.3	37	CCDS5434.1																																																																																				0.478	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
ELMO1	9844	hgsc.bcm.edu	37	7	37354499	37354499	+	Silent	SNP	A	A	G			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr7:37354499A>G	ENST00000310758.4	-	4	794	c.147T>C	c.(145-147)ttT>ttC	p.F49F	ELMO1_ENST00000442504.1_Silent_p.F49F|ELMO1_ENST00000448602.1_Silent_p.F49F	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	49					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.F49F(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GCTGGAGTGCAAAATATTCAT	0.323																																					p.F49F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T147C	7						.						101.0	96.0	98.0					7																	37354499		2203	4300	6503	37321024	SO:0001819	synonymous_variant	9844	exon4			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.147T>C	7.37:g.37354499A>G			37321024	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	CCDS5449.1																																																																																				0.323	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
UBE2D4	51619	hgsc.bcm.edu	37	7	43990226	43990226	+	Silent	SNP	C	C	T	rs561601278		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr7:43990226C>T	ENST00000222402.3	+	6	422	c.333C>T	c.(331-333)tgC>tgT	p.C111C	POLR2J4_ENST00000427076.1_RNA|UBE2D4_ENST00000394798.4_Silent_p.C73C|RP5-1165K10.2_ENST00000454572.1_RNA	NM_015983.3	NP_057067.1	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)	111					protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.C111C(1)		endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)	5						CGCTGCTCTGCGACCCCAACC	0.562													c|||	1	0.000199681	0.0	0.0	5008	,	,		22165	0.0		0.0	False		,,,				2504	0.001				p.C111C	Esophageal Squamous(27;401 815 16344 30604)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C333T	7						.						126.0	112.0	117.0					7																	43990226		2203	4300	6503	43956751	SO:0001819	synonymous_variant	51619	exon6			BC004104	CCDS5474.1	7p13	2005-08-11			ENSG00000078967	ENSG00000078967		"""Ubiquitin-conjugating enzymes E2"""	21647	protein-coding gene	gene with protein product						12690205	Standard	NM_015983		Approved	HBUCE1	uc003tja.2	Q9Y2X8	OTTHUMG00000128971	ENST00000222402.3:c.333C>T	7.37:g.43990226C>T			43956751	NM_015983	A4D1V0	Silent	SNP	ENST00000222402.3	37	CCDS5474.1																																																																																				0.562	UBE2D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250958.2	NM_015983	
GNAI1	2770	hgsc.bcm.edu	37	7	79840297	79840297	+	Silent	SNP	G	G	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr7:79840297G>T	ENST00000351004.3	+	6	976	c.603G>T	c.(601-603)gtG>gtT	p.V201V	GNAI1_ENST00000457358.2_Silent_p.V149V	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	201					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.V201V(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						TGTTTGATGTGGGAGGTCAGA	0.408																																					p.V201V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G603T	7						.						153.0	132.0	139.0					7																	79840297		2203	4300	6503	79678233	SO:0001819	synonymous_variant	2770	exon6			AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.603G>T	7.37:g.79840297G>T			79678233	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Silent	SNP	ENST00000351004.3	37	CCDS5595.1																																																																																				0.408	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
RBM12	10137	hgsc.bcm.edu	37	20	34241869	34241869	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr20:34241869C>A	ENST00000374114.3	-	3	1639	c.1376G>T	c.(1375-1377)aGt>aTt	p.S459I	CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.S459I|CPNE1_ENST00000352393.4_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.S459I|CPNE1_ENST00000317677.5_5'Flank|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000397445.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	459	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S459I(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TATATAAATACTATCTTCCAC	0.383											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.S459I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1376T	20						.						78.0	83.0	81.0					20																	34241869		2203	4300	6503	33705283	SO:0001583	missense	10137	exon3			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1376G>T	20.37:g.34241869C>A	ENSP00000363228:p.Ser459Ile	846	33705283	NM_152838	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341230	0.60963	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.08984	3.03;3.03;3.03	4.81	4.81	0.61882	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10337	-1.0634	10	0.66056	D	0.02	-12.1095	18.1021	0.89509	0.0:1.0:0.0:0.0	.	459	Q9NTZ6	RBM12_HUMAN	I	459;459;459;258	ENSP00000363228:S459I;ENSP00000352668:S459I;ENSP00000363217:S459I	ENSP00000339879:S258I	S	-	2	0	RBM12	33705283	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.095000	0.76952	2.498000	0.84270	0.555000	0.69702	AGT		0.383	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
SAMD4A	23034	hgsc.bcm.edu	37	14	55243205	55243205	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr14:55243205G>A	ENST00000554335.1	+	11	2654	c.1991G>A	c.(1990-1992)cGc>cAc	p.R664H	SAMD4A_ENST00000555192.1_Missense_Mutation_p.R255H|SAMD4A_ENST00000251091.5_Missense_Mutation_p.R576H|SAMD4A_ENST00000392067.3_Missense_Mutation_p.R664H|SAMD4A_ENST00000357634.3_Missense_Mutation_p.R663H			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	664					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)	p.R663H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CAGAGGACCCGCTCGCTGCCC	0.602																																					p.R663H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1988A	14						.						104.0	113.0	110.0					14																	55243205		2203	4300	6503	54312955	SO:0001583	missense	23034	exon10			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1991G>A	14.37:g.55243205G>A	ENSP00000452535:p.Arg664His		54312955	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071366	0.76301	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	L	0.35487	1.065	0.58432	D	0.999998	D;B;P	0.89917	1.0;0.055;0.861	D;B;B	0.74674	0.984;0.032;0.161	T	0.60566	-0.7238	9	0.23302	T	0.38	-13.3068	19.7863	0.96440	0.0:0.0:1.0:0.0	.	255;576;664	G3V2R1;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	H	664;664;576;575;663;255	.	ENSP00000251091:R293H	R	+	2	0	SAMD4A	54312955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.325000	0.72901	2.665000	0.90641	0.655000	0.94253	CGC		0.602	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102493582	102493582	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr14:102493582G>A	ENST00000360184.4	+	45	9007	c.8843G>A	c.(8842-8844)cGt>cAt	p.R2948H		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2948	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.R2948H(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACCCTGTCTCGTTTCGTCGCC	0.478																																					p.R2948H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8843A	14						.						319.0	274.0	289.0					14																	102493582		2203	4300	6503	101563335	SO:0001583	missense	1778	exon45			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8843G>A	14.37:g.102493582G>A	ENSP00000348965:p.Arg2948His		101563335	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	34	5.394979	0.96009	.	.	ENSG00000197102	ENST00000360184	T	0.57273	0.41	5.81	5.81	0.92471	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.181162	0.47093	N	0.000250	D	0.82595	0.5071	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.87460	0.2407	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	2948	Q14204	DYHC1_HUMAN	H	2948	ENSP00000348965:R2948H	ENSP00000348965:R2948H	R	+	2	0	DYNC1H1	101563335	1.000000	0.71417	0.436000	0.26797	0.924000	0.55760	9.531000	0.98054	2.736000	0.93811	0.655000	0.94253	CGT		0.478	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
TRMU	55687	hgsc.bcm.edu	37	22	46749744	46749744	+	Missense_Mutation	SNP	G	G	A	rs147754663	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr22:46749744G>A	ENST00000290846.4	+	8	1193	c.853G>A	c.(853-855)Gtc>Atc	p.V285I	TRMU_ENST00000381019.3_Missense_Mutation_p.V285I	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	285					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)	p.V285I(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		GAAGGACAGCGTCAAGGGTGA	0.577													G|||	2	0.000399361	0.0	0.0014	5008	,	,		21140	0.001		0.0	False		,,,				2504	0.0				p.V285I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G853A	22						.	G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	171.0	138.0	149.0		853	-7.4	0.0	22	dbSNP_134	149	0,8600		0,0,4300	yes	missense	TRMU	NM_018006.4	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	285/422	46749744	1,13005	2203	4300	6503	45128408	SO:0001583	missense	55687	exon8			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.853G>A	22.37:g.46749744G>A	ENSP00000290846:p.Val285Ile		45128408	NM_018006	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	37	CCDS14075.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	1	0.0017482517482517483	0	0.0	G	7.110	0.575847	0.13623	2.27E-4	0.0	ENSG00000100416	ENST00000290846;ENST00000381019	T;T	0.72394	-0.65;-0.65	4.99	-7.37	0.01412	Adenine nucleotide alpha hydrolase-like domains (1);	1.532230	0.03489	N	0.216295	T	0.45756	0.1358	N	0.17278	0.47	0.09310	N	1	B;B;B;B;B	0.34349	0.269;0.45;0.45;0.039;0.006	B;B;B;B;B	0.27500	0.065;0.08;0.08;0.02;0.01	T	0.43310	-0.9399	10	0.49607	T	0.09	-0.0036	4.6752	0.12708	0.5709:0.1002:0.2283:0.1006	.	285;131;131;285;285	B4DHM1;O75648-3;O75648-4;O75648-2;O75648	.;.;.;.;MTU1_HUMAN	I	285	ENSP00000290846:V285I;ENSP00000370407:V285I	ENSP00000290846:V285I	V	+	1	0	TRMU	45128408	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.049000	0.14099	-0.810000	0.04375	-0.806000	0.03193	GTC		0.577	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006	
SMARCA4	6597	hgsc.bcm.edu	37	19	11138522	11138522	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr19:11138522G>A	ENST00000429416.3	+	25	3559	c.3278G>A	c.(3277-3279)cGa>cAa	p.R1093Q	SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1093Q|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1093Q	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1093	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(2)|p.R1093Q(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CCCAAACTCCGAGCAACCAAC	0.507			"""F, N, Mis"""		NSCLC																																p.R1093Q			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.	3	Unknown(2)|Substitution - Missense(1)	lung(2)|large_intestine(1)	c.G3278A	19						.						140.0	139.0	139.0					19																	11138522		2203	4300	6503	10999522	SO:0001583	missense	6597	exon24			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3278G>A	19.37:g.11138522G>A	ENSP00000395654:p.Arg1093Gln		10999522	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800357	0.70567	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.04	5.04	0.67666	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62804	0.2458	L	0.28054	0.825	0.58432	D	0.999992	B;B;B;B;B;B;B;B	0.34264	0.054;0.054;0.054;0.446;0.392;0.128;0.285;0.285	B;B;B;B;B;B;B;B	0.27380	0.029;0.029;0.029;0.079;0.065;0.012;0.044;0.044	T	0.67902	-0.5550	10	0.72032	D	0.01	-16.4511	17.3259	0.87246	0.0:0.0:1.0:0.0	.	1093;1093;1093;1093;1093;313;1093;1093	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	Q	1093;1093;1157;1093;1093;1093;1093;1093	ENSP00000395654:R1093Q;ENSP00000350720:R1093Q;ENSP00000343896:R1093Q;ENSP00000445036:R1093Q;ENSP00000392837:R1093Q;ENSP00000397783:R1093Q;ENSP00000414727:R1093Q	ENSP00000343896:R1093Q	R	+	2	0	SMARCA4	10999522	1.000000	0.71417	0.836000	0.33094	0.986000	0.74619	9.293000	0.96082	2.617000	0.88574	0.655000	0.94253	CGA		0.507	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
CASP14	23581	hgsc.bcm.edu	37	19	15164616	15164616	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr19:15164616G>A	ENST00000427043.3	+	4	558	c.250G>A	c.(250-252)Gtg>Atg	p.V84M	AC004699.1_ENST00000411269.1_RNA|CASP14_ENST00000221740.1_Missense_Mutation_p.V84M	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	84					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.V84M(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						TTGTGCCTTCGTGGTACTCAT	0.537																																					p.V84M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250A	19						.						93.0	81.0	85.0					19																	15164616		2203	4300	6503	15025616	SO:0001583	missense	23581	exon4				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.250G>A	19.37:g.15164616G>A	ENSP00000393417:p.Val84Met		15025616	NM_012114	O95823|Q3SYC9	Missense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	.	.	.	.	.	.	.	.	.	.	g	13.87	2.366007	0.41902	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.28069	1.63;1.63	5.27	4.23	0.50019	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.56097	D	0.000026	T	0.57417	0.2052	M	0.87900	2.915	0.33261	D	0.5598	D	0.89917	1.0	D	0.91635	0.999	T	0.71892	-0.4455	10	0.66056	D	0.02	.	9.7296	0.40352	0.0966:0.0:0.9034:0.0	.	84	P31944	CASPE_HUMAN	M	84	ENSP00000393417:V84M;ENSP00000221740:V84M	ENSP00000221740:V84M	V	+	1	0	CASP14	15025616	0.981000	0.34729	0.295000	0.24960	0.255000	0.26057	1.864000	0.39469	1.210000	0.43336	0.306000	0.20318	GTG		0.537	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
NLRP8	126205	hgsc.bcm.edu	37	19	56485167	56485167	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr19:56485167G>T	ENST00000291971.3	+	7	2755	c.2684G>T	c.(2683-2685)aGa>aTa	p.R895I	NLRP8_ENST00000590542.1_Missense_Mutation_p.R876I	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	895					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.R895I(2)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CCACACCTGAGATGTCCTCTG	0.478																																					p.R895I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2684T	19						.						117.0	105.0	110.0					19																	56485167		2203	4300	6503	61176979	SO:0001583	missense	126205	exon7			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2684G>T	19.37:g.56485167G>T	ENSP00000291971:p.Arg895Ile		61176979	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	0.495	-0.873711	0.02570	.	.	ENSG00000179709	ENST00000291971	T	0.51817	0.69	2.04	-4.08	0.03963	.	.	.	.	.	T	0.25044	0.0608	N	0.08118	0	0.09310	N	1	B;B	0.26483	0.15;0.009	B;B	0.36186	0.219;0.003	T	0.22556	-1.0213	9	0.44086	T	0.13	.	2.1976	0.03915	0.5222:0.1985:0.1634:0.1159	.	876;895	Q86W28-2;Q86W28	.;NALP8_HUMAN	I	895	ENSP00000291971:R895I	ENSP00000291971:R895I	R	+	2	0	NLRP8	61176979	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.313000	0.02718	-3.829000	0.00102	-1.514000	0.00941	AGA		0.478	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
VPS13B	157680	hgsc.bcm.edu	37	8	100836127	100836127	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr8:100836127C>G	ENST00000358544.2	+	51	9437	c.9326C>G	c.(9325-9327)aCt>aGt	p.T3109S	VPS13B_ENST00000357162.2_Missense_Mutation_p.T3084S|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3109					protein transport (GO:0015031)			p.T3109S(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GAAGACAAGACTACAATAATC	0.323																																					p.T3084S	Colon(161;2205 2542 7338 31318)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9251G	8						.						162.0	167.0	165.0					8																	100836127		2203	4297	6500	100905303	SO:0001583	missense	157680	exon51			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9326C>G	8.37:g.100836127C>G	ENSP00000351346:p.Thr3109Ser		100905303	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754491	0.49362	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.78924	-1.22;-1.22	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.66366	0.2782	L	0.32530	0.975	0.80722	D	1	B;B	0.28350	0.037;0.208	B;B	0.23716	0.022;0.048	T	0.62044	-0.6937	10	0.12430	T	0.62	.	15.8451	0.78883	0.0:0.8642:0.1358:0.0	.	3084;3109	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	S	3084;3109	ENSP00000349685:T3084S;ENSP00000351346:T3109S	ENSP00000349685:T3084S	T	+	2	0	VPS13B	100905303	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.589000	0.61006	2.677000	0.91161	0.655000	0.94253	ACT		0.323	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ENPP2	5168	hgsc.bcm.edu	37	8	120575159	120575159	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr8:120575159C>T	ENST00000075322.6	-	24	2417	c.2359G>A	c.(2359-2361)Ggc>Agc	p.G787S	ENPP2_ENST00000522826.1_Missense_Mutation_p.G812S|ENPP2_ENST00000522167.1_Missense_Mutation_p.G422S|ENPP2_ENST00000427067.2_Missense_Mutation_p.G808S|ENPP2_ENST00000259486.6_Missense_Mutation_p.G839S	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	787					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G839S(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GAGAGAGGGCCGTCACACTTG	0.517																																					p.G812S	Melanoma(20;305 879 2501 4818 31020)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2434A	8						.						142.0	119.0	127.0					8																	120575159		2203	4300	6503	120644340	SO:0001583	missense	5168	exon25			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2359G>A	8.37:g.120575159C>T	ENSP00000075322:p.Gly787Ser		120644340	NM_001130863	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	C	35	5.532916	0.96446	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	5.8	5.8	0.92144	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.000000	0.85682	D	0.000000	T	0.59582	0.2204	M	0.75264	2.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.60591	-0.7233	10	0.72032	D	0.01	.	20.0589	0.97667	0.0:1.0:0.0:0.0	.	325;812;787;839;422	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	S	839;808;422;812;787	ENSP00000259486:G839S;ENSP00000403315:G808S;ENSP00000429476:G422S;ENSP00000428291:G812S;ENSP00000075322:G787S	ENSP00000075322:G787S	G	-	1	0	ENPP2	120644340	1.000000	0.71417	0.970000	0.41538	0.888000	0.51559	7.729000	0.84864	2.732000	0.93576	0.650000	0.86243	GGC		0.517	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
RAB2A	5862	hgsc.bcm.edu	37	8	61533316	61533316	+	Silent	SNP	C	C	T	rs370628676		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr8:61533316C>T	ENST00000262646.7	+	8	978	c.627C>T	c.(625-627)ggC>ggT	p.G209G	RAB2A_ENST00000529579.1_Missense_Mutation_p.A172V|RAB2A_ENST00000531289.1_Silent_p.G185G|RAB2A_ENST00000530071.1_3'UTR	NM_002865.2	NP_002856.1	P61019	RAB2A_HUMAN	RAB2A, member RAS oncogene family	209					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G209G(1)		endometrium(1)|large_intestine(1)|lung(4)	6			BRCA - Breast invasive adenocarcinoma(89;0.0805)			AGGCTGGGGGCGGCTGCTGTT	0.507																																					p.G209G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C627T	8						.	C	,	1,4405	2.1+/-5.4	0,1,2202	67.0	75.0	73.0		555,627	-11.6	0.1	8		73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RAB2A	NM_001242644.1,NM_002865.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	185/189,209/213	61533316	1,13005	2203	4300	6503	61695870	SO:0001819	synonymous_variant	5862	exon8				CCDS6175.1, CCDS56537.1	8q12.1	2007-01-15	2007-01-15	2007-01-15	ENSG00000104388	ENSG00000104388		"""RAB, member RAS oncogene"""	9763	protein-coding gene	gene with protein product		179509	"""RAB2, member RAS oncogene family"""	RAB2			Standard	NM_002865		Approved		uc003xud.2	P61019	OTTHUMG00000134298	ENST00000262646.7:c.627C>T	8.37:g.61533316C>T			61695870	NM_002865	B2R5W8|B4DMQ5|P08886	Silent	SNP	ENST00000262646.7	37	CCDS6175.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512746	0.27123	2.27E-4	0.0	ENSG00000104388	ENST00000529579	T	0.64618	-0.11	5.81	-11.6	0.00059	.	.	.	.	.	T	0.36358	0.0964	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.11446	-1.0587	6	0.14656	T	0.56	.	8.9928	0.36035	0.1596:0.563:0.0499:0.2274	.	.	.	.	V	172	ENSP00000431589:A172V	ENSP00000431589:A172V	A	+	2	0	RAB2A	61695870	0.561000	0.26578	0.099000	0.21106	0.970000	0.65996	-0.105000	0.10907	-3.122000	0.00238	-1.601000	0.00813	GCG		0.507	RAB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259145.2		
FAM135B	51059	hgsc.bcm.edu	37	8	139163685	139163685	+	Silent	SNP	C	C	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr8:139163685C>A	ENST00000395297.1	-	13	3203	c.3033G>T	c.(3031-3033)ggG>ggT	p.G1011G		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1011								p.G1011G(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TCAGATGGGACCCCATGATGG	0.507										HNSCC(54;0.14)																											p.G1011G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3033T	8						.						81.0	78.0	79.0					8																	139163685		2203	4300	6503	139232867	SO:0001819	synonymous_variant	51059	exon13			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3033G>T	8.37:g.139163685C>A			139232867	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	CCDS6375.2																																																																																				0.507	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
GOLPH3L	55204	hgsc.bcm.edu	37	1	150621063	150621063	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr1:150621063G>A	ENST00000271732.3	-	5	636	c.592C>T	c.(592-594)Cga>Tga	p.R198*	GOLPH3L_ENST00000540514.1_Nonsense_Mutation_p.R154*	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	198					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)	p.R198*(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTCACTAGTCGCTGTTTCTCT	0.443																																					p.R198X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C592T	1						.						92.0	87.0	89.0					1																	150621063		2203	4300	6503	148887687	SO:0001587	stop_gained	55204	exon5			AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.592C>T	1.37:g.150621063G>A	ENSP00000271732:p.Arg198*		148887687	NM_018178	B1AN09|B7Z6N3|Q9NVK0	Nonsense_Mutation	SNP	ENST00000271732.3	37	CCDS966.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563139	0.86335	.	.	ENSG00000143457	ENST00000271732;ENST00000369003;ENST00000540514;ENST00000427665	.	.	.	5.44	4.5	0.54988	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1034	13.8768	0.63657	0.0:0.0:0.8342:0.1658	.	.	.	.	X	198;220;154;220	.	ENSP00000271732:R198X	R	-	1	2	GOLPH3L	148887687	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.179000	0.71974	1.462000	0.47948	0.655000	0.94253	CGA		0.443	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178	
CAPN2	824	hgsc.bcm.edu	37	1	223936818	223936818	+	Silent	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr1:223936818C>T	ENST00000295006.5	+	6	1116	c.807C>T	c.(805-807)gcC>gcT	p.A269A	CAPN2_ENST00000433674.2_Silent_p.A191A	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	269	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)	p.A269A(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TCACCGGAGCCGAGGAGGTAA	0.662											OREG0014276	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A269A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C807T	1						.						50.0	46.0	47.0					1																	223936818		2203	4300	6503	222003441	SO:0001819	synonymous_variant	824	exon6			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.807C>T	1.37:g.223936818C>T		2293	222003441	NM_001748	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Silent	SNP	ENST00000295006.5	37	CCDS31035.1																																																																																				0.662	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
CYP2J2	1573	hgsc.bcm.edu	37	1	60381646	60381646	+	Missense_Mutation	SNP	C	C	T	rs11572242	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr1:60381646C>T	ENST00000371204.3	-	2	380	c.337G>A	c.(337-339)Gtg>Atg	p.V113M	CYP2J2_ENST00000492633.1_5'Flank	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	113			V -> M (in dbSNP:rs11572242).		arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.V113M(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	ATAGGGGTCACGGGGCGGTTC	0.428													C|||	3	0.000599042	0.0008	0.0029	5008	,	,		19082	0.0		0.0	False		,,,				2504	0.0				p.V113M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G337A	1						.						108.0	110.0	110.0					1																	60381646		2203	4300	6503	60154234	SO:0001583	missense	1573	exon2			BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.337G>A	1.37:g.60381646C>T	ENSP00000360247:p.Val113Met		60154234	NM_000775	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	3	0.0013736263736263737	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	0	0.0	C	7.417	0.635998	0.14386	.	.	ENSG00000134716	ENST00000371204	T	0.69040	-0.37	5.8	-11.6	0.00059	.	3.755470	0.00166	N	0.000010	T	0.40372	0.1114	N	0.25789	0.76	0.09310	N	1	P	0.38020	0.615	B	0.36186	0.219	T	0.56275	-0.8006	10	0.44086	T	0.13	.	10.2805	0.43537	0.0643:0.5248:0.2124:0.1986	rs11572242;rs52814181;rs11572242	113	P51589	CP2J2_HUMAN	M	113	ENSP00000360247:V113M	ENSP00000360247:V113M	V	-	1	0	CYP2J2	60154234	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.110000	0.00150	-3.492000	0.00153	-2.084000	0.00378	GTG		0.428	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
SGIP1	84251	hgsc.bcm.edu	37	1	67147809	67147809	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr1:67147809A>C	ENST00000371037.4	+	15	1149	c.1072A>C	c.(1072-1074)Aca>Cca	p.T358P	SGIP1_ENST00000371039.1_Intron|SGIP1_ENST00000237247.6_Missense_Mutation_p.T362P|SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000371036.3_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	358	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.T358P(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						CCCAGGTCCCACAGGCCCCCC	0.587																																					p.T358P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1072C	1						.						86.0	110.0	102.0					1																	67147809		2203	4300	6503	66920397	SO:0001583	missense	84251	exon15			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1072A>C	1.37:g.67147809A>C	ENSP00000360076:p.Thr358Pro		66920397	NM_032291	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.117275	0.00032	.	.	ENSG00000118473	ENST00000237247;ENST00000371038;ENST00000407289;ENST00000371037	T;T	0.15834	2.39;2.47	4.15	-1.89	0.07689	.	0.428623	0.22346	N	0.061261	T	0.01254	0.0041	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43327	-0.9398	10	0.23302	T	0.38	0.0096	0.4	0.00424	0.3383:0.2813:0.1645:0.2159	.	361;358	A6NEV3;Q9BQI5	.;SGIP1_HUMAN	P	362;361;361;358	ENSP00000237247:T362P;ENSP00000360076:T358P	ENSP00000237247:T362P	T	+	1	0	SGIP1	66920397	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.863000	0.04259	-0.133000	0.11537	-0.666000	0.03841	ACA		0.587	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291	
ZNF669	79862	hgsc.bcm.edu	37	1	247263870	247263870	+	Missense_Mutation	SNP	G	G	A	rs200207138		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr1:247263870G>A	ENST00000343381.6	-	4	1373	c.1201C>T	c.(1201-1203)Cgc>Tgc	p.R401C	ZNF669_ENST00000448299.2_Missense_Mutation_p.R315C|ZNF669_ENST00000358785.4_3'UTR	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R401C(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			GAACTGAGGCGACTGAAGGCT	0.433																																					p.R401C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1201T	1						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	151.0	151.0	151.0		943,1201	0.5	0.1	1		151	0,8600		0,0,4300	no	missense,missense	ZNF669	NM_001142572.1,NM_024804.2	180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	315/379,401/465	247263870	1,13005	2203	4300	6503	245330493	SO:0001583	missense	79862	exon4				CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.1201C>T	1.37:g.247263870G>A	ENSP00000342818:p.Arg401Cys		245330493	NM_024804	B3KP94|Q5VT39|Q9H9Q6	Missense_Mutation	SNP	ENST00000343381.6	37	CCDS31088.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	8.204	0.798715	0.16397	2.27E-4	0.0	ENSG00000188295	ENST00000535105;ENST00000448299;ENST00000343381	T;T	0.07567	3.18;3.18	0.544	0.544	0.17185	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18002	0.0432	M	0.66439	2.03	0.09310	N	1	D;D	0.89917	0.999;1.0	P;D	0.64144	0.794;0.922	T	0.12167	-1.0558	9	0.36615	T	0.2	.	4.3293	0.11055	0.0:0.4356:0.5644:1.0E-4	.	315;401	B3KP94;Q96BR6	.;ZN669_HUMAN	C	315;315;401	ENSP00000404370:R315C;ENSP00000342818:R401C	ENSP00000342818:R401C	R	-	1	0	ZNF669	245330493	0.000000	0.05858	0.133000	0.22050	0.127000	0.20565	-0.161000	0.10026	0.543000	0.28864	0.289000	0.19496	CGC		0.433	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000098394.4	NM_024804	
SAAL1	113174	hgsc.bcm.edu	37	11	18112005	18112005	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr11:18112005G>A	ENST00000524803.1	-	5	498	c.449C>T	c.(448-450)cCa>cTa	p.P150L	SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000300013.4_Missense_Mutation_p.P150L|SAAL1_ENST00000529318.1_Missense_Mutation_p.P150L			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	150								p.P150L(1)		breast(2)|large_intestine(5)|lung(8)	15						CAGAGTAGGTGGGTCTGAATC	0.323																																					p.P150L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C449T	11						.						43.0	44.0	44.0					11																	18112005		2200	4293	6493	18068581	SO:0001583	missense	113174	exon5			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.449C>T	11.37:g.18112005G>A	ENSP00000432487:p.Pro150Leu		18068581	NM_138421	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	CCDS31439.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.38|18.38	3.611923|3.611923	0.66558|0.66558	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000530180|ENST00000524803;ENST00000300013;ENST00000531751;ENST00000529318	T|T;T;T;T	0.29397|0.51574	1.57|1.29;0.7;1.29;0.7	5.62|5.62	4.7|4.7	0.59300|0.59300	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.364059	.|0.31589	.|N	.|0.007394	T|T	0.45716|0.45716	0.1356|0.1356	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999997|0.999997	.|P;P;P	.|0.42296	.|0.775;0.775;0.775	.|B;B;B	.|0.39660	.|0.306;0.306;0.306	T|T	0.50890|0.50890	-0.8774|-0.8774	7|10	0.05721|0.72032	T|D	0.95|0.01	-11.2913|-11.2913	12.5751|12.5751	0.56359|0.56359	0.0769:0.0:0.9231:0.0|0.0769:0.0:0.9231:0.0	.|.	.|150;150;150	.|E9PRZ1;G1UCX3;Q96ER3	.|.;.;SAAL1_HUMAN	Y|L	149|150;150;39;150	ENSP00000431489:H149Y|ENSP00000432487:P150L;ENSP00000300013:P150L;ENSP00000436031:P39L;ENSP00000432216:P150L	ENSP00000431489:H149Y|ENSP00000300013:P150L	H|P	-|-	1|2	0|0	SAAL1|SAAL1	18068581|18068581	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.998000|0.998000	0.95712|0.95712	8.314000|8.314000	0.89980|0.89980	1.361000|1.361000	0.45981|0.45981	0.542000|0.542000	0.68232|0.68232	CAC|CCA		0.323	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
CPSF7	79869	hgsc.bcm.edu	37	11	61178462	61178462	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr11:61178462G>A	ENST00000394888.4	-	9	1541	c.1369C>T	c.(1369-1371)Cgg>Tgg	p.R457W	CPSF7_ENST00000340437.4_Missense_Mutation_p.R500W|CPSF7_ENST00000439958.3_Missense_Mutation_p.R448W|CPSF7_ENST00000448745.1_Missense_Mutation_p.R448W	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	457	Arg-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R457W(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						TCATGCTCCCGGTTCCTTTCT	0.547																																					p.R457W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1369T	11						.						117.0	122.0	121.0					11																	61178462		2202	4299	6501	60935038	SO:0001583	missense	79869	exon9				CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.1369C>T	11.37:g.61178462G>A	ENSP00000378352:p.Arg457Trp		60935038	NM_001136040	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	G	32	5.145376	0.94603	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000544147	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.42988	0.1227	L	0.49778	1.585	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	P;D;P	0.66196	0.717;0.942;0.853	T	0.09907	-1.0653	10	0.72032	D	0.01	-3.4214	20.0036	0.97427	0.0:0.0:1.0:0.0	.	457;500;448	Q8N684;Q8N684-3;Q8N684-2	CPSF7_HUMAN;.;.	W	500;457;448;448;223	ENSP00000345412:R500W;ENSP00000378352:R457W;ENSP00000397203:R448W;ENSP00000407394:R448W	ENSP00000345412:R500W	R	-	1	2	CPSF7	60935038	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.434000	0.97515	2.824000	0.97209	0.655000	0.94253	CGG		0.547	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811	
INPPL1	3636	hgsc.bcm.edu	37	11	71944515	71944515	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr11:71944515C>T	ENST00000298229.2	+	18	2275	c.2071C>T	c.(2071-2073)Cgg>Tgg	p.R691W	INPPL1_ENST00000538751.1_Missense_Mutation_p.R449W|INPPL1_ENST00000541756.1_Missense_Mutation_p.R449W	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	691					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.R691W(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						ATGGTGTGACCGGATTCTGTG	0.567																																					p.R691W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2071T	11						.						92.0	78.0	83.0					11																	71944515		2200	4293	6493	71622163	SO:0001583	missense	3636	exon18			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2071C>T	11.37:g.71944515C>T	ENSP00000298229:p.Arg691Trp		71622163	NM_001567	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	c	22.9	4.348527	0.82132	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.82984	-1.67;-1.67;-1.67	5.66	3.7	0.42460	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.94785	0.8316	H	0.99312	4.51	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	D	0.95895	0.8910	10	0.87932	D	0	.	13.7812	0.63084	0.2799:0.7201:0.0:0.0	.	691	O15357	SHIP2_HUMAN	W	691;449;449	ENSP00000298229:R691W;ENSP00000446360:R449W;ENSP00000444619:R449W	ENSP00000298229:R691W	R	+	1	2	INPPL1	71622163	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.665000	0.37449	0.786000	0.33708	0.655000	0.94253	CGG		0.567	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
CDC40	51362	hgsc.bcm.edu	37	6	110534292	110534292	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr6:110534292G>A	ENST00000368932.1	+	9	972	c.871G>A	c.(871-873)Gtc>Atc	p.V291I	CDC40_ENST00000307731.1_Missense_Mutation_p.V291I|CDC40_ENST00000368930.1_Missense_Mutation_p.V291I			O60508	PRP17_HUMAN	cell division cycle 40	291					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.V291I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TTTATAGGGCGTCAGTGCAGT	0.378																																					p.V291I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G871A	6						.						205.0	180.0	188.0					6																	110534292		2203	4300	6503	110640985	SO:0001583	missense	51362	exon8			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.871G>A	6.37:g.110534292G>A	ENSP00000357928:p.Val291Ile		110640985	NM_015891	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663304	0.67700	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.8	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.118823	0.56097	D	0.000021	T	0.49253	0.1546	L	0.38175	1.15	0.80722	D	1	P	0.46952	0.887	P	0.44860	0.462	T	0.49854	-0.8895	10	0.31617	T	0.26	-25.9423	16.6781	0.85284	0.0:0.1298:0.8702:0.0	.	291	O60508	PRP17_HUMAN	I	291	ENSP00000357928:V291I;ENSP00000357929:V291I;ENSP00000357926:V291I;ENSP00000304370:V291I	ENSP00000304370:V291I	V	+	1	0	CDC40	110640985	1.000000	0.71417	0.864000	0.33941	0.966000	0.64601	9.042000	0.93793	1.410000	0.46936	0.563000	0.77884	GTC		0.378	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
GRM1	2911	hgsc.bcm.edu	37	6	146755257	146755257	+	Silent	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr6:146755257G>A	ENST00000282753.1	+	8	3145	c.2910G>A	c.(2908-2910)ccG>ccA	p.P970P	GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000361719.2_Silent_p.P970P			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	970					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.P970P(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCTTTAGCCCGCCTGGTAGCC	0.627																																					p.P970P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2910A	6						.						86.0	89.0	88.0					6																	146755257		2203	4300	6503	146796950	SO:0001819	synonymous_variant	2911	exon9			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2910G>A	6.37:g.146755257G>A			146796950	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																				0.627	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
POLR2A	5430	hgsc.bcm.edu	37	17	7406474	7406474	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr17:7406474C>T	ENST00000322644.6	+	17	3190	c.2791C>T	c.(2791-2793)Cgg>Tgg	p.R931W		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	931					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.R931W(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GAGGGCCCTGCGGCGCACTCT	0.587																																					p.R931W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2791T	17						.						61.0	60.0	60.0					17																	7406474		2203	4300	6503	7347198	SO:0001583	missense	5430	exon17					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2791C>T	17.37:g.7406474C>T	ENSP00000314949:p.Arg931Trp		7347198	NM_000937	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.853262	0.71719	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.69306	-0.39	5.65	4.67	0.58626	RNA polymerase Rpb1, domain 6 (1);RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.83321	0.5229	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.65443	0.935	D	0.87247	0.2270	10	0.87932	D	0	-10.0897	15.324	0.74144	0.141:0.859:0.0:0.0	.	931	P24928	RPB1_HUMAN	W	887;931	ENSP00000314949:R931W	ENSP00000314949:R931W	R	+	1	2	SLC35G6	7347198	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.856000	0.48341	1.519000	0.48950	0.563000	0.77884	CGG		0.587	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
KRTAP19-5	337972	hgsc.bcm.edu	37	21	31874364	31874364	+	Silent	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr21:31874364G>A	ENST00000334151.2	-	1	71	c.45C>T	c.(43-45)taC>taT	p.Y15Y		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	15						intermediate filament (GO:0005882)		p.Y15Y(1)		endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CGAAGCCTCCGTAGCCGTAGC	0.572																																					p.Y15Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C45T	21						.						145.0	122.0	130.0					21																	31874364		2203	4300	6503	30796235	SO:0001819	synonymous_variant	337972	exon1			AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.45C>T	21.37:g.31874364G>A			30796235	NM_181611	A4IF22	Silent	SNP	ENST00000334151.2	37	CCDS13597.1																																																																																				0.572	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2		
CMTM4	146223	hgsc.bcm.edu	37	16	66670374	66670374	+	Silent	SNP	G	G	A	rs111405424	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr16:66670374G>A	ENST00000330687.4	-	2	478	c.297C>T	c.(295-297)ggC>ggT	p.G99G	CMTM4_ENST00000563952.1_Silent_p.G70G|CMTM4_ENST00000394106.2_Silent_p.G99G	NM_178818.2|NM_181521.2	NP_848933.1|NP_852662.1	Q8IZR5	CKLF4_HUMAN	CKLF-like MARVEL transmembrane domain containing 4	99	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.G99G(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		TCAGCAAGACGCCAGTCACCA	0.498													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17990	0.0		0.0	False		,,,				2504	0.0				p.G99G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T	16						.	G	,	1,4401	2.1+/-5.4	0,1,2200	107.0	87.0	94.0		297,297	-0.7	1.0	16	dbSNP_132	94	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CMTM4	NM_178818.2,NM_181521.2	,	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	,	99/235,99/209	66670374	1,13001	2201	4300	6501	65227875	SO:0001819	synonymous_variant	146223	exon2			AF479814	CCDS10817.1, CCDS42170.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000183723	ENSG00000183723			19175	protein-coding gene	gene with protein product		607887	"""chemokine-like factor super family 4"", ""chemokine-like factor superfamily 4"""	CKLFSF4		12782130	Standard	NM_178818		Approved		uc002epz.3	Q8IZR5	OTTHUMG00000137500	ENST00000330687.4:c.297C>T	16.37:g.66670374G>A			65227875	NM_181521	Q52M40|Q8IZR4|Q8IZV1	Silent	SNP	ENST00000330687.4	37	CCDS10817.1																																																																																				0.498	CMTM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268807.1		
NECAB2	54550	hgsc.bcm.edu	37	16	84024176	84024176	+	Silent	SNP	G	G	A	rs184798656		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr16:84024176G>A	ENST00000305202.4	+	6	554	c.537G>A	c.(535-537)tcG>tcA	p.S179S	NECAB2_ENST00000565691.1_Silent_p.S96S	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	179						cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.S179S(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						AGATCCAGTCGCTGCTGAGCT	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17539	0.0		0.0	False		,,,				2504	0.0				p.S179S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G537A	16						.						92.0	85.0	88.0					16																	84024176		2200	4300	6500	82581677	SO:0001819	synonymous_variant	54550	exon6			AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.537G>A	16.37:g.84024176G>A			82581677	NM_019065	A2RRG3|O75547|Q6ZSK0	Silent	SNP	ENST00000305202.4	37	CCDS10940.1																																																																																				0.597	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269077.2	NM_019065	
IMPA2	3613	hgsc.bcm.edu	37	18	12028083	12028083	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr18:12028083C>T	ENST00000269159.3	+	6	774	c.532C>T	c.(532-534)Cgt>Tgt	p.R178C	IMPA2_ENST00000588752.1_3'UTR|IMPA2_ENST00000589238.1_5'UTR|IMPA2_ENST00000588927.1_5'UTR	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	178					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.R178C(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	TGGCCCCAAACGTGACCCTGC	0.507																																					p.R178C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C532T	18						.						126.0	114.0	118.0					18																	12028083		2203	4300	6503	12018083	SO:0001583	missense	3613	exon6			AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.532C>T	18.37:g.12028083C>T	ENSP00000269159:p.Arg178Cys		12018083	NM_014214	B0YJ29|Q9UJT3	Missense_Mutation	SNP	ENST00000269159.3	37	CCDS11855.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368592	0.61624	.	.	ENSG00000141401	ENST00000269159	T	0.47528	0.84	5.84	5.84	0.93424	.	0.115998	0.56097	D	0.000028	T	0.73768	0.3629	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.70716	0.681;0.97	T	0.76862	-0.2802	10	0.87932	D	0	-12.6218	20.1434	0.98067	0.0:1.0:0.0:0.0	.	151;178	O14732-2;O14732	.;IMPA2_HUMAN	C	178	ENSP00000269159:R178C	ENSP00000269159:R178C	R	+	1	0	IMPA2	12018083	1.000000	0.71417	0.927000	0.36925	0.317000	0.28152	1.705000	0.37867	2.769000	0.95229	0.563000	0.77884	CGT		0.507	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254601.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21494444	21494444	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr18:21494444G>A	ENST00000313654.9	+	57	7641	c.7400G>A	c.(7399-7401)cGt>cAt	p.R2467H	LAMA3_ENST00000587184.1_Missense_Mutation_p.R802H|LAMA3_ENST00000399516.3_Missense_Mutation_p.R2411H|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.R858H	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2467	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.R2467H(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTGGGGGACCGTGAGGCTGAA	0.537																																					p.R802H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2405A	18						.						93.0	85.0	88.0					18																	21494444		2203	4300	6503	19748442	SO:0001583	missense	3909	exon19			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.7400G>A	18.37:g.21494444G>A	ENSP00000324532:p.Arg2467His		19748442	NM_001127718	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935419	0.34189	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.63417	-0.04;-0.04;-0.04	5.25	-5.51	0.02568	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.61464	0.2349	L	0.47716	1.5	0.09310	N	1	D;D;D;D	0.67145	0.989;0.991;0.984;0.996	P;P;P;P	0.56042	0.636;0.709;0.714;0.79	T	0.59830	-0.7380	9	0.38643	T	0.18	.	10.4243	0.44369	0.6579:0.0:0.2441:0.098	.	802;858;2411;2467	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	H	2467;2411;858	ENSP00000324532:R2467H;ENSP00000382432:R2411H;ENSP00000269217:R858H	ENSP00000269217:R858H	R	+	2	0	LAMA3	19748442	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.027000	0.13621	-1.076000	0.03125	-0.224000	0.12420	CGT		0.537	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
RIT2	6014	hgsc.bcm.edu	37	18	40323463	40323463	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr18:40323463T>C	ENST00000326695.5	-	5	820	c.649A>G	c.(649-651)Aca>Gca	p.T217A	RIT2_ENST00000590910.1_3'UTR|RIT2_ENST00000589109.1_3'UTR	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	217					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T217A(1)		endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGATATCATGTCATATTTTCT	0.378																																					p.T217A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A649G	18						.						110.0	111.0	111.0					18																	40323463		2203	4300	6503	38577461	SO:0001583	missense	6014	exon5			BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.649A>G	18.37:g.40323463T>C	ENSP00000321805:p.Thr217Ala		38577461	NM_002930	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	ENST00000326695.5	37	CCDS11921.1	.	.	.	.	.	.	.	.	.	.	t	14.73	2.622173	0.46840	.	.	ENSG00000152214	ENST00000326695	T	0.69561	-0.41	5.55	0.138	0.14793	.	0.436794	0.19097	N	0.122820	T	0.39545	0.1082	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07481	-1.0770	10	0.72032	D	0.01	.	4.444	0.11588	0.2451:0.1384:0.0:0.6165	.	217	Q99578	RIT2_HUMAN	A	217	ENSP00000321805:T217A	ENSP00000321805:T217A	T	-	1	0	RIT2	38577461	1.000000	0.71417	0.834000	0.33040	0.963000	0.63663	0.516000	0.22817	-0.194000	0.10399	0.529000	0.55759	ACA		0.378	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930	
PTPRM	5797	hgsc.bcm.edu	37	18	8406135	8406135	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr18:8406135C>A	ENST00000332175.8	+	31	5371	c.4334C>A	c.(4333-4335)gCc>gAc	p.A1445D	PTPRM_ENST00000400060.4_Missense_Mutation_p.A1459D|RP11-789C17.5_ENST00000579805.1_RNA|PTPRM_ENST00000400053.4_Missense_Mutation_p.A1383D|PTPRM_ENST00000444013.1_Missense_Mutation_p.A1232D|PTPRM_ENST00000580170.1_Missense_Mutation_p.A1458D|RP11-789C17.1_ENST00000578897.1_RNA	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1445	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1445D(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TACGAGGTGGCCCTGGAATAC	0.443																																					p.A1445D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4334A	18						.						151.0	134.0	140.0					18																	8406135		2203	4300	6503	8396135	SO:0001583	missense	5797	exon31			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.4334C>A	18.37:g.8406135C>A	ENSP00000331418:p.Ala1445Asp		8396135	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026266	0.93518	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	6.17	6.17	0.99709	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.121597	0.53938	D	0.000045	D	0.93406	0.7897	M	0.90145	3.09	0.80722	D	1	P;D;D	0.76494	0.925;0.999;0.999	D;D;D	0.85130	0.925;0.997;0.997	D	0.93425	0.6780	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1232;1458;1445	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	D	1445;1459;1383;1232	ENSP00000331418:A1445D;ENSP00000382933:A1459D;ENSP00000382927:A1383D;ENSP00000387608:A1232D	ENSP00000331418:A1445D	A	+	2	0	PTPRM	8396135	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.345000	0.72995	2.941000	0.99782	0.655000	0.94253	GCC		0.443	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
DSEL	92126	hgsc.bcm.edu	37	18	65180217	65180217	+	Silent	SNP	G	G	T	rs73454543	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr18:65180217G>T	ENST00000310045.7	-	2	3132	c.1659C>A	c.(1657-1659)gcC>gcA	p.A553A	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	543					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.A553A(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CATGTTGAGAGGCAGTGATTA	0.478																																					p.A553A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1659A	18						.						98.0	88.0	91.0					18																	65180217		2203	4300	6503	63331197	SO:0001819	synonymous_variant	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1659C>A	18.37:g.65180217G>T			63331197	NM_032160	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																				0.478	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
DUSP7	1849	hgsc.bcm.edu	37	3	52084848	52084848	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr3:52084848T>A	ENST00000495880.1	-	3	1426	c.1243A>T	c.(1243-1245)Acg>Tcg	p.T415S	DUSP7_ENST00000296483.6_Missense_Mutation_p.T364S			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	415					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.T364S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GACTCCAGCGTATTGAGTGGG	0.657																																					p.T415S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1243T	3						.						109.0	86.0	94.0					3																	52084848		2203	4300	6503	52059888	SO:0001583	missense	1849	exon3			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.1243A>T	3.37:g.52084848T>A	ENSP00000417183:p.Thr415Ser		52059888	NM_001947	Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	ENST00000495880.1	37	CCDS33766.2	.	.	.	.	.	.	.	.	.	.	t	10.67	1.416268	0.25552	.	.	ENSG00000164086	ENST00000495880;ENST00000296483	T;T	0.02216	4.39;4.43	5.75	5.75	0.90469	.	0.052145	0.85682	D	0.000000	T	0.00815	0.0027	N	0.01219	-0.95	0.39928	D	0.974248	B	0.06786	0.001	B	0.08055	0.003	T	0.43048	-0.9415	10	0.02654	T	1	.	6.9396	0.24486	0.0:0.0757:0.1515:0.7728	.	415	Q16829	DUS7_HUMAN	S	415;364	ENSP00000417183:T415S;ENSP00000296483:T364S	ENSP00000296483:T364S	T	-	1	0	DUSP7	52059888	1.000000	0.71417	0.994000	0.49952	0.832000	0.47134	1.733000	0.38156	2.198000	0.70561	0.523000	0.50628	ACG		0.657	DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947	
CACNA1D	776	hgsc.bcm.edu	37	3	53535711	53535711	+	Silent	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr3:53535711C>T	ENST00000350061.5	+	3	958	c.447C>T	c.(445-447)ttC>ttT	p.F149F	CACNA1D_ENST00000288139.4_Silent_p.F149F|CACNA1D_ENST00000422281.2_Silent_p.F149F	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	149					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.F149F(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACATCCCATTCCCTGAAGATG	0.333																																					p.F149F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C447T	3						.						171.0	166.0	168.0					3																	53535711		2203	4300	6503	53510751	SO:0001819	synonymous_variant	776	exon3			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.447C>T	3.37:g.53535711C>T			53510751	NM_001128839	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	37	CCDS46848.1																																																																																				0.333	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CNTN3	5067	hgsc.bcm.edu	37	3	74384034	74384034	+	Missense_Mutation	SNP	G	G	T	rs200087609		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr3:74384034G>T	ENST00000263665.6	-	12	1547	c.1520C>A	c.(1519-1521)tCt>tAt	p.S507Y		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	507	Ig-like C2-type 6.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.S507Y(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ATCCATGTTAGATGGTGCCAA	0.403																																					p.S507Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1520A	3						.						113.0	106.0	109.0					3																	74384034		2203	4300	6503	74466724	SO:0001583	missense	5067	exon12			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1520C>A	3.37:g.74384034G>T	ENSP00000263665:p.Ser507Tyr		74466724	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308376	0.60305	.	.	ENSG00000113805	ENST00000263665	T	0.68765	-0.35	5.4	4.5	0.54988	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.131007	0.52532	D	0.000063	T	0.74512	0.3726	M	0.83774	2.66	0.28075	N	0.932411	P	0.44281	0.831	P	0.45753	0.492	T	0.73594	-0.3933	10	0.72032	D	0.01	.	15.8427	0.78861	0.0:0.1362:0.8638:0.0	.	507	Q9P232	CNTN3_HUMAN	Y	507	ENSP00000263665:S507Y	ENSP00000263665:S507Y	S	-	2	0	CNTN3	74466724	0.787000	0.28750	0.032000	0.17829	0.976000	0.68499	2.836000	0.48183	1.240000	0.43803	0.655000	0.94253	TCT		0.403	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
XRN1	54464	hgsc.bcm.edu	37	3	142103481	142103481	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr3:142103481C>A	ENST00000264951.4	-	21	2503	c.2386G>T	c.(2386-2388)Gtg>Ttg	p.V796L	XRN1_ENST00000392981.2_Missense_Mutation_p.V796L	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	796					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.V796L(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TGAGCATACACAACTGCAGAT	0.303																																					p.V796L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2386T	3						.						147.0	149.0	148.0					3																	142103481		2202	4297	6499	143586171	SO:0001583	missense	54464	exon21			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2386G>T	3.37:g.142103481C>A	ENSP00000264951:p.Val796Leu		143586171	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.288929	0.23478	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.34859	1.34;1.34	5.06	3.22	0.36961	.	0.155908	0.42964	D	0.000634	T	0.21801	0.0525	L	0.27053	0.805	0.80722	D	1	B;B;B	0.17038	0.0;0.02;0.012	B;B;B	0.19946	0.002;0.027;0.012	T	0.05852	-1.0860	10	0.25751	T	0.34	-2.2134	5.8032	0.18426	0.1521:0.682:0.0:0.1659	.	657;796;796	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	L	796	ENSP00000264951:V796L;ENSP00000376707:V796L	ENSP00000264951:V796L	V	-	1	0	XRN1	143586171	0.943000	0.32029	0.871000	0.34182	0.954000	0.61252	0.402000	0.20965	0.504000	0.28082	0.650000	0.86243	GTG		0.303	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
PFKM	5213	hgsc.bcm.edu	37	12	48539485	48539485	+	Silent	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr12:48539485C>T	ENST00000312352.7	+	23	2376	c.2337C>T	c.(2335-2337)gcC>gcT	p.A779A	PFKM_ENST00000340802.6_Silent_p.A850A|PFKM_ENST00000395233.2_Silent_p.A748A|PFKM_ENST00000547587.1_Silent_p.A779A|PFKM_ENST00000551804.1_Silent_p.A748A|PFKM_ENST00000359794.5_Silent_p.A779A	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	779	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.A779A(1)		NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GGGAAGCTGCCGTCTAAACCT	0.502																																					p.A850A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2550T	12						.						79.0	71.0	74.0					12																	48539485		2203	4300	6503	46825752	SO:0001819	synonymous_variant	5213	exon25			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.2337C>T	12.37:g.48539485C>T			46825752	NM_001166686	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	ENST00000312352.7	37	CCDS8760.1																																																																																				0.502	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	NM_000289	
FAT4	79633	hgsc.bcm.edu	37	4	126336726	126336726	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr4:126336726G>A	ENST00000394329.3	+	5	6621	c.6608G>A	c.(6607-6609)cGg>cAg	p.R2203Q	FAT4_ENST00000335110.5_Missense_Mutation_p.R501Q	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2203	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2203Q(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAGGAATTTCGGATAGACTCT	0.448																																					p.R2203Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6608A	4						.						152.0	139.0	144.0					4																	126336726		2203	4300	6503	126556176	SO:0001583	missense	79633	exon5			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6608G>A	4.37:g.126336726G>A	ENSP00000377862:p.Arg2203Gln		126556176	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432948	0.62844	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01725	4.67;4.67	5.48	4.63	0.57726	Cadherin (4);Cadherin-like (1);	0.000000	0.32987	U	0.005412	T	0.05410	0.0143	L	0.35854	1.095	0.41749	D	0.989656	D;D	0.89917	0.998;1.0	D;D	0.91635	0.982;0.999	T	0.59910	-0.7365	10	0.19147	T	0.46	.	13.8094	0.63253	0.0732:0.0:0.9268:0.0	.	501;2203	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	Q	2203;501	ENSP00000377862:R2203Q;ENSP00000335169:R501Q	ENSP00000335169:R501Q	R	+	2	0	FAT4	126556176	1.000000	0.71417	0.989000	0.46669	0.639000	0.38242	7.833000	0.86765	1.317000	0.45149	0.460000	0.39030	CGG		0.448	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
C4orf26	152816	hgsc.bcm.edu	37	4	76489417	76489417	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr4:76489417C>T	ENST00000311623.4	+	2	196	c.161C>T	c.(160-162)cCg>cTg	p.P54L	C4orf26_ENST00000435974.2_Nonsense_Mutation_p.R69*	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	54						extracellular region (GO:0005576)		p.P54L(1)		kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CCACCTGCCCCGAGGAGTCCG	0.522																																					p.P54L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C161T	4						.						92.0	94.0	93.0					4																	76489417		2203	4300	6503	76708441	SO:0001583	missense	152816	exon2			AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.161C>T	4.37:g.76489417C>T	ENSP00000311307:p.Pro54Leu		76708441	NM_178497	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	37	CCDS3569.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.04|14.04	2.415552|2.415552	0.42817|0.42817	.|.	.|.	ENSG00000174792|ENSG00000174792	ENST00000311623|ENST00000435974	T|.	0.34859|.	1.34|.	4.9|4.9	4.04|4.04	0.47022|0.47022	.|.	0.250148|.	0.28431|.	N|.	0.015363|.	T|.	0.39733|.	0.1089|.	N|N	0.08118|0.08118	0|0	0.53005|0.53005	D|D	0.999969|0.999969	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.47824|.	-0.9087|.	10|.	0.35671|0.87932	T|D	0.21|0	.|.	11.3437|11.3437	0.49548|0.49548	0.0:0.8166:0.1834:0.0|0.0:0.8166:0.1834:0.0	.|.	54|.	Q17RF5|.	CD026_HUMAN|.	L|X	54|69	ENSP00000311307:P54L|.	ENSP00000311307:P54L|ENSP00000406925:R69X	P|R	+|+	2|1	0|2	C4orf26|C4orf26	76708441|76708441	0.003000|0.003000	0.15002|0.15002	0.042000|0.042000	0.18584|0.18584	0.007000|0.007000	0.05969|0.05969	0.764000|0.764000	0.26532|0.26532	1.411000|1.411000	0.46957|0.46957	0.644000|0.644000	0.83932|0.83932	CCG|CGA		0.522	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
COPS4	51138	hgsc.bcm.edu	37	4	83996452	83996452	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr4:83996452C>T	ENST00000264389.2	+	10	1225	c.1090C>T	c.(1090-1092)Cga>Tga	p.R364*	COPS4_ENST00000503682.1_Nonsense_Mutation_p.R396*|COPS4_ENST00000511653.1_Missense_Mutation_p.T413M|COPS4_ENST00000509093.1_Silent_p.H335H	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	364					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)		p.R364*(2)		endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				CCCCTTAGCACGAGAAGCCCT	0.363																																					p.R364X												.	.	2	Substitution - Nonsense(2)	urinary_tract(1)|large_intestine(1)	c.C1090T	4						.						60.0	60.0	60.0					4																	83996452		2203	4300	6503	84215476	SO:0001587	stop_gained	51138	exon10			AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.1090C>T	4.37:g.83996452C>T	ENSP00000264389:p.Arg364*		84215476	NM_016129	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Nonsense_Mutation	SNP	ENST00000264389.2	37	CCDS3600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.438577|4.438577	0.83885|0.83885	.|.	.|.	ENSG00000138663|ENSG00000138663	ENST00000264389;ENST00000509317;ENST00000503682|ENST00000511653	.|T	.|0.48522	.|0.81	5.78|5.78	4.01|4.01	0.46588|0.46588	.|.	0.064020|.	0.64402|.	D|.	0.000004|.	.|T	.|0.38612	.|0.1047	.|.	.|.	.|.	0.35989|0.35989	D|D	0.836599|0.836599	.|B	.|0.20164	.|0.042	.|B	.|0.09377	.|0.004	.|T	.|0.40942	.|-0.9536	.|8	0.08837|0.54805	T|T	0.75|0.06	-5.9455|-5.9455	11.2479|11.2479	0.49008|0.49008	0.1276:0.8063:0.0:0.0661|0.1276:0.8063:0.0:0.0661	.|.	.|413	.|D6RAX7	.|.	X|M	364;252;396|413	.|ENSP00000424655:T413M	ENSP00000264389:R364X|ENSP00000424655:T413M	R|T	+|+	1|2	2|0	COPS4|COPS4	84215476|84215476	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.832000|0.832000	0.47134|0.47134	5.669000|5.669000	0.68081|0.68081	0.855000|0.855000	0.35359|0.35359	0.591000|0.591000	0.81541|0.81541	CGA|ACG		0.363	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
TLR3	7098	hgsc.bcm.edu	37	4	187003592	187003592	+	Missense_Mutation	SNP	G	G	A	rs539192081		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr4:187003592G>A	ENST00000296795.3	+	4	856	c.752G>A	c.(751-753)cGg>cAg	p.R251Q	TLR3_ENST00000504367.1_5'UTR|TLR3_ENST00000508051.1_3'UTR	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	251					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.R251Q(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		ACAAGCATTCGGAATCTGTCT	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		16634	0.0		0.0	False		,,,				2504	0.001				p.R251Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G752A	4						.						130.0	123.0	125.0					4																	187003592		2203	4300	6503	187240586	SO:0001583	missense	7098	exon4			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.752G>A	4.37:g.187003592G>A	ENSP00000296795:p.Arg251Gln		187240586	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	37	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.269209	0.00259	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.79940	-1.32;-1.32	5.33	0.418	0.16429	.	0.689756	0.16027	N	0.233035	T	0.58004	0.2092	N	0.16790	0.44	0.09310	N	0.999994	B	0.12013	0.005	B	0.08055	0.003	T	0.38628	-0.9652	10	0.08179	T	0.78	.	5.7985	0.18399	0.569:0.0:0.314:0.117	.	251	O15455	TLR3_HUMAN	Q	251	ENSP00000296795:R251Q;ENSP00000423386:R251Q	ENSP00000296795:R251Q	R	+	2	0	TLR3	187240586	0.752000	0.28338	0.048000	0.18961	0.327000	0.28475	0.901000	0.28445	-0.006000	0.14370	-0.384000	0.06662	CGG		0.448	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
FRMPD4	9758	hgsc.bcm.edu	37	X	12157129	12157129	+	Silent	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:12157129G>A	ENST00000380682.1	+	1	545	c.39G>A	c.(37-39)tcG>tcA	p.S13S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	13					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.?(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CAAAGCTTTCGAGGTAGGGGC	0.607																																					p.S13S												.	.	1	Unknown(1)	large_intestine(1)	c.G39A	X						.						54.0	44.0	47.0					X																	12157129		2195	4288	6483	12067050	SO:0001819	synonymous_variant	9758	exon1			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.39G>A	X.37:g.12157129G>A			12067050	NM_014728	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	CCDS35201.1																																																																																				0.607	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
PRPS2	5634	hgsc.bcm.edu	37	X	12838886	12838886	+	Silent	SNP	G	G	T	rs142502838		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:12838886G>T	ENST00000380668.5	+	6	956	c.828G>T	c.(826-828)ccG>ccT	p.P276P	PRPS2_ENST00000398491.2_Silent_p.P279P	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	276					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.P276P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						ACACAATTCCGCAAGAGGACA	0.443																																					p.P279P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G837T	X						.						100.0	81.0	88.0					X																	12838886		2203	4300	6503	12748807	SO:0001819	synonymous_variant	5634	exon6			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.828G>T	X.37:g.12838886G>T			12748807	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Silent	SNP	ENST00000380668.5	37	CCDS14150.1																																																																																				0.443	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
SMARCA1	6594	hgsc.bcm.edu	37	X	128630781	128630781	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:128630781C>T	ENST00000371122.4	-	12	1701	c.1572G>A	c.(1570-1572)tgG>tgA	p.W524*	SMARCA1_ENST00000371121.3_Nonsense_Mutation_p.W524*|SMARCA1_ENST00000371123.1_Nonsense_Mutation_p.W524*	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	524	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.W524*(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CATAACCACGCCACATGCAAT	0.388																																					p.W524X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1572A	X						.						151.0	139.0	143.0					X																	128630781		2203	4300	6503	128458462	SO:0001587	stop_gained	6594	exon12			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1572G>A	X.37:g.128630781C>T	ENSP00000360163:p.Trp524*		128458462	NM_003069	Q5JV41|Q5JV42	Nonsense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	C	40	8.463679	0.98822	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-4.5597	18.2071	0.89858	0.0:1.0:0.0:0.0	.	.	.	.	X	524;524;524;503	.	ENSP00000360162:W524X	W	-	3	0	SMARCA1	128458462	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.023000	0.70848	2.238000	0.73509	0.422000	0.28245	TGG		0.388	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
GPR64	10149	hgsc.bcm.edu	37	X	19031856	19031856	+	Silent	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:19031856G>A	ENST00000379869.3	-	16	1210	c.1047C>T	c.(1045-1047)acC>acT	p.T349T	GPR64_ENST00000340581.3_Silent_p.T319T|GPR64_ENST00000379878.3_Silent_p.T333T|GPR64_ENST00000379873.2_Silent_p.T349T|GPR64_ENST00000357991.3_Silent_p.T346T|GPR64_ENST00000379876.1_Silent_p.T325T|GPR64_ENST00000360279.4_Silent_p.T327T|GPR64_ENST00000357544.3_Silent_p.T319T|GPR64_ENST00000356606.4_Silent_p.T335T|GPR64_ENST00000354791.3_Silent_p.T333T	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	349					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T346T(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					GGGCAGACACGGTGGGAGAGG	0.542																																					p.T319T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C957T	X						.						140.0	116.0	124.0					X																	19031856		2203	4300	6503	18941777	SO:0001819	synonymous_variant	10149	exon14			X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1047C>T	X.37:g.19031856G>A			18941777	NM_001184837	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Silent	SNP	ENST00000379869.3	37	CCDS43923.1																																																																																				0.542	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2		
SLC9A7	84679	hgsc.bcm.edu	37	X	46502696	46502696	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:46502696G>A	ENST00000328306.4	-	12	1613	c.1588C>T	c.(1588-1590)Ccc>Tcc	p.P530S		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	530					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)	p.P530S(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GACAACATGGGTGTCGTGCCT	0.498																																					p.P530S	Pancreas(118;454 1696 1930 13865 39976)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1588T	X						.						106.0	63.0	77.0					X																	46502696		2203	4300	6503	46387640	SO:0001583	missense	84679	exon12			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1588C>T	X.37:g.46502696G>A	ENSP00000330320:p.Pro530Ser		46387640	NM_032591	O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	37	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.856044	0.51376	.	.	ENSG00000065923	ENST00000328306	T	0.20463	2.07	5.48	5.48	0.80851	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	L	0.53249	1.67	0.80722	D	1	P	0.38250	0.624	B	0.43445	0.42	T	0.01844	-1.1262	10	0.40728	T	0.16	.	18.3916	0.90485	0.0:0.0:1.0:0.0	.	530	Q96T83	SL9A7_HUMAN	S	530	ENSP00000330320:P530S	ENSP00000330320:P530S	P	-	1	0	SLC9A7	46387640	1.000000	0.71417	0.951000	0.38953	0.847000	0.48162	7.476000	0.81055	2.283000	0.76528	0.468000	0.43344	CCC		0.498	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
CLCN5	1184	hgsc.bcm.edu	37	X	49855335	49855335	+	Nonsense_Mutation	SNP	C	C	T	rs151340621		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:49855335C>T	ENST00000307367.2	+	11	2233	c.1942C>T	c.(1942-1944)Cga>Tga	p.R648*	CLCN5_ENST00000376108.3_Nonsense_Mutation_p.R648*|CLCN5_ENST00000376088.3_Nonsense_Mutation_p.R718*|CLCN5_ENST00000376091.3_Nonsense_Mutation_p.R718*			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	648	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.R648*(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					AGAAAATGCTCGAAAGAAACA	0.463																																					p.R718X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2152T	X	GRCh37	CM960313	CLCN5	M	rs151340621	.						75.0	64.0	68.0					X																	49855335		2203	4300	6503	49742075	SO:0001587	stop_gained	1184	exon14			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1942C>T	X.37:g.49855335C>T	ENSP00000304257:p.Arg648*		49742075	NM_001127899	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Nonsense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	C	40	8.393576	0.98791	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.35	12.2765	0.54739	0.1696:0.8304:0.0:0.0	.	.	.	.	X	718;550;718;648;648	.	ENSP00000304257:R648X	R	+	1	2	CLCN5	49742075	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	2.916000	0.48813	2.401000	0.81631	0.600000	0.82982	CGA		0.463	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
CD40LG	959	hgsc.bcm.edu	37	X	135730558	135730558	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chrX:135730558G>C	ENST00000370629.2	+	1	207	c.151G>C	c.(151-153)Gac>Cac	p.D51H	CD40LG_ENST00000370628.2_Missense_Mutation_p.D51H	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	51					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)	p.D51H(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					TAGAAGGTTGGACAAGGTAAG	0.368									Immune Deficiency with Hyper-IgM																												p.D51H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151C	X						.						134.0	126.0	129.0					X																	135730558		2203	4300	6503	135558224	SO:0001583	missense	959	exon1	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.151G>C	X.37:g.135730558G>C	ENSP00000359663:p.Asp51His		135558224	NM_000074		Missense_Mutation	SNP	ENST00000370629.2	37	CCDS14659.1	.	.	.	.	.	.	.	.	.	.	g	17.16	3.318811	0.60524	.	.	ENSG00000102245	ENST00000370629;ENST00000370628	T;T	0.75589	-0.95;-0.95	5.32	5.32	0.75619	.	0.212353	0.41823	D	0.000809	T	0.78654	0.4317	L	0.29908	0.895	0.34299	D	0.684091	P;D	0.89917	0.89;1.0	P;D	0.83275	0.503;0.996	D	0.84288	0.0498	10	0.52906	T	0.07	-0.355	13.3495	0.60593	0.0:0.0:1.0:0.0	.	51;51	Q3L8U2;P29965	.;CD40L_HUMAN	H	51	ENSP00000359663:D51H;ENSP00000359662:D51H	ENSP00000359662:D51H	D	+	1	0	CD40LG	135558224	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.704000	0.68347	2.213000	0.71641	0.597000	0.82753	GAC		0.368	CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1	NM_000074	
POLR1B	84172	hgsc.bcm.edu	37	2	113321945	113321945	+	Missense_Mutation	SNP	G	G	A	rs147512217		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr2:113321945G>A	ENST00000263331.5	+	10	2195	c.1615G>A	c.(1615-1617)Gtc>Atc	p.V539I	POLR1B_ENST00000409894.3_Silent_p.G387G|POLR1B_ENST00000537335.1_Missense_Mutation_p.V328I|POLR1B_ENST00000417433.2_Missense_Mutation_p.V483I|POLR1B_ENST00000541869.1_Missense_Mutation_p.V577I	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	539					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.V539I(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTTACCAGGGGTCACTCCCAT	0.512																																					p.V483I	Ovarian(16;256 576 9537 23969 41147)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1447A	2						.						182.0	153.0	163.0					2																	113321945		2203	4300	6503	113038416	SO:0001583	missense	84172	exon9			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1615G>A	2.37:g.113321945G>A	ENSP00000263331:p.Val539Ile		113038416	NM_001137604	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	37	CCDS2097.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860014	0.51482	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000537335;ENST00000417433;ENST00000458012	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.62	3.82	0.43975	.	0.177686	0.50627	D	0.000115	T	0.70544	0.3236	L	0.54323	1.7	0.51012	D	0.999908	B;B;B	0.13594	0.008;0.005;0.003	B;B;B	0.17979	0.019;0.02;0.006	T	0.68247	-0.5459	10	0.52906	T	0.07	-20.0178	8.0446	0.30542	0.2444:0.0:0.7556:0.0	.	577;483;539	F5GZX4;Q9H9Y6-2;Q9H9Y6	.;.;RPA2_HUMAN	I	539;577;328;483;3	ENSP00000263331:V539I;ENSP00000444136:V577I;ENSP00000437914:V328I;ENSP00000405358:V483I;ENSP00000394408:V3I	ENSP00000263331:V539I	V	+	1	0	POLR1B	113038416	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.445000	0.60007	1.378000	0.46305	0.650000	0.86243	GTC		0.512	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
IL1RN	3557	hgsc.bcm.edu	37	2	113885269	113885269	+	Missense_Mutation	SNP	C	C	T	rs55860727	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr2:113885269C>T	ENST00000409930.3	+	1	132	c.68C>T	c.(67-69)aCg>aTg	p.T23M	IL1RN_ENST00000361779.3_5'UTR|IL1RN_ENST00000409052.1_5'UTR|IL1RN_ENST00000354115.2_Missense_Mutation_p.T5M|IL1RN_ENST00000259206.5_Missense_Mutation_p.T26M	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	23					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)	p.T26M(1)		breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	CATTCAGAGACGATCTGCCGA	0.542									Lichen Sclerosis et Atrophicus, Familial Clustering of				C|||	2	0.000399361	0.0008	0.0	5008	,	,		15545	0.0		0.0	False		,,,				2504	0.001				p.T5M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14T	2						.						81.0	78.0	79.0					2																	113885269		2203	4300	6503	113601740	SO:0001583	missense	3557	exon2	Familial Cancer Database	Lichen Sclerosis, Familial	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.68C>T	2.37:g.113885269C>T	ENSP00000387173:p.Thr23Met		113601740	NM_000577	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	37	CCDS46396.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640588	0.47153	.	.	ENSG00000136689	ENST00000259206;ENST00000354115;ENST00000409930	T;T;T	0.53423	0.62;0.93;0.94	5.24	5.24	0.73138	.	0.683729	0.15937	N	0.237395	T	0.64114	0.2569	M	0.69823	2.125	0.09310	N	0.999997	D;D;D	0.76494	0.999;0.999;0.997	P;P;P	0.59288	0.719;0.855;0.719	T	0.58618	-0.7605	10	0.59425	D	0.04	-0.6976	14.6809	0.69017	0.0:1.0:0.0:0.0	rs55860727	23;5;26	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	M	26;5;23	ENSP00000259206:T26M;ENSP00000329072:T5M;ENSP00000387173:T23M	ENSP00000259206:T26M	T	+	2	0	IL1RN	113601740	0.186000	0.23225	0.148000	0.22405	0.240000	0.25518	1.344000	0.33941	2.604000	0.88044	0.655000	0.94253	ACG		0.542	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841	
APOB	338	hgsc.bcm.edu	37	2	21232387	21232387	+	Silent	SNP	A	A	G			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr2:21232387A>G	ENST00000233242.1	-	26	7480	c.7353T>C	c.(7351-7353)aaT>aaC	p.N2451N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2451					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.N2451N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAATTTCACCATTGAGTCTCT	0.388																																					p.N2451N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7353C	2						.						144.0	142.0	143.0					2																	21232387		2203	4300	6503	21085892	SO:0001819	synonymous_variant	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7353T>C	2.37:g.21232387A>G			21085892	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.388	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
SESTD1	91404	hgsc.bcm.edu	37	2	179982318	179982318	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr2:179982318G>A	ENST00000428443.3	-	14	1781	c.1465C>T	c.(1465-1467)Cga>Tga	p.R489*		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	489							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.R489*(2)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTTAACCTTCGCACATCTACC	0.348																																					p.R489X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|breast(1)	c.C1465T	2						.						188.0	164.0	172.0					2																	179982318		2203	4300	6503	179690563	SO:0001587	stop_gained	91404	exon14			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1465C>T	2.37:g.179982318G>A	ENSP00000415332:p.Arg489*		179690563	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Nonsense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599489	0.87055	.	.	ENSG00000187231	ENST00000428443	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.5653	14.6811	0.69017	0.0:0.0:0.8541:0.1458	.	.	.	.	X	489	.	.	R	-	1	2	SESTD1	179690563	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.641000	0.61375	2.572000	0.86782	0.585000	0.79938	CGA		0.348	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
PASK	23178	hgsc.bcm.edu	37	2	242047665	242047665	+	Missense_Mutation	SNP	G	G	A	rs41266953	byFrequency	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr2:242047665G>A	ENST00000405260.1	-	16	4282	c.3584C>T	c.(3583-3585)aCg>aTg	p.T1195M	PASK_ENST00000475666.1_5'UTR|PASK_ENST00000234040.4_Missense_Mutation_p.T1195M|PASK_ENST00000539818.1_Missense_Mutation_p.T979M|PASK_ENST00000358649.4_Missense_Mutation_p.T1202M|PASK_ENST00000544142.1_Missense_Mutation_p.T1009M	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.T1195M(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AAAGACCAGCGTGTACAGAGT	0.607																																					p.T1195M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3584T	2						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	130.0	110.0	117.0		3584	5.4	1.0	2	dbSNP_127	117	15,8585	11.2+/-40.8	0,15,4285	yes	missense	PASK	NM_015148.2	81	0,16,6487	AA,AG,GG		0.1744,0.0227,0.123	probably-damaging	1195/1324	242047665	16,12990	2203	4300	6503	241696338	SO:0001583	missense	23178	exon16			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3584C>T	2.37:g.242047665G>A	ENSP00000384016:p.Thr1195Met		241696338	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	27.7	4.852288	0.91355	2.27E-4	0.001744	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818	T;T;T;T;T	0.39787	1.83;1.83;1.83;1.06;1.83	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000022	T	0.51991	0.1707	N	0.17278	0.47	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	T	0.58645	-0.7600	10	0.87932	D	0	.	19.6451	0.95773	0.0:0.0:1.0:0.0	rs41266953	1160;1009;1202;1195	B7Z7R6;F5GYW7;Q96RG2-2;Q96RG2	.;.;.;PASK_HUMAN	M	1195;1009;1195;1202;979	ENSP00000234040:T1195M;ENSP00000441374:T1009M;ENSP00000384016:T1195M;ENSP00000351475:T1202M;ENSP00000443083:T979M	ENSP00000234040:T1195M	T	-	2	0	PASK	241696338	1.000000	0.71417	0.984000	0.44739	0.884000	0.51177	9.229000	0.95273	2.720000	0.93068	0.655000	0.94253	ACG		0.607	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
COL15A1	1306	hgsc.bcm.edu	37	9	101829176	101829176	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr9:101829176G>T	ENST00000375001.3	+	40	4087	c.3664G>T	c.(3664-3666)Gct>Tct	p.A1222S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1222	Nonhelical region 10 (NC10).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.A1222S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GCATTTGGCTGCTCTGAACAT	0.483																																					p.A1222S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3664T	9						.						115.0	107.0	110.0					9																	101829176		2203	4300	6503	100868997	SO:0001583	missense	1306	exon40			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3664G>T	9.37:g.101829176G>T	ENSP00000364140:p.Ala1222Ser		100868997	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187708	0.78789	.	.	ENSG00000204291	ENST00000375001	T	0.61742	0.08	5.85	5.85	0.93711	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.83068	-0.0144	10	0.87932	D	0	-18.3777	18.9423	0.92608	0.0:0.0:1.0:0.0	.	1222	P39059	COFA1_HUMAN	S	1222	ENSP00000364140:A1222S	ENSP00000364140:A1222S	A	+	1	0	COL15A1	100868997	1.000000	0.71417	0.978000	0.43139	0.942000	0.58702	9.864000	0.99589	2.761000	0.94854	0.655000	0.94253	GCT		0.483	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
RFXAP	5994	hgsc.bcm.edu	37	13	37394020	37394022	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	AAG	AAG	AAG	-	AAG	AAG	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr13:37394020_37394022delAAG	ENST00000255476.2	+	1	660_662	c.526_528delAAG	c.(526-528)aagdel	p.K178del		NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	178	Poly-Lys.				positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K176delK(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		CAAGTATAAAAAGAAGAAGAGCG	0.562																																					p.176_176del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.526_528del	13						.																																			36292022	SO:0001651	inframe_deletion	5994	exon1			Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.526_528delAAG	13.37:g.37394026_37394028delAAG	ENSP00000255476:p.Lys178del		36292020	NM_000538	B2R9T8|Q5VZM6|Q8TC40	In_Frame_Del	DEL	ENST00000255476.2	37	CCDS9359.1																																																																																				0.562	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044521.1	NM_000538	
SUPV3L1	6832	hgsc.bcm.edu	37	10	70968676	70968676	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr10:70968676A>G	ENST00000359655.4	+	15	2306	c.2246A>G	c.(2245-2247)aAa>aGa	p.K749R		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	749	Interaction with LAMTOR5, important for protein stability.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.K749R(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GACATGCTGAAACAGCTAGAA	0.483																																					p.K749R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2246G	10						.						69.0	63.0	65.0					10																	70968676		2203	4300	6503	70638682	SO:0001583	missense	6832	exon15			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.2246A>G	10.37:g.70968676A>G	ENSP00000352678:p.Lys749Arg		70638682	NM_003171	A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	37	CCDS7287.1	.	.	.	.	.	.	.	.	.	.	A	9.190	1.025774	0.19512	.	.	ENSG00000156502	ENST00000359655	T	0.30714	1.52	6.01	-1.99	0.07457	.	0.419371	0.30210	N	0.010153	T	0.18676	0.0448	L	0.40543	1.245	0.22666	N	0.998873	B	0.02656	0.0	B	0.01281	0.0	T	0.34030	-0.9845	10	0.12430	T	0.62	-20.5932	9.8128	0.40833	0.275:0.2153:0.5097:0.0	.	749	Q8IYB8	SUV3_HUMAN	R	749	ENSP00000352678:K749R	ENSP00000352678:K749R	K	+	2	0	SUPV3L1	70638682	0.992000	0.36948	0.962000	0.40283	0.934000	0.57294	0.489000	0.22387	-0.605000	0.05753	-0.256000	0.11100	AAA		0.483	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171	
MYO3A	53904	hgsc.bcm.edu	37	10	26385320	26385320	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr10:26385320A>C	ENST00000265944.5	+	16	1739	c.1573A>C	c.(1573-1575)Aat>Cat	p.N525H	MYO3A_ENST00000543632.1_Missense_Mutation_p.N525H	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	525	Myosin motor.		N -> K (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N525H(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TGGAGAAAAAAATTTTCATAT	0.318																																					p.N525H												MYO3A,ovary,NS,Substitution - Missense,-2	.	1	Substitution - Missense(1)	ovary(1)	c.A1573C	10						.						30.0	33.0	32.0					10																	26385320		2194	4285	6479	26425326	SO:0001583	missense	53904	exon16			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1573A>C	10.37:g.26385320A>C	ENSP00000265944:p.Asn525His		26425326	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228298	0.79576	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;D	0.89746	-1.09;-2.56	5.48	5.48	0.80851	Myosin head, motor domain (2);	0.042713	0.85682	D	0.000000	D	0.96605	0.8892	H	0.97659	4.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.98093	1.0410	10	0.87932	D	0	.	15.8746	0.79151	1.0:0.0:0.0:0.0	.	525;525;525	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	H	525	ENSP00000265944:N525H;ENSP00000445909:N525H	ENSP00000265944:N525H	N	+	1	0	MYO3A	26425326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.205000	0.71048	0.533000	0.62120	AAT		0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
GRID1	2894	hgsc.bcm.edu	37	10	87482799	87482799	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr10:87482799G>T	ENST00000327946.7	-	12	2043	c.1958C>A	c.(1957-1959)gCt>gAt	p.A653D	GRID1_ENST00000536331.1_Missense_Mutation_p.A224D	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	653					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A653D(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GAGGAAGGCAGCAAGGTTGGC	0.542										Multiple Myeloma(13;0.14)																											p.A653D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1958A	10						.						112.0	83.0	93.0					10																	87482799		2203	4300	6503	87472779	SO:0001583	missense	2894	exon12			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1958C>A	10.37:g.87482799G>T	ENSP00000330148:p.Ala653Asp		87472779	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701868	0.88924	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.64618	-0.11;-0.11	5.95	5.04	0.67666	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.090966	0.85682	D	0.000000	T	0.80308	0.4599	H	0.95950	3.745	0.80722	D	1	P	0.43578	0.811	P	0.48270	0.572	D	0.86468	0.1783	10	0.87932	D	0	.	15.6699	0.77264	0.0:0.0:0.862:0.138	.	653	Q9ULK0	GRID1_HUMAN	D	653;224	ENSP00000330148:A653D;ENSP00000444455:A224D	ENSP00000330148:A653D	A	-	2	0	GRID1	87472779	1.000000	0.71417	0.940000	0.37924	0.956000	0.61745	9.771000	0.98977	1.506000	0.48736	0.561000	0.74099	GCT		0.542	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
NDUFS6	4726	hgsc.bcm.edu	37	5	1814513	1814513	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr5:1814513C>T	ENST00000274137.5	+	3	265	c.247C>T	c.(247-249)Cgg>Tgg	p.R83W	NDUFS6_ENST00000469176.1_Missense_Mutation_p.R83W	NM_004553.4	NP_004544.1	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)	83					cardiovascular system development (GO:0072358)|cellular metabolic process (GO:0044237)|fatty acid metabolic process (GO:0006631)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrion morphogenesis (GO:0070584)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|muscle contraction (GO:0006936)|reproductive system development (GO:0061458)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.R83W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	7						GGTGGAGACTCGGGTGATAGC	0.507																																					p.R83W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C247T	5						.						127.0	119.0	122.0					5																	1814513		2203	4300	6503	1867513	SO:0001583	missense	4726	exon3			BC038664	CCDS3866.1	5p15.33	2011-07-04	2002-08-29		ENSG00000145494	ENSG00000145494	1.6.99.3, 1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7713	protein-coding gene	gene with protein product	"""complex I 13kDa subunit A"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial"""	603848	"""NADH dehydrogenase (ubiquinone) Fe-S protein 6 (13kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004553		Approved	CI-13kA	uc003jcy.3	O75380	OTTHUMG00000090372	ENST00000274137.5:c.247C>T	5.37:g.1814513C>T	ENSP00000274137:p.Arg83Trp		1867513	NM_004553		Missense_Mutation	SNP	ENST00000274137.5	37	CCDS3866.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980229	0.34942	.	.	ENSG00000145494	ENST00000274137;ENST00000469176	T;T	0.79033	-1.23;-1.23	4.85	3.96	0.45880	Zinc finger, CHCC-type (2);	0.000000	0.85682	D	0.000000	D	0.88074	0.6339	M	0.87180	2.865	0.42150	D	0.991553	D	0.89917	1.0	D	0.80764	0.994	D	0.89058	0.3460	10	0.87932	D	0	-26.3446	10.9699	0.47434	0.4662:0.5338:0.0:0.0	.	83	O75380	NDUS6_HUMAN	W	83	ENSP00000274137:R83W;ENSP00000422557:R83W	ENSP00000274137:R83W	R	+	1	2	NDUFS6	1867513	0.997000	0.39634	0.004000	0.12327	0.008000	0.06430	3.833000	0.55790	1.001000	0.39076	0.585000	0.79938	CGG		0.507	NDUFS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206744.2	NM_004553	
SLC25A2	83884	hgsc.bcm.edu	37	5	140682572	140682572	+	Silent	SNP	G	G	A	rs544728314		TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3529-01A-02W-0831-10	TCGA-AA-3529-10A-01W-0831-10	g.chr5:140682572G>A	ENST00000239451.4	-	1	1040	c.861C>T	c.(859-861)taC>taT	p.Y287Y		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	287					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.Y287Y(1)		breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	TGCTGTATTCGTAGGCCACAA	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		22113	0.0		0.0	False		,,,				2504	0.001				p.Y287Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C861T	5						.						115.0	100.0	105.0					5																	140682572		2203	4300	6503	140662756	SO:0001819	synonymous_variant	83884	exon1			AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.861C>T	5.37:g.140682572G>A			140662756	NM_031947	Q496C1|Q6XUI0|Q8NFZ2	Silent	SNP	ENST00000239451.4	37	CCDS4258.1																																																																																				0.438	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947	
