#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BCLAF1	9774	hgsc.bcm.edu	37	6	136599909	136599910	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:136599909_136599910insTG	ENST00000531224.1	-	4	361_362	c.109_110insCA	c.(109-111)aggfs	p.R37fs	BCLAF1_ENST00000392348.2_Splice_Site|BCLAF1_ENST00000353331.4_Splice_Site|BCLAF1_ENST00000527536.1_Frame_Shift_Ins_p.R37fs|BCLAF1_ENST00000527759.1_Splice_Site|BCLAF1_ENST00000530767.1_Frame_Shift_Ins_p.R37fs	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	37					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R37fs*32(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GGAACGAGACCTAGAACTAAAA	0.322																																					p.R37fs	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.110_111insCA	6						.																																			136641603	SO:0001589	frameshift_variant	9774	exon4			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.109_110insCA	6.37:g.136599909_136599910insTG	ENSP00000435210:p.Arg37fs		136641602	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Frame_Shift_Ins	INS	ENST00000531224.1	37	CCDS5177.1																																																																																				0.322	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
PSMA2	5683	hgsc.bcm.edu	37	7	42961510	42961510	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr7:42961510T>C	ENST00000223321.4	-	6	541	c.477A>G	c.(475-477)aaA>aaG	p.K159K	PSMA2_ENST00000445517.1_Silent_p.K89K|PSMA2_ENST00000538645.1_Silent_p.K81K|PSMA2_ENST00000442788.1_Silent_p.K159K	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	159					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)	p.K159K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						TTGCTGTAGCTTTCCAGGCAA	0.353																																					p.K159K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A477G	7						.						121.0	99.0	106.0					7																	42961510		2203	4300	6503	42928035	SO:0001819	synonymous_variant	5683	exon6			D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.477A>G	7.37:g.42961510T>C			42928035	NM_002787	Q6ICS6|Q9BU45	Silent	SNP	ENST00000223321.4	37	CCDS5467.1																																																																																				0.353	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250816.1	NM_002787	
CHD6	84181	hgsc.bcm.edu	37	20	40084602	40084602	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr20:40084602T>C	ENST00000373233.3	-	19	3024	c.2847A>G	c.(2845-2847)aaA>aaG	p.K949K	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	949	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.K949K(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCACCTCCATTTTTGAGAGCT	0.443																																					p.K949K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2847G	20						.						163.0	155.0	158.0					20																	40084602		2203	4300	6503	39518016	SO:0001819	synonymous_variant	84181	exon19			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.2847A>G	20.37:g.40084602T>C			39518016	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	CCDS13317.1																																																																																				0.443	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
HAO1	54363	hgsc.bcm.edu	37	20	7921007	7921007	+	Silent	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr20:7921007C>T	ENST00000378789.3	-	1	114	c.63G>A	c.(61-63)aaG>aaA	p.K21K		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	21	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.K21K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CATATATAGACTTTGGAAGTA	0.348																																					p.K21K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63A	20						.						74.0	76.0	75.0					20																	7921007		2203	4300	6503	7869007	SO:0001819	synonymous_variant	54363	exon1			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.63G>A	20.37:g.7921007C>T			7869007	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	37	CCDS13100.1																																																																																				0.348	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
STMN3	50861	hgsc.bcm.edu	37	20	62275630	62275630	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr20:62275630G>A	ENST00000370053.1	-	2	133	c.52C>T	c.(52-54)Ctg>Ttg	p.L18L	STMN3_ENST00000540534.1_Silent_p.L7L	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	18					cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)	p.L18L(1)		kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			ATGAGCGACAGCACCGACAGC	0.642																																					p.L18L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C52T	20						.						184.0	141.0	156.0					20																	62275630		2203	4300	6503	61746074	SO:0001819	synonymous_variant	50861	exon2			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.52C>T	20.37:g.62275630G>A			61746074	NM_015894	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Silent	SNP	ENST00000370053.1	37	CCDS13529.1																																																																																				0.642	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080163.1	NM_015894	
EIF3D	8664	hgsc.bcm.edu	37	22	36907710	36907710	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr22:36907710T>C	ENST00000216190.8	-	14	1843	c.1473A>G	c.(1471-1473)ttA>ttG	p.L491L	EIF3D_ENST00000478547.1_5'Flank|EIF3D_ENST00000405442.1_Silent_p.L491L|EIF3D_ENST00000541106.1_Silent_p.L442L	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D									p.L491L(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						TGACGCAGCGTAAAATGCCCC	0.542											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L491L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1473G	22						.						150.0	115.0	127.0					22																	36907710		2203	4300	6503	35237656	SO:0001819	synonymous_variant	8664	exon14			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1473A>G	22.37:g.36907710T>C		866	35237656	NM_003753		Silent	SNP	ENST00000216190.8	37	CCDS13930.1																																																																																				0.542	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1		
PVALB	5816	hgsc.bcm.edu	37	22	37209709	37209709	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr22:37209709G>A	ENST00000216200.5	-	4	340	c.285C>T	c.(283-285)gaC>gaT	p.D95D	CITF22-24E5.1_ENST00000417792.1_RNA|PVALB_ENST00000404171.1_Silent_p.D63D|PVALB_ENST00000417718.2_Silent_p.D95D	NM_002854.2	NP_002845.1	P20472	PRVA_HUMAN	parvalbumin	95	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytosolic calcium ion homeostasis (GO:0051480)	axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)	p.D95D(1)		large_intestine(1)|lung(1)|skin(1)	3						CAATTTTGCCGTCCCCATCTT	0.512																																					p.D95D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C285T	22						.						167.0	146.0	153.0					22																	37209709		2203	4300	6503	35539655	SO:0001819	synonymous_variant	5816	exon4				CCDS13933.1	22q13.1	2013-01-10			ENSG00000100362	ENSG00000100362		"""EF-hand domain containing"""	9704	protein-coding gene	gene with protein product		168890				1559707, 10591208	Standard	NM_002854		Approved	D22S749	uc003apx.3	P20472	OTTHUMG00000150547	ENST00000216200.5:c.285C>T	22.37:g.37209709G>A			35539655	NM_002854	B2R4H7|P78378|Q4VB78|Q5R3Q9	Silent	SNP	ENST00000216200.5	37	CCDS13933.1	.	.	.	.	.	.	.	.	.	.	g	3.525	-0.097017	0.07010	.	.	ENSG00000100362	ENST00000406910	.	.	.	5.41	-1.1	0.09872	.	.	.	.	.	T	0.55242	0.1908	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51116	-0.8746	4	.	.	.	-12.7014	9.7115	0.40247	0.6105:0.0:0.3895:0.0	.	.	.	.	M	94	.	.	T	-	2	0	PVALB	35539655	0.965000	0.33210	0.998000	0.56505	0.477000	0.33069	0.151000	0.16283	-0.002000	0.14469	-0.148000	0.13756	ACG		0.512	PVALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318857.1	NM_002854	
PHF5A	84844	hgsc.bcm.edu	37	22	41864132	41864132	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr22:41864132T>G	ENST00000216252.3	-	2	143	c.72A>C	c.(70-72)gaA>gaC	p.E24D	PHF5A_ENST00000491254.1_5'UTR|ACO2_ENST00000216254.4_5'Flank|ACO2_ENST00000396512.3_5'Flank	NM_032758.3	NP_116147.1	Q7RTV0	PHF5A_HUMAN	PHD finger protein 5A	24					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|U12-type spliceosomal complex (GO:0005689)|U2 snRNP (GO:0005686)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E24D(1)		central_nervous_system(1)|large_intestine(2)|lung(1)	4						ACTCACATTTTTCACACAGTC	0.458																																					p.E24D	Ovarian(15;130 571 1826 2981 46141)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A72C	22						.						122.0	105.0	111.0					22																	41864132		2203	4300	6503	40194078	SO:0001583	missense	84844	exon2			BC007321	CCDS14016.1	22q13.2	2014-02-14			ENSG00000100410	ENSG00000100410		"""Zinc fingers, PHD-type"""	18000	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 7"""					12054543, 12234937, 18076038	Standard	NM_032758		Approved	MGC1346, SF3b14b, INI, bK223H9.2, Rds3, SAP14b, SF3B7	uc003bab.3	Q7RTV0	OTTHUMG00000150966	ENST00000216252.3:c.72A>C	22.37:g.41864132T>G	ENSP00000216252:p.Glu24Asp		40194078	NM_032758	Q9UH06	Missense_Mutation	SNP	ENST00000216252.3	37	CCDS14016.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165715	0.38217	.	.	ENSG00000100410	ENST00000216252	.	.	.	5.29	1.42	0.22433	.	0.000000	0.85682	D	0.000000	T	0.40886	0.1135	L	0.35542	1.07	0.58432	D	0.999998	B	0.02656	0.0	B	0.09377	0.004	T	0.14062	-1.0486	9	0.25751	T	0.34	-23.1136	9.0901	0.36605	0.0:0.2967:0.0:0.7033	.	24	Q7RTV0	PHF5A_HUMAN	D	24	.	ENSP00000216252:E24D	E	-	3	2	PHF5A	40194078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.289000	0.33307	0.400000	0.25396	0.459000	0.35465	GAA		0.458	PHF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320686.1	NM_032758	
ARID4A	5926	hgsc.bcm.edu	37	14	58832238	58832238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr14:58832238C>T	ENST00000355431.3	+	21	3587	c.3214C>T	c.(3214-3216)Cag>Tag	p.Q1072*	ARID4A_ENST00000395168.3_Nonsense_Mutation_p.Q1072*|ARID4A_ENST00000431317.2_Nonsense_Mutation_p.Q1072*|ARID4A_ENST00000348476.3_Nonsense_Mutation_p.Q1072*	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1072					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q1072*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TATTTCAGGTCAGAAGAGGCC	0.343																																					p.Q1072X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3214T	14						.						72.0	69.0	70.0					14																	58832238		2203	4300	6503	57901991	SO:0001587	stop_gained	5926	exon21			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3214C>T	14.37:g.58832238C>T	ENSP00000347602:p.Gln1072*		57901991	NM_023001	Q15991|Q15992|Q15993	Nonsense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	C	43	9.909163	0.99293	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317	.	.	.	5.4	4.51	0.55191	.	0.369919	0.31542	N	0.007476	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-13.4399	16.0812	0.81005	0.0:0.8656:0.1344:0.0	.	.	.	.	X	1072	.	ENSP00000344556:Q1072X	Q	+	1	0	ARID4A	57901991	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	6.890000	0.75633	1.252000	0.44001	0.460000	0.39030	CAG		0.343	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
ACYP1	97	hgsc.bcm.edu	37	14	75530247	75530247	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr14:75530247C>A	ENST00000238618.3	-	2	113	c.10G>T	c.(10-12)Gga>Tga	p.G4*	ACYP1_ENST00000555463.1_Nonsense_Mutation_p.G34*|ACYP1_ENST00000555135.1_Nonsense_Mutation_p.G4*|ACYP1_ENST00000553302.1_Nonsense_Mutation_p.G4*|ACYP1_ENST00000357971.3_Nonsense_Mutation_p.G4*|ACYP1_ENST00000555694.1_Nonsense_Mutation_p.G4*	NM_001107.3	NP_001098.1	P07311	ACYP1_HUMAN	acylphosphatase 1, erythrocyte (common) type	4					phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)	acylphosphatase activity (GO:0003998)	p.G4*(1)		large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.00646)		AGGGTGTTTCCTTCTGCCATG	0.502																																					p.G4X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G10T	14						.						113.0	102.0	106.0					14																	75530247		2203	4300	6503	74600000	SO:0001587	stop_gained	97	exon2			X84194	CCDS9838.1, CCDS45137.1	14q24.3	2014-08-08			ENSG00000119640	ENSG00000119640	3.6.1.7		179	protein-coding gene	gene with protein product		600875				7796909, 9730610	Standard	NM_001107		Approved		uc001xrg.3	P07311	OTTHUMG00000171767	ENST00000238618.3:c.10G>T	14.37:g.75530247C>A	ENSP00000238618:p.Gly4*		74600000	NM_203488	A6NDV8|B2R590	Nonsense_Mutation	SNP	ENST00000238618.3	37	CCDS9838.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659741	0.88154	.	.	ENSG00000119640	ENST00000238618;ENST00000555463;ENST00000357971;ENST00000555694;ENST00000555135;ENST00000553302	.	.	.	5.64	4.75	0.60458	.	0.315893	0.29956	N	0.010773	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-2.5261	12.6629	0.56824	0.0:0.8638:0.0:0.1362	.	.	.	.	X	4;34;4;4;4;4	.	ENSP00000238618:G4X	G	-	1	0	ACYP1	74600000	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	3.655000	0.54460	1.628000	0.50416	0.650000	0.86243	GGA		0.502	ACYP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415013.1		
SETD3	84193	hgsc.bcm.edu	37	14	99871679	99871679	+	Silent	SNP	G	G	A	rs148994126		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr14:99871679G>A	ENST00000331768.5	-	10	1113	c.954C>T	c.(952-954)aaC>aaT	p.N318N		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	318					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.N318N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CAAACTCTGCGTTGGATCGAG	0.398													A|||	1	0.000199681	0.0	0.0	5008	,	,		20317	0.001		0.0	False		,,,				2504	0.0				p.N318N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C954T	14						.	A		1,4405	826.1+/-416.6	0,1,2202	99.0	94.0	96.0		954	3.1	1.0	14	dbSNP_134	96	0,8600		0,0,4300	no	coding-synonymous	SETD3	NM_032233.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		318/595	99871679	1,13005	2203	4300	6503	98941432	SO:0001819	synonymous_variant	84193	exon10			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.954C>T	14.37:g.99871679G>A			98941432	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	ENST00000331768.5	37	CCDS9951.1																																																																																				0.398	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
USP9Y	8287	hgsc.bcm.edu	37	Y	14847976	14847976	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrY:14847976A>C	ENST00000338981.3	+	9	1763	c.818A>C	c.(817-819)aAa>aCa	p.K273T	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	273					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.K273T(1)		kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CATACACTGAAAAAGTACTTC	0.323																																					p.K273T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A818C	Y						.						33.0	29.0	30.0					Y																	14847976		591	1925	2516	13357370	SO:0001583	missense	8287	exon9			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.818A>C	Y.37:g.14847976A>C	ENSP00000342812:p.Lys273Thr		13357370	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																				0.323	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
SGCZ	137868	hgsc.bcm.edu	37	8	13948034	13948034	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr8:13948034C>A	ENST00000382080.1	-	8	1572	c.857G>T	c.(856-858)tGc>tTc	p.C286F	SGCZ_ENST00000421524.2_Missense_Mutation_p.C239F	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	273					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.C286F(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		GCCATTGGGGCAGACGCAGAG	0.498																																					p.C286F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G857T	8						.						167.0	150.0	156.0					8																	13948034		2203	4300	6503	13992405	SO:0001583	missense	137868	exon8			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.857G>T	8.37:g.13948034C>A	ENSP00000371512:p.Cys286Phe		13992405	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660763	0.67700	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.97688	-4.49;-4.49	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.98779	0.9589	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.996	D	0.99755	1.1019	10	0.87932	D	0	.	18.7556	0.91832	0.0:1.0:0.0:0.0	.	239;286	Q08AT0;Q96LD1-2	.;.	F	286;239	ENSP00000371512:C286F;ENSP00000405224:C239F	ENSP00000371512:C286F	C	-	2	0	SGCZ	13992405	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.487000	0.81328	2.760000	0.94817	0.655000	0.94253	TGC		0.498	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
PARP10	84875	hgsc.bcm.edu	37	8	145059254	145059254	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr8:145059254C>T	ENST00000313028.7	-	5	1010	c.916G>A	c.(916-918)Gcc>Acc	p.A306T	PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000525773.1_Missense_Mutation_p.A318T|PARP10_ENST00000524918.1_Missense_Mutation_p.A306T	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	306					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.A306T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTCAGAGAGGCCCCTGACTGC	0.617																																					p.A306T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G916A	8						.						79.0	78.0	78.0					8																	145059254		2203	4300	6503	145131242	SO:0001583	missense	84875	exon5			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.916G>A	8.37:g.145059254C>T	ENSP00000325618:p.Ala306Thr		145131242	NM_032789	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.433458	0.25813	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.34667	2.9;2.92;2.91;1.35	2.32	-3.21	0.05140	.	.	.	.	.	T	0.14184	0.0343	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.0	B;B;B	0.08055	0.003;0.003;0.001	T	0.30679	-0.9970	9	0.07990	T	0.79	.	3.3687	0.07212	0.1933:0.4015:0.0:0.4051	.	318;306;306	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	T	306;12;306;318;221	ENSP00000431620:A306T;ENSP00000325618:A306T;ENSP00000434776:A318T;ENSP00000314320:A221T	ENSP00000325618:A306T	A	-	1	0	PARP10	145131242	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.694000	0.00828	-1.216000	0.02607	-3.130000	0.00060	GCC		0.617	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
SMARCA4	6597	hgsc.bcm.edu	37	19	11100090	11100090	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:11100090G>A	ENST00000429416.3	+	8	1497	c.1216G>A	c.(1216-1218)Gcc>Acc	p.A406T	SMARCA4_ENST00000344626.4_Missense_Mutation_p.A406T|SMARCA4_ENST00000413806.3_Missense_Mutation_p.A406T|SMARCA4_ENST00000590574.1_Missense_Mutation_p.A406T|SMARCA4_ENST00000444061.3_Missense_Mutation_p.A406T|SMARCA4_ENST00000589677.1_Missense_Mutation_p.A406T|SMARCA4_ENST00000450717.3_Missense_Mutation_p.A406T|SMARCA4_ENST00000541122.2_Missense_Mutation_p.A406T|SMARCA4_ENST00000358026.2_Missense_Mutation_p.A406T	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	406					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.A406T(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGAGCTCAAGGCCCTCAGGCT	0.582			"""F, N, Mis"""		NSCLC																																p.A406T			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|lung(1)	c.G1216A	19						.						79.0	70.0	73.0					19																	11100090		2203	4300	6503	10961090	SO:0001583	missense	6597	exon6			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1216G>A	19.37:g.11100090G>A	ENSP00000395654:p.Ala406Thr		10961090	NM_001128845	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	30	5.053650	0.93793	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.66187	0.2764	M	0.65975	2.015	0.80722	D	1	P;D;D;B;D;B;B	0.89917	0.931;0.974;0.974;0.253;1.0;0.415;0.415	P;P;P;B;D;B;B	0.91635	0.566;0.677;0.677;0.213;0.999;0.213;0.213	T	0.70417	-0.4877	10	0.62326	D	0.03	-18.2836	15.1825	0.72972	0.0:0.0:1.0:0.0	.	406;406;406;406;406;406;406	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	T	406	ENSP00000395654:A406T;ENSP00000350720:A406T;ENSP00000343896:A406T;ENSP00000445036:A406T;ENSP00000392837:A406T;ENSP00000397783:A406T;ENSP00000414727:A406T	ENSP00000343896:A406T	A	+	1	0	SMARCA4	10961090	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.596000	0.98267	2.122000	0.65172	0.462000	0.41574	GCC		0.582	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ZNF507	22847	hgsc.bcm.edu	37	19	32845696	32845696	+	Missense_Mutation	SNP	G	G	T	rs186446098		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:32845696G>T	ENST00000311921.4	+	2	2152	c.1960G>T	c.(1960-1962)Ggc>Tgc	p.G654C	ZNF507_ENST00000544431.1_Missense_Mutation_p.G654C|ZNF507_ENST00000355898.5_Missense_Mutation_p.G654C	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G654C(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					TGGCAACAAGGGCTACATCAA	0.502																																					p.G654C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1960T	19						.						174.0	132.0	146.0					19																	32845696		2203	4300	6503	37537536	SO:0001583	missense	22847	exon2			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.1960G>T	19.37:g.32845696G>T	ENSP00000312277:p.Gly654Cys		37537536	NM_014910	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	ENST00000311921.4	37	CCDS32985.1	14	0.00641025641025641	2	0.0040650406504065045	2	0.0055248618784530384	2	0.0034965034965034965	8	0.010554089709762533	G	19.01	3.743880	0.69418	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.15603	2.41;2.41;2.41	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.35219	0.0924	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.12734	-1.0536	10	0.59425	D	0.04	.	19.4684	0.94952	0.0:0.0:1.0:0.0	.	654;654	Q8TCN5;Q8TCN5-2	ZN507_HUMAN;.	C	654	ENSP00000348162:G654C;ENSP00000312277:G654C;ENSP00000441549:G654C	ENSP00000312277:G654C	G	+	1	0	ZNF507	37537536	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	9.410000	0.97335	2.596000	0.87737	0.491000	0.48974	GGC		0.502	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910	
PDCD2L	84306	hgsc.bcm.edu	37	19	34900388	34900388	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:34900388T>C	ENST00000246535.3	+	4	706	c.659T>C	c.(658-660)aTt>aCt	p.I220T	PDCD2L_ENST00000587065.2_Intron	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	220					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.I220T(1)		breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			AGAGAAGGCATTGCCATGGAT	0.502																																					p.I220T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T659C	19						.						116.0	105.0	109.0					19																	34900388		2203	4300	6503	39592228	SO:0001583	missense	84306	exon4			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.659T>C	19.37:g.34900388T>C	ENSP00000246535:p.Ile220Thr		39592228	NM_032346		Missense_Mutation	SNP	ENST00000246535.3	37	CCDS12438.1	.	.	.	.	.	.	.	.	.	.	T	12.58	1.979219	0.34942	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.86	5.86	0.93980	Programmed cell death protein 2, C-terminal (1);	1.315340	0.04424	N	0.368151	T	0.36963	0.0986	L	0.27053	0.805	0.09310	N	1	B	0.26147	0.143	B	0.28553	0.091	T	0.30822	-0.9965	9	0.14252	T	0.57	-0.5002	13.7901	0.63135	0.0:0.0:0.0:1.0	.	220	Q9BRP1	PDD2L_HUMAN	T	220	.	ENSP00000246535:I220T	I	+	2	0	PDCD2L	39592228	0.137000	0.22531	0.003000	0.11579	0.668000	0.39293	3.653000	0.54446	2.240000	0.73641	0.533000	0.62120	ATT		0.502	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
ACTN4	81	hgsc.bcm.edu	37	19	39198806	39198806	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:39198806G>A	ENST00000252699.2	+	6	698	c.622G>A	c.(622-624)Gag>Aag	p.E208K	ACTN4_ENST00000424234.2_Intron|ACTN4_ENST00000390009.3_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	208	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E208K(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCACAGACCAGAGCTGATTGA	0.567																																					p.E208K	Colon(168;199 1940 10254 46213 46384)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622A	19						.						207.0	143.0	165.0					19																	39198806		2203	4300	6503	43890646	SO:0001583	missense	81	exon6			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.622G>A	19.37:g.39198806G>A	ENSP00000252699:p.Glu208Lys		43890646	NM_004924	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	37	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	G	36	5.646392	0.96704	.	.	ENSG00000130402	ENST00000252699;ENST00000445727	D	0.95724	-3.79	5.08	5.08	0.68730	Calponin homology domain (5);	0.065901	0.64402	D	0.000014	D	0.96580	0.8884	M	0.70108	2.13	0.80722	D	1	B;B	0.33477	0.368;0.413	P;B	0.47206	0.541;0.444	D	0.96583	0.9432	10	0.87932	D	0	.	17.7647	0.88475	0.0:0.0:1.0:0.0	.	208;208	E7EV83;O43707	.;ACTN4_HUMAN	K	208	ENSP00000252699:E208K	ENSP00000252699:E208K	E	+	1	0	ACTN4	43890646	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	9.623000	0.98386	2.804000	0.96469	0.462000	0.41574	GAG		0.567	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
SIRT2	22933	hgsc.bcm.edu	37	19	39384486	39384486	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:39384486C>T	ENST00000249396.7	-	3	386	c.85G>A	c.(85-87)Gga>Aga	p.G29R	SIRT2_ENST00000392081.2_5'UTR|SIRT2_ENST00000358931.5_Missense_Mutation_p.G29R	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	29					autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.G29R(1)		endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GCGGCTCCTCCCTCAGAGTCT	0.637																																					p.G29R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G85A	19						.						69.0	75.0	73.0					19																	39384486		2203	4300	6503	44076326	SO:0001583	missense	22933	exon3			AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.85G>A	19.37:g.39384486C>T	ENSP00000249396:p.Gly29Arg		44076326	NM_012237	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Missense_Mutation	SNP	ENST00000249396.7	37	CCDS12523.1	.	.	.	.	.	.	.	.	.	.	C	5.464	0.270710	0.10349	.	.	ENSG00000068903	ENST00000249396;ENST00000358931;ENST00000456703	T;T	0.42900	1.54;0.96	4.36	1.1	0.20463	.	0.554792	0.18093	N	0.151927	T	0.22205	0.0535	N	0.22421	0.69	0.32137	N	0.586005	B	0.23058	0.079	B	0.18871	0.023	T	0.21381	-1.0247	10	0.16420	T	0.52	-11.1252	6.0608	0.19837	0.0:0.6773:0.0:0.3227	.	29	Q8IXJ6	SIRT2_HUMAN	R	29;29;14	ENSP00000249396:G29R;ENSP00000351809:G29R	ENSP00000249396:G29R	G	-	1	0	SIRT2	44076326	0.187000	0.23238	0.680000	0.29994	0.056000	0.15407	0.527000	0.22987	0.572000	0.29383	-1.036000	0.02392	GGA		0.637	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318278.1		
SUPT5H	6829	hgsc.bcm.edu	37	19	39963692	39963692	+	Silent	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:39963692C>A	ENST00000599117.1	+	24	2563	c.2196C>A	c.(2194-2196)gcC>gcA	p.A732A	SUPT5H_ENST00000432763.2_Silent_p.A732A|SUPT5H_ENST00000402194.2_Silent_p.A728A|SUPT5H_ENST00000359191.6_Silent_p.A728A|SUPT5H_ENST00000598725.1_Silent_p.A732A			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	732	KOW 5.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.A732A(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGTCCACGGCCCGTGTGGAGC	0.677																																					p.A732A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2196A	19						.						56.0	50.0	52.0					19																	39963692		2203	4300	6503	44655532	SO:0001819	synonymous_variant	6829	exon23			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2196C>A	19.37:g.39963692C>A			44655532	NM_001111020	O43279|Q59G52|Q99639	Silent	SNP	ENST00000599117.1	37	CCDS12536.1																																																																																				0.677	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
CCDC8	83987	hgsc.bcm.edu	37	19	46915159	46915159	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:46915159T>C	ENST00000307522.3	-	1	1682	c.909A>G	c.(907-909)caA>caG	p.Q303Q		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	303					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.Q303Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CCTCTTCCCTTTGACTATCTG	0.637																																					p.Q303Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A909G	19						.						88.0	88.0	88.0					19																	46915159		2203	4300	6503	51606999	SO:0001819	synonymous_variant	83987	exon1			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.909A>G	19.37:g.46915159T>C			51606999	NM_032040	Q8TB26	Silent	SNP	ENST00000307522.3	37	CCDS12685.1																																																																																				0.637	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
SIGLEC9	27180	hgsc.bcm.edu	37	19	51633150	51633150	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:51633150G>A	ENST00000250360.3	+	7	1273	c.1206G>A	c.(1204-1206)ggG>ggA	p.G402G	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	402					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.G402G(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TGTCTCAGGGGCCCCTGACTG	0.612																																					p.G402G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1206A	19						.						72.0	77.0	75.0					19																	51633150		2203	4300	6503	56324962	SO:0001819	synonymous_variant	27180	exon7			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1206G>A	19.37:g.51633150G>A			56324962	NM_014441	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	CCDS12825.1																																																																																				0.612	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
ZNF304	57343	hgsc.bcm.edu	37	19	57868626	57868626	+	Silent	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr19:57868626T>G	ENST00000282286.5	+	3	1562	c.1389T>G	c.(1387-1389)gtT>gtG	p.V463V	ZNF304_ENST00000391705.3_Silent_p.V463V|ZNF304_ENST00000598744.1_Silent_p.V421V|ZNF304_ENST00000443917.2_Silent_p.V510V			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V463V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACACACTTGTTCAGCACCAGA	0.478																																					p.V463V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1389G	19						.						90.0	87.0	88.0					19																	57868626		2203	4300	6503	62560438	SO:0001819	synonymous_variant	57343	exon3			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1389T>G	19.37:g.57868626T>G			62560438	NM_020657		Silent	SNP	ENST00000282286.5	37	CCDS12950.1																																																																																				0.478	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1		
KCND3	3752	hgsc.bcm.edu	37	1	112525121	112525121	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:112525121G>A	ENST00000315987.2	-	2	707	c.228C>T	c.(226-228)aaC>aaT	p.N76N	KCND3_ENST00000369697.1_Silent_p.N76N|KCND3_ENST00000302127.4_Silent_p.N76N	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	76					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.N76N(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TGGTGTCCTCGTTGAAGAAGA	0.622																																					p.N76N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C228T	1						.						122.0	110.0	114.0					1																	112525121		2203	4300	6503	112326644	SO:0001819	synonymous_variant	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.228C>T	1.37:g.112525121G>A			112326644	NM_172198	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1																																																																																				0.622	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
NRAS	4893	hgsc.bcm.edu	37	1	115258748	115258748	+	Missense_Mutation	SNP	C	C	A	rs121913250		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:115258748C>A	ENST00000369535.4	-	2	287	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12S(133)|p.G12C(81)|p.G12R(18)|p.G12N(2)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACCACCTGCTCCAACC	0.493	G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12C			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1	.	236	Substitution - Missense(236)	haematopoietic_and_lymphoid_tissue(149)|skin(29)|upper_aerodigestive_tract(21)|large_intestine(13)|thyroid(8)|prostate(6)|lung(4)|soft_tissue(2)|urinary_tract(1)|NS(1)|kidney(1)|pancreas(1)	c.G34T	1						.						203.0	181.0	189.0					1																	115258748		2203	4300	6503	115060271	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.34G>T	1.37:g.115258748C>A	ENSP00000358548:p.Gly12Cys		115060271	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208516	0.95069	.	.	ENSG00000213281	ENST00000369535	T	0.79141	-1.24	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	D	0.85826	0.5787	M	0.89904	3.07	0.80722	D	1	P	0.39480	0.675	P	0.49276	0.605	D	0.87171	0.2221	10	0.72032	D	0.01	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	C	12	ENSP00000358548:G12C	ENSP00000358548:G12C	G	-	1	0	NRAS	115060271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT		0.493	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
TARS2	80222	hgsc.bcm.edu	37	1	150463139	150463139	+	Silent	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:150463139T>G	ENST00000369064.3	+	4	484	c.450T>G	c.(448-450)gtT>gtG	p.V150V	TARS2_ENST00000438568.2_Intron|TARS2_ENST00000369054.2_Silent_p.V150V|TARS2_ENST00000606933.1_Silent_p.V150V	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	150					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.V150V(1)		cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TAGGTGCTGTTCTCTGCAGAG	0.473																																					p.V150V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T450G	1						.						113.0	111.0	112.0					1																	150463139		2203	4300	6503	148729763	SO:0001819	synonymous_variant	80222	exon4			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.450T>G	1.37:g.150463139T>G			148729763	NM_025150	Q53GW7|Q96I50|Q9H9V2	Silent	SNP	ENST00000369064.3	37	CCDS952.1																																																																																				0.473	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155934813	155934813	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:155934813T>C	ENST00000361247.4	-	7	789	c.690A>G	c.(688-690)aaA>aaG	p.K230K	ARHGEF2_ENST00000368316.1_Silent_p.K202K|ARHGEF2_ENST00000313667.4_Silent_p.K229K|ARHGEF2_ENST00000462460.2_Silent_p.K275K|ARHGEF2_ENST00000313695.7_Silent_p.K202K|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368315.4_Silent_p.K231K	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	230					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K202K(1)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCACCTCCTTTTTATGCTGCT	0.468																																					p.K230K	Melanoma(178;35 2768 6610 28839)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A690G	1						.						142.0	125.0	130.0					1																	155934813		2203	4300	6503	154201437	SO:0001819	synonymous_variant	9181	exon7			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.690A>G	1.37:g.155934813T>C			154201437	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	ENST00000361247.4	37	CCDS53376.1																																																																																				0.468	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
IQGAP3	128239	hgsc.bcm.edu	37	1	156503844	156503844	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:156503844G>T	ENST00000361170.2	-	30	3840	c.3830C>A	c.(3829-3831)cCc>cAc	p.P1277H		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1277					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.P1277H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTACACCATGGGTTTGGCCAC	0.592																																					p.P1277H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3830A	1						.						134.0	112.0	120.0					1																	156503844		2203	4300	6503	154770468	SO:0001583	missense	128239	exon30			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3830C>A	1.37:g.156503844G>T	ENSP00000354451:p.Pro1277His		154770468	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045854	0.75846	.	.	ENSG00000183856	ENST00000361170	T	0.69806	-0.43	4.88	4.88	0.63580	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	T	0.82051	0.4953	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84806	0.0787	10	0.87932	D	0	-23.4263	17.1295	0.86723	0.0:0.0:1.0:0.0	.	1277	Q86VI3	IQGA3_HUMAN	H	1277	ENSP00000354451:P1277H	ENSP00000354451:P1277H	P	-	2	0	IQGAP3	154770468	1.000000	0.71417	0.709000	0.30452	0.531000	0.34715	9.577000	0.98196	2.700000	0.92200	0.462000	0.41574	CCC		0.592	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
CD1B	910	hgsc.bcm.edu	37	1	158299826	158299826	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:158299826G>A	ENST00000368168.3	-	3	530	c.423C>T	c.(421-423)ttC>ttT	p.F141F		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	141					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.F141F(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TGACACTCAGGAAATCCAATC	0.483																																					p.F141F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C423T	1						.						167.0	168.0	168.0					1																	158299826		2203	4300	6503	156566450	SO:0001819	synonymous_variant	910	exon3			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.423C>T	1.37:g.158299826G>A			156566450	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Silent	SNP	ENST00000368168.3	37	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	G	5.274	0.235943	0.10023	.	.	ENSG00000158485	ENST00000451207	.	.	.	4.28	3.36	0.38483	.	.	.	.	.	T	0.45115	0.1326	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.41840	-0.9486	4	.	.	.	-22.4588	8.3505	0.32299	0.1096:0.0:0.8904:0.0	.	.	.	.	S	109	.	.	P	-	1	0	CD1B	156566450	0.042000	0.20092	0.727000	0.30756	0.088000	0.18126	0.190000	0.17057	1.140000	0.42260	0.655000	0.94253	CCT		0.483	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
IGSF9	57549	hgsc.bcm.edu	37	1	159897211	159897211	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:159897211C>T	ENST00000368094.1	-	21	3661	c.3464G>A	c.(3463-3465)cGc>cAc	p.R1155H	IGSF9_ENST00000361509.3_Missense_Mutation_p.R1139H|TAGLN2_ENST00000478033.1_5'Flank|TAGLN2_ENST00000320307.4_5'Flank|TAGLN2_ENST00000368097.4_5'Flank|IGSF9_ENST00000493195.1_5'UTR	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	1155					dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R1139H(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCATCTCGGCGGCGGCGGAA	0.627																																					p.R1139H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3416A	1						.						46.0	51.0	49.0					1																	159897211		2203	4297	6500	158163835	SO:0001583	missense	57549	exon21			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.3464G>A	1.37:g.159897211C>T	ENSP00000357073:p.Arg1155His		158163835	NM_020789		Missense_Mutation	SNP	ENST00000368094.1	37	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560526	0.86335	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.72282	-0.64;-0.56	5.52	4.61	0.57282	.	0.000000	0.42420	D	0.000711	T	0.65004	0.2650	L	0.29908	0.895	0.34941	D	0.750305	D;D	0.76494	0.998;0.999	D;D	0.72075	0.976;0.94	T	0.67806	-0.5575	9	.	.	.	-17.4238	12.4698	0.55781	0.0:0.8318:0.1682:0.0	.	1155;693	Q9P2J2;C9JI81	TUTLA_HUMAN;.	H	1139;1155;693	ENSP00000355049:R1139H;ENSP00000357073:R1155H	.	R	-	2	0	IGSF9	158163835	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.335000	0.43929	1.326000	0.45319	0.563000	0.77884	CGC		0.627	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
PPOX	5498	hgsc.bcm.edu	37	1	161137892	161137892	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:161137892T>G	ENST00000367999.4	+	5	712	c.446T>G	c.(445-447)tTt>tGt	p.F149C	PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.F149C|PPOX_ENST00000544598.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	149					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)	p.F149C(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GTGCACAGTTTTGCCCAGCGC	0.602																																					p.F149C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T446G	1						.						50.0	53.0	52.0					1																	161137892		2203	4300	6503	159404516	SO:0001583	missense	5498	exon5			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.446T>G	1.37:g.161137892T>G	ENSP00000356978:p.Phe149Cys		159404516	NM_001122764	D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	CCDS1221.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391258	0.82902	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.96716	-4.1;-4.1	5.69	5.69	0.88448	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.98419	0.9474	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99694	1.1002	10	0.87932	D	0	-22.9136	13.9104	0.63864	0.0:0.0:0.0:1.0	.	149	P50336	PPOX_HUMAN	C	149	ENSP00000343943:F149C;ENSP00000356978:F149C	ENSP00000343943:F149C	F	+	2	0	PPOX	159404516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.686000	0.68211	2.165000	0.68154	0.528000	0.53228	TTT		0.602	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309	
AJAP1	55966	hgsc.bcm.edu	37	1	4832363	4832363	+	Missense_Mutation	SNP	G	G	A	rs267598631		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:4832363G>A	ENST00000378191.4	+	4	1322	c.941G>A	c.(940-942)cGt>cAt	p.R314H	AJAP1_ENST00000378190.3_Missense_Mutation_p.R314H	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	314	Targeting signals.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R314H(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GGGAACACTCGTCGGAACAGC	0.607																																					p.R314H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G941A	1						.						75.0	67.0	70.0					1																	4832363		2203	4300	6503	4732223	SO:0001583	missense	55966	exon4			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.941G>A	1.37:g.4832363G>A	ENSP00000367433:p.Arg314His		4732223	NM_001042478	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	37	CCDS54.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615777	0.87359	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.68331	-0.32;-0.32	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.72606	0.3481	N	0.24115	0.695	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.77088	-0.2717	10	0.87932	D	0	-17.6043	17.1126	0.86680	0.0:0.0:1.0:0.0	.	314	Q9UKB5	AJAP1_HUMAN	H	314	ENSP00000367432:R314H;ENSP00000367433:R314H	ENSP00000367432:R314H	R	+	2	0	AJAP1	4732223	1.000000	0.71417	0.064000	0.19789	0.748000	0.42578	9.159000	0.94728	2.380000	0.81148	0.561000	0.74099	CGT		0.607	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
RPS6KA1	6195	hgsc.bcm.edu	37	1	26897999	26897999	+	Silent	SNP	C	C	T	rs374126540		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:26897999C>T	ENST00000374168.2	+	18	1804	c.1650C>T	c.(1648-1650)ccC>ccT	p.P550P	RPS6KA1_ENST00000531382.1_Silent_p.P559P|RPS6KA1_ENST00000374162.2_Silent_p.P458P|RPS6KA1_ENST00000374166.4_Silent_p.P539P|RPS6KA1_ENST00000526792.1_Silent_p.P458P|RPS6KA1_ENST00000530003.1_Silent_p.P534P	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	550	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.P559P(1)		lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		CCGGGAATCCCGAGTGCCTGC	0.592																																					p.P550P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1650T	1						.	C	,	1,4405	2.1+/-5.4	0,1,2202	90.0	79.0	83.0		1677,1650	-1.2	1.0	1		83	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RPS6KA1	NM_001006665.1,NM_002953.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	559/745,550/736	26897999	1,13005	2203	4300	6503	26770586	SO:0001819	synonymous_variant	6195	exon18			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1650C>T	1.37:g.26897999C>T			26770586	NM_002953	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																				0.592	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
LHX8	431707	hgsc.bcm.edu	37	1	75609594	75609594	+	Silent	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:75609594A>G	ENST00000294638.5	+	7	1339	c.675A>G	c.(673-675)gcA>gcG	p.A225A	LHX8_ENST00000356261.3_Silent_p.A215A	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	225					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.A225A(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CAAAACCAGCAAAAAGAGCTC	0.388																																					p.A225A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A675G	1						.						105.0	103.0	103.0					1																	75609594		2203	4300	6503	75382182	SO:0001819	synonymous_variant	431707	exon7			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.675A>G	1.37:g.75609594A>G			75382182	NM_001001933	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																				0.388	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
TTLL7	79739	hgsc.bcm.edu	37	1	84394907	84394907	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:84394907G>A	ENST00000260505.8	-	10	1431	c.1054C>T	c.(1054-1056)Cga>Tga	p.R352*	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	352	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.R352*(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		CTTGGGGCTCGGTTAATCTGA	0.343																																					p.R352X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1054T	1						.						100.0	94.0	96.0					1																	84394907		2202	4298	6500	84167495	SO:0001587	stop_gained	79739	exon10			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1054C>T	1.37:g.84394907G>A	ENSP00000260505:p.Arg352*		84167495	NM_024686	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Nonsense_Mutation	SNP	ENST00000260505.8	37	CCDS690.2	.	.	.	.	.	.	.	.	.	.	G	41	8.711384	0.98925	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	.	.	.	5.11	3.18	0.36537	.	0.068061	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	12.785	0.57500	0.0:0.0:0.7016:0.2984	.	.	.	.	X	352;129;352	.	ENSP00000260505:R352X	R	-	1	2	TTLL7	84167495	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	6.188000	0.72045	0.618000	0.30179	0.650000	0.86243	CGA		0.343	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
SSX2IP	117178	hgsc.bcm.edu	37	1	85130166	85130166	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:85130166G>A	ENST00000342203.3	-	6	870	c.607C>T	c.(607-609)Cgt>Tgt	p.R203C	SSX2IP_ENST00000605755.1_Missense_Mutation_p.R176C|SSX2IP_ENST00000370612.4_Missense_Mutation_p.R203C|SSX2IP_ENST00000437941.2_Missense_Mutation_p.R176C|SSX2IP_ENST00000603677.1_Intron	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	203					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.R203C(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTATATTCACGCTCTTTTCTC	0.333																																					p.R203C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C607T	1						.						162.0	157.0	158.0					1																	85130166		2202	4297	6499	84902754	SO:0001583	missense	117178	exon6				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.607C>T	1.37:g.85130166G>A	ENSP00000340279:p.Arg203Cys		84902754	NM_001166293	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	37	CCDS699.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743648	0.69418	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T;T	0.33216	1.42;1.42;1.42	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	M	0.65498	2.005	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.45498	-0.9257	10	0.87932	D	0	-15.3412	13.6067	0.62052	0.0:0.0:0.806:0.194	.	199;203;176	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	C	203;176;199;203	ENSP00000340279:R203C;ENSP00000412781:R176C;ENSP00000359644:R203C	ENSP00000340279:R203C	R	-	1	0	SSX2IP	84902754	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.319000	0.59197	2.494000	0.84150	0.655000	0.94253	CGT		0.333	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
CCSAP	126731	hgsc.bcm.edu	37	1	229462499	229462499	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:229462499C>G	ENST00000366687.1	-	2	673	c.622G>C	c.(622-624)Gct>Cct	p.A208P	CCSAP_ENST00000366686.1_Missense_Mutation_p.A94P|CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000284617.2_Missense_Mutation_p.A208P			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	208					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)		p.A208P(1)									TGCACAGGAGCGGACGCACAG	0.532																																					p.A208P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622C	1						.						174.0	143.0	154.0					1																	229462499		2203	4300	6503	227529122	SO:0001583	missense	126731	exon3			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.622G>C	1.37:g.229462499C>G	ENSP00000355648:p.Ala208Pro		227529122	NM_145257	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Missense_Mutation	SNP	ENST00000366687.1	37	CCDS1577.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505380	0.44558	.	.	ENSG00000154429	ENST00000366687;ENST00000284617;ENST00000366686	T;T;T	0.57752	0.57;0.57;0.38	5.7	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.73291	-0.4029	10	0.66056	D	0.02	-5.1673	13.0248	0.58808	0.0:0.9258:0.0:0.0742	.	208	Q6IQ19	CA096_HUMAN	P	208;208;94	ENSP00000355648:A208P;ENSP00000284617:A208P;ENSP00000355647:A94P	ENSP00000284617:A208P	A	-	1	0	C1orf96	227529122	1.000000	0.71417	0.046000	0.18839	0.009000	0.06853	5.717000	0.68446	1.412000	0.46977	-0.140000	0.14226	GCT		0.532	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091839.1	NM_145257	
RNF182	221687	hgsc.bcm.edu	37	6	13978020	13978020	+	Missense_Mutation	SNP	G	G	A	rs376733532		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:13978020G>A	ENST00000488300.1	+	3	1193	c.670G>A	c.(670-672)Gtt>Att	p.V224I	RNF182_ENST00000544682.1_Missense_Mutation_p.V224I|RNF182_ENST00000537388.1_Missense_Mutation_p.V224I|RNF182_ENST00000537663.1_Missense_Mutation_p.V224I	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	224					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V224I(1)		cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			TTCGAGCCTCGTTATTCTTAT	0.428																																					p.V224I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G670A	6						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	188.0	175.0	179.0		670,670,670,670	4.6	1.0	6		179	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	RNF182	NM_001165032.1,NM_001165033.1,NM_001165034.1,NM_152737.3	29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	224/248,224/248,224/248,224/248	13978020	1,13005	2203	4300	6503	14085999	SO:0001583	missense	221687	exon3			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.670G>A	6.37:g.13978020G>A	ENSP00000420465:p.Val224Ile		14085999	NM_152737	B2RDG2|Q8NBG3	Missense_Mutation	SNP	ENST00000488300.1	37	CCDS4531.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845808	0.51164	0.0	1.16E-4	ENSG00000180537	ENST00000537663;ENST00000488300;ENST00000544682;ENST00000537388	T;T;T;T	0.06608	3.28;3.28;3.28;3.28	5.51	4.64	0.57946	.	0.464193	0.22692	N	0.056808	T	0.02156	0.0067	L	0.34521	1.04	0.37501	D	0.916752	B	0.33238	0.403	B	0.20184	0.028	T	0.52939	-0.8508	9	.	.	.	-14.3913	14.7267	0.69349	0.0709:0.0:0.9291:0.0	.	224	Q8N6D2	RN182_HUMAN	I	224	ENSP00000443228:V224I;ENSP00000420465:V224I;ENSP00000442021:V224I;ENSP00000441271:V224I	.	V	+	1	0	RNF182	14085999	0.991000	0.36638	1.000000	0.80357	0.991000	0.79684	2.155000	0.42301	2.584000	0.87258	0.563000	0.77884	GTT		0.428	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039911.2	NM_152737	
SLC22A23	63027	hgsc.bcm.edu	37	6	3324068	3324068	+	Splice_Site	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:3324068G>A	ENST00000406686.3	-	4	1081	c.1082C>T	c.(1081-1083)tCg>tTg	p.S361L	SLC22A23_ENST00000380302.4_Splice_Site_p.S80L|SLC22A23_ENST00000436008.2_Splice_Site_p.S361L|SLC22A23_ENST00000433689.2_5'UTR|SLC22A23_ENST00000490273.1_Splice_Site_p.S80L|SLC22A23_ENST00000380298.2_Missense_Mutation_p.S361L	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	361					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.S80L(1)|p.S361L(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GTGTACTCACGACCAGTAGAG	0.642																																					p.S80L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C239T	6						.						37.0	30.0	32.0					6																	3324068		2203	4300	6503	3269067	SO:0001630	splice_region_variant	63027	exon5			AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1082+1C>T	6.37:g.3324068G>A			3269067	NM_021945	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763475	0.49574	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273;ENST00000485307;ENST00000467177;ENST00000380298	T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.53	4.38	4.38	0.52667	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.320649	0.24766	N	0.035779	T	0.36110	0.0955	N	0.22421	0.69	0.34644	D	0.720907	P;P	0.34522	0.455;0.455	B;B	0.30782	0.12;0.12	T	0.48843	-0.8999	10	0.87932	D	0	-10.1507	5.7448	0.18114	0.2614:0.0:0.7386:0.0	.	361;361	C9J4Z0;A1A5C7	.;S22AN_HUMAN	L	361;361;80;80;189;187;361	ENSP00000410245:S361L;ENSP00000385028:S361L;ENSP00000369657:S80L;ENSP00000419463:S80L;ENSP00000418134:S189L;ENSP00000418985:S187L;ENSP00000369653:S361L	ENSP00000369653:S361L	S	-	2	0	SLC22A23	3269067	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.863000	0.39459	1.998000	0.58463	0.561000	0.74099	TCG		0.642	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	Missense_Mutation
EHMT2	10919	hgsc.bcm.edu	37	6	31851681	31851681	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:31851681C>T	ENST00000375537.4	-	22	2824	c.2818G>A	c.(2818-2820)Ggt>Agt	p.G940S	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000395728.3_Missense_Mutation_p.G997S|EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000375530.4_Missense_Mutation_p.G906S|EHMT2_ENST00000375528.4_Missense_Mutation_p.G963S	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	940					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.G940S(1)		central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CCATCCACACCGTTGACACAG	0.577																																					p.G940S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2818A	6						.						110.0	95.0	100.0					6																	31851681		2203	4300	6503	31959660	SO:0001583	missense	10919	exon22			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2818G>A	6.37:g.31851681C>T	ENSP00000364687:p.Gly940Ser		31959660	NM_006709	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.37|16.37	3.103503|3.103503	0.56291|0.56291	.|.	.|.	ENSG00000204371|ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298|ENST00000436026	D;D;D;D|.	0.89050|.	-2.46;-2.46;-2.46;-2.46|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Pre-SET zinc-binding sub-group (1);Pre-SET domain (1);|.	0.120124|.	0.56097|.	D|.	0.000032|.	T|T	0.34366|0.34366	0.0895|0.0895	N|N	0.11313|0.11313	0.125|0.125	0.47245|0.47245	D|D	0.999369|0.999369	B;B;B;B|.	0.29037|.	0.231;0.074;0.116;0.073|.	B;B;B;B|.	0.27262|.	0.078;0.066;0.065;0.041|.	T|T	0.31861|0.31861	-0.9928|-0.9928	10|5	0.41790|.	T|.	0.15|.	.|.	18.0735|18.0735	0.89419|0.89419	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	963;906;940;761|.	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7|.	.;.;EHMT2_HUMAN;.|.	S|Q	997;963;906;940;761|270	ENSP00000379078:G997S;ENSP00000364678:G963S;ENSP00000364680:G906S;ENSP00000364687:G940S|.	ENSP00000364678:G963S|.	G|R	-|-	1|2	0|0	EHMT2|EHMT2	31959660|31959660	0.001000|0.001000	0.12720|0.12720	0.086000|0.086000	0.20670|0.20670	0.718000|0.718000	0.41266|0.41266	1.475000|1.475000	0.35409|0.35409	2.568000|2.568000	0.86640|0.86640	0.650000|0.650000	0.86243|0.86243	GGT|CGG		0.577	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
UBR2	23304	hgsc.bcm.edu	37	6	42585005	42585005	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:42585005A>G	ENST00000372899.1	+	11	1468	c.1210A>G	c.(1210-1212)Atg>Gtg	p.M404V	UBR2_ENST00000372901.1_Intron|UBR2_ENST00000372883.3_Intron|UBR2_ENST00000372903.2_Intron	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	404					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M404V(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GAGAGATTTTATGGAGGATGA	0.433																																					p.M404V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1210G	6						.						167.0	154.0	158.0					6																	42585005		2203	4300	6503	42692983	SO:0001583	missense	23304	exon11			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1210A>G	6.37:g.42585005A>G	ENSP00000361990:p.Met404Val		42692983	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954774	0.34471	.	.	ENSG00000024048	ENST00000372899	T	0.55588	0.51	4.95	4.95	0.65309	.	.	.	.	.	T	0.13927	0.0337	N	0.02158	-0.66	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05971	-1.0853	9	0.30078	T	0.28	.	14.9141	0.70781	1.0:0.0:0.0:0.0	.	404	Q8IWV8	UBR2_HUMAN	V	404	ENSP00000361990:M404V	ENSP00000361990:M404V	M	+	1	0	UBR2	42692983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.995000	0.76257	1.995000	0.58328	0.533000	0.62120	ATG		0.433	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
CUL9	23113	hgsc.bcm.edu	37	6	43166414	43166414	+	Silent	SNP	G	G	T	rs397840127|rs3215697	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:43166414G>T	ENST00000252050.4	+	12	2955	c.2871G>T	c.(2869-2871)ggG>ggT	p.G957G	CUL9_ENST00000354495.3_Silent_p.G847G|CUL9_ENST00000372647.2_Silent_p.G957G	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	957					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.G957G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCTGGTTGGGGGCCCATCTG	0.627																																					p.G957G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2871T	6						.						112.0	115.0	114.0					6																	43166414		2201	4298	6499	43274392	SO:0001819	synonymous_variant	23113	exon12			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2871G>T	6.37:g.43166414G>T			43274392	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																				0.627	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
RRAGD	58528	hgsc.bcm.edu	37	6	90082161	90082161	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:90082161C>A	ENST00000369415.4	-	6	1322	c.1046G>T	c.(1045-1047)aGa>aTa	p.R349I	RRAGD_ENST00000359203.3_Missense_Mutation_p.R198I	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.R349I(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		GTTACCTTTTCTTTCAAAGCT	0.373											OREG0017567	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R349I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1046T	6						.						68.0	60.0	63.0					6																	90082161		2203	4300	6503	90138880	SO:0001583	missense	58528	exon6			AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.1046G>T	6.37:g.90082161C>A	ENSP00000358423:p.Arg349Ile	1272	90138880	NM_021244		Missense_Mutation	SNP	ENST00000369415.4	37	CCDS5022.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541541	0.65085	.	.	ENSG00000025039	ENST00000369415;ENST00000359203	.	.	.	4.86	4.86	0.63082	.	0.046291	0.85682	D	0.000000	T	0.66577	0.2803	M	0.82323	2.585	0.80722	D	1	P	0.45715	0.865	P	0.47206	0.541	T	0.75001	-0.3471	9	0.72032	D	0.01	-14.5098	18.012	0.89226	0.0:1.0:0.0:0.0	.	349	Q9NQL2	RRAGD_HUMAN	I	349;198	.	ENSP00000352131:R198I	R	-	2	0	RRAGD	90138880	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.966000	0.70395	2.229000	0.72834	0.563000	0.77884	AGA		0.373	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	NM_021244	
MMS22L	253714	hgsc.bcm.edu	37	6	97609907	97609907	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:97609907T>C	ENST00000275053.4	-	22	3621	c.3356A>G	c.(3355-3357)aAa>aGa	p.K1119R	MMS22L_ENST00000369251.2_Missense_Mutation_p.K1079R	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1119					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.K1119R(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CACCAAGCATTTTAAAATGCC	0.383																																					p.K1119R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3356G	6						.						104.0	101.0	102.0					6																	97609907		2203	4300	6503	97716628	SO:0001583	missense	253714	exon22				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3356A>G	6.37:g.97609907T>C	ENSP00000275053:p.Lys1119Arg		97716628	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.301840	0.60195	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.31769	3.46;1.48	5.87	4.7	0.59300	.	0.274051	0.42964	N	0.000627	T	0.33760	0.0874	L	0.55103	1.725	0.33238	D	0.556883	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.957	T	0.21415	-1.0246	10	0.28530	T	0.3	-13.4007	11.7295	0.51728	0.0:0.0688:0.0:0.9312	.	1079;1119	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	R	1119;1079	ENSP00000275053:K1119R;ENSP00000358254:K1079R	ENSP00000275053:K1119R	K	-	2	0	MMS22L	97716628	1.000000	0.71417	0.142000	0.22268	0.984000	0.73092	3.714000	0.54889	1.046000	0.40249	0.528000	0.53228	AAA		0.383	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151152743	151152743	+	Silent	SNP	C	C	T	rs377576260		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:151152743C>T	ENST00000358517.2	+	15	2707	c.2496C>T	c.(2494-2496)tcC>tcT	p.S832S	PLEKHG1_ENST00000367328.1_Silent_p.S832S			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	832							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S832S(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ATAAACTGTCCGAAGAAGTAG	0.458																																					p.S832S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2496T	6						.	C		1,4405	2.1+/-5.4	0,1,2202	106.0	110.0	109.0		2496	-11.4	0.4	6		109	0,8600		0,0,4300	no	coding-synonymous	PLEKHG1	NM_001029884.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		832/1386	151152743	1,13005	2203	4300	6503	151194436	SO:0001819	synonymous_variant	57480	exon16			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2496C>T	6.37:g.151152743C>T			151194436	NM_001029884	Q5T1F2	Silent	SNP	ENST00000358517.2	37	CCDS34552.1																																																																																				0.458	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
HSD17B12	51144	hgsc.bcm.edu	37	11	43702506	43702506	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr11:43702506G>A	ENST00000278353.4	+	1	248	c.129G>A	c.(127-129)gcG>gcA	p.A43A	HSD17B12_ENST00000395700.4_Silent_p.A43A|HSD17B12_ENST00000529261.1_Intron	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	43					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)	p.A43A(1)		endometrium(2)|large_intestine(4)|lung(4)	10						GGAATGAGGCGGGGGTCGGCC	0.706																																					p.A43A	Ovarian(58;548 1143 13948 16572 34258)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G129A	11						.						19.0	23.0	22.0					11																	43702506		2201	4298	6499	43659082	SO:0001819	synonymous_variant	51144	exon1			AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.129G>A	11.37:g.43702506G>A			43659082	NM_016142	A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Silent	SNP	ENST00000278353.4	37	CCDS7905.1																																																																																				0.706	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389594.1		
OR9G4	283189	hgsc.bcm.edu	37	11	56511137	56511137	+	Silent	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr11:56511137A>G	ENST00000302957.3	-	1	150	c.151T>C	c.(151-153)Ttg>Ctg	p.L51L		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L51L(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						AAGGTTATCAAATAGAGCATC	0.408																																					p.L51L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T151C	11						.						88.0	82.0	84.0					11																	56511137		2201	4296	6497	56267713	SO:0001819	synonymous_variant	283189	exon1			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.151T>C	11.37:g.56511137A>G			56267713	NM_001005284	Q6IF62|Q96RA9	Silent	SNP	ENST00000302957.3	37	CCDS31537.1																																																																																				0.408	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284	
APLNR	187	hgsc.bcm.edu	37	11	57004344	57004344	+	Silent	SNP	G	G	T	rs948847	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr11:57004344G>T	ENST00000606794.1	-	1	331	c.135C>A	c.(133-135)ggC>ggA	p.G45G		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	45					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.G45G(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CCAGACCGTTGCCCGTGGTGC	0.597													G|||	2928	0.584665	0.3835	0.6412	5008	,	,		19084	0.7113		0.5577	False		,,,				2504	0.7137				p.G45G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C135A	11						.	G		1948,2454	549.3+/-377.7	406,1136,659	75.0	72.0	73.0		135	3.3	1.0	11	dbSNP_86	73	4752,3840	608.4+/-395.4	1353,2046,897	no	coding-synonymous	APLNR	NM_005161.4		1759,3182,1556	TT,TG,GG		44.6927,44.2526,48.4377		45/381	57004344	6700,6294	2201	4296	6497	56760920	SO:0001819	synonymous_variant	187	exon1			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.135C>A	11.37:g.57004344G>T			56760920	NM_005161		Silent	SNP	ENST00000606794.1	37	CCDS7950.1																																																																																				0.597	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161	
RELT	84957	hgsc.bcm.edu	37	11	73105345	73105345	+	Missense_Mutation	SNP	C	C	A	rs181492685		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr11:73105345C>A	ENST00000064780.2	+	8	1032	c.771C>A	c.(769-771)agC>agA	p.S257R	RELT_ENST00000393580.2_Missense_Mutation_p.S257R|RP11-809N8.2_ENST00000544674.1_RNA	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	257						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S257R(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						TGCAGACGAGCCACAGGCCTG	0.592											OREG0021216	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S257R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C771A	11						.						65.0	65.0	65.0					11																	73105345		2200	4293	6493	72782993	SO:0001583	missense	84957	exon8			AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.771C>A	11.37:g.73105345C>A	ENSP00000064780:p.Ser257Arg	1142	72782993	NM_152222	Q86V34|Q96JU1|Q9BUX7	Missense_Mutation	SNP	ENST00000064780.2	37	CCDS8222.1	276	0.12637362637362637	89	0.18089430894308944	30	0.08287292817679558	52	0.09090909090909091	105	0.13852242744063326	C	14.98	2.697776	0.48307	.	.	ENSG00000054967	ENST00000064780;ENST00000393580;ENST00000438119	T;T	0.76316	-1.01;-1.01	5.57	-0.334	0.12666	.	0.362529	0.31872	N	0.006937	T	0.00300	0.0009	M	0.70275	2.135	0.21915	N	0.999471	B	0.16802	0.019	B	0.14023	0.01	T	0.02275	-1.1184	10	0.32370	T	0.25	-6.9656	4.3033	0.10935	0.2725:0.473:0.0:0.2545	.	257	Q969Z4	TR19L_HUMAN	R	257;257;125	ENSP00000064780:S257R;ENSP00000377207:S257R	ENSP00000064780:S257R	S	+	3	2	RELT	72782993	0.020000	0.18652	0.877000	0.34402	0.976000	0.68499	1.011000	0.29911	0.278000	0.22164	0.655000	0.94253	AGC		0.592	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397380.2	NM_032871	
PIH1D2	120379	hgsc.bcm.edu	37	11	111941852	111941852	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr11:111941852A>G	ENST00000280350.4	-	4	679	c.457T>C	c.(457-459)Ttt>Ctt	p.F153L	PIH1D2_ENST00000521853.2_5'Flank|PIH1D2_ENST00000530641.1_Missense_Mutation_p.F153L|PIH1D2_ENST00000431456.1_Missense_Mutation_p.F153L|PIH1D2_ENST00000528775.1_Missense_Mutation_p.F153L|C11orf57_ENST00000420986.2_5'Flank|PIH1D2_ENST00000532211.1_Missense_Mutation_p.F153L	NM_138789.3	NP_620144.1	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2	153								p.F153L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TTTATTCTAAATTTGGTAATA	0.338																																					p.F153L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T457C	11						.						140.0	141.0	141.0					11																	111941852		2201	4297	6498	111447062	SO:0001583	missense	120379	exon4			BC019238	CCDS8355.1, CCDS44730.1	11q23.1	2007-01-31			ENSG00000150773	ENSG00000150773			25210	protein-coding gene	gene with protein product						12477932	Standard	NM_138789		Approved		uc001pmp.4	Q8WWB5	OTTHUMG00000166925	ENST00000280350.4:c.457T>C	11.37:g.111941852A>G	ENSP00000280350:p.Phe153Leu		111447062	NM_001082619	B4DU48|E9PD82	Missense_Mutation	SNP	ENST00000280350.4	37	CCDS8355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.501|9.501	1.103317|1.103317	0.20632|0.20632	.|.	.|.	ENSG00000150773|ENSG00000150773	ENST00000528775;ENST00000431456;ENST00000532211;ENST00000280350;ENST00000530641;ENST00000525744|ENST00000525072	T;T;T;T;T;T|.	0.17691|.	2.26;2.26;2.26;2.26;2.26;2.26|.	5.9|5.9	3.06|3.06	0.35304|0.35304	.|.	0.862928|.	0.10731|.	N|.	0.640612|.	T|T	0.56217|0.56217	0.1970|0.1970	M|M	0.77820|0.77820	2.39|2.39	0.09310|0.09310	N|N	1|1	B;B;B|.	0.19445|.	0.036;0.036;0.015|.	B;B;B|.	0.19148|.	0.024;0.024;0.015|.	T|T	0.48007|0.48007	-0.9072|-0.9072	10|5	0.10111|.	T|.	0.7|.	-7.7397|-7.7397	8.5716|8.5716	0.33572|0.33572	0.8021:0.0:0.0755:0.1224|0.8021:0.0:0.0755:0.1224	.|.	153;153;153|.	B4DU48;E9PD82;Q8WWB5|.	.;.;PIHD2_HUMAN|.	L|T	153;153;153;153;153;118|108	ENSP00000434275:F153L;ENSP00000388209:F153L;ENSP00000431841:F153L;ENSP00000280350:F153L;ENSP00000431147:F153L;ENSP00000433297:F118L|.	ENSP00000280350:F153L|.	F|I	-|-	1|2	0|0	PIH1D2|PIH1D2	111447062|111447062	0.952000|0.952000	0.32445|0.32445	0.560000|0.560000	0.28344|0.28344	0.982000|0.982000	0.71751|0.71751	2.125000|2.125000	0.42016|0.42016	0.934000|0.934000	0.37316|0.37316	0.482000|0.482000	0.46254|0.46254	TTT|ATT		0.338	PIH1D2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391916.1	NM_138789	
PIGS	94005	hgsc.bcm.edu	37	17	26883861	26883861	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:26883861C>T	ENST00000308360.7	-	9	1439	c.1064G>A	c.(1063-1065)cGc>cAc	p.R355H	PIGS_ENST00000395346.2_Missense_Mutation_p.R347H|PIGS_ENST00000465444.1_5'Flank|PIGS_ENST00000543734.1_Missense_Mutation_p.R294H	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	355					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.R355H(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					GCCACCCCAGCGGGGACTATG	0.542																																					p.R355H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1064A	17						.						66.0	56.0	59.0					17																	26883861		2203	4300	6503	23907988	SO:0001583	missense	94005	exon9				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1064G>A	17.37:g.26883861C>T	ENSP00000309430:p.Arg355His		23907988	NM_033198	Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	37	CCDS11235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.296818|5.296818	0.95574|0.95574	.|.	.|.	ENSG00000087111|ENSG00000087111	ENST00000268758|ENST00000395346;ENST00000308360;ENST00000543734	.|T;T;T	.|0.45668	.|0.89;0.89;0.89	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68742|0.68742	0.3034|0.3034	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.998	T|T	0.70498|0.70498	-0.4855|-0.4855	6|10	0.54805|0.56958	T|D	0.06|0.05	-16.0365|-16.0365	19.7296|19.7296	0.96177|0.96177	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|355;347	.|Q96S52;Q96S52-2	.|PIGS_HUMAN;.	T|H	98|347;355;294	.|ENSP00000378755:R347H;ENSP00000309430:R355H;ENSP00000438447:R294H	ENSP00000268758:A98T|ENSP00000309430:R355H	A|R	-|-	1|2	0|0	PIGS|PIGS	23907988|23907988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.416000|7.416000	0.80143|0.80143	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.542	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
ACACA	31	hgsc.bcm.edu	37	17	35549096	35549096	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:35549096T>G	ENST00000394406.2	-	37	4430	c.4240A>C	c.(4240-4242)Aca>Cca	p.T1414P	ACACA_ENST00000335166.5_Missense_Mutation_p.T1336P|ACACA_ENST00000353139.5_Missense_Mutation_p.T1451P|ACACA_ENST00000360679.3_Missense_Mutation_p.T1356P	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1414					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.T1356P(1)|p.T1451P(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GTCACTTCTGTGCCCACTTCC	0.483																																					p.T1414P	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4240C	17						.						144.0	112.0	123.0					17																	35549096		2203	4300	6503	32623209	SO:0001583	missense	31	exon41			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4240A>C	17.37:g.35549096T>G	ENSP00000377928:p.Thr1414Pro		32623209	NM_198839	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.338925	0.41398	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.68	5.68	0.88126	Acetyl-CoA carboxylase, central domain (1);	0.048274	0.85682	D	0.000000	T	0.32704	0.0838	L	0.36672	1.1	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.10450	0.003;0.005;0.005;0.003	T	0.10636	-1.0621	10	0.30854	T	0.27	-11.4591	10.7835	0.46393	0.0:0.0746:0.0:0.9254	.	162;1451;1414;1356	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	P	1451;1356;1414;1438;1336;162	ENSP00000344789:T1451P;ENSP00000353898:T1356P;ENSP00000377928:T1414P;ENSP00000335323:T1336P	ENSP00000335323:T1336P	T	-	1	0	ACACA	32623209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.888000	0.48594	2.156000	0.67533	0.528000	0.53228	ACA		0.483	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
KRT28	162605	hgsc.bcm.edu	37	17	38954594	38954594	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:38954594C>T	ENST00000306658.7	-	3	648	c.583G>A	c.(583-585)Gga>Aga	p.G195R		NM_181535.3	NP_853513.2			keratin 28									p.G195R(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				CGCCGTAATCCGTTGATGTCG	0.493																																					p.G195R	Melanoma(19;789 869 15380 26882 39836)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G583A	17						.						101.0	107.0	105.0					17																	38954594		2203	4300	6503	36208120	SO:0001583	missense	162605	exon3			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.583G>A	17.37:g.38954594C>T	ENSP00000305263:p.Gly195Arg		36208120	NM_181535		Missense_Mutation	SNP	ENST00000306658.7	37	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.720578	0.68959	.	.	ENSG00000173908	ENST00000306658	D	0.82984	-1.67	5.32	5.32	0.75619	Filament (1);	0.000000	0.64402	D	0.000008	D	0.92341	0.7570	M	0.87758	2.905	0.51767	D	0.99993	D	0.89917	1.0	D	0.78314	0.991	D	0.93326	0.6697	10	0.87932	D	0	.	18.3458	0.90321	0.0:1.0:0.0:0.0	.	195	Q7Z3Y7	K1C28_HUMAN	R	195	ENSP00000305263:G195R	ENSP00000305263:G195R	G	-	1	0	KRT28	36208120	0.962000	0.33011	0.221000	0.23827	0.381000	0.30169	3.912000	0.56386	2.656000	0.90262	0.561000	0.74099	GGA		0.493	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
SLC35B1	10237	hgsc.bcm.edu	37	17	47785136	47785136	+	Silent	SNP	A	A	G	rs140540859		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:47785136A>G	ENST00000240333.6	-	1	181	c.60T>C	c.(58-60)ggT>ggC	p.G20G	RP11-613C6.2_ENST00000512720.1_RNA|SLC35B1_ENST00000415270.2_Silent_p.G57G			P78383	S35B1_HUMAN	solute carrier family 35, member B1	20					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)	p.G20G(1)		endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						AGACAAAGACACCCAGGAAGC	0.637											OREG0024545	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G20G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T60C	17						.	A		0,4406		0,0,2203	24.0	34.0	30.0		60	0.6	1.0	17	dbSNP_134	30	1,8595		0,1,4297	no	coding-synonymous	SLC35B1	NM_005827.1		0,1,6500	GG,GA,AA		0.0116,0.0,0.0077		20/323	47785136	1,13001	2203	4298	6501	45140135	SO:0001819	synonymous_variant	10237	exon1			D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.60T>C	17.37:g.47785136A>G		949	45140135	NM_005827	B4DEC4|J3KQV4|Q96EW7	Silent	SNP	ENST00000240333.6	37	CCDS11552.1																																																																																				0.637	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365564.2	NM_005827	
TNFSF12	8742	hgsc.bcm.edu	37	17	7460517	7460517	+	Silent	SNP	G	G	C	rs3803798	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:7460517G>C	ENST00000293825.6	+	7	863	c.600G>C	c.(598-600)gcG>gcC	p.A200A	TNFSF13_ENST00000338784.4_5'Flank|TNFSF13_ENST00000349228.4_5'Flank|TNFSF12_ENST00000462811.1_3'UTR|TNFSF12_ENST00000557233.1_Intron|TNFSF13_ENST00000380535.4_5'Flank|TNFSF13_ENST00000396542.1_5'Flank|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF13_ENST00000483039.1_5'Flank|TNFSF13_ENST00000396545.4_5'Flank	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	200					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)	p.A200A(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				CCACTGCGGCGAGTTCCCTCG	0.662													G|||	2742	0.547524	0.4266	0.6167	5008	,	,		13631	0.6458		0.5139	False		,,,				2504	0.5951				p.A200A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G600C	17						.	G	,	1994,2412	559.5+/-380.2	456,1082,665	78.0	62.0	67.0		600,	-7.7	0.0	17	dbSNP_107	67	4514,4086	591.8+/-392.9	1190,2134,976	no	coding-synonymous,intron	TNFSF12,TNFSF12-TNFSF13	NM_003809.2,NM_172089.3	,	1646,3216,1641	CC,CG,GG		47.5116,45.2565,49.9616	,	200/250,	7460517	6508,6498	2203	4300	6503	7401241	SO:0001819	synonymous_variant	8742	exon7			AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.600G>C	17.37:g.7460517G>C			7401241	NM_003809	Q8IZK7|Q8WUZ7	Silent	SNP	ENST00000293825.6	37	CCDS11109.1																																																																																				0.662	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226951.2	NM_003809	
ODF4	146852	hgsc.bcm.edu	37	17	8243389	8243389	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:8243389G>A	ENST00000328248.2	+	1	208	c.20G>A	c.(19-21)gGg>gAg	p.G7E	RP11-849F2.4_ENST00000585275.1_lincRNA|ODF4_ENST00000584943.1_Missense_Mutation_p.G7E	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	7					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)		p.G7E(1)		endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						GAGTACTCTGGGAATGAGTTC	0.507																																					p.G7E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G20A	17						.						68.0	67.0	67.0					17																	8243389		2203	4300	6503	8184114	SO:0001583	missense	146852	exon1			AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.20G>A	17.37:g.8243389G>A	ENSP00000331086:p.Gly7Glu		8184114	NM_153007	Q8J021	Missense_Mutation	SNP	ENST00000328248.2	37	CCDS11140.1	.	.	.	.	.	.	.	.	.	.	G	5.992	0.367025	0.11352	.	.	ENSG00000184650	ENST00000328248	T	0.30714	1.52	4.04	1.99	0.26369	.	0.717152	0.11471	N	0.560811	T	0.20292	0.0488	L	0.29908	0.895	0.09310	N	1	B	0.27732	0.187	B	0.25140	0.058	T	0.23691	-1.0181	10	0.87932	D	0	0.2234	5.0257	0.14383	0.111:0.0:0.6832:0.2059	.	7	Q2M2E3	ODFP4_HUMAN	E	7	ENSP00000331086:G7E	ENSP00000331086:G7E	G	+	2	0	ODF4	8184114	0.004000	0.15560	0.003000	0.11579	0.001000	0.01503	0.638000	0.24674	0.456000	0.26937	-0.140000	0.14226	GGG		0.507	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1		
SPAG9	9043	hgsc.bcm.edu	37	17	49071278	49071278	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:49071278T>C	ENST00000262013.7	-	19	2453	c.2245A>G	c.(2245-2247)Aaa>Gaa	p.K749E	SPAG9_ENST00000505279.1_Missense_Mutation_p.K739E|SPAG9_ENST00000357122.4_Missense_Mutation_p.K735E|SPAG9_ENST00000510283.1_Missense_Mutation_p.K592E	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	749					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.K735E(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TCTTGATTTTTTAACTCCTTC	0.363																																					p.K735E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2203G	17						.						94.0	86.0	88.0					17																	49071278		2203	4300	6503	46426277	SO:0001583	missense	9043	exon18			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.2245A>G	17.37:g.49071278T>C	ENSP00000262013:p.Lys749Glu		46426277	NM_003971	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470783	0.26423	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000357791;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.22336	1.96;1.97;1.96;1.96	5.93	5.93	0.95920	.	0.297276	0.35805	N	0.002970	T	0.08492	0.0211	N	0.02916	-0.46	0.31780	N	0.631048	P;B;B;B;B;B	0.35033	0.481;0.002;0.005;0.001;0.191;0.003	B;B;B;B;B;B	0.36092	0.217;0.023;0.037;0.008;0.095;0.009	T	0.12372	-1.0550	10	0.05525	T	0.97	-15.1997	12.2529	0.54608	0.0:0.0:0.1416:0.8584	.	735;749;739;749;735;592	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	E	749;506;496;286;592;739;735;347	ENSP00000262013:K749E;ENSP00000423165:K592E;ENSP00000426900:K739E;ENSP00000349636:K735E	ENSP00000262013:K749E	K	-	1	0	SPAG9	46426277	0.985000	0.35326	0.997000	0.53966	0.998000	0.95712	1.934000	0.40163	2.263000	0.75096	0.533000	0.62120	AAA		0.363	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19698878	19698878	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr21:19698878C>A	ENST00000284885.3	-	16	1825	c.1792G>T	c.(1792-1794)Ggg>Tgg	p.G598W		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	598	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.G598W(2)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GGGCCAGGCCCTGTGTACACA	0.463																																					p.G598W												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G1792T	21						.						156.0	129.0	138.0					21																	19698878		2203	4300	6503	18620749	SO:0001583	missense	5651	exon16				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1792G>T	21.37:g.19698878C>A	ENSP00000284885:p.Gly598Trp		18620749	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064511	0.76187	.	.	ENSG00000154646	ENST00000284885	T	0.65364	-0.15	5.27	5.27	0.74061	CUB (5);	0.000000	0.85682	D	0.000000	D	0.87466	0.6184	H	0.98525	4.255	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.92136	0.5716	9	.	.	.	.	16.7401	0.85457	0.0:1.0:0.0:0.0	.	598	P98073	ENTK_HUMAN	W	598	ENSP00000284885:G598W	.	G	-	1	0	TMPRSS15	18620749	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	5.518000	0.67068	2.612000	0.88384	0.650000	0.86243	GGG		0.463	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
DNAH3	55567	hgsc.bcm.edu	37	16	21157309	21157309	+	Missense_Mutation	SNP	T	T	A	rs549123743		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:21157309T>A	ENST00000261383.3	-	2	217	c.218A>T	c.(217-219)tAt>tTt	p.Y73F	DNAH3_ENST00000415178.1_Missense_Mutation_p.Y73F|DNAH3_ENST00000575491.1_5'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	73	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.Y73F(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCATACCTGATAGAGTCCAGA	0.552																																					p.Y73F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A218T	16						.						87.0	78.0	81.0					16																	21157309		2201	4300	6501	21064810	SO:0001583	missense	55567	exon2			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.218A>T	16.37:g.21157309T>A	ENSP00000261383:p.Tyr73Phe		21064810	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.528599	0.44969	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.26223	1.75;2.03	5.71	5.71	0.89125	.	0.222765	0.31897	N	0.006899	T	0.23014	0.0556	L	0.36672	1.1	0.32865	D	0.508424	B;P	0.45715	0.006;0.865	B;B	0.44133	0.004;0.442	T	0.21075	-1.0256	10	0.19147	T	0.46	.	12.3631	0.55215	0.0:0.0:0.0:1.0	.	73;44	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	F	73;73;44	ENSP00000261383:Y73F;ENSP00000394245:Y73F	ENSP00000261383:Y73F	Y	-	2	0	DNAH3	21064810	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.980000	0.63812	2.165000	0.68154	0.528000	0.53228	TAT		0.552	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
ZNF500	26048	hgsc.bcm.edu	37	16	4812665	4812665	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:4812665G>A	ENST00000219478.6	-	3	806	c.507C>T	c.(505-507)tcC>tcT	p.S169S	ZNF500_ENST00000545009.1_Silent_p.S169S			O60304	ZN500_HUMAN	zinc finger protein 500	169					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S169S(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CTTCCTCCAGGGACAGATCCT	0.622																																					p.S169S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C507T	16						.						84.0	92.0	90.0					16																	4812665		2197	4300	6497	4752666	SO:0001819	synonymous_variant	26048	exon3			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.507C>T	16.37:g.4812665G>A			4752666	NM_021646	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Silent	SNP	ENST00000219478.6	37	CCDS32383.1																																																																																				0.622	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507	
USP31	57478	hgsc.bcm.edu	37	16	23080107	23080107	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:23080107C>T	ENST00000219689.7	-	16	3318	c.3319G>A	c.(3319-3321)Gtg>Atg	p.V1107M	USP31_ENST00000567975.1_Missense_Mutation_p.V400M	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.V1107M(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GGAGATGACACGGAGTCCTGA	0.587																																					p.V1107M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3319A	16						.						92.0	100.0	97.0					16																	23080107		2197	4300	6497	22987608	SO:0001583	missense	57478	exon16			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.3319G>A	16.37:g.23080107C>T	ENSP00000219689:p.Val1107Met		22987608	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	C	1.497	-0.553032	0.03996	.	.	ENSG00000103404	ENST00000219689	T	0.08282	3.11	6.06	-1.35	0.09114	.	4.081560	0.01245	N	0.008724	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.017;0.008	B;B	0.11329	0.006;0.003	T	0.34976	-0.9807	10	0.42905	T	0.14	2.447	3.2604	0.06846	0.1035:0.3801:0.1016:0.4149	.	1107;400	Q70CQ4;B3KS48	UBP31_HUMAN;.	M	1107	ENSP00000219689:V1107M	ENSP00000219689:V1107M	V	-	1	0	USP31	22987608	0.000000	0.05858	0.000000	0.03702	0.455000	0.32408	-1.839000	0.01686	-0.477000	0.06832	-0.769000	0.03391	GTG		0.587	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
RBL2	5934	hgsc.bcm.edu	37	16	53524129	53524129	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:53524129C>T	ENST00000262133.6	+	22	3474	c.3337C>T	c.(3337-3339)Cct>Tct	p.P1113S	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.P492S	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	1113					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.P1113S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AAGTGAATCACCTGCAAAAAG	0.403																																					p.P1113S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3337T	16						.						95.0	96.0	96.0					16																	53524129		2198	4300	6498	52081630	SO:0001583	missense	5934	exon22			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.3337C>T	16.37:g.53524129C>T	ENSP00000262133:p.Pro1113Ser		52081630	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017791	0.75161	.	.	ENSG00000103479	ENST00000262133;ENST00000379935;ENST00000544545	D;D	0.91407	-2.84;-2.06	5.63	5.63	0.86233	.	0.054356	0.85682	D	0.000000	D	0.90625	0.7060	M	0.78049	2.395	0.26349	N	0.977235	B;P;B	0.35507	0.008;0.506;0.061	B;B;B	0.35114	0.006;0.196;0.018	D	0.86778	0.1977	10	0.66056	D	0.02	-13.1544	15.6269	0.76867	0.138:0.862:0.0:0.0	.	492;823;1113	B7Z913;E9PG04;Q08999	.;.;RBL2_HUMAN	S	1113;823;492	ENSP00000262133:P1113S;ENSP00000444685:P492S	ENSP00000262133:P1113S	P	+	1	0	RBL2	52081630	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.234000	0.51320	2.805000	0.96524	0.655000	0.94253	CCT		0.403	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
IRX6	79190	hgsc.bcm.edu	37	16	55361692	55361692	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:55361692G>A	ENST00000290552.7	+	4	1940	c.608G>A	c.(607-609)cGc>cAc	p.R203H	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	203					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R203H(2)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						GCACGCCGGCGCCTCAAGAAA	0.562																																					p.R203H												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G608A	16						.						85.0	80.0	82.0					16																	55361692		2198	4300	6498	53919193	SO:0001583	missense	79190	exon4			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.608G>A	16.37:g.55361692G>A	ENSP00000290552:p.Arg203His		53919193	NM_024335	B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	37	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	G	36	5.952068	0.97139	.	.	ENSG00000159387	ENST00000290552	D	0.98617	-5.03	5.82	5.82	0.92795	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99510	0.9825	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98258	1.0497	10	0.87932	D	0	-26.186	19.7005	0.96050	0.0:0.0:1.0:0.0	.	203	P78412	IRX6_HUMAN	H	203	ENSP00000290552:R203H	ENSP00000290552:R203H	R	+	2	0	IRX6	53919193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.909000	0.87444	2.757000	0.94681	0.655000	0.94253	CGC		0.562	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
GNAO1	2775	hgsc.bcm.edu	37	16	56309872	56309872	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:56309872A>C	ENST00000262493.6	+	3	1037	c.191A>C	c.(190-192)gAa>gCa	p.E64A	GNAO1_ENST00000262494.7_Missense_Mutation_p.E64A	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	64					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.E64A(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				TTCTCCGGAGAAGACGTGAAA	0.502																																					p.E64A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A191C	16						.						133.0	102.0	112.0					16																	56309872		2198	4300	6498	54867373	SO:0001583	missense	2775	exon3				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.191A>C	16.37:g.56309872A>C	ENSP00000262493:p.Glu64Ala		54867373	NM_020988	P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	37	CCDS10756.1	.	.	.	.	.	.	.	.	.	.	A	18.31	3.595617	0.66219	.	.	ENSG00000087258	ENST00000262493;ENST00000262494	D;D	0.89617	-2.54;-2.54	5.26	5.26	0.73747	G protein alpha subunit, helical insertion (2);	0.050082	0.85682	D	0.000000	D	0.88164	0.6363	M	0.69358	2.11	0.80722	D	1	B;B	0.12630	0.0;0.006	B;B	0.20184	0.028;0.019	D	0.85815	0.1382	10	0.66056	D	0.02	.	14.3895	0.66968	1.0:0.0:0.0:0.0	.	64;64	P09471;P09471-2	GNAO_HUMAN;.	A	64	ENSP00000262493:E64A;ENSP00000262494:E64A	ENSP00000262493:E64A	E	+	2	0	GNAO1	54867373	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.339000	0.96797	1.999000	0.58509	0.460000	0.39030	GAA		0.502	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988	
NRN1L	123904	hgsc.bcm.edu	37	16	67919983	67919983	+	Missense_Mutation	SNP	C	C	T	rs200752015	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr16:67919983C>T	ENST00000339176.3	+	3	418	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000576147.1_Silent_p.P33P	NM_198443.1	NP_940845.1	Q496H8	NRN1L_HUMAN	neuritin 1-like	107					nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R107C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)		CCAGGCCCCCCGTCCGAATAA	0.632													C|||	13	0.00259585	0.0	0.0	5008	,	,		15594	0.0119		0.0	False		,,,				2504	0.001				p.R107C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	16						.						50.0	44.0	46.0					16																	67919983		2198	4299	6497	66477484	SO:0001583	missense	123904	exon3			AY358782	CCDS10850.1	16q22.1	2008-02-05			ENSG00000188038	ENSG00000188038			29811	protein-coding gene	gene with protein product						12975309	Standard	NM_198443		Approved	UNQ2446, MRCC2446	uc002euu.3	Q496H8	OTTHUMG00000137541	ENST00000339176.3:c.319C>T	16.37:g.67919983C>T	ENSP00000342411:p.Arg107Cys		66477484	NM_198443	Q6UWH7	Missense_Mutation	SNP	ENST00000339176.3	37	CCDS10850.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	11.89	1.772983	0.31411	.	.	ENSG00000188038	ENST00000339176	.	.	.	4.86	1.13	0.20643	.	0.289804	0.33834	N	0.004506	T	0.12732	0.0309	N	0.08118	0	0.80722	D	1	B	0.33171	0.4	B	0.16289	0.015	T	0.05068	-1.0908	9	0.51188	T	0.08	.	2.7874	0.05377	0.4916:0.3338:0.0:0.1746	.	107	Q496H8	NRN1L_HUMAN	C	107	.	ENSP00000342411:R107C	R	+	1	0	NRN1L	66477484	0.974000	0.33945	0.863000	0.33907	0.173000	0.22820	2.078000	0.41567	0.534000	0.28695	0.462000	0.41574	CGT		0.632	NRN1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268872.2	NM_198443	
EMILIN2	84034	hgsc.bcm.edu	37	18	2891917	2891917	+	Missense_Mutation	SNP	G	G	A	rs115304890	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr18:2891917G>A	ENST00000254528.3	+	4	1951	c.1792G>A	c.(1792-1794)Gaa>Aaa	p.E598K		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	598					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.E598K(2)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		TCAAGAAACCGAACAAACCAT	0.428													G|||	4	0.000798722	0.003	0.0	5008	,	,		21738	0.0		0.0	False		,,,				2504	0.0				p.E598K												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1792A	18						.						51.0	52.0	51.0					18																	2891917		2203	4300	6503	2881917	SO:0001583	missense	84034	exon4			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1792G>A	18.37:g.2891917G>A	ENSP00000254528:p.Glu598Lys		2881917	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	5.325	0.245237	0.10077	.	.	ENSG00000132205	ENST00000254528	T	0.39406	1.08	5.48	4.59	0.56863	.	0.381299	0.25929	N	0.027395	T	0.22936	0.0554	L	0.48642	1.525	0.09310	N	1	B	0.23377	0.084	B	0.14578	0.011	T	0.21143	-1.0254	10	0.07644	T	0.81	-14.6984	9.6258	0.39750	0.0836:0.1851:0.7313:0.0	.	598	Q9BXX0	EMIL2_HUMAN	K	598	ENSP00000254528:E598K	ENSP00000254528:E598K	E	+	1	0	EMILIN2	2881917	0.596000	0.26866	0.006000	0.13384	0.030000	0.12068	1.147000	0.31602	1.276000	0.44395	0.563000	0.77884	GAA		0.428	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
SMAD4	4089	hgsc.bcm.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H|SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H												SMAD4,small_intestine,duodenum,Substitution - Missense,+1	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	18	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	46845917	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His		46845917	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
RABL3	285282	hgsc.bcm.edu	37	3	120424911	120424911	+	Missense_Mutation	SNP	G	G	A	rs144478835		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:120424911G>A	ENST00000273375.3	-	4	348	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	RABL3_ENST00000491398.1_5'UTR|RABL3_ENST00000483733.1_Missense_Mutation_p.R107C	NM_173825.3	NP_776186.2	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	107	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)	p.R107C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)	17				GBM - Glioblastoma multiforme(114;0.151)		GACCAACGACGCAAGTTTTGG	0.383													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17923	0.0		0.0	False		,,,				2504	0.0				p.R107C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	3						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	112.0	111.0		319	1.6	1.0	3	dbSNP_134	111	0,8600		0,0,4300	no	missense	RABL3	NM_173825.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	107/237	120424911	1,13005	2203	4300	6503	121907601	SO:0001583	missense	285282	exon4			BC020832	CCDS3001.1	3q13.33	2008-02-05			ENSG00000144840	ENSG00000144840			18072	protein-coding gene	gene with protein product						12477932	Standard	NM_173825		Approved	MGC23920	uc003edx.3	Q5HYI8	OTTHUMG00000159668	ENST00000273375.3:c.319C>T	3.37:g.120424911G>A	ENSP00000273375:p.Arg107Cys		121907601	NM_173825	Q8WUD3	Missense_Mutation	SNP	ENST00000273375.3	37	CCDS3001.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717904	0.48622	2.27E-4	0.0	ENSG00000144840	ENST00000273375;ENST00000483733	T;T	0.78126	-1.15;-1.15	5.61	1.59	0.23543	.	0.112676	0.64402	D	0.000007	T	0.68659	0.3025	M	0.65975	2.015	0.35236	D	0.777347	P	0.46395	0.877	B	0.38264	0.269	T	0.69480	-0.5134	10	0.51188	T	0.08	-0.2813	5.4813	0.16725	0.7274:0.0:0.1445:0.1281	.	107	Q5HYI8	RABL3_HUMAN	C	107	ENSP00000273375:R107C;ENSP00000419986:R107C	ENSP00000273375:R107C	R	-	1	0	RABL3	121907601	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	5.842000	0.69417	0.062000	0.16340	-0.290000	0.09829	CGT		0.383	RABL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356776.1	NM_173825	
TGFBR2	7048	hgsc.bcm.edu	37	3	30732980	30732980	+	Silent	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:30732980C>A	ENST00000295754.5	+	7	1975	c.1593C>A	c.(1591-1593)gcC>gcA	p.A531A	TGFBR2_ENST00000359013.4_Silent_p.A556A	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	531	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.A531A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GTCTCACAGCCCAGTGTGTGG	0.587																																					p.A556A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1668A	3						.						76.0	73.0	74.0					3																	30732980		2203	4300	6503	30707984	SO:0001819	synonymous_variant	7048	exon8				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1593C>A	3.37:g.30732980C>A			30707984	NM_001024847	B4DTV5|Q15580|Q6DKT6|Q99474	Silent	SNP	ENST00000295754.5	37	CCDS2648.1																																																																																				0.587	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
SCN10A	6336	hgsc.bcm.edu	37	3	38763831	38763831	+	Missense_Mutation	SNP	C	C	T	rs200584416	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:38763831C>T	ENST00000449082.2	-	19	3424	c.3425G>A	c.(3424-3426)cGc>cAc	p.R1142H		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1142					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1142H(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GCAAGTCTTGCGCACCTGCCA	0.552													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19001	0.001		0.0	False		,,,				2504	0.0				p.R1142H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3425A	3						.						164.0	136.0	145.0					3																	38763831		2203	4300	6503	38738835	SO:0001583	missense	6336	exon19			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3425G>A	3.37:g.38763831C>T	ENSP00000390600:p.Arg1142His		38738835	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	28.2	4.902019	0.92035	.	.	ENSG00000185313	ENST00000449082	D	0.98105	-4.72	4.27	4.27	0.50696	Sodium ion transport-associated (1);	0.000000	0.85682	D	0.000000	D	0.98785	0.9591	M	0.87682	2.9	0.51482	D	0.999925	D	0.89917	1.0	D	0.97110	1.0	D	0.99795	1.1033	10	0.87932	D	0	.	16.8955	0.86099	0.0:1.0:0.0:0.0	.	1142	Q9Y5Y9	SCNAA_HUMAN	H	1142	ENSP00000390600:R1142H	ENSP00000390600:R1142H	R	-	2	0	SCN10A	38738835	1.000000	0.71417	0.999000	0.59377	0.868000	0.49771	7.651000	0.83577	2.221000	0.72209	0.561000	0.74099	CGC		0.552	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
GORASP1	64689	hgsc.bcm.edu	37	3	39142355	39142355	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:39142355A>G	ENST00000319283.3	-	5	1270	c.449T>C	c.(448-450)tTt>tCt	p.F150S	GORASP1_ENST00000422110.2_Intron|GORASP1_ENST00000476334.1_5'Flank|GORASP1_ENST00000479927.1_Missense_Mutation_p.F55S	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	150					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)		p.F150S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GATGAGCGTAAAGAAGTCCTC	0.537											OREG0015486	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F150S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T449C	3						.						133.0	130.0	131.0					3																	39142355		2203	4300	6503	39117359	SO:0001583	missense	64689	exon5			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.449T>C	3.37:g.39142355A>G	ENSP00000313869:p.Phe150Ser	883	39117359	NM_031899	B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	CCDS2681.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.782348	0.70222	.	.	ENSG00000114745	ENST00000319283;ENST00000479927;ENST00000437458	T;T	0.30182	1.54;1.54	5.26	5.26	0.73747	PDZ/DHR/GLGF (1);	0.046783	0.85682	D	0.000000	T	0.46014	0.1371	L	0.46614	1.455	0.58432	D	0.999998	D;P	0.67145	0.996;0.949	D;P	0.75020	0.985;0.885	T	0.44697	-0.9311	10	0.87932	D	0	-18.817	10.4306	0.44405	0.8544:0.0:0.0:0.1455	.	55;150	B4E1H8;Q9BQQ3	.;GORS1_HUMAN	S	150;55;190	ENSP00000313869:F150S;ENSP00000419123:F55S	ENSP00000313869:F150S	F	-	2	0	GORASP1	39117359	1.000000	0.71417	0.897000	0.35233	0.793000	0.44817	4.948000	0.63590	1.991000	0.58162	0.533000	0.62120	TTT		0.537	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1		
ATRIP	84126	hgsc.bcm.edu	37	3	48491483	48491483	+	Silent	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:48491483A>G	ENST00000320211.3	+	2	401	c.288A>G	c.(286-288)aaA>aaG	p.K96K	ATRIP_ENST00000346691.4_Silent_p.K96K|ATRIP_ENST00000412052.1_Silent_p.K3K|ATRIP_ENST00000357105.6_5'UTR	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	96					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K96K(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCATGTCAAAAAATCCTTCAG	0.338								Other conserved DNA damage response genes																													p.K96K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A288G	3						.						123.0	139.0	134.0					3																	48491483		2203	4298	6501	48466487	SO:0001819	synonymous_variant	84126	exon2			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.288A>G	3.37:g.48491483A>G			48466487	NM_032166	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	ENST00000320211.3	37	CCDS2768.1																																																																																				0.338	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
CADM2	253559	hgsc.bcm.edu	37	3	85851258	85851258	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:85851258T>G	ENST00000407528.2	+	2	185	c.123T>G	c.(121-123)atT>atG	p.I41M	CADM2_ENST00000405615.2_Missense_Mutation_p.I43M|CADM2_ENST00000383699.3_Missense_Mutation_p.I50M|CADM2-AS2_ENST00000467225.1_RNA	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	41	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I50M(1)|p.I43M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GAACTGCAATTTTGACCTGCA	0.408																																					p.I41M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T123G	3						.						96.0	81.0	86.0					3																	85851258		2203	4300	6503	85933948	SO:0001583	missense	253559	exon2			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.123T>G	3.37:g.85851258T>G	ENSP00000384575:p.Ile41Met		85933948	NM_001167674	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095454	0.36952	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.65732	-0.17;-0.17;-0.17	5.27	4.11	0.48088	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.048999	0.85682	D	0.000000	T	0.45276	0.1334	L	0.31065	0.9	0.26459	N	0.975486	B;P;P	0.36162	0.002;0.484;0.54	B;B;B	0.37267	0.005;0.102;0.245	T	0.30416	-0.9979	10	0.30854	T	0.27	.	5.2852	0.15698	0.0:0.1527:0.1506:0.6967	.	43;50;41	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	M	50;41;43	ENSP00000373200:I50M;ENSP00000384575:I41M;ENSP00000384193:I43M	ENSP00000373200:I50M	I	+	3	3	CADM2	85933948	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.888000	0.48594	0.957000	0.37930	0.445000	0.29226	ATT		0.408	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
MRPL3	11222	hgsc.bcm.edu	37	3	131217026	131217026	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:131217026A>C	ENST00000264995.3	-	4	612	c.465T>G	c.(463-465)ttT>ttG	p.F155L	MRPL3_ENST00000425847.2_Missense_Mutation_p.F182L|MRPL3_ENST00000506946.1_5'UTR	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	155					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.F155L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TCCTTACACGAAAACGTGATA	0.353																																					p.F155L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T465G	3						.						141.0	127.0	131.0					3																	131217026		2202	4300	6502	132699716	SO:0001583	missense	11222	exon4			X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.465T>G	3.37:g.131217026A>C	ENSP00000264995:p.Phe155Leu		132699716	NM_007208	Q6IBT2	Missense_Mutation	SNP	ENST00000264995.3	37	CCDS3071.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.711|2.711	-0.268859|-0.268859	0.05716|0.05716	.|.	.|.	ENSG00000114686|ENSG00000114686	ENST00000264995;ENST00000425847;ENST00000507669|ENST00000511168	T;T;T|.	0.38722|.	1.12;1.12;1.12|.	4.96|4.96	-2.07|-2.07	0.07276|0.07276	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);|.	0.047533|.	0.85682|.	N|.	0.000000|.	T|T	0.56077|0.56077	0.1961|0.1961	L|L	0.60455|0.60455	1.87|1.87	0.43372|0.43372	D|D	0.995463|0.995463	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.16722|.	0.016;0.011|.	T|T	0.51980|0.51980	-0.8636|-0.8636	10|5	0.19147|.	T|.	0.46|.	-5.4685|-5.4685	7.6584|7.6584	0.28389|0.28389	0.5783:0.1207:0.301:0.0|0.5783:0.1207:0.301:0.0	.|.	182;155|.	E7ETU7;P09001|.	.;RM03_HUMAN|.	L|A	155;182;50|170	ENSP00000264995:F155L;ENSP00000398536:F182L;ENSP00000422419:F50L|.	ENSP00000264995:F155L|.	F|S	-|-	3|1	2|0	MRPL3|MRPL3	132699716|132699716	0.041000|0.041000	0.20044|0.20044	0.011000|0.011000	0.14972|0.14972	0.133000|0.133000	0.20885|0.20885	0.174000|0.174000	0.16743|0.16743	-0.489000|-0.489000	0.06716|0.06716	-0.248000|-0.248000	0.11899|0.11899	TTT|TCG		0.353	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356471.3	NM_007208	
KCNA1	3736	hgsc.bcm.edu	37	12	5021148	5021148	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:5021148G>A	ENST00000382545.3	+	2	1711	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	202					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.V202I(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CACGGGCACCGTCCACCGCAT	0.532																																					p.V202I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G604A	12						.						113.0	91.0	98.0					12																	5021148		2203	4300	6503	4891409	SO:0001583	missense	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.604G>A	12.37:g.5021148G>A	ENSP00000371985:p.Val202Ile		4891409	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	G	0.804	-0.754383	0.03041	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.70749	-0.51	4.86	-7.07	0.01563	.	0.675265	0.14956	N	0.288648	T	0.32346	0.0826	N	0.04669	-0.19	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27806	-1.0063	10	0.19590	T	0.45	.	1.0509	0.01579	0.2377:0.3555:0.1398:0.2671	.	202	Q09470	KCNA1_HUMAN	I	202	ENSP00000371985:V202I	ENSP00000228858:V202I	V	+	1	0	KCNA1	4891409	0.072000	0.21174	0.089000	0.20774	0.323000	0.28346	-0.235000	0.09016	-0.928000	0.03761	0.655000	0.94253	GTC		0.532	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
PDE1B	5153	hgsc.bcm.edu	37	12	54967155	54967155	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:54967155G>A	ENST00000243052.3	+	9	1289	c.853G>A	c.(853-855)Gtg>Atg	p.V285M	PDE1B_ENST00000538346.1_Missense_Mutation_p.V244M|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.V265M	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	285	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.V285M(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ATGTGCCATCGTGTACAATGA	0.517																																					p.V265M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793A	12						.						150.0	135.0	140.0					12																	54967155		2203	4300	6503	53253422	SO:0001583	missense	5153	exon8			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.853G>A	12.37:g.54967155G>A	ENSP00000243052:p.Val285Met		53253422	NM_001165975	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286346	0.59867	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.80994	-1.44;-1.44;-1.44	4.59	2.74	0.32292	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.169245	0.40302	N	0.001138	T	0.50051	0.1593	N	0.01789	-0.72	0.20074	N	0.999931	B;B	0.27286	0.174;0.003	B;B	0.25987	0.065;0.013	T	0.44375	-0.9332	10	0.10377	T	0.69	.	6.6141	0.22766	0.0:0.6811:0.1485:0.1704	.	265;285	Q01064-2;Q01064	.;PDE1B_HUMAN	M	285;244;265	ENSP00000243052:V285M;ENSP00000442559:V244M;ENSP00000448519:V265M	ENSP00000243052:V285M	V	+	1	0	PDE1B	53253422	0.165000	0.22948	1.000000	0.80357	0.619000	0.37552	0.202000	0.17295	0.273000	0.22049	-0.127000	0.14921	GTG		0.517	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
RAB5B	5869	hgsc.bcm.edu	37	12	56384469	56384469	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:56384469A>T	ENST00000360299.5	+	4	540	c.319A>T	c.(319-321)Acc>Tcc	p.T107S	RAB5B_ENST00000448789.2_Intron|RAB5B_ENST00000553116.1_Missense_Mutation_p.T107S	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	107					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)	p.T107S(1)		endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			TTCCTAGGAAACCTTTGCCCG	0.473																																					p.T107S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A319T	12						.						160.0	150.0	153.0					12																	56384469		2203	4300	6503	54670736	SO:0001583	missense	5869	exon4				CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.319A>T	12.37:g.56384469A>T	ENSP00000353444:p.Thr107Ser		54670736	NM_002868	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	37	CCDS8900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.041|4.041	0.005233|0.005233	0.07866|0.07866	.|.	.|.	ENSG00000111540|ENSG00000111540	ENST00000549218|ENST00000553116;ENST00000360299;ENST00000548068	.|T;T;T	.|0.69435	.|-0.4;-0.4;-0.4	4.47|4.47	4.47|4.47	0.54385|0.54385	.|Small GTP-binding protein domain (1);	.|0.000000	.|0.64402	.|D	.|0.000011	T|T	0.33644|0.33644	0.0870|0.0870	N|N	0.01267|0.01267	-0.92|-0.92	0.80722|0.80722	D|D	1|1	.|B;B	.|0.19445	.|0.036;0.023	.|B;B	.|0.23275	.|0.03;0.045	T|T	0.42949|0.42949	-0.9421|-0.9421	5|10	.|0.02654	.|T	.|1	-13.0537|-13.0537	13.1727|13.1727	0.59609|0.59609	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|107;107	.|Q6FI54;P61020	.|.;RAB5B_HUMAN	I|S	26|107	.|ENSP00000450168:T107S;ENSP00000353444:T107S;ENSP00000447895:T107S	.|ENSP00000353444:T107S	N|T	+|+	2|1	0|0	RAB5B|RAB5B	54670736|54670736	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.211000|3.211000	0.51137|0.51137	2.017000|2.017000	0.59298|0.59298	0.383000|0.383000	0.25322|0.25322	AAC|ACC		0.473	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405396.1		
GNB3	2784	hgsc.bcm.edu	37	12	6952161	6952161	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:6952161C>T	ENST00000229264.3	+	5	529	c.124C>T	c.(124-126)Cga>Tga	p.R42*	CDCA3_ENST00000604599.1_5'Flank|GNB3_ENST00000435982.2_Nonsense_Mutation_p.R42*	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3	42					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)	p.R42*(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						GGTGGTGGGACGAGTCCAGAT	0.592																																					p.R42X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C124T	12						.						96.0	77.0	84.0					12																	6952161		2203	4300	6503	6822422	SO:0001587	stop_gained	2784	exon5				CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517	ENST00000229264.3:c.124C>T	12.37:g.6952161C>T	ENSP00000229264:p.Arg42*		6822422	NM_002075	Q96B71|Q9BQC0	Nonsense_Mutation	SNP	ENST00000229264.3	37	CCDS8564.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689799	0.88735	.	.	ENSG00000111664	ENST00000229264;ENST00000541257;ENST00000541978;ENST00000435982;ENST00000537035	.	.	.	5.26	3.32	0.38043	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5687	14.1076	0.65101	0.2873:0.7127:0.0:0.0	.	.	.	.	X	42	.	ENSP00000229264:R42X	R	+	1	2	GNB3	6822422	0.999000	0.42202	0.998000	0.56505	0.964000	0.63967	4.061000	0.57485	1.173000	0.42796	0.491000	0.48974	CGA		0.592	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400006.1	NM_002075	
ATP5B	506	hgsc.bcm.edu	37	12	57033003	57033003	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:57033003T>G	ENST00000262030.3	-	9	1426	c.1376A>C	c.(1375-1377)aAa>aCa	p.K459T	BAZ2A_ENST00000379441.3_5'Flank|ATP5B_ENST00000550162.1_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.K448T|BAZ2A_ENST00000551812.1_5'Flank|BAZ2A_ENST00000179765.5_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	459					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.K459T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACGCTGTATTTTCCGTGCACG	0.483																																					p.K459T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1376C	12						.						146.0	133.0	137.0					12																	57033003		2203	4300	6503	55319270	SO:0001583	missense	506	exon9			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1376A>C	12.37:g.57033003T>G	ENSP00000262030:p.Lys459Thr		55319270	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.951440	0.92660	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104;ENST00000551020	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	5.92	5.92	0.95590	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93344	0.7878	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95929	0.8937	10	0.87932	D	0	-19.0085	15.3986	0.74818	0.0:0.0:0.0:1.0	.	459	P06576	ATPB_HUMAN	T	459;448;162;274	ENSP00000262030:K459T;ENSP00000450297:K448T;ENSP00000450233:K162T;ENSP00000446677:K274T	ENSP00000262030:K459T	K	-	2	0	ATP5B	55319270	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.872000	0.87187	2.278000	0.76064	0.524000	0.50904	AAA		0.483	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
CDK17	5128	hgsc.bcm.edu	37	12	96728610	96728610	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:96728610T>C	ENST00000261211.3	-	2	608	c.5A>G	c.(4-6)aAa>aGa	p.K2R	CDK17_ENST00000543119.2_Missense_Mutation_p.K2R|CDK17_ENST00000542666.1_Intron	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	2					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.K2R(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						CTTAAATTTTTTCATCCTATC	0.338																																					p.K2R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5G	12						.						83.0	81.0	82.0					12																	96728610		2203	4300	6503	95252741	SO:0001583	missense	5128	exon2				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.5A>G	12.37:g.96728610T>C	ENSP00000261211:p.Lys2Arg		95252741	NM_002595	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552310	0.65311	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000551816;ENST00000552496;ENST00000548734;ENST00000552262	T;T;T;T;T	0.73152	-0.69;-0.72;0.43;0.4;0.4	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	L	0.47190	1.495	0.80722	D	1	B;B	0.20164	0.024;0.042	B;B	0.19666	0.026;0.025	T	0.64343	-0.6430	10	0.59425	D	0.04	-21.144	15.8513	0.78934	0.0:0.0:0.0:1.0	.	2;2	A8K1U6;Q00537	.;CDK17_HUMAN	R	2;2;2;2;22;2	ENSP00000261211:K2R;ENSP00000444459:K2R;ENSP00000450058:K2R;ENSP00000447282:K2R;ENSP00000447441:K22R	ENSP00000261211:K2R	K	-	2	0	CDK17	95252741	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.339000	0.79282	2.152000	0.67230	0.533000	0.62120	AAA		0.338	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595	
ATP10A	57194	hgsc.bcm.edu	37	15	25926204	25926204	+	Silent	SNP	C	C	G	rs2076741	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr15:25926204C>G	ENST00000356865.6	-	18	3621	c.3510G>C	c.(3508-3510)acG>acC	p.T1170T		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1170					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T1170T(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TAAACCAGAACGTTCGTGGCC	0.478													C|||	640	0.127796	0.0582	0.0461	5008	,	,		18394	0.1687		0.0994	False		,,,				2504	0.2669				p.T1170T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3510C	15						.	C		309,4097	168.0+/-198.9	16,277,1910	78.0	75.0	76.0		3510	-9.7	0.0	15	dbSNP_96	76	835,7765	191.4+/-237.6	36,763,3501	no	coding-synonymous	ATP10A	NM_024490.3		52,1040,5411	GG,GC,CC		9.7093,7.0132,8.7959		1170/1500	25926204	1144,11862	2203	4300	6503	23477297	SO:0001819	synonymous_variant	57194	exon18			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3510G>C	15.37:g.25926204C>G			23477297	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				0.478	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
BMF	90427	hgsc.bcm.edu	37	15	40398219	40398219	+	Silent	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr15:40398219C>A	ENST00000354670.4	-	3	303	c.69G>T	c.(67-69)gtG>gtT	p.V23V	BMF_ENST00000431415.3_Silent_p.V23V|BMF_ENST00000220446.4_Silent_p.V23V|BMF_ENST00000559701.1_Silent_p.V23V|BMF_ENST00000397573.1_Silent_p.V23V|BMF_ENST00000558057.1_5'Flank|BMF_ENST00000561282.1_Silent_p.V23V|BMF_ENST00000561360.1_Silent_p.V23V|BMF_ENST00000558774.1_Silent_p.V23V	NM_001003940.1	NP_001003940.1	Q96LC9	BMF_HUMAN	Bcl2 modifying factor	23					anoikis (GO:0043276)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)		p.V23V(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	6		all_cancers(109;4.18e-18)|all_epithelial(112;6.15e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0516)		CGGGTTGGGTCACCGGCTCCC	0.612																																					p.V23V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G69T	15						.						77.0	87.0	84.0					15																	40398219		2203	4300	6503	38185511	SO:0001819	synonymous_variant	90427	exon3			BC060783	CCDS10052.1, CCDS32196.1, CCDS45223.1	15q14	2014-03-07			ENSG00000104081	ENSG00000104081			24132	protein-coding gene	gene with protein product		606266				11546872	Standard	NM_001003943		Approved	FLJ00065	uc001zkw.4	Q96LC9	OTTHUMG00000129875	ENST00000354670.4:c.69G>T	15.37:g.40398219C>A			38185511	NM_001003940	Q2M396|Q6NT30|Q6NT56|Q6P9F6|Q7Z7D4|Q7Z7D5|Q9H7K7	Silent	SNP	ENST00000354670.4	37	CCDS10052.1																																																																																				0.612	BMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252119.1	NM_033503	
IGDCC4	57722	hgsc.bcm.edu	37	15	65687480	65687480	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr15:65687480C>A	ENST00000352385.2	-	8	1737	c.1528G>T	c.(1528-1530)Gga>Tga	p.G510*		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	510	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G510*(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CGGCTGGCTCCCAGCTGGGAG	0.562																																					p.G510X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1528T	15						.						69.0	68.0	68.0					15																	65687480		2201	4299	6500	63474533	SO:0001587	stop_gained	57722	exon8				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1528G>T	15.37:g.65687480C>A	ENSP00000319623:p.Gly510*		63474533	NM_020962	Q9HCE4	Nonsense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	C	42	9.306136	0.99132	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.3271	19.6981	0.96039	0.0:1.0:0.0:0.0	.	.	.	.	X	510;239	.	ENSP00000319623:G510X	G	-	1	0	IGDCC4	63474533	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.818000	0.86416	2.659000	0.90383	0.563000	0.77884	GGA		0.562	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
IREB2	3658	hgsc.bcm.edu	37	15	78732216	78732216	+	Silent	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr15:78732216C>T	ENST00000258886.8	+	2	248	c.99C>T	c.(97-99)acC>acT	p.T33T	IREB2_ENST00000560440.1_Silent_p.T33T	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	33					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)	p.T33T(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		AACTTGGCACCAAGTATGGTA	0.303																																					p.T33T	NSCLC(200;764 2208 35157 49871 50830)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C99T	15						.						144.0	120.0	128.0					15																	78732216		2196	4293	6489	76519271	SO:0001819	synonymous_variant	3658	exon2			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.99C>T	15.37:g.78732216C>T			76519271	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Silent	SNP	ENST00000258886.8	37	CCDS10302.1																																																																																				0.303	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
ALDH1A3	220	hgsc.bcm.edu	37	15	101440788	101440788	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr15:101440788G>T	ENST00000329841.5	+	9	1424	c.892G>T	c.(892-894)Gca>Tca	p.A298S	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.A191S|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	298					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)	p.A298S(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	AGTGGACTTGGCAGTGGAGTG	0.572																																					p.A298S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G892T	15						.						45.0	36.0	39.0					15																	101440788		2200	4298	6498	99258311	SO:0001583	missense	220	exon9			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.892G>T	15.37:g.101440788G>T	ENSP00000332256:p.Ala298Ser		99258311	NM_000693	Q6NT64	Missense_Mutation	SNP	ENST00000329841.5	37	CCDS10389.1	.	.	.	.	.	.	.	.	.	.	G	35	5.454460	0.96223	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	D	0.82433	-1.61	5.57	5.57	0.84162	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	H	0.98612	4.28	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.91635	0.999;0.999	D	0.96604	0.9447	10	0.62326	D	0.03	.	19.556	0.95347	0.0:0.0:1.0:0.0	.	202;298	Q7Z3A2;P47895	.;AL1A3_HUMAN	S	298;202	ENSP00000332256:A298S	ENSP00000332256:A298S	A	+	1	0	ALDH1A3	99258311	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.246000	0.95438	2.602000	0.87976	0.563000	0.77884	GCA		0.572	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		
GLUD2	2747	hgsc.bcm.edu	37	X	120183120	120183120	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:120183120T>C	ENST00000328078.1	+	1	1659	c.1582T>C	c.(1582-1584)Tat>Cat	p.Y528H		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	528					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.Y528H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGCCATGAAGTATAACCTGGG	0.458																																					p.Y528H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1582C	X						.						173.0	133.0	147.0					X																	120183120		2203	4300	6503	120010801	SO:0001583	missense	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1582T>C	X.37:g.120183120T>C	ENSP00000327589:p.Tyr528His		120010801	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	T	12.34	1.909169	0.33721	.	.	ENSG00000182890	ENST00000328078	D	0.96716	-4.1	1.51	1.51	0.23008	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93080	0.7797	L	0.60957	1.885	0.80722	D	1	B	0.17465	0.022	B	0.20184	0.028	D	0.88612	0.3157	10	0.42905	T	0.14	.	6.734	0.23399	0.0:0.0:0.0:1.0	.	528	P49448	DHE4_HUMAN	H	528	ENSP00000327589:Y528H	ENSP00000327589:Y528H	Y	+	1	0	GLUD2	120010801	1.000000	0.71417	0.175000	0.22980	0.460000	0.32559	5.476000	0.66793	0.887000	0.36136	0.336000	0.21669	TAT		0.458	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
CNKSR2	22866	hgsc.bcm.edu	37	X	21393036	21393036	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:21393036G>A	ENST00000379510.3	+	1	57	c.21G>A	c.(19-21)ccG>ccA	p.P7P	CNKSR2_ENST00000543067.1_Silent_p.P7P|CNKSR2_ENST00000425654.2_Silent_p.P7P|CNKSR2_ENST00000279451.4_Silent_p.P7P	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	7					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.P7>?(1)|p.P7P(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TAATGGAACCGGTGAGCAAAT	0.622																																					p.P7P												.	.	2	Substitution - coding silent(1)|Complex(1)	large_intestine(1)|lung(1)	c.G21A	X						.						96.0	74.0	81.0					X																	21393036		2203	4300	6503	21302957	SO:0001819	synonymous_variant	22866	exon1			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.21G>A	X.37:g.21393036G>A			21302957	NM_001168648	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	37	CCDS14198.1																																																																																				0.622	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
DCAF8L1	139425	hgsc.bcm.edu	37	X	27997962	27997962	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:27997962G>A	ENST00000441525.1	-	1	1604	c.1490C>T	c.(1489-1491)gCg>gTg	p.A497V		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	497								p.A497V(1)|p.A497G(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GCCACTGGTCGCCAACACAGG	0.483																																					p.A497V												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1490T	X						.						85.0	78.0	80.0					X																	27997962		2202	4300	6502	27907883	SO:0001583	missense	139425	exon1				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1490C>T	X.37:g.27997962G>A	ENSP00000405222:p.Ala497Val		27907883	NM_001017930	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024113	0.35701	.	.	ENSG00000226372	ENST00000441525	T	0.66280	-0.2	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	M	0.73598	2.24	0.37721	D	0.924901	D	0.54964	0.969	P	0.51297	0.665	T	0.73023	-0.4113	9	0.49607	T	0.09	-11.7171	.	.	.	.	497	A6NGE4	DC8L1_HUMAN	V	497	ENSP00000405222:A497V	ENSP00000405222:A497V	A	-	2	0	DCAF8L1	27907883	0.998000	0.40836	0.087000	0.20705	0.038000	0.13279	1.941000	0.40233	0.691000	0.31592	0.284000	0.19432	GCG		0.483	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
SMC1A	8243	hgsc.bcm.edu	37	X	53436389	53436389	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:53436389G>A	ENST00000322213.4	-	8	1427	c.1300C>T	c.(1300-1302)Cgg>Tgg	p.R434W	SMC1A_ENST00000375340.6_Missense_Mutation_p.R200W	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	434					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R434W(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TTCTCAATCCGCTTCTGATTC	0.488																																					p.R434W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1300T	X						.						253.0	177.0	203.0					X																	53436389		2203	4300	6503	53453114	SO:0001583	missense	8243	exon8			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1300C>T	X.37:g.53436389G>A	ENSP00000323421:p.Arg434Trp		53453114	NM_006306	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247977	0.80024	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	T;T	0.79352	-1.26;3.23	4.97	4.04	0.47022	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.89705	0.6792	M	0.93678	3.445	0.80722	D	1	D;D;D	0.89917	0.99;1.0;1.0	B;D;D	0.91635	0.242;0.999;0.999	D	0.91304	0.5069	10	0.87932	D	0	.	10.764	0.46281	0.0:0.0:0.687:0.3129	.	200;412;434	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	W	434;200	ENSP00000323421:R434W;ENSP00000364489:R200W	ENSP00000323421:R434W	R	-	1	2	SMC1A	53453114	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.318000	0.72866	2.209000	0.71365	0.600000	0.82982	CGG		0.488	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
CYLC1	1538	hgsc.bcm.edu	37	X	83128982	83128982	+	Silent	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:83128982A>G	ENST00000329312.4	+	4	1303	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	422					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E421E(3)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGAAAGATGAAAAAAAGGATA	0.338																																					p.E422E												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.A1266G	X						.						20.0	16.0	17.0					X																	83128982		2186	4262	6448	83015638	SO:0001819	synonymous_variant	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1266A>G	X.37:g.83128982A>G			83015638	NM_021118	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																				0.338	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
SLC9A6	10479	hgsc.bcm.edu	37	X	135126869	135126869	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chrX:135126869C>T	ENST00000370698.3	+	16	2031	c.1996C>T	c.(1996-1998)Cat>Tat	p.H666Y	SLC9A6_ENST00000370695.4_Missense_Mutation_p.H698Y|SLC9A6_ENST00000370701.1_Missense_Mutation_p.H646Y	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	666					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.H666Y(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TAATACGAGACATGGTCCAGC	0.413																																					p.H646Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1936T	X						.						71.0	64.0	66.0					X																	135126869		2203	4300	6503	134954535	SO:0001583	missense	10479	exon17			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1996C>T	X.37:g.135126869C>T	ENSP00000359732:p.His666Tyr		134954535	NM_001177651	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417691	0.42918	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.55234	0.55;0.54;0.53	5.48	5.48	0.80851	.	0.074710	0.56097	D	0.000028	T	0.44891	0.1315	L	0.36672	1.1	0.42499	D	0.992927	P;B	0.37015	0.578;0.442	B;B	0.32465	0.146;0.069	T	0.51576	-0.8688	10	0.72032	D	0.01	.	17.4622	0.87622	0.0:1.0:0.0:0.0	.	698;666	Q92581-2;Q92581	.;SL9A6_HUMAN	Y	646;666;698	ENSP00000359735:H646Y;ENSP00000359732:H666Y;ENSP00000359729:H698Y	ENSP00000359729:H698Y	H	+	1	0	SLC9A6	134954535	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.317000	0.65822	2.425000	0.82216	0.600000	0.82982	CAT		0.413	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
FAT4	79633	hgsc.bcm.edu	37	4	126373382	126373382	+	Silent	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:126373382C>T	ENST00000394329.3	+	9	11224	c.11211C>T	c.(11209-11211)gcC>gcT	p.A3737A	FAT4_ENST00000335110.5_Silent_p.A2035A	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3737					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A3737A(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TACGCATTGCCAGCTCACAGC	0.443																																					p.A3737A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C11211T	4						.						137.0	132.0	134.0					4																	126373382		2203	4300	6503	126592832	SO:0001819	synonymous_variant	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11211C>T	4.37:g.126373382C>T			126592832	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				0.443	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
SETD7	80854	hgsc.bcm.edu	37	4	140439085	140439085	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:140439085C>A	ENST00000274031.3	-	7	1510	c.874G>T	c.(874-876)Gga>Tga	p.G292*	SETD7_ENST00000506866.2_Nonsense_Mutation_p.G292*	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	292	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)	p.G292*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					GCCTTGTGTCCCAAGGAGGCA	0.522																																					p.G292X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G874T	4						.						225.0	192.0	203.0					4																	140439085		2203	4300	6503	140658535	SO:0001587	stop_gained	80854	exon7			AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.874G>T	4.37:g.140439085C>A	ENSP00000274031:p.Gly292*		140658535	NM_030648	B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Nonsense_Mutation	SNP	ENST00000274031.3	37	CCDS3748.1	.	.	.	.	.	.	.	.	.	.	C	39	7.293100	0.98192	.	.	ENSG00000145391	ENST00000506866;ENST00000274031	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.4871	19.1087	0.93309	0.0:1.0:0.0:0.0	.	.	.	.	X	292	.	ENSP00000274031:G292X	G	-	1	0	SETD7	140658535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.607000	0.82883	2.546000	0.85860	0.555000	0.69702	GGA		0.522	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257236.1	NM_030648	
ARFIP1	27236	hgsc.bcm.edu	37	4	153791960	153791960	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:153791960T>A	ENST00000451320.2	+	4	422	c.258T>A	c.(256-258)agT>agA	p.S86R	ARFIP1_ENST00000511289.1_3'UTR|ARFIP1_ENST00000353617.2_Missense_Mutation_p.S86R|ARFIP1_ENST00000405727.2_Intron|ARFIP1_ENST00000429148.2_Intron|ARFIP1_ENST00000356064.3_Intron			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	86					intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.S86R(2)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TTGCAGCTAGTCGACTGGCTC	0.448																																					p.S86R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T258A	4						.						118.0	104.0	109.0					4																	153791960		2203	4300	6503	154011410	SO:0001583	missense	27236	exon4			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.258T>A	4.37:g.153791960T>A	ENSP00000395083:p.Ser86Arg		154011410	NM_001025595	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347424	0.61183	.	.	ENSG00000164144	ENST00000451320;ENST00000353617	T;T	0.79033	-1.23;-1.23	6.04	0.945	0.19543	.	0.045183	0.85682	D	0.000000	T	0.66277	0.2773	L	0.31664	0.95	0.48975	D	0.999732	D	0.56968	0.978	P	0.45998	0.5	T	0.62909	-0.6754	10	0.51188	T	0.08	-10.3948	8.3692	0.32404	0.0:0.6027:0.0:0.3973	.	86	P53367	ARFP1_HUMAN	R	86	ENSP00000395083:S86R;ENSP00000296557:S86R	ENSP00000296557:S86R	S	+	3	2	ARFIP1	154011410	0.988000	0.35896	0.811000	0.32455	0.997000	0.91878	0.195000	0.17155	0.172000	0.19760	0.460000	0.39030	AGT		0.448	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
SLC34A2	10568	hgsc.bcm.edu	37	4	25678090	25678090	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:25678090C>T	ENST00000382051.3	+	13	1842	c.1792C>T	c.(1792-1794)Cgc>Tgc	p.R598C	SLC34A2_ENST00000504570.1_Missense_Mutation_p.R597C|SLC34A2_ENST00000503434.1_Missense_Mutation_p.R597C	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	598					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.R598C(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCTGTGGATGCGCTCGCTGAA	0.632			T	ROS1	NSCLC																																p.R597C			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1789T	4						.						74.0	74.0	74.0					4																	25678090		2203	4300	6503	25287188	SO:0001583	missense	10568	exon13			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1792C>T	4.37:g.25678090C>T	ENSP00000371483:p.Arg598Cys		25287188	NM_001177998	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778180	0.70107	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	T;T;T	0.26810	1.71;1.71;1.71	5.18	5.18	0.71444	.	0.367222	0.33327	N	0.005036	T	0.48909	0.1526	M	0.71036	2.16	0.50632	D	0.999884	D;D	0.76494	0.999;0.997	P;P	0.59424	0.857;0.724	T	0.52079	-0.8623	10	0.87932	D	0	-7.0509	19.0623	0.93097	0.0:1.0:0.0:0.0	.	597;598	O95436-2;O95436	.;NPT2B_HUMAN	C	597;598;597	ENSP00000425501:R597C;ENSP00000371483:R598C;ENSP00000423021:R597C	ENSP00000371483:R598C	R	+	1	0	SLC34A2	25287188	1.000000	0.71417	0.994000	0.49952	0.178000	0.23041	7.776000	0.85560	2.584000	0.87258	0.561000	0.74099	CGC		0.632	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
UBA6	55236	hgsc.bcm.edu	37	4	68490812	68490812	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:68490812T>G	ENST00000322244.5	-	29	2671	c.2612A>C	c.(2611-2613)aAa>aCa	p.K871T		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	871					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.K871T(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						GCTGTACATTTTGGCACGAAG	0.403																																					p.K871T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2612C	4						.						154.0	141.0	146.0					4																	68490812		2203	4300	6503	68173407	SO:0001583	missense	55236	exon29			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2612A>C	4.37:g.68490812T>G	ENSP00000313454:p.Lys871Thr		68173407	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.852792	0.32699	.	.	ENSG00000033178	ENST00000322244	T	0.42900	0.96	5.52	2.99	0.34606	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.141939	0.64402	D	0.000006	T	0.12646	0.0307	N	0.01134	-0.995	0.80722	D	1	B	0.13594	0.008	B	0.10450	0.005	T	0.04621	-1.0938	10	0.19590	T	0.45	-9.3486	5.3987	0.16283	0.0:0.1525:0.148:0.6995	.	871	A0AVT1	UBA6_HUMAN	T	871	ENSP00000313454:K871T	ENSP00000313454:K871T	K	-	2	0	UBA6	68173407	0.996000	0.38824	1.000000	0.80357	0.980000	0.70556	0.667000	0.25112	0.921000	0.36994	0.533000	0.62120	AAA		0.403	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
ADAMTS3	9508	hgsc.bcm.edu	37	4	73176816	73176816	+	Silent	SNP	C	C	T	rs143790784	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:73176816C>T	ENST00000286657.4	-	14	2040	c.2004G>A	c.(2002-2004)acG>acA	p.T668T		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	668	Cys-rich.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T668T(3)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAGAACAGTGCGTTCCATCAT	0.433													C|||	7	0.00139776	0.0	0.0086	5008	,	,		15497	0.0		0.0	False		,,,				2504	0.001				p.T668T	NSCLC(168;1941 2048 2918 13048 43078)											.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G2004A	4						.	C		1,4405	2.1+/-5.4	0,1,2202	236.0	182.0	200.0		2004	-11.4	0.0	4	dbSNP_134	200	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ADAMTS3	NM_014243.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		668/1206	73176816	3,13003	2203	4300	6503	73395680	SO:0001819	synonymous_variant	9508	exon14			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2004G>A	4.37:g.73176816C>T			73395680	NM_014243	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																				0.433	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
HAND2	9464	hgsc.bcm.edu	37	4	174450074	174450074	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr4:174450074G>A	ENST00000359562.4	-	1	1306	c.367C>T	c.(367-369)Cgc>Tgc	p.R123C	HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000505817.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	123	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R123C(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		ATGCACTCGCGCAGTTCGGCG	0.677																																					p.R123C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C367T	4						.						146.0	139.0	141.0					4																	174450074		2203	4300	6503	174686649	SO:0001583	missense	9464	exon1			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.367C>T	4.37:g.174450074G>A	ENSP00000352565:p.Arg123Cys		174686649	NM_021973	B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	ENST00000359562.4	37	CCDS3819.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338911	0.60963	.	.	ENSG00000164107	ENST00000359562;ENST00000393686;ENST00000535864	D	0.98747	-5.11	4.51	4.51	0.55191	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99405	0.9790	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98308	1.0522	10	0.87932	D	0	-17.7739	13.9933	0.64380	0.0:0.0:0.8484:0.1516	.	123;123	B6ECG9;P61296	.;HAND2_HUMAN	C	123;92;71	ENSP00000352565:R123C	ENSP00000352565:R123C	R	-	1	0	HAND2	174686649	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.371000	0.52379	2.326000	0.78906	0.561000	0.74099	CGC		0.677	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
SAP130	79595	hgsc.bcm.edu	37	2	128750799	128750799	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:128750799G>A	ENST00000259235.3	-	12	1646	c.1517C>T	c.(1516-1518)cCa>cTa	p.P506L	SAP130_ENST00000259234.6_Missense_Mutation_p.P480L|SAP130_ENST00000357702.5_Missense_Mutation_p.P506L	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	506					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.P506L(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ACTGGTGATTGGGGTGTAGGT	0.453																																					p.P506L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1517T	2						.						151.0	141.0	144.0					2																	128750799		2203	4300	6503	128467269	SO:0001583	missense	79595	exon12			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1517C>T	2.37:g.128750799G>A	ENSP00000259235:p.Pro506Leu		128467269	NM_024545	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739742	0.69304	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.55	4.67	0.58626	.	0.047245	0.85682	N	0.000000	T	0.66376	0.2783	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.991;0.998	T	0.69789	-0.5050	9	0.72032	D	0.01	-8.2733	14.2444	0.65978	0.0713:0.0:0.9287:0.0	.	506;479;506;36;144	B7ZLM3;Q96DP1;Q9H0E3;Q9H0E3-2;B3KRT9	.;.;SP130_HUMAN;.;.	L	506;506;480	.	ENSP00000259234:P480L	P	-	2	0	SAP130	128467269	1.000000	0.71417	0.994000	0.49952	0.891000	0.51852	9.036000	0.93758	1.345000	0.45676	0.655000	0.94253	CCA		0.453	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
UPP2	151531	hgsc.bcm.edu	37	2	158980295	158980295	+	Silent	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:158980295T>C	ENST00000005756.4	+	6	893	c.699T>C	c.(697-699)ttT>ttC	p.F233F	UPP2_ENST00000605860.1_Silent_p.F290F|UPP2_ENST00000409859.4_Silent_p.F290F|UPP2_ENST00000460456.1_3'UTR	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	233					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.F233F(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	TGTGCTCCTTTTCCAGAGAAA	0.468																																					p.F233F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T699C	2						.						87.0	87.0	87.0					2																	158980295		2203	4300	6503	158688541	SO:0001819	synonymous_variant	151531	exon6			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.699T>C	2.37:g.158980295T>C			158688541	NM_173355	B3KV87	Silent	SNP	ENST00000005756.4	37	CCDS2207.1																																																																																				0.468	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355	
TTN	7273	hgsc.bcm.edu	37	2	179631233	179631233	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:179631233C>T	ENST00000591111.1	-	41	9802	c.9578G>A	c.(9577-9579)cGa>cAa	p.R3193Q	TTN_ENST00000360870.5_Missense_Mutation_p.R3193Q|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R3147Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R3147Q|TTN_ENST00000460472.2_Missense_Mutation_p.R3147Q|TTN_ENST00000589042.1_Missense_Mutation_p.R3193Q|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R3193Q			Q8WZ42	TITIN_HUMAN	titin	13523					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R3147Q(6)|p.R3193Q(4)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTTGTGTCGTTCTTGAAC	0.428																																					p.R3147Q												.	.	10	Substitution - Missense(10)	large_intestine(10)	c.G9440A	2						.						158.0	145.0	149.0					2																	179631233		2203	4300	6503	179339478	SO:0001583	missense	7273	exon40			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9578G>A	2.37:g.179631233C>T	ENSP00000465570:p.Arg3193Gln		179339478	NM_133437	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	17.20	3.328582	0.60743	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	5.7	5.7	0.88788	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83326	0.5230	M	0.79258	2.445	0.33558	D	0.596937	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999	D	0.87476	0.2417	9	0.87932	D	0	.	19.8277	0.96624	0.0:1.0:0.0:0.0	.	3147;3147;3147;3193;3193	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Q	3193;3147;3147;3147;3147;3193	ENSP00000343764:R3193Q;ENSP00000434586:R3147Q;ENSP00000340554:R3147Q;ENSP00000352154:R3147Q;ENSP00000354117:R3193Q	ENSP00000340554:R3147Q	R	-	2	0	TTN	179339478	1.000000	0.71417	0.997000	0.53966	0.520000	0.34377	7.487000	0.81328	2.695000	0.91970	0.591000	0.81541	CGA		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ALS2CR11	151254	hgsc.bcm.edu	37	2	202412319	202412319	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:202412319T>C	ENST00000286195.3	-	10	1036	c.992A>G	c.(991-993)aAa>aGa	p.K331R	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.K331R|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.K331R|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.K331R	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	331								p.K331R(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						ATATTCTTTTTTCATCTTTTC	0.294																																					p.K331R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A992G	2						.						61.0	62.0	62.0					2																	202412319		2175	4260	6435	202120564	SO:0001583	missense	151254	exon10			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.992A>G	2.37:g.202412319T>C	ENSP00000286195:p.Lys331Arg		202120564	NM_001168221	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	37	CCDS2349.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566555	0.65651	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.82	3.66	0.41972	.	0.387436	0.24710	N	0.036240	T	0.49081	0.1536	M	0.63843	1.955	0.27374	N	0.95559	D;P;D	0.54601	0.964;0.954;0.967	P;P;P	0.55011	0.728;0.766;0.725	T	0.38499	-0.9658	10	0.40728	T	0.16	.	7.1866	0.25803	0.0:0.1008:0.0:0.8992	.	331;331;331	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	R	331	ENSP00000286195:K331R;ENSP00000400672:K331R;ENSP00000409937:K331R;ENSP00000399016:K331R	ENSP00000286195:K331R	K	-	2	0	ALS2CR11	202120564	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.978000	0.40598	0.958000	0.37956	0.460000	0.39030	AAA		0.294	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
TMEM169	92691	hgsc.bcm.edu	37	2	216960884	216960884	+	Silent	SNP	C	C	T	rs148746587	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:216960884C>T	ENST00000295658.4	+	2	405	c.198C>T	c.(196-198)ccC>ccT	p.P66P	TMEM169_ENST00000437356.2_Silent_p.P66P|TMEM169_ENST00000454545.1_Silent_p.P66P|TMEM169_ENST00000406027.2_Silent_p.P66P	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	66						integral component of membrane (GO:0016021)		p.P66P(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATGAGGAGCCCGGAGAATCAG	0.478													c|||	7	0.00139776	0.0053	0.0	5008	,	,		19641	0.0		0.0	False		,,,				2504	0.0				p.P66P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C198T	2						.	T	,,,	7,4399	12.9+/-30.5	0,7,2196	89.0	87.0	88.0		198,198,198,198	-8.6	0.0	2	dbSNP_134	88	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TMEM169	NM_001142310.1,NM_001142311.1,NM_001142312.1,NM_138390.3	,,,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,,,	66/298,66/298,66/298,66/298	216960884	7,12999	2203	4300	6503	216669129	SO:0001819	synonymous_variant	92691	exon2			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.198C>T	2.37:g.216960884C>T			216669129	NM_001142312	B2R8W6	Silent	SNP	ENST00000295658.4	37	CCDS2401.1																																																																																				0.478	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390	
ADD2	119	hgsc.bcm.edu	37	2	70890768	70890768	+	Missense_Mutation	SNP	G	G	A	rs371492015		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:70890768G>A	ENST00000264436.4	-	16	2414	c.1970C>T	c.(1969-1971)aCg>aTg	p.T657M	ADD2_ENST00000355733.3_3'UTR|ADD2_ENST00000407644.2_Missense_Mutation_p.T657M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	657					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.T657M(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						TTCCTCTGCCGTCTGCTCCTC	0.572																																					p.T657M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1970T	2						.	G	MET/THR,MET/THR,	0,4406		0,0,2203	159.0	134.0	142.0		1970,1970,	4.5	0.8	2		142	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,utr-3	ADD2	NM_001185054.1,NM_001617.3,NM_017488.3	81,81,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,	657/727,657/727,	70890768	1,13005	2203	4300	6503	70744276	SO:0001583	missense	119	exon16			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1970C>T	2.37:g.70890768G>A	ENSP00000264436:p.Thr657Met		70744276	NM_001185054	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554912	0.27739	0.0	1.16E-4	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320	T;T	0.47177	0.85;0.85	5.43	4.53	0.55603	.	0.960839	0.08665	N	0.911763	T	0.34571	0.0902	N	0.08118	0	0.80722	D	1	D;D	0.59767	0.964;0.986	B;B	0.43623	0.425;0.425	T	0.22173	-1.0224	10	0.66056	D	0.02	-15.3815	13.9247	0.63955	0.0:0.1595:0.8405:0.0	.	657;657	Q05DK5;P35612	.;ADDB_HUMAN	M	657;657;408	ENSP00000264436:T657M;ENSP00000384677:T657M	ENSP00000264436:T657M	T	-	2	0	ADD2	70744276	0.905000	0.30787	0.780000	0.31762	0.032000	0.12392	1.937000	0.40193	1.377000	0.46286	0.650000	0.86243	ACG		0.572	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
SMARCAL1	50485	hgsc.bcm.edu	37	2	217285127	217285127	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr2:217285127C>T	ENST00000357276.4	+	5	1298	c.968C>T	c.(967-969)cCa>cTa	p.P323L	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.P323L	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	323					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.P323L(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCCGGCCTTCCATCAGCTCCA	0.582									Schimke Immuno-Osseous Dysplasia																												p.P323L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C968T	2						.						118.0	97.0	105.0					2																	217285127		2203	4300	6503	216993372	SO:0001583	missense	50485	exon5	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.968C>T	2.37:g.217285127C>T	ENSP00000349823:p.Pro323Leu		216993372	NM_001127207	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206254	0.58343	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128;ENST00000412913	D;D;T;D;T	0.85411	-1.96;-1.96;1.45;-1.98;0.67	4.85	4.85	0.62838	.	0.762033	0.12712	N	0.445407	D	0.87410	0.6170	M	0.61703	1.905	0.18873	N	0.999983	D	0.65815	0.995	P	0.58721	0.844	T	0.77731	-0.2478	10	0.33940	T	0.23	-14.4804	6.1512	0.20313	0.1872:0.7206:0.0:0.0923	.	323	Q9NZC9	SMAL1_HUMAN	L	323;323;222;187;43	ENSP00000349823:P323L;ENSP00000350940:P323L;ENSP00000392997:P222L;ENSP00000375974:P187L;ENSP00000390248:P43L	ENSP00000349823:P323L	P	+	2	0	SMARCAL1	216993372	0.357000	0.24938	0.478000	0.27316	0.171000	0.22731	1.715000	0.37971	2.531000	0.85337	0.561000	0.74099	CCA		0.582	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
CIZ1	25792	hgsc.bcm.edu	37	9	130938660	130938660	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:130938660A>G	ENST00000393608.1	-	11	2115	c.1913T>C	c.(1912-1914)gTg>gCg	p.V638A	CIZ1_ENST00000325721.8_Missense_Mutation_p.V609A|CIZ1_ENST00000538431.1_Missense_Mutation_p.V638A|CIZ1_ENST00000372938.5_Missense_Mutation_p.V638A|CIZ1_ENST00000357558.5_Missense_Mutation_p.V610A|CIZ1_ENST00000372948.3_Missense_Mutation_p.V582A|CIZ1_ENST00000372954.1_Missense_Mutation_p.V558A|CIZ1_ENST00000541172.1_Missense_Mutation_p.V537A|CIZ1_ENST00000277465.4_Missense_Mutation_p.V610A|CIZ1_ENST00000476727.2_Intron	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	638			V -> M (in dbSNP:rs11549266). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.		maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V638A(2)|p.L636_R640delLPVPR(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GTCCCGGGGCACGGGCAGCAG	0.637																																					p.V582A												.	.	3	Substitution - Missense(2)|Deletion - In frame(1)	large_intestine(2)|breast(1)	c.T1745C	9						.						100.0	102.0	101.0					9																	130938660		2203	4300	6503	129978481	SO:0001583	missense	25792	exon12			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1913T>C	9.37:g.130938660A>G	ENSP00000377232:p.Val638Ala		129978481	NM_001131015	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	A	7.958	0.746396	0.15710	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.32753	1.44;1.61;1.54;1.77;1.61;2.04;1.77;1.45;1.61;2.22	5.43	3.04	0.35103	.	0.495363	0.16770	N	0.200242	T	0.12987	0.0315	N	0.08118	0	0.09310	N	0.999998	B;B;B;P;B;P;B	0.47350	0.129;0.245;0.058;0.629;0.034;0.894;0.034	B;B;B;B;B;B;B	0.43225	0.036;0.05;0.047;0.292;0.021;0.412;0.021	T	0.07309	-1.0779	10	0.08381	T	0.77	-5.4729	5.0495	0.14501	0.6608:0.167:0.1722:0.0	.	638;577;582;558;638;609;610	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	A	558;638;638;610;609;577;537;610;582;638;560	ENSP00000362045:V558A;ENSP00000377232:V638A;ENSP00000439244:V638A;ENSP00000350169:V610A;ENSP00000320374:V609A;ENSP00000445057:V537A;ENSP00000277465:V610A;ENSP00000362039:V582A;ENSP00000362029:V638A;ENSP00000398011:V560A	ENSP00000277465:V610A	V	-	2	0	CIZ1	129978481	0.927000	0.31430	0.812000	0.32479	0.003000	0.03518	1.683000	0.37638	0.870000	0.35726	-0.648000	0.03929	GTG		0.637	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
LAMC3	10319	hgsc.bcm.edu	37	9	133963174	133963174	+	Missense_Mutation	SNP	G	G	A	rs367784109		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:133963174G>A	ENST00000361069.4	+	27	4580	c.4447G>A	c.(4447-4449)Gag>Aag	p.E1483K	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1483	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.E1483K(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GAAGGACATCGAGACCTTGTC	0.602																																					p.E1483K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4447A	9						.	G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	84.0	79.0	81.0		4447	-1.7	0.0	9		81	0,8600		0,0,4300	no	missense	LAMC3	NM_006059.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1483/1576	133963174	1,13005	2203	4300	6503	132952995	SO:0001583	missense	10319	exon27			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4447G>A	9.37:g.133963174G>A	ENSP00000354360:p.Glu1483Lys		132952995	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.541608	0.00934	2.27E-4	0.0	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.26373	1.74	5.13	-1.69	0.08186	.	0.802537	0.11640	N	0.543893	T	0.06781	0.0173	N	0.02247	-0.625	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.38067	-0.9678	10	0.05833	T	0.94	.	5.0372	0.14440	0.4386:0.1703:0.3911:0.0	.	164;1483	Q9UF61;Q9Y6N6	.;LAMC3_HUMAN	K	1483;1495	ENSP00000354360:E1483K	ENSP00000347156:E1495K	E	+	1	0	LAMC3	132952995	0.026000	0.19158	0.003000	0.11579	0.000000	0.00434	-0.673000	0.05239	-0.221000	0.09973	-0.379000	0.06801	GAG		0.602	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
GTF3C4	9329	hgsc.bcm.edu	37	9	135554566	135554566	+	Silent	SNP	G	G	A	rs371169	byFrequency	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:135554566G>A	ENST00000372146.4	+	2	2124	c.1560G>A	c.(1558-1560)gaG>gaA	p.E520E	GTF3C4_ENST00000483873.2_3'UTR	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	520					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)	p.E520E(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		CCTTTGAAGAGGCAGCTGCTC	0.423													G|||	2568	0.51278	0.6498	0.4971	5008	,	,		19032	0.5714		0.4036	False		,,,				2504	0.3906				p.E520E	Pancreas(142;417 1875 11086 31973 47667)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1560A	9						.	G		2680,1726	621.6+/-393.8	821,1038,344	75.0	84.0	81.0		1560	4.7	1.0	9	dbSNP_80	81	3325,5275	480.4+/-370.4	636,2053,1611	no	coding-synonymous	GTF3C4	NM_012204.2		1457,3091,1955	AA,AG,GG		38.6628,39.1739,46.171		520/823	135554566	6005,7001	2203	4300	6503	134544387	SO:0001819	synonymous_variant	9329	exon2			AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.1560G>A	9.37:g.135554566G>A			134544387	NM_012204	Q5VZJ7	Silent	SNP	ENST00000372146.4	37	CCDS6953.1																																																																																				0.423	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1		
BNC2	54796	hgsc.bcm.edu	37	9	16419123	16419123	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:16419123T>G	ENST00000380672.4	-	7	3221	c.3164A>C	c.(3163-3165)aAa>aCa	p.K1055T	BNC2_ENST00000545497.1_Missense_Mutation_p.K960T|BNC2_ENST00000380667.2_Missense_Mutation_p.K988T	NM_017637.5	NP_060107.3			basonuclin 2									p.K1055T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		ATGCACAGTTTTGTAGTGCAC	0.458																																					p.K1055T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3164C	9						.						109.0	90.0	96.0					9																	16419123		2203	4300	6503	16409123	SO:0001583	missense	54796	exon7			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.3164A>C	9.37:g.16419123T>G	ENSP00000370047:p.Lys1055Thr		16409123	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252284	0.59212	.	.	ENSG00000173068	ENST00000380672;ENST00000380667;ENST00000545497	T;T;T	0.55052	0.54;0.54;0.54	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.75503	0.3858	M	0.83384	2.64	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.996;0.997;0.996	T	0.78357	-0.2235	10	0.59425	D	0.04	-19.5095	16.6512	0.85203	0.0:0.0:0.0:1.0	.	960;1055;820	F5H586;Q6ZN30;D3DRJ1	.;BNC2_HUMAN;.	T	1055;988;960	ENSP00000370047:K1055T;ENSP00000370042:K988T;ENSP00000444640:K960T	ENSP00000370042:K988T	K	-	2	0	BNC2	16409123	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.040000	0.89188	2.333000	0.79357	0.482000	0.46254	AAA		0.458	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
ZNF169	169841	hgsc.bcm.edu	37	9	97063211	97063211	+	Silent	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:97063211C>T	ENST00000395395.2	+	5	1461	c.1371C>T	c.(1369-1371)ccC>ccT	p.P457P	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P457P(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GGGAGAAGCCCTACCTGTGCC	0.582																																					p.P457P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1371T	9						.						68.0	65.0	66.0					9																	97063211		2203	4300	6503	96103032	SO:0001819	synonymous_variant	169841	exon5			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1371C>T	9.37:g.97063211C>T			96103032	NM_194320	A2AGP5|A8K127|Q6PI28	Silent	SNP	ENST00000395395.2	37	CCDS6709.2																																																																																				0.582	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	
CORO2A	7464	hgsc.bcm.edu	37	9	100887058	100887058	+	Nonstop_Mutation	SNP	A	A	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:100887058A>T	ENST00000343933.5	-	12	1833	c.1576T>A	c.(1576-1578)Tga>Aga	p.*526R	CORO2A_ENST00000375077.4_Nonstop_Mutation_p.*526R	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	0					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)	p.*526R(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GTCTCTGCTCAGAGCTGCTCT	0.567																																					p.X526R												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T1576A	9						.						81.0	74.0	76.0					9																	100887058		2203	4300	6503	99926879	SO:0001578	stop_lost	7464	exon12			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1576T>A	9.37:g.100887058A>T			99926879	NM_003389	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.477625	0.26511	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	.	.	.	5.6	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4165	0.44325	0.8191:0.1809:0.0:0.0	.	.	.	.	R	526	.	.	X	-	1	0	CORO2A	99926879	1.000000	0.71417	0.124000	0.21820	0.635000	0.38103	4.016000	0.57159	0.958000	0.37956	0.533000	0.62120	TGA		0.567	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389	
AK8	158067	hgsc.bcm.edu	37	9	135668080	135668080	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr9:135668080G>A	ENST00000298545.3	-	11	1583	c.1062C>T	c.(1060-1062)ggC>ggT	p.G354G	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	354	Adenylate kinase 2.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.G354G(2)		NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						CCCGCGGGACGCCGTGTAGCA	0.657																																					p.G354G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1062T	9						.						28.0	23.0	25.0					9																	135668080		2189	4280	6469	134657901	SO:0001819	synonymous_variant	158067	exon11			AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.1062C>T	9.37:g.135668080G>A			134657901	NM_152572	A8K821|Q8N9W9	Silent	SNP	ENST00000298545.3	37	CCDS6954.1																																																																																				0.657	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572	
GPC5	2262	hgsc.bcm.edu	37	13	92797185	92797185	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr13:92797185G>A	ENST00000377067.3	+	7	1876	c.1504G>A	c.(1504-1506)Gat>Aat	p.D502N		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	502					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.D502N(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TGATGATGAAGATGGTTGCGG	0.458																																					p.D502N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1504A	13						.						178.0	151.0	160.0					13																	92797185		2203	4300	6503	91595186	SO:0001583	missense	2262	exon7			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1504G>A	13.37:g.92797185G>A	ENSP00000366267:p.Asp502Asn		91595186	NM_004466	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480084	0.84747	.	.	ENSG00000179399	ENST00000377067	T	0.49432	0.78	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	M	0.77103	2.36	0.45676	D	0.998598	D	0.89917	1.0	D	0.91635	0.999	T	0.72931	-0.4142	10	0.72032	D	0.01	-9.5195	17.2722	0.87105	0.0:0.0:1.0:0.0	.	502	P78333	GPC5_HUMAN	N	502	ENSP00000366267:D502N	ENSP00000366267:D502N	D	+	1	0	GPC5	91595186	1.000000	0.71417	0.997000	0.53966	0.647000	0.38526	6.945000	0.75947	2.757000	0.94681	0.563000	0.77884	GAT		0.458	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
HS6ST3	266722	hgsc.bcm.edu	37	13	97484800	97484800	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr13:97484800G>A	ENST00000376705.2	+	2	788	c.764G>A	c.(763-765)tGg>tAg	p.W255*		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	255					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)	p.W255*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CTGAGCGAGTGGAAACATGTC	0.473																																					p.W255X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G764A	13						.						67.0	68.0	68.0					13																	97484800		2203	4300	6503	96282801	SO:0001587	stop_gained	266722	exon2			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.764G>A	13.37:g.97484800G>A	ENSP00000365895:p.Trp255*		96282801	NM_153456	Q5W0L0|Q68CW6	Nonsense_Mutation	SNP	ENST00000376705.2	37	CCDS9481.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395774	0.83011	.	.	ENSG00000185352	ENST00000376705	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8293	19.8327	0.96642	0.0:0.0:1.0:0.0	.	.	.	.	X	255	.	ENSP00000365895:W255X	W	+	2	0	HS6ST3	96282801	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.864000	0.99589	2.670000	0.90874	0.655000	0.94253	TGG		0.473	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
NALCN	259232	hgsc.bcm.edu	37	13	101910858	101910858	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr13:101910858G>A	ENST00000251127.6	-	11	1283	c.1202C>T	c.(1201-1203)gCg>gTg	p.A401V	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.A401V	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	401					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.A401V(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTTGCTAGCCGCCACGATCAC	0.527																																					p.A401V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1202T	13						.						78.0	59.0	66.0					13																	101910858		2203	4300	6503	100708859	SO:0001583	missense	259232	exon11			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1202C>T	13.37:g.101910858G>A	ENSP00000251127:p.Ala401Val		100708859	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810176	0.50421	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.97016	-4.21;-4.21	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.93680	0.7981	L	0.40543	1.245	0.80722	D	1	D;D;P	0.59767	0.977;0.986;0.897	B;B;B	0.42214	0.229;0.38;0.229	D	0.91804	0.5454	10	0.15066	T	0.55	.	19.4154	0.94694	0.0:0.0:1.0:0.0	.	401;401;401	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	V	401	ENSP00000251127:A401V;ENSP00000365367:A401V	ENSP00000251127:A401V	A	-	2	0	NALCN	100708859	1.000000	0.71417	0.291000	0.24904	0.188000	0.23474	9.295000	0.96095	2.884000	0.98904	0.655000	0.94253	GCG		0.527	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
SEMA4G	57715	hgsc.bcm.edu	37	10	102738143	102738143	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:102738143T>G	ENST00000370250.4	+	5	900	c.527T>G	c.(526-528)aTt>aGt	p.I176S	SEMA4G_ENST00000519756.1_3'UTR|SEMA4G_ENST00000517724.1_Missense_Mutation_p.I176S|MRPL43_ENST00000318325.2_3'UTR|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.I176S	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	176	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.I176S(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		GGCCTCATCATTGGTGAGCAG	0.522																																					p.I176S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T527G	10						.						80.0	61.0	67.0					10																	102738143		2203	4300	6503	102728133	SO:0001583	missense	57715	exon5			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.527T>G	10.37:g.102738143T>G	ENSP00000359270:p.Ile176Ser		102728133	NM_017893	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.	.	.	.	.	.	.	.	.	.	T	20.6	4.023591	0.75390	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	.	.	.	.	T	0.18173	0.0436	L	0.28344	0.845	0.48762	D	0.999702	D;D;B	0.61080	0.989;0.974;0.372	P;P;B	0.58077	0.832;0.794;0.173	T	0.01021	-1.1478	9	0.87932	D	0	.	15.0463	0.71830	0.0:0.0:0.0:1.0	.	176;176;176	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	S	176	ENSP00000428896:I176S;ENSP00000359270:I176S;ENSP00000430175:I176S;ENSP00000210633:I176S	ENSP00000210633:I176S	I	+	2	0	SEMA4G	102728133	0.998000	0.40836	0.975000	0.42487	0.640000	0.38277	5.635000	0.67841	2.155000	0.67459	0.391000	0.25812	ATT		0.522	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
SUFU	51684	hgsc.bcm.edu	37	10	104377121	104377121	+	Missense_Mutation	SNP	C	C	T	rs368020224		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:104377121C>T	ENST00000369902.3	+	10	1398	c.1232C>T	c.(1231-1233)aCg>aTg	p.T411M	SUFU_ENST00000423559.2_Missense_Mutation_p.T411M|SUFU_ENST00000369899.2_Missense_Mutation_p.T411M	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	411					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.T411M(1)		breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		TTTGTCTCCACGGGAGTGGAA	0.537			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.T411M		yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1232T	10						.	C	MET/THR,MET/THR	0,4406		0,0,2203	126.0	119.0	122.0		1232,1232	5.1	1.0	10		122	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	SUFU	NM_001178133.1,NM_016169.3	81,81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	411/434,411/485	104377121	2,13004	2203	4300	6503	104367111	SO:0001583	missense	51684	exon10	Familial Cancer Database		AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.1232C>T	10.37:g.104377121C>T	ENSP00000358918:p.Thr411Met		104367111	NM_016169	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	37	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663605	0.88251	0.0	2.33E-4	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	T;T;T	0.47528	0.84;0.84;0.84	5.08	5.08	0.68730	Suppressor of fused C-terminal (1);	0.046866	0.85682	D	0.000000	T	0.55114	0.1900	L	0.44542	1.39	0.58432	D	0.999995	D;D;D	0.71674	0.992;0.989;0.998	P;P;P	0.53549	0.703;0.578;0.729	T	0.58053	-0.7704	10	0.56958	D	0.05	-8.7224	18.482	0.90815	0.0:1.0:0.0:0.0	.	411;411;411	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	M	411	ENSP00000358918:T411M;ENSP00000358915:T411M;ENSP00000411597:T411M	ENSP00000358915:T411M	T	+	2	0	SUFU	104367111	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.487000	0.81328	2.359000	0.80004	0.462000	0.41574	ACG		0.537	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
GSTO1	9446	hgsc.bcm.edu	37	10	106027036	106027036	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:106027036A>C	ENST00000369713.5	+	6	793	c.599A>C	c.(598-600)aAa>aCa	p.K200T	GSTO2_ENST00000450629.2_5'Flank|GSTO2_ENST00000338595.2_5'Flank|GSTO1_ENST00000369710.4_Missense_Mutation_p.K167T|GSTO1_ENST00000539281.1_Missense_Mutation_p.K172T|MIR4482-1_ENST00000583050.1_RNA	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	200	GST C-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.K200T(1)		large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	CCAAAACTGAAACTGTGGATG	0.468																																					p.K200T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A599C	10						.						75.0	63.0	67.0					10																	106027036		2203	4300	6503	106017026	SO:0001583	missense	9446	exon6			AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.599A>C	10.37:g.106027036A>C	ENSP00000358727:p.Lys200Thr		106017026	NM_004832	D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Missense_Mutation	SNP	ENST00000369713.5	37	CCDS7555.1	.	.	.	.	.	.	.	.	.	.	A	5.711	0.315759	0.10789	.	.	ENSG00000148834	ENST00000539281;ENST00000369710;ENST00000369713;ENST00000445155;ENST00000432659	T;T;T;T;T	0.02197	4.4;4.4;4.4;4.4;4.4	4.95	2.62	0.31277	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.399821	0.28730	N	0.014330	T	0.02304	0.0071	L	0.42581	1.335	0.34943	D	0.750474	P	0.38420	0.63	B	0.37780	0.258	T	0.53294	-0.8459	10	0.12766	T	0.61	-5.2485	8.9988	0.36069	0.8472:0.0:0.1528:0.0	.	200	P78417	GSTO1_HUMAN	T	172;167;200;172;139	ENSP00000441488:K172T;ENSP00000358724:K167T;ENSP00000358727:K200T;ENSP00000406708:K172T;ENSP00000405325:K139T	ENSP00000358724:K167T	K	+	2	0	GSTO1	106017026	0.809000	0.29036	0.987000	0.45799	0.499000	0.33736	2.252000	0.43196	0.385000	0.24970	-0.326000	0.08463	AAA		0.468	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050193.1	NM_004832	
CUBN	8029	hgsc.bcm.edu	37	10	16932417	16932417	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:16932417T>G	ENST00000377833.4	-	55	8773	c.8708A>C	c.(8707-8709)cAg>cCg	p.Q2903P		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2903	CUB 21. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.Q2903P(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCCTGAGACTGGAAGACGGC	0.567																																					p.Q2903P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8708C	10						.						110.0	99.0	102.0					10																	16932417		2203	4300	6503	16972423	SO:0001583	missense	8029	exon55			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8708A>C	10.37:g.16932417T>G	ENSP00000367064:p.Gln2903Pro		16972423	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	19.43	3.826635	0.71143	.	.	ENSG00000107611	ENST00000377833	T	0.28895	1.59	5.47	5.47	0.80525	CUB (5);	0.000000	0.41605	D	0.000854	T	0.61413	0.2345	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.68311	-0.5442	10	0.62326	D	0.03	.	15.8297	0.78741	0.0:0.0:0.0:1.0	.	2903	O60494	CUBN_HUMAN	P	2903	ENSP00000367064:Q2903P	ENSP00000367064:Q2903P	Q	-	2	0	CUBN	16972423	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	7.236000	0.78154	2.194000	0.70268	0.533000	0.62120	CAG		0.567	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CREM	1390	hgsc.bcm.edu	37	10	35500192	35500192	+	Intron	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:35500192C>T	ENST00000395895.2	+	10	1100				CREM_ENST00000488741.1_Missense_Mutation_p.R59W|CREM_ENST00000479070.1_Intron|CREM_ENST00000395887.3_Intron|CREM_ENST00000488328.1_Intron|CREM_ENST00000374721.3_Missense_Mutation_p.R226W|CREM_ENST00000474362.1_Intron|CREM_ENST00000473940.1_Missense_Mutation_p.R77W|CREM_ENST00000463314.1_Intron|CREM_ENST00000468236.1_Intron|CREM_ENST00000460270.1_Missense_Mutation_p.R52W|CREM_ENST00000354759.3_Missense_Mutation_p.R205W|CREM_ENST00000490511.1_Intron|CREM_ENST00000374728.3_Intron|CREM_ENST00000337656.4_Missense_Mutation_p.R256W|CREM_ENST00000487763.1_Intron|CREM_ENST00000348787.2_Intron|CREM_ENST00000361599.4_Intron|CREM_ENST00000429130.3_Intron|CREM_ENST00000439705.1_Missense_Mutation_p.R242W|CREM_ENST00000344351.5_Missense_Mutation_p.R52W|CREM_ENST00000374734.3_Missense_Mutation_p.R193W|CREM_ENST00000333809.8_Missense_Mutation_p.R305W|CREM_ENST00000345491.3_Intron|CREM_ENST00000356917.5_Missense_Mutation_p.R65W|CREM_ENST00000463960.1_Intron|CREM_ENST00000484283.1_Intron|CREM_ENST00000474931.1_Missense_Mutation_p.R69W|RP11-324I22.3_ENST00000602435.1_RNA|CREM_ENST00000342105.3_Intron			Q03060	CREM_HUMAN	cAMP responsive element modulator						cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R256W(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						GGAAGCTGCCCGGGAGTGTCG	0.488																																					p.R69W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T	10						.						79.0	78.0	78.0					10																	35500192		2203	4300	6503	35540198	SO:0001627	intron_variant	1390	exon3				CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953	ENST00000395895.2:c.939-392C>T	10.37:g.35500192C>T			35540198	NM_182721	A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	Missense_Mutation	SNP	ENST00000395895.2	37		.	.	.	.	.	.	.	.	.	.	C	17.40	3.381318	0.61845	.	.	ENSG00000095794	ENST00000460270;ENST00000354759;ENST00000333809;ENST00000439705;ENST00000374734;ENST00000337656;ENST00000462058;ENST00000374721;ENST00000473940;ENST00000356917;ENST00000488741;ENST00000474931;ENST00000344351	T;T;T;T;T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08	5.65	5.65	0.86999	.	0.602490	0.15903	N	0.238978	D	0.83220	0.5207	H	0.95645	3.7	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.997;0.999;0.999;1.0;0.99;0.997;0.979	D;D;D;D;P;D;P	0.80764	0.975;0.948;0.948;0.994;0.849;0.965;0.896	D	0.86865	0.2032	10	0.87932	D	0	.	15.2565	0.73591	0.1409:0.8591:0.0:0.0	.	69;59;65;77;193;256;205	A8K014;A8K6A1;A8K3J7;Q5W1B2;A8MPQ2;E9PHM1;Q5W1B0	.;.;.;.;.;.;.	W	52;205;305;242;193;256;226;289;77;65;59;69;52	ENSP00000420437:R52W;ENSP00000346804:R205W;ENSP00000333055:R305W;ENSP00000409220:R242W;ENSP00000363866:R193W;ENSP00000337138:R256W;ENSP00000420681:R77W;ENSP00000349387:R65W;ENSP00000419075:R59W;ENSP00000417562:R69W;ENSP00000344365:R52W	ENSP00000333055:R305W	R	+	1	2	CREM	35540198	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.934000	0.63491	2.664000	0.90586	0.650000	0.86243	CGG		0.488	CREM-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001881	
ACSL5	51703	hgsc.bcm.edu	37	10	114154767	114154767	+	Silent	SNP	G	G	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr10:114154767G>C	ENST00000393081.1	+	2	370	c.63G>C	c.(61-63)ctG>ctC	p.L21L	ACSL5_ENST00000354655.4_Silent_p.L21L|ACSL5_ENST00000354273.4_Silent_p.L21L|ACSL5_ENST00000433418.1_Silent_p.L21L|ACSL5_ENST00000356116.1_Silent_p.L77L|ACSL5_ENST00000479936.1_3'UTR	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	21					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.L77L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		TCTGCATCCTGACATTTGGAG	0.438																																					p.L21L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63C	10						.						149.0	141.0	144.0					10																	114154767		2203	4300	6503	114144757	SO:0001819	synonymous_variant	51703	exon2			AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.63G>C	10.37:g.114154767G>C			114144757	NM_203379	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Silent	SNP	ENST00000393081.1	37	CCDS7573.1																																																																																				0.438	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234	
CTNND2	1501	hgsc.bcm.edu	37	5	11023012	11023012	+	Silent	SNP	C	C	T	rs374086847		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:11023012C>T	ENST00000304623.8	-	17	3057	c.2868G>A	c.(2866-2868)tcG>tcA	p.S956S	CTNND2_ENST00000458100.2_Silent_p.S523S|CTNND2_ENST00000359640.2_Silent_p.S898S|CTNND2_ENST00000503622.1_Silent_p.S619S|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.S865S	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	956					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S956S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						CTGTGTCATCCGACATGGCCT	0.517																																					p.S956S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2868A	5						.	C		1,4405	2.1+/-5.4	0,1,2202	221.0	164.0	183.0		2868	-1.1	1.0	5		183	0,8600		0,0,4300	no	coding-synonymous	CTNND2	NM_001332.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		956/1226	11023012	1,13005	2203	4300	6503	11076012	SO:0001819	synonymous_variant	1501	exon17			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2868G>A	5.37:g.11023012C>T			11076012	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																				0.517	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
APC	324	hgsc.bcm.edu	37	5	112164586	112164586	+	Nonsense_Mutation	SNP	C	C	T	rs137854573		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:112164586C>T	ENST00000457016.1	+	14	2040	c.1660C>T	c.(1660-1662)Cga>Tga	p.R554*	APC_ENST00000257430.4_Nonsense_Mutation_p.R554*|CTC-554D6.1_ENST00000520401.1_Silent_p.G49G|APC_ENST00000508376.2_Nonsense_Mutation_p.R554*			P25054	APC_HUMAN	adenomatous polyposis coli	554	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R554*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTGTCTTGGCGAGCAGATGT	0.303		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R554X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,ovary,NS,Substitution - Nonsense,0	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(9)|ovary(1)|skin(1)	c.C1660T	5	GRCh37	CM920034	APC	M	rs137854573	.						120.0	128.0	125.0					5																	112164586		2202	4300	6502	112192485	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1660C>T	5.37:g.112164586C>T	ENSP00000413133:p.Arg554*		112192485	NM_000038	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.421849	0.98275	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.62	1.6	0.23607	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.1281	16.6906	0.85320	0.7141:0.2859:0.0:0.0	.	.	.	.	X	554;536;554;554;554	.	ENSP00000257430:R554X	R	+	1	2	APC	112192485	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	0.994000	0.29693	-0.006000	0.14370	0.655000	0.94253	CGA		0.303	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175423	112175423	+	Nonsense_Mutation	SNP	C	C	T	rs121913329		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:112175423C>T	ENST00000457016.1	+	16	4512	c.4132C>T	c.(4132-4134)Cag>Tag	p.Q1378*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1378*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1378*			P25054	APC_HUMAN	adenomatous polyposis coli	1378	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1378*(47)|p.Q1378fs*7(2)|p.Y1376fs*41(1)|p.?(1)|p.Q1378fs*5(1)|p.Q1378fs*8(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)|p.Y1376fs*1(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACACTATGTTCAGGAGACCCC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1378X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	56	Substitution - Nonsense(47)|Deletion - Frameshift(6)|Unknown(1)|Complex - frameshift(1)|Insertion - Frameshift(1)	large_intestine(49)|stomach(5)|soft_tissue(1)|skin(1)	c.C4132T	5						.						91.0	87.0	88.0					5																	112175423		2202	4300	6502	112203322	SO:0001587	stop_gained	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4132C>T	5.37:g.112175423C>T	ENSP00000413133:p.Gln1378*		112203322	NM_000038	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.764727	0.98945	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1139	20.4898	0.99202	0.0:1.0:0.0:0.0	.	.	.	.	X	1378	.	.	Q	+	1	0	APC	112203322	1.000000	0.71417	0.999000	0.59377	0.831000	0.47069	5.761000	0.68801	2.941000	0.99782	0.655000	0.94253	CAG		0.468	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TCF7	6932	hgsc.bcm.edu	37	5	133478709	133478709	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:133478709A>T	ENST00000321584.4	+	8	1140	c.944A>T	c.(943-945)cAg>cTg	p.Q315L	TCF7_ENST00000342854.5_Missense_Mutation_p.Q315L|TCF7_ENST00000395023.1_Missense_Mutation_p.Q200L|TCF7_ENST00000378560.4_Missense_Mutation_p.Q200L|TCF7_ENST00000321603.6_Missense_Mutation_p.Q315L|TCF7_ENST00000395029.1_Missense_Mutation_p.Q315L|TCF7_ENST00000378564.1_Missense_Mutation_p.Q315L|TCF7_ENST00000518915.1_Missense_Mutation_p.Q200L|TCF7_ENST00000432532.2_Missense_Mutation_p.Q200L|TCF7_ENST00000520958.1_Missense_Mutation_p.Q200L			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)	315					alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q315L(2)		kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGAGAAGAGCAGGCCAAGTAC	0.622																																					p.Q200L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A599T	5						.						35.0	32.0	33.0					5																	133478709		2203	4300	6503	133506608	SO:0001583	missense	6932	exon7			Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.944A>T	5.37:g.133478709A>T	ENSP00000326540:p.Gln315Leu		133506608	NM_201634	B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	ENST00000321584.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.329197|5.329197	0.95733|0.95733	.|.	.|.	ENSG00000081059|ENSG00000081059	ENST00000342854;ENST00000361590;ENST00000321603;ENST00000321584;ENST00000378564;ENST00000395029;ENST00000378560;ENST00000432532;ENST00000520958;ENST00000518915;ENST00000395023;ENST00000517799|ENST00000520699	D;D;D;D;D;D;D;D;D;D;D|.	0.98044|.	-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68|.	5.69|5.69	5.69|5.69	0.88448|0.88448	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83843|0.83843	0.5342|0.5342	M|M	0.89904|0.89904	3.07|3.07	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.71674|.	0.996;0.981;0.998;0.983;0.997;0.992|.	D;D;D;P;D;D|.	0.87578|.	0.983;0.969;0.998;0.82;0.994;0.979|.	D|D	0.86997|0.86997	0.2114|0.2114	10|5	0.87932|.	D|.	0|.	.|.	15.9391|15.9391	0.79739|0.79739	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	129;315;315;113;315;315|.	B3KSI6;P36402-9;B7WNT5;B3KQ75;P36402;P36402-5|.	.;.;.;.;TCF7_HUMAN;.|.	L|W	315;315;315;315;315;315;200;200;200;200;200;93|40	ENSP00000340347:Q315L;ENSP00000326654:Q315L;ENSP00000326540:Q315L;ENSP00000367827:Q315L;ENSP00000378472:Q315L;ENSP00000367822:Q200L;ENSP00000397946:Q200L;ENSP00000429547:Q200L;ENSP00000430179:Q200L;ENSP00000378469:Q200L;ENSP00000427968:Q93L|.	ENSP00000326540:Q315L|.	Q|R	+|+	2|1	0|2	TCF7|TCF7	133506608|133506608	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	7.513000|7.513000	0.81739|0.81739	2.174000|2.174000	0.68829|0.68829	0.460000|0.460000	0.39030|0.39030	CAG|AGG		0.622	TCF7-201	KNOWN	basic	protein_coding	protein_coding		NM_201634	
SPDL1	54908	hgsc.bcm.edu	37	5	169015465	169015465	+	Silent	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:169015465G>A	ENST00000265295.4	+	2	324	c.45G>A	c.(43-45)gaG>gaA	p.E15E	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.E15E(1)									GGCTCAAAGAGGCTGAAGAAG	0.343																																					p.E15E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G45A	5						.						82.0	80.0	81.0					5																	169015465		2203	4300	6503	168948043	SO:0001819	synonymous_variant	54908	exon2			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.45G>A	5.37:g.169015465G>A			168948043	NM_017785		Silent	SNP	ENST00000265295.4	37	CCDS4370.1																																																																																				0.343	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
DOCK2	1794	hgsc.bcm.edu	37	5	169129308	169129308	+	Splice_Site	SNP	G	G	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:169129308G>A	ENST00000256935.8	+	14	1340	c.1260G>A	c.(1258-1260)ggG>ggA	p.G420G	DOCK2_ENST00000540750.1_5'Flank|DOCK2_ENST00000520908.1_5'Flank	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	420					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.G420G(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGCCTCAGGGGATGTCAGGA	0.493											OREG0017017	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G420G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1260A	5						.						132.0	120.0	124.0					5																	169129308		2203	4300	6503	169061886	SO:0001630	splice_region_variant	1794	exon14			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1259-1G>A	5.37:g.169129308G>A		1875	169061886	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																				0.493	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	Silent
LIFR	3977	hgsc.bcm.edu	37	5	38502816	38502816	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:38502816C>T	ENST00000263409.4	-	11	1685	c.1523G>A	c.(1522-1524)cGg>cAg	p.R508Q	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.R508Q	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	508	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.R508Q(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ACAACGAATCCGAAAAGTATA	0.338			T	PLAG1	salivary adenoma																																p.R508Q	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1523A	5						.						98.0	93.0	94.0					5																	38502816		2201	4300	6501	38538573	SO:0001583	missense	3977	exon11			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1523G>A	5.37:g.38502816C>T	ENSP00000263409:p.Arg508Gln		38538573	NM_002310	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352812	0.61293	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.59772	0.24;0.24	5.68	5.68	0.88126	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.284658	0.35466	N	0.003184	T	0.55609	0.1931	L	0.60455	1.87	0.48185	D	0.999608	D	0.62365	0.991	P	0.44477	0.451	T	0.53063	-0.8491	10	0.13853	T	0.58	-11.1358	16.5133	0.84292	0.0:1.0:0.0:0.0	.	508	P42702	LIFR_HUMAN	Q	508	ENSP00000263409:R508Q;ENSP00000398368:R508Q	ENSP00000263409:R508Q	R	-	2	0	LIFR	38538573	1.000000	0.71417	0.996000	0.52242	0.911000	0.54048	4.296000	0.59055	2.678000	0.91216	0.655000	0.94253	CGG		0.338	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
NIM1K	167359	hgsc.bcm.edu	37	5	43280400	43280400	+	Missense_Mutation	SNP	G	G	A	rs367746669		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:43280400G>A	ENST00000512796.1	+	4	2379	c.880G>A	c.(880-882)Gtg>Atg	p.V294M	NIM1_ENST00000326035.2_Missense_Mutation_p.V294M			Q8IY84	NIM1_HUMAN		294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.V294M(1)									ACCGCCGCACGTGTCAGAGCC	0.537																																					p.V294M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G880A	5						.						83.0	71.0	75.0					5																	43280400		2203	4300	6503	43316157	SO:0001583	missense	167359	exon4																														ENST00000512796.1:c.880G>A	5.37:g.43280400G>A	ENSP00000420849:p.Val294Met		43316157	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.221301	0.39300	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.26810	1.71;1.71	5.73	3.97	0.46021	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.139286	0.47852	N	0.000220	T	0.22085	0.0532	L	0.54863	1.705	0.80722	D	1	B	0.26318	0.146	B	0.34452	0.183	T	0.05209	-1.0899	10	0.02654	T	1	.	8.5246	0.33298	0.1474:0.1608:0.6919:0.0	.	294	Q8IY84	NIM1_HUMAN	M	294	ENSP00000313572:V294M;ENSP00000420849:V294M	ENSP00000313572:V294M	V	+	1	0	AC114947.1	43316157	1.000000	0.71417	0.669000	0.29828	0.302000	0.27658	6.376000	0.73141	0.795000	0.33922	0.655000	0.94253	GTG		0.537	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
DDX4	54514	hgsc.bcm.edu	37	5	55083694	55083694	+	Silent	SNP	T	T	A			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:55083694T>A	ENST00000505374.1	+	15	1130	c.1038T>A	c.(1036-1038)atT>atA	p.I346I	DDX4_ENST00000353507.5_Silent_p.I312I|DDX4_ENST00000514278.2_Silent_p.I326I|DDX4_ENST00000511853.1_Silent_p.I197I|DDX4_ENST00000354991.5_Silent_p.I312I	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	346	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.I346I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TCCTACCAATTTTGGCTCATA	0.393																																					p.I326I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T978A	5						.						100.0	101.0	100.0					5																	55083694		2203	4300	6503	55119451	SO:0001819	synonymous_variant	54514	exon14			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1038T>A	5.37:g.55083694T>A			55119451	NM_001166533	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Silent	SNP	ENST00000505374.1	37	CCDS3969.1																																																																																				0.393	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
CD180	4064	hgsc.bcm.edu	37	5	66479988	66479988	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:66479988T>G	ENST00000256447.4	-	3	840	c.683A>C	c.(682-684)aAc>aCc	p.N228T		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	228					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N228T(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TCCTCCAAAGTTCAAACTTTG	0.418																																					p.N228T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A683C	5						.						66.0	71.0	69.0					5																	66479988		2202	4300	6502	66515744	SO:0001583	missense	4064	exon3			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.683A>C	5.37:g.66479988T>G	ENSP00000256447:p.Asn228Thr		66515744	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	37	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.362761	0.24684	.	.	ENSG00000134061	ENST00000256447	T	0.36340	1.26	5.4	0.15	0.14883	.	0.435749	0.22628	N	0.057616	T	0.25082	0.0609	M	0.71581	2.175	0.28991	N	0.888025	P	0.44139	0.827	B	0.33750	0.169	T	0.34104	-0.9842	10	0.13470	T	0.59	.	6.292	0.21065	0.0:0.1322:0.2501:0.6177	.	228	Q99467	CD180_HUMAN	T	228	ENSP00000256447:N228T	ENSP00000256447:N228T	N	-	2	0	CD180	66515744	0.989000	0.36119	0.860000	0.33809	0.414000	0.31173	1.632000	0.37102	-0.092000	0.12417	0.533000	0.62120	AAC		0.418	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
FBXW11	23291	hgsc.bcm.edu	37	5	171303305	171303305	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr5:171303305C>T	ENST00000265094.5	-	8	1279	c.1142G>A	c.(1141-1143)gGt>gAt	p.G381D	FBXW11_ENST00000296933.6_Missense_Mutation_p.G368D|FBXW11_ENST00000393802.2_Missense_Mutation_p.G347D|FBXW11_ENST00000522891.1_5'Flank|FBXW11_ENST00000425623.2_Missense_Mutation_p.G349D	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	381					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.G368D(1)|p.G381D(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGTCCTGTCACCAGAGGCAGA	0.512																																					p.G381D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1142A	5						.						93.0	79.0	84.0					5																	171303305		2203	4300	6503	171235910	SO:0001583	missense	23291	exon8			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1142G>A	5.37:g.171303305C>T	ENSP00000265094:p.Gly381Asp		171235910	NM_012300	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	C	31	5.074451	0.94000	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	N	0.01729	-0.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.68708	-0.5337	10	0.40728	T	0.16	-17.0154	19.3047	0.94157	0.0:1.0:0.0:0.0	.	349;347;381;368	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	D	368;381;347;349	ENSP00000296933:G368D;ENSP00000265094:G381D;ENSP00000377391:G347D;ENSP00000444929:G349D	ENSP00000265094:G381D	G	-	2	0	FBXW11	171235910	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.770000	0.85390	2.652000	0.90054	0.655000	0.94253	GGT		0.512	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
NRXN3	9369	hgsc.bcm.edu	37	14	79269961	79269961	+	Splice_Site	SNP	A	A	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr14:79269961A>G	ENST00000554719.1	+	6	1416		c.e6-1		NRXN3_ENST00000335750.5_Splice_Site	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTTCTTTGGCAGAGGCATCCA	0.483																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	14						.						154.0	119.0	131.0					14																	79269961		2203	4300	6503	78339714	SO:0001630	splice_region_variant	9369	.			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.926-1A>G	14.37:g.79269961A>G			78339714	.	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Splice_Site	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357321	0.61293	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NRXN3	78339714	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	9.339000	0.96797	2.254000	0.74563	0.533000	0.62120	.		0.483	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	Intron
PLA2G4A	5321	hgsc.bcm.edu	37	1	186925233	186925233	+	Splice_Site	SNP	G	G	C			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.	.	.	SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr1:186925233G>C	ENST00000367466.3	+	14	1488		c.e14-1		PLA2G4A_ENST00000442353.2_Splice_Site	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)						arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.?(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTTTTCCCTAGGCACTGAAAA	0.413																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	1						.						75.0	71.0	72.0					1																	186925233		2203	4300	6503	185191856	SO:0001630	splice_region_variant	5321	.			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1337-1G>C	1.37:g.186925233G>C			185191856	.	B1AKG4|Q29R80	Splice_Site	SNP	ENST00000367466.3	37	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771827	0.69992	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2186	0.89894	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLA2G4A	185191856	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	8.584000	0.90798	2.725000	0.93324	0.655000	0.94253	.		0.413	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	Intron
TASP1	55617	hgsc.bcm.edu	37	20	13514769	13514769	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr20:13514769A>T	ENST00000337743.4	-	9	815	c.695T>A	c.(694-696)tTg>tAg	p.L232*	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Intron	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	232					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)	p.L232*(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						TACCGTGTCCAAAGTGCCTGA	0.512																																					p.L232X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.T695A	20						.						166.0	141.0	149.0					20																	13514769		2203	4300	6503	13462769	SO:0001587	stop_gained	55617	exon9			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.695T>A	20.37:g.13514769A>T	ENSP00000338624:p.Leu232*		13462769	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Nonsense_Mutation	SNP	ENST00000337743.4	37	CCDS13116.1	.	.	.	.	.	.	.	.	.	.	A	38	7.193181	0.98125	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5537	15.7943	0.78398	1.0:0.0:0.0:0.0	.	.	.	.	X	209;232;209	.	ENSP00000338624:L232X	L	-	2	0	TASP1	13462769	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.405000	0.90213	2.208000	0.71279	0.533000	0.62120	TTG		0.512	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
SYNE1	23345	hgsc.bcm.edu	37	6	152765638	152765638	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr6:152765638T>G	ENST00000367255.5	-	30	4346	c.3745A>C	c.(3745-3747)Att>Ctt	p.I1249L	SYNE1_ENST00000265368.4_Missense_Mutation_p.I1249L|SYNE1_ENST00000448038.1_Missense_Mutation_p.I1256L|SYNE1_ENST00000367248.3_Missense_Mutation_p.I1239L|SYNE1_ENST00000341594.5_Missense_Mutation_p.I1315L|SYNE1_ENST00000423061.1_Missense_Mutation_p.I1256L|SYNE1_ENST00000413186.2_Missense_Mutation_p.I1249L|SYNE1_ENST00000367253.4_Missense_Mutation_p.I1249L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1249					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.I1249L(4)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGCCAGAAATTAATTCTTCG	0.343										HNSCC(10;0.0054)																											p.I1256L												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A3766C	6						.						92.0	92.0	92.0					6																	152765638		2203	4300	6503	152807331	SO:0001583	missense	23345	exon30			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3745A>C	6.37:g.152765638T>G	ENSP00000356224:p.Ile1249Leu		152807331	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597284	0.46318	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87650	0.69;0.69;0.6;0.69;0.78;-2.14;-2.28;-2.28	5.96	5.96	0.96718	.	0.098580	0.44902	D	0.000418	T	0.77089	0.4079	M	0.61703	1.905	0.80722	D	1	B;B;B;B;B;B	0.25850	0.136;0.002;0.001;0.056;0.002;0.006	B;B;B;B;B;B	0.21708	0.036;0.005;0.005;0.027;0.005;0.019	T	0.75780	-0.3197	10	0.11182	T	0.66	.	16.4277	0.83824	0.0:0.0:0.0:1.0	.	1232;1249;1239;1249;1249;1256	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	L	1249;1256;1249;1256;1315;1249;1239;1249	ENSP00000356224:I1249L;ENSP00000396024:I1256L;ENSP00000265368:I1249L;ENSP00000390975:I1256L;ENSP00000341887:I1315L;ENSP00000356222:I1249L;ENSP00000356217:I1239L;ENSP00000414510:I1249L	ENSP00000265368:I1249L	I	-	1	0	SYNE1	152807331	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.982000	0.40638	2.279000	0.76181	0.533000	0.62120	ATT		0.343	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TP53	7157	hgsc.bcm.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476698	28476698	+	Missense_Mutation	SNP	G	G	A	rs370104321		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr3:28476698G>A	ENST00000383768.2	+	4	618	c.430G>A	c.(430-432)Gat>Aat	p.D144N	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.D144N			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	144	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)	p.D144N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						ATTCCTGGGCGATCCCCATTC	0.383																																					p.D144N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G430A	3						.	G	ASN/ASP	0,4406		0,0,2203	111.0	114.0	113.0		430	2.9	1.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZCWPW2	NM_001040432.1	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	144/357	28476698	1,13005	2203	4300	6503	28451702	SO:0001583	missense	152098	exon3			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.430G>A	3.37:g.28476698G>A	ENSP00000373278:p.Asp144Asn		28451702	NM_001040432		Missense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.17|14.17	2.455621|2.455621	0.43634|0.43634	0.0|0.0	1.16E-4|1.16E-4	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000428875	T;T|.	0.73047|.	-0.71;-0.71|.	6.06|6.06	2.88|2.88	0.33553|0.33553	PWWP (2);|.	0.386348|.	0.25613|.	N|.	0.029471|.	T|T	0.31420|0.31420	0.0796|0.0796	L|L	0.29908|0.29908	0.895|0.895	0.27918|0.27918	N|N	0.938353|0.938353	B|.	0.28470|.	0.213|.	B|.	0.26517|.	0.07|.	T|T	0.20273|0.20273	-1.0280|-1.0280	9|5	.|.	.|.	.|.	-10.0984|-10.0984	6.6991|6.6991	0.23215|0.23215	0.1771:0.1518:0.6711:0.0|0.1771:0.1518:0.6711:0.0	.|.	144|.	Q504Y3|.	ZCPW2_HUMAN|.	N|Q	144|127	ENSP00000373278:D144N;ENSP00000412386:D144N|.	.|.	D|R	+|+	1|2	0|0	ZCWPW2|ZCWPW2	28451702|28451702	0.995000|0.995000	0.38212|0.38212	0.988000|0.988000	0.46212|0.46212	0.967000|0.967000	0.64934|0.64934	1.073000|1.073000	0.30691|0.30691	0.881000|0.881000	0.35993|0.35993	0.650000|0.650000	0.86243|0.86243	GAT|CGA		0.383	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3558-01A-01W-0831-10	TCGA-AA-3558-10A-01W-0831-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
