#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS14	140766	broad.mit.edu	37	10	72489913	72489913	+	Missense_Mutation	SNP	G	G	A	rs369181052		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr10:72489913G>A	ENST00000373207.1	+	6	1010	c.1010G>A	c.(1009-1011)cGc>cAc	p.R337H	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R337H	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	337	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R337H(2)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CAGGTGTGTCGCTGGGCACAC	0.662																																					p.R337H												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.G1010A	10						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	78.0	72.0	74.0		1010,1010	4.7	1.0	10		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADAMTS14	NM_080722.3,NM_139155.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	337/1224,337/1227	72489913	1,13005	2203	4300	6503	72159919	SO:0001583	missense	140766	exon6			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1010G>A	10.37:g.72489913G>A	ENSP00000362303:p.Arg337His		72159919	NM_080722	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475196	0.84640	0.0	1.16E-4	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.63744	-0.06;-0.06	4.7	4.7	0.59300	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	L	0.55103	1.725	0.58432	D	0.999997	B;P	0.38455	0.403;0.632	B;B	0.34242	0.141;0.178	T	0.59542	-0.7435	10	0.33940	T	0.23	.	17.8161	0.88634	0.0:0.0:1.0:0.0	.	337;337	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	H	337	ENSP00000362304:R337H;ENSP00000362303:R337H	ENSP00000362303:R337H	R	+	2	0	ADAMTS14	72159919	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.578000	0.98200	2.608000	0.88229	0.655000	0.94253	CGC		0.662	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
ITPRIP	85450	broad.mit.edu	37	10	106074372	106074372	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr10:106074372C>T	ENST00000337478.1	-	2	1609	c.1438G>A	c.(1438-1440)Ggc>Agc	p.G480S	ITPRIP_ENST00000358187.2_Missense_Mutation_p.G480S|ITPRIP_ENST00000278071.2_Missense_Mutation_p.G480S|RP11-127L20.5_ENST00000472915.2_RNA	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	480						membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G480S(1)		breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TTGCGGTTGCCGATGAAGAAG	0.632																																					p.G480S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1438A	10						.						59.0	63.0	62.0					10																	106074372		2203	4300	6503	106064362	SO:0001583	missense	85450	exon3			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.1438G>A	10.37:g.106074372C>T	ENSP00000337178:p.Gly480Ser		106064362	NM_033397	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602646	0.66445	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.40756	1.02;1.02;1.02	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.68302	0.2986	M	0.81802	2.56	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.72500	-0.4274	10	0.66056	D	0.02	-35.4455	18.9115	0.92487	0.0:1.0:0.0:0.0	.	480	Q8IWB1	IPRI_HUMAN	S	480	ENSP00000337178:G480S;ENSP00000278071:G480S;ENSP00000350915:G480S	ENSP00000278071:G480S	G	-	1	0	ITPRIP	106064362	1.000000	0.71417	0.995000	0.50966	0.180000	0.23129	7.776000	0.85560	2.543000	0.85770	0.561000	0.74099	GGC		0.632	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
GRIA4	2893	broad.mit.edu	37	11	105797559	105797559	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr11:105797559C>T	ENST00000530497.1	+	12	1940	c.1940C>T	c.(1939-1941)aCg>aTg	p.T647M	GRIA4_ENST00000282499.5_Missense_Mutation_p.T647M|GRIA4_ENST00000525187.1_Missense_Mutation_p.T647M|GRIA4_ENST00000393127.2_Missense_Mutation_p.T647M			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	647					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.T647M(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GCTTTCCTGACGGTTGAGCGA	0.428																																					p.T647M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1940T	11						.						121.0	117.0	118.0					11																	105797559		2202	4298	6500	105302769	SO:0001583	missense	2893	exon13			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1940C>T	11.37:g.105797559C>T	ENSP00000435775:p.Thr647Met		105302769	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	C	32	5.131130	0.94473	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	5.87	5.87	0.94306	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.86760	0.6010	H	0.98612	4.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90848	0.4729	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	647;647	P48058;G3V164	GRIA4_HUMAN;.	M	647	ENSP00000282499:T647M;ENSP00000376835:T647M;ENSP00000435775:T647M;ENSP00000432180:T647M	ENSP00000282499:T647M	T	+	2	0	GRIA4	105302769	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	ACG		0.428	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
HBD	3045	broad.mit.edu	37	11	5255281	5255281	+	Silent	SNP	A	A	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr11:5255281A>C	ENST00000380299.3	-	2	469	c.255T>G	c.(253-255)acT>acG	p.T85T	HBD_ENST00000292901.3_Silent_p.T85T	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	85					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.T85T(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGAGAAAAAGTGCCCTTGA	0.507																																					p.T85T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T255G	11						.						130.0	110.0	117.0					11																	5255281		2201	4298	6499	5211857	SO:0001819	synonymous_variant	3045	exon2			AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.255T>G	11.37:g.5255281A>C			5211857	NM_000519	Q3Y5H3|Q8WXT7	Silent	SNP	ENST00000380299.3	37	CCDS31376.1																																																																																				0.507	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519	
CCKBR	887	broad.mit.edu	37	11	6291978	6291978	+	Silent	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr11:6291978C>T	ENST00000334619.2	+	4	949	c.756C>T	c.(754-756)gaC>gaT	p.D252D	CCKBR_ENST00000525462.1_Silent_p.D252D|CCKBR_ENST00000532715.1_Silent_p.D168D	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	252					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.D252D(2)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TTCGCTTTGACGGCGACAGTG	0.602																																					p.D252D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C756T	11						.						111.0	86.0	94.0					11																	6291978		2201	4296	6497	6248554	SO:0001819	synonymous_variant	887	exon4			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.756C>T	11.37:g.6291978C>T			6248554	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Silent	SNP	ENST00000334619.2	37	CCDS7761.1																																																																																				0.602	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
ATM	472	broad.mit.edu	37	11	108199931	108199931	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr11:108199931delG	ENST00000452508.2	+	50	7462	c.7273delG	c.(7273-7275)ggtfs	p.G2425fs	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Frame_Shift_Del_p.G2425fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2425	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G2425fs*15(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGAGGAAGTAGGTCTCCTTAG	0.368			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.G2425fs		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.7273delG	11						.						66.0	66.0	66.0					11																	108199931		2201	4298	6499	107705141	SO:0001589	frameshift_variant	472	exon49	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7273delG	11.37:g.108199931delG	ENSP00000388058:p.Gly2425fs		107705141	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																				0.368	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
CDON	50937	broad.mit.edu	37	11	125875946	125875946	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr11:125875946A>G	ENST00000392693.3	-	9	1686	c.1559T>C	c.(1558-1560)tTt>tCt	p.F520S	CDON_ENST00000531738.1_5'Flank|CDON_ENST00000263577.7_Missense_Mutation_p.F520S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	520					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F520S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATTTGTTTCAAAAGGAACTGC	0.438																																					p.F520S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1559C	11						.						55.0	48.0	50.0					11																	125875946		2201	4299	6500	125381156	SO:0001583	missense	50937	exon9			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1559T>C	11.37:g.125875946A>G	ENSP00000376458:p.Phe520Ser		125381156	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.125853	0.37533	.	.	ENSG00000064309	ENST00000392693;ENST00000263577	T;T	0.68624	-0.34;-0.34	6.07	2.52	0.30459	Immunoglobulin-like fold (1);	0.357608	0.24291	N	0.039802	T	0.56426	0.1984	M	0.67953	2.075	0.31545	N	0.659439	B;B	0.09022	0.001;0.002	B;B	0.10450	0.002;0.005	T	0.50923	-0.8770	10	0.22109	T	0.4	-8.1696	3.8331	0.08882	0.4705:0.0:0.1941:0.3354	.	520;520	Q4KMG0;Q4KMG0-2	CDON_HUMAN;.	S	520	ENSP00000376458:F520S;ENSP00000263577:F520S	ENSP00000263577:F520S	F	-	2	0	CDON	125381156	0.940000	0.31905	0.988000	0.46212	0.826000	0.46750	0.454000	0.21827	0.183000	0.20059	0.533000	0.62120	TTT		0.438	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
ATN1	1822	broad.mit.edu	37	12	7045142	7045142	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:7045142G>C	ENST00000356654.4	+	5	949	c.712G>C	c.(712-714)Gga>Cga	p.G238R	ATN1_ENST00000396684.2_Missense_Mutation_p.G238R	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	238					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.G238R(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						TCCCAAGGGGGGAGGGGCTGC	0.632																																					p.G238R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G712C	12						.						16.0	18.0	17.0					12																	7045142		2187	4285	6472	6915403	SO:0001583	missense	1822	exon5			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.712G>C	12.37:g.7045142G>C	ENSP00000349076:p.Gly238Arg		6915403	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	-	8.620	0.891161	0.17613	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.77620	-1.11;-1.11;-1.11	3.83	2.93	0.34026	.	0.303746	0.18436	U	0.141286	T	0.52224	0.1721	N	0.08118	0	0.09310	N	0.999998	B;P	0.44578	0.232;0.838	B;B	0.35413	0.07;0.202	T	0.44050	-0.9353	10	0.15066	T	0.55	.	11.7164	0.51655	0.0882:0.0:0.9118:0.0	.	238;238	Q86V38;P54259	.;ATN1_HUMAN	R	238	ENSP00000349076:G238R;ENSP00000379915:G238R;ENSP00000441744:G238R	ENSP00000349076:G238R	G	+	1	0	ATN1	6915403	0.146000	0.22672	0.531000	0.27976	0.079000	0.17450	1.690000	0.37711	0.957000	0.37930	0.580000	0.79431	GGA		0.632	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PCED1B	91523	broad.mit.edu	37	12	47471457	47471457	+	5'Flank	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:47471457C>T	ENST00000546455.1	+	0	0				AMIGO2_ENST00000550413.1_Silent_p.S443S|AMIGO2_ENST00000321382.3_Silent_p.S443S|AMIGO2_ENST00000429635.1_Silent_p.S443S|AMIGO2_ENST00000266581.4_Silent_p.S443S			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)	p.S443S(1)									GACTGAGAATCGATGAATGGG	0.483																																					p.S443S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1329A	12						.						168.0	172.0	171.0					12																	47471457		2203	4300	6503	45757724	SO:0001631	upstream_gene_variant	347902	exon2			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617		12.37:g.47471457C>T	Exception_encountered		45757724	NM_181847	Q96B20	Silent	SNP	ENST00000546455.1	37	CCDS8752.1																																																																																				0.483	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
C12orf54	121273	broad.mit.edu	37	12	48880508	48880508	+	Splice_Site	SNP	A	A	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:48880508A>T	ENST00000548364.1	+	3	191	c.134A>T	c.(133-135)cAg>cTg	p.Q45L	C12orf54_ENST00000314014.2_Splice_Site_p.Q45L|RP11-722P11.4_ENST00000551847.1_RNA|C12orf54_ENST00000548913.1_3'UTR			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54	45								p.Q45L(1)		endometrium(1)|large_intestine(4)	5						CTGTGGGACCAGGTGAGTACA	0.453																																					p.Q45L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A134T	12						.						96.0	88.0	91.0					12																	48880508		2203	4300	6503	47166775	SO:0001630	splice_region_variant	121273	exon4			BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.135+1A>T	12.37:g.48880508A>T			47166775	NM_152319	Q6X4S9|Q8N5S2	Missense_Mutation	SNP	ENST00000548364.1	37	CCDS8764.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831852	0.71258	.	.	ENSG00000177627	ENST00000314014;ENST00000548364	T;T	0.47177	0.85;0.85	4.39	4.39	0.52855	.	0.000000	0.44902	D	0.000416	T	0.49406	0.1555	N	0.19112	0.55	0.25427	N	0.988214	D	0.71674	0.998	D	0.66979	0.948	T	0.38607	-0.9653	10	0.72032	D	0.01	-1.0795	10.3024	0.43661	1.0:0.0:0.0:0.0	.	45	Q6X4T0	CL054_HUMAN	L	45	ENSP00000316898:Q45L;ENSP00000447109:Q45L	ENSP00000316898:Q45L	Q	+	2	0	C12orf54	47166775	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.077000	0.50089	2.199000	0.70637	0.524000	0.50904	CAG		0.453	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406875.1	NM_152319	Missense_Mutation
LEMD3	23592	broad.mit.edu	37	12	65640064	65640064	+	Missense_Mutation	SNP	C	C	T	rs201280850		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:65640064C>T	ENST00000308330.2	+	13	2721	c.2695C>T	c.(2695-2697)Cgt>Tgt	p.R899C		NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	899	Interaction with SMAD1, SMAD2, SMAD3 and SMAD5.				negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.R899C(1)		breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		GTCTCATCTTCGTCTTCGGAC	0.398																																					p.R899C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2695T	12						.						122.0	117.0	119.0					12																	65640064		2203	4300	6503	63926331	SO:0001583	missense	23592	exon13			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.2695C>T	12.37:g.65640064C>T	ENSP00000308369:p.Arg899Cys		63926331	NM_014319	Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	37	CCDS8972.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820248	0.71028	.	.	ENSG00000174106	ENST00000308330	T	0.53206	0.63	5.59	5.59	0.84812	.	0.391182	0.27340	N	0.019807	T	0.45558	0.1348	N	0.08118	0	0.46028	D	0.998823	D	0.89917	1.0	D	0.64687	0.928	T	0.43410	-0.9393	9	.	.	.	-9.9841	14.4356	0.67279	0.1473:0.8527:0.0:0.0	.	899	Q9Y2U8	MAN1_HUMAN	C	899	ENSP00000308369:R899C	.	R	+	1	0	LEMD3	63926331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.007000	0.49536	2.645000	0.89757	0.551000	0.68910	CGT		0.398	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
SLC6A15	55117	broad.mit.edu	37	12	85257352	85257352	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:85257352C>T	ENST00000266682.5	-	11	2225	c.1684G>A	c.(1684-1686)Ggc>Agc	p.G562S	SLC6A15_ENST00000552192.1_Missense_Mutation_p.G455S|SLC6A15_ENST00000309283.7_Missense_Mutation_p.G270S	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	562					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.G562S(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GGAGCAAAGCCCAGCATATCT	0.289																																					p.G562S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1684A	12						.						47.0	51.0	50.0					12																	85257352		2202	4295	6497	83781483	SO:0001583	missense	55117	exon11			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.1684G>A	12.37:g.85257352C>T	ENSP00000266682:p.Gly562Ser		83781483	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289229	0.95517	.	.	ENSG00000072041	ENST00000309283;ENST00000266682;ENST00000552192;ENST00000548267	T;T;T	0.79454	-1.27;-1.27;-1.27	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.90048	0.6892	M	0.86573	2.825	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.976;0.986	D	0.91168	0.4966	10	0.72032	D	0.01	.	19.5129	0.95151	0.0:1.0:0.0:0.0	.	270;562	F8WJN6;Q9H2J7	.;S6A15_HUMAN	S	270;562;455;40	ENSP00000311645:G270S;ENSP00000266682:G562S;ENSP00000450145:G455S	ENSP00000266682:G562S	G	-	1	0	SLC6A15	83781483	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.395000	0.79876	2.608000	0.88229	0.585000	0.79938	GGC		0.289	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
POLE	5426	broad.mit.edu	37	12	133218357	133218357	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr12:133218357C>T	ENST00000320574.5	-	39	5297	c.5254G>A	c.(5254-5256)Gac>Aac	p.D1752N	POLE_ENST00000535270.1_Missense_Mutation_p.D1725N|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1752			D -> N (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.D1752N(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CCCATGCTGTCGGCCCCCTCC	0.607								DNA polymerases (catalytic subunits)																													p.D1752N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5254A	12						.						104.0	88.0	94.0					12																	133218357		2203	4300	6503	131728430	SO:0001583	missense	5426	exon39				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.5254G>A	12.37:g.133218357C>T	ENSP00000322570:p.Asp1752Asn		131728430	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243259	0.39697	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.27720	1.65;1.65;1.65	5.43	2.32	0.28847	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.333415	0.34531	N	0.003888	T	0.26593	0.0650	L	0.51422	1.61	0.22866	N	0.998633	B	0.31769	0.339	B	0.35859	0.212	T	0.13442	-1.0509	10	0.27082	T	0.32	.	8.6846	0.34229	0.1635:0.6768:0.0:0.1598	.	1752	Q07864	DPOE1_HUMAN	N	1752;1763;1725	ENSP00000322570:D1752N;ENSP00000406383:D1763N;ENSP00000445753:D1725N	ENSP00000322570:D1752N	D	-	1	0	POLE	131728430	0.543000	0.26434	0.473000	0.27253	0.758000	0.43043	1.229000	0.32600	0.670000	0.31165	0.655000	0.94253	GAC		0.607	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
AQP9	366	broad.mit.edu	37	15	58458989	58458989	+	Missense_Mutation	SNP	G	G	A	rs536480649		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr15:58458989G>A	ENST00000219919.4	+	2	599	c.229G>A	c.(229-231)Ggt>Agt	p.G77S	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000558772.1_Missense_Mutation_p.G12S|AQP9_ENST00000536493.1_Missense_Mutation_p.G77S	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	77					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.G77S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TGTGGCTGGCGGTGTCTCTGG	0.458																																					p.G77S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G229A	15						.						191.0	169.0	176.0					15																	58458989		2192	4292	6484	56246281	SO:0001583	missense	366	exon2			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.229G>A	15.37:g.58458989G>A	ENSP00000219919:p.Gly77Ser		56246281	NM_020980	Q9NP32	Missense_Mutation	SNP	ENST00000219919.4	37	CCDS10165.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726968	0.69074	.	.	ENSG00000103569	ENST00000219919;ENST00000536493	D;D	0.86497	-2.13;-2.13	4.76	4.76	0.60689	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	L	0.59912	1.85	0.54753	D	0.999985	D	0.65815	0.995	P	0.62491	0.903	D	0.91877	0.5512	10	0.62326	D	0.03	.	16.7107	0.85384	0.0:0.0:1.0:0.0	.	77	O43315	AQP9_HUMAN	S	77	ENSP00000219919:G77S;ENSP00000441390:G77S	ENSP00000219919:G77S	G	+	1	0	AQP9	56246281	1.000000	0.71417	0.945000	0.38365	0.028000	0.11728	4.500000	0.60387	2.485000	0.83878	0.561000	0.74099	GGT		0.458	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
NR2F2	7026	broad.mit.edu	37	15	96877773	96877773	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr15:96877773C>T	ENST00000394166.3	+	2	2300	c.911C>T	c.(910-912)gCg>gTg	p.A304V	MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000394171.2_Missense_Mutation_p.A151V|NR2F2_ENST00000453270.2_Missense_Mutation_p.A151V|NR2F2_ENST00000421109.2_Missense_Mutation_p.A171V	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	304	Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A304V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AAGCTCAAGGCGCTGCACGTT	0.617																																					p.A171V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C512T	15						.						34.0	32.0	33.0					15																	96877773		2197	4295	6492	94678777	SO:0001583	missense	7026	exon2			M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.911C>T	15.37:g.96877773C>T	ENSP00000377721:p.Ala304Val		94678777	NM_001145155	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314491	0.81358	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18	5.09	5.09	0.68999	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.057114	0.64402	D	0.000001	D	0.94788	0.8317	L	0.49126	1.545	0.80722	D	1	B;B	0.16603	0.018;0.007	B;B	0.18561	0.022;0.022	D	0.92250	0.5808	10	0.66056	D	0.02	.	18.4813	0.90812	0.0:1.0:0.0:0.0	.	304;171	P24468;Q3KQR7	COT2_HUMAN;.	V	171;304;151;151	ENSP00000401674:A171V;ENSP00000377721:A304V;ENSP00000377726:A151V;ENSP00000389853:A151V	ENSP00000377721:A304V	A	+	2	0	NR2F2	94678777	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	6.087000	0.71362	2.376000	0.81061	0.655000	0.94253	GCG		0.617	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
ZNF423	23090	broad.mit.edu	37	16	49671871	49671871	+	Missense_Mutation	SNP	G	G	A	rs368847069		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr16:49671871G>A	ENST00000561648.1	-	4	1245	c.1192C>T	c.(1192-1194)Cgg>Tgg	p.R398W	ZNF423_ENST00000535559.1_Missense_Mutation_p.R281W|ZNF423_ENST00000562871.1_Missense_Mutation_p.R338W|ZNF423_ENST00000563137.2_Missense_Mutation_p.R338W|ZNF423_ENST00000562520.1_Missense_Mutation_p.R338W|ZNF423_ENST00000262383.2_Missense_Mutation_p.R398W|ZNF423_ENST00000567169.1_Missense_Mutation_p.R281W	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	398					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R398W(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCGTCATCCCGCATCTTCTTC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		18445	0.0		0.0	False		,,,				2504	0.001				p.R398W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1192T	16						.	G	TRP/ARG	0,4396		0,0,2198	43.0	39.0	40.0		1192	5.2	1.0	16		40	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF423	NM_015069.2	101	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	398/1285	49671871	2,12994	2198	4300	6498	48229372	SO:0001583	missense	23090	exon5			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1192C>T	16.37:g.49671871G>A	ENSP00000455426:p.Arg398Trp		48229372	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.128109	0.37533	0.0	2.33E-4	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09163	3.01;3.04	5.24	5.24	0.73138	.	0.182784	0.47852	D	0.000205	T	0.13243	0.0321	L	0.44542	1.39	0.36596	D	0.874414	D	0.65815	0.995	P	0.48677	0.586	T	0.06917	-1.0800	9	.	.	.	.	9.1247	0.36807	0.0:0.1303:0.667:0.2027	.	398	Q2M1K9	ZN423_HUMAN	W	398;281	ENSP00000262383:R398W;ENSP00000442321:R281W	.	R	-	1	2	ZNF423	48229372	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	1.702000	0.37836	2.449000	0.82847	0.561000	0.74099	CGG		0.637	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
SALL1	6299	broad.mit.edu	37	16	51173338	51173338	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr16:51173338G>T	ENST00000251020.4	-	2	2828	c.2795C>A	c.(2794-2796)tCc>tAc	p.S932Y	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S835Y|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	932					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S932Y(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CGTGCTGTTGGACGGGGACAG	0.557																																					p.S932Y	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2795A	16						.						91.0	75.0	81.0					16																	51173338		2198	4300	6498	49730839	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2795C>A	16.37:g.51173338G>T	ENSP00000251020:p.Ser932Tyr		49730839	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	9.236	1.037078	0.19669	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.80480	-1.38;-1.38	5.46	5.46	0.80206	.	0.276346	0.41938	D	0.000791	T	0.71508	0.3348	L	0.40543	1.245	0.58432	D	0.999999	B	0.31910	0.346	B	0.26864	0.074	T	0.69351	-0.5168	10	0.07030	T	0.85	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	932	Q9NSC2	SALL1_HUMAN	Y	932;835;896	ENSP00000251020:S932Y;ENSP00000407914:S835Y	ENSP00000251020:S932Y	S	-	2	0	SALL1	49730839	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.549000	0.67261	2.557000	0.86248	0.455000	0.32223	TCC		0.557	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
FTO	79068	broad.mit.edu	37	16	53860210	53860210	+	Silent	SNP	C	C	T	rs45492996		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr16:53860210C>T	ENST00000471389.1	+	3	780	c.558C>T	c.(556-558)aaC>aaT	p.N186N	FTO_ENST00000394647.3_Intron	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	186	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)	p.N186N(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						CATCCTACAACGGACAAGATG	0.453																																					p.N186N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C558T	16						.						155.0	133.0	141.0					16																	53860210		2198	4300	6498	52417711	SO:0001819	synonymous_variant	79068	exon3			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.558C>T	16.37:g.53860210C>T			52417711	NM_001080432	A2RUH1|B2RNS0|Q0P676|Q7Z785	Silent	SNP	ENST00000471389.1	37	CCDS32448.1																																																																																				0.453	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432	
DHX38	9785	broad.mit.edu	37	16	72137013	72137013	+	Missense_Mutation	SNP	G	G	A	rs373210227		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr16:72137013G>A	ENST00000268482.3	+	12	2049	c.1540G>A	c.(1540-1542)Gaa>Aaa	p.E514K	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	514					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.E514K(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GAGAAAGAGCGAAGCCAGCAG	0.507																																					p.E514K	Melanoma(97;711 1442 7855 13832 28836)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1540A	16						.	G	LYS/GLU	0,4396		0,0,2198	119.0	113.0	115.0		1540	5.6	1.0	16		115	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX38	NM_014003.3	56	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	514/1228	72137013	1,12995	2198	4300	6498	70694514	SO:0001583	missense	9785	exon12			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1540G>A	16.37:g.72137013G>A	ENSP00000268482:p.Glu514Lys		70694514	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	37	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103893	0.76983	0.0	1.16E-4	ENSG00000140829	ENST00000268482	T	0.09911	2.93	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.10294	0.0252	L	0.52266	1.64	0.80722	D	1	P	0.42973	0.796	B	0.29524	0.103	T	0.27536	-1.0071	10	0.17369	T	0.5	.	19.5375	0.95260	0.0:0.0:1.0:0.0	.	514	Q92620	PRP16_HUMAN	K	514	ENSP00000268482:E514K	ENSP00000268482:E514K	E	+	1	0	DHX38	70694514	1.000000	0.71417	0.959000	0.39883	0.968000	0.65278	9.363000	0.97131	2.620000	0.88729	0.655000	0.94253	GAA		0.507	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
FANCA	2175	broad.mit.edu	37	16	89809219	89809219	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr16:89809219C>T	ENST00000389301.3	-	37	3784	c.3754G>A	c.(3754-3756)Gag>Aag	p.E1252K	FANCA_ENST00000568369.1_Missense_Mutation_p.E1252K	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1252					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.E1252K(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TCCTCTCTCTCGCAGTCCAGC	0.463			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E1252K		yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3754A	16						.						112.0	96.0	101.0					16																	89809219		2198	4300	6498	88336720	SO:0001583	missense	2175	exon37	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3754G>A	16.37:g.89809219C>T	ENSP00000373952:p.Glu1252Lys		88336720	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	9.359	1.067615	0.20067	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.84370	-1.84	4.85	0.467	0.16721	.	1.893460	0.02818	N	0.125240	T	0.80597	0.4653	L	0.40543	1.245	0.09310	N	0.999999	B;B;B	0.21688	0.001;0.059;0.059	B;B;B	0.08055	0.001;0.003;0.003	T	0.63024	-0.6729	10	0.42905	T	0.14	1.1324	10.0451	0.42182	0.0:0.418:0.4979:0.0841	.	229;1252;1252	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	K	1252;229	ENSP00000373952:E1252K	ENSP00000306281:E229K	E	-	1	0	FANCA	88336720	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	-0.059000	0.13154	-0.233000	0.12211	GAG		0.463	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
KSR1	8844	broad.mit.edu	37	17	25910015	25910016	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr17:25910015_25910016insC	ENST00000319524.6	+	4	864_865	c.864_865insC	c.(865-867)cccfs	p.P289fs	KSR1_ENST00000268763.6_Frame_Shift_Ins_p.P152fs|KSR1_ENST00000398988.3_Frame_Shift_Ins_p.P152fs|KSR1_ENST00000509603.2_Frame_Shift_Ins_p.P289fs			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	289	Poly-Pro.				Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P292fs*22(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CACCACGGACGCCCCCCCCACC	0.678																																					p.T151fs	Esophageal Squamous(88;1120 1336 6324 10502 16832)											.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.453_454insC	17						.																																			22934143	SO:0001589	frameshift_variant	8844	exon5			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.872dupC	17.37:g.25910023_25910023dupC	ENSP00000323178:p.Pro289fs		22934142	NM_014238	F8WEA9|H7BYU0|Q13476	Frame_Shift_Ins	INS	ENST00000319524.6	37																																																																																					0.678	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	
SDK2	54549	broad.mit.edu	37	17	71427712	71427712	+	Missense_Mutation	SNP	G	G	A	rs572942777		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr17:71427712G>A	ENST00000392650.3	-	11	1409	c.1409C>T	c.(1408-1410)gCg>gTg	p.A470V	SDK2_ENST00000388726.3_Missense_Mutation_p.A470V	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	470	Ig-like C2-type 5.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.A470V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTAGGTCCCCGCATCGGAGAT	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		16263	0.001		0.0	False		,,,				2504	0.0				p.A470V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1409T	17						.						133.0	132.0	133.0					17																	71427712		2203	4300	6503	68939307	SO:0001583	missense	54549	exon11			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1409C>T	17.37:g.71427712G>A	ENSP00000376421:p.Ala470Val		68939307	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468552	0.43839	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.68479	-0.33;-0.33	4.75	4.75	0.60458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.132848	0.50627	D	0.000111	T	0.62514	0.2434	L	0.60904	1.88	0.58432	D	0.999998	P;B	0.42941	0.794;0.299	B;B	0.35813	0.211;0.21	T	0.69266	-0.5190	10	0.52906	T	0.07	.	17.3273	0.87252	0.0:0.0:1.0:0.0	.	470;470	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	V	94;470;470;470	ENSP00000376421:A470V;ENSP00000373378:A470V	ENSP00000324967:A470V	A	-	2	0	SDK2	68939307	1.000000	0.71417	0.072000	0.20136	0.021000	0.10359	7.146000	0.77373	2.165000	0.68154	0.467000	0.42956	GCG		0.627	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
ZNF532	55205	broad.mit.edu	37	18	56587706	56587706	+	Silent	SNP	G	G	A	rs139763599	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr18:56587706G>A	ENST00000336078.4	+	4	2963	c.2187G>A	c.(2185-2187)tcG>tcA	p.S729S	ZNF532_ENST00000591083.1_Silent_p.S729S|ZNF532_ENST00000589288.1_Silent_p.S729S|ZNF532_ENST00000591808.1_Silent_p.S729S|ZNF532_ENST00000591230.1_Silent_p.S729S	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	729					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S729S(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CAGTCATATCGGCTCCTTCAA	0.483													G|||	9	0.00179712	0.0061	0.0014	5008	,	,		17911	0.0		0.0	False		,,,				2504	0.0				p.S729S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2187A	18						.	G		29,4377	35.2+/-66.4	0,29,2174	43.0	39.0	41.0		2187	-11.1	0.4	18	dbSNP_134	41	0,8600		0,0,4300	no	coding-synonymous	ZNF532	NM_018181.4		0,29,6474	AA,AG,GG		0.0,0.6582,0.223		729/1302	56587706	29,12977	2203	4300	6503	54738686	SO:0001819	synonymous_variant	55205	exon4			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2187G>A	18.37:g.56587706G>A			54738686	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	ENST00000336078.4	37	CCDS11969.1																																																																																				0.483	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
RANBP3	8498	broad.mit.edu	37	19	5951555	5951556	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr19:5951555_5951556insC	ENST00000340578.6	-	3	187_188	c.130_131insG	c.(130-132)gagfs	p.E44fs	RANBP3_ENST00000034275.8_Intron|RANBP3_ENST00000591092.1_Intron|RANBP3_ENST00000439268.2_Frame_Shift_Ins_p.E44fs|RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000591124.1_Intron	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	44					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						GGCCTCAGCCTCCCCCCGAGGC	0.599																																					p.E44fs												.	.	0			c.131_132insG	19						.																																			5902556	SO:0001589	frameshift_variant	8498	exon3			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.131dupG	19.37:g.5951561_5951561dupC	ENSP00000341483:p.Glu44fs		5902555	NM_003624	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Frame_Shift_Ins	INS	ENST00000340578.6	37	CCDS42478.1																																																																																				0.599	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
CACNA1A	773	broad.mit.edu	37	19	13445248	13445248	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr19:13445248C>T	ENST00000360228.5	-	8	1141	c.1142G>A	c.(1141-1143)cGg>cAg	p.R381Q	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R381Q	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	381					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.R381Q(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGTTGTTGCCGCCTCAGCTT	0.532																																					p.R381Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1142A	19						.						104.0	102.0	103.0					19																	13445248		1897	4114	6011	13306248	SO:0001583	missense	773	exon8			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1142G>A	19.37:g.13445248C>T	ENSP00000353362:p.Arg381Gln		13306248	NM_001174080	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.529184	0.85706	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.93076	-3.16	5.13	5.13	0.70059	.	0.153352	0.41823	D	0.000804	D	0.97362	0.9137	M	0.91459	3.21	0.48830	D	0.999719	D;D	0.89917	0.999;1.0	D;D	0.79108	0.978;0.992	D	0.97797	1.0242	10	0.56958	D	0.05	.	17.7333	0.88384	0.0:1.0:0.0:0.0	.	381;381	O00555;Q9NS88	CAC1A_HUMAN;.	Q	381	ENSP00000353362:R381Q	ENSP00000317661:R381Q	R	-	2	0	CACNA1A	13306248	0.993000	0.37304	1.000000	0.80357	0.994000	0.84299	7.326000	0.79133	2.543000	0.85770	0.655000	0.94253	CGG		0.532	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
ZNF430	80264	broad.mit.edu	37	19	21239615	21239615	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr19:21239615G>C	ENST00000261560.5	+	5	682	c.501G>C	c.(499-501)caG>caC	p.Q167H	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	167					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q167H(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						AACTAAACCAGTGTTTGACAA	0.303																																					p.Q166H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G498C	19						.						67.0	67.0	67.0					19																	21239615		2203	4300	6503	21031455	SO:0001583	missense	80264	exon5			AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.501G>C	19.37:g.21239615G>C	ENSP00000261560:p.Gln167His		21031455	NM_001172671	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	8.938	0.965113	0.18583	.	.	ENSG00000118620	ENST00000261560	T	0.39056	1.1	1.23	-1.42	0.08913	.	.	.	.	.	T	0.62539	0.2436	M	0.89715	3.055	0.09310	N	1	D;B	0.67145	0.996;0.096	D;B	0.75484	0.986;0.062	T	0.51020	-0.8758	9	0.39692	T	0.17	.	5.3905	0.16242	0.4128:0.0:0.5872:0.0	.	166;167	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	H	167	ENSP00000261560:Q167H	ENSP00000261560:Q167H	Q	+	3	2	ZNF430	21031455	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	0.225000	0.17757	-0.233000	0.09797	-0.391000	0.06502	CAG		0.303	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
CLCNKB	1188	broad.mit.edu	37	1	16378854	16378854	+	Missense_Mutation	SNP	G	G	A	rs114387880	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr1:16378854G>A	ENST00000375679.4	+	15	1681	c.1570G>A	c.(1570-1572)Gtc>Atc	p.V524I	CLCNKB_ENST00000375667.3_Missense_Mutation_p.V355I	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	524					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)	p.V524I(3)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TGATGGCACCGTCATTGTCAA	0.607													A|||	63	0.0125799	0.0378	0.0029	5008	,	,		16935	0.004		0.005	False		,,,				2504	0.002				p.V355I												.	.	3	Substitution - Missense(3)	skin(2)|large_intestine(1)	c.G1063A	1						.						48.0	50.0	49.0					1																	16378854		2202	4300	6502	16251441	SO:0001583	missense	1188	exon8			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.1570G>A	1.37:g.16378854G>A	ENSP00000364831:p.Val524Ile		16251441	NM_001165945	B3KUY3|Q5T5Q7|Q5T5Q8	Missense_Mutation	SNP	ENST00000375679.4	37	CCDS168.1	25	0.011446886446886446	19	0.03861788617886179	2	0.0055248618784530384	2	0.0034965034965034965	2	0.002638522427440633	a	0.485	-0.878053	0.02550	.	.	ENSG00000184908	ENST00000375668;ENST00000375679;ENST00000331579;ENST00000375667;ENST00000431772	D;D;T	0.92199	-2.99;-2.99;0.49	4.04	4.04	0.47022	Chloride channel, core (2);	0.250223	0.41938	N	0.000796	T	0.29093	0.0723	N	0.00057	-2.36	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.60229	-0.7304	10	0.02654	T	1	.	6.399	0.21628	0.8011:0.0:0.1989:0.0	.	355;524	Q5T5Q7;P51801	.;CLCKB_HUMAN	I	22;524;396;355;13	ENSP00000364831:V524I;ENSP00000364819:V355I;ENSP00000389344:V13I	ENSP00000332055:V396I	V	+	1	0	CLCNKB	16251441	1.000000	0.71417	0.998000	0.56505	0.646000	0.38490	4.902000	0.63266	0.614000	0.30107	-0.381000	0.06696	GTC		0.607	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
SOAT1	6646	broad.mit.edu	37	1	179308682	179308682	+	Splice_Site	SNP	T	T	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr1:179308682T>C	ENST00000367619.3	+	6	640		c.e6+2		SOAT1_ENST00000540564.1_Splice_Site|SOAT1_ENST00000539888.1_Splice_Site|SOAT1_ENST00000535686.1_Splice_Site	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)	p.?(1)		central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	TGAAGGAAGGTAAGACAACAA	0.358																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	1						.						129.0	120.0	123.0					1																	179308682		2203	4300	6503	177575305	SO:0001630	splice_region_variant	6646	.			L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.497+2T>C	1.37:g.179308682T>C			177575305	.	A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Splice_Site	SNP	ENST00000367619.3	37	CCDS1330.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606365	0.87157	.	.	ENSG00000057252	ENST00000539888;ENST00000540564;ENST00000367619;ENST00000426956	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4268	0.61030	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SOAT1	177575305	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.847000	0.86896	2.055000	0.61198	0.533000	0.62120	.		0.358	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085286.2	NM_003101	Intron
CFH	3075	broad.mit.edu	37	1	196695661	196695661	+	Silent	SNP	G	G	A	rs56035657	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr1:196695661G>A	ENST00000367429.4	+	13	2175	c.1935G>A	c.(1933-1935)acG>acA	p.T645T		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	645	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.T645T(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AGGAAAAAACGAAAGAAGAAT	0.353																																					p.T645T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1935A	1						.						91.0	97.0	95.0					1																	196695661		2203	4300	6503	194962284	SO:0001819	synonymous_variant	3075	exon13			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1935G>A	1.37:g.196695661G>A			194962284	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	37	CCDS1385.1																																																																																				0.353	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
ITPA	3704	broad.mit.edu	37	20	3204085	3204085	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:3204085T>G	ENST00000380113.3	+	8	754	c.562T>G	c.(562-564)Tac>Gac	p.Y188D	ITPA_ENST00000399838.3_Missense_Mutation_p.Y147D|ITPA_ENST00000455664.2_Missense_Mutation_p.Y171D|ITPA_ENST00000483354.1_3'UTR	NM_033453.3|NM_181493.2	NP_258412.1|NP_852470.1			inosine triphosphatase (nucleoside triphosphate pyrophosphatase)									p.Y188D(1)		autonomic_ganglia(1)|large_intestine(3)|ovary(1)|stomach(1)	6						GCTGCAGGAGTACTTTGGCAG	0.632																																					p.Y188D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T562G	20						.						50.0	40.0	43.0					20																	3204085		2203	4300	6503	3152085	SO:0001583	missense	3704	exon8			AF026816	CCDS13051.1, CCDS46576.1, CCDS58762.1	20p	2002-02-01			ENSG00000125877	ENSG00000125877	3.6.1.19		6176	protein-coding gene	gene with protein product		147520		C20orf37		11278832	Standard	NM_033453		Approved	HLC14-06-P, dJ794I6.3	uc002wid.4	Q9BY32	OTTHUMG00000031738	ENST00000380113.3:c.562T>G	20.37:g.3204085T>G	ENSP00000369456:p.Tyr188Asp		3152085	NM_033453		Missense_Mutation	SNP	ENST00000380113.3	37	CCDS13051.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303184	0.81136	.	.	ENSG00000125877	ENST00000380113;ENST00000455664;ENST00000399838	.	.	.	5.82	4.71	0.59529	.	0.250208	0.40818	N	0.001017	T	0.76919	0.4055	M	0.90019	3.08	0.34442	D	0.699746	D;D	0.56035	0.974;0.969	D;P	0.69654	0.965;0.875	D	0.85256	0.1047	9	0.87932	D	0	.	8.9026	0.35503	0.0:0.0864:0.0:0.9136	.	171;188	B2BCH7;Q9BY32	.;ITPA_HUMAN	D	188;171;147	.	ENSP00000369456:Y188D	Y	+	1	0	ITPA	3152085	0.971000	0.33674	0.622000	0.29159	0.428000	0.31595	1.862000	0.39448	2.225000	0.72522	0.460000	0.39030	TAC		0.632	ITPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077719.2		
SLC4A11	83959	broad.mit.edu	37	20	3211400	3211400	+	Silent	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:3211400C>T	ENST00000380056.3	-	10	1355	c.1308G>A	c.(1306-1308)gcG>gcA	p.A436A	SLC4A11_ENST00000539553.2_Silent_p.A420A|SLC4A11_ENST00000380059.3_Silent_p.A463A|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	436	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.A436A(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GCGCCAGGGGCGCGGTGGTCA	0.687																																					p.A463A	NSCLC(190;922 2139 10266 10292 38692)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1389A	20						.						38.0	46.0	43.0					20																	3211400		2203	4300	6503	3159400	SO:0001819	synonymous_variant	83959	exon11			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1308G>A	20.37:g.3211400C>T			3159400	NM_001174090	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Silent	SNP	ENST00000380056.3	37	CCDS13052.1																																																																																				0.687	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
MYBL2	4605	broad.mit.edu	37	20	42344603	42344603	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:42344603C>T	ENST00000217026.4	+	14	2106	c.1979C>T	c.(1978-1980)tCc>tTc	p.S660F	MYBL2_ENST00000396863.4_Missense_Mutation_p.S636F	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	660					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S660F(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCCCAGATGTCCAGTGCCTGG	0.612																																					p.S660F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1979T	20						.						116.0	124.0	121.0					20																	42344603		2203	4300	6503	41778017	SO:0001583	missense	4605	exon14				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1979C>T	20.37:g.42344603C>T	ENSP00000217026:p.Ser660Phe		41778017	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896983	0.72639	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.15718	2.4;2.41	4.97	4.97	0.65823	.	0.326514	0.33631	N	0.004709	T	0.23014	0.0556	L	0.48642	1.525	0.42596	D	0.993268	P;P	0.42123	0.771;0.771	B;B	0.43783	0.431;0.424	T	0.01993	-1.1233	10	0.72032	D	0.01	-21.326	17.3976	0.87450	0.0:1.0:0.0:0.0	.	636;660	F8W6N6;P10244	.;MYBB_HUMAN	F	636;660	ENSP00000380072:S636F;ENSP00000217026:S660F	ENSP00000217026:S660F	S	+	2	0	MYBL2	41778017	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	4.312000	0.59154	2.474000	0.83562	0.561000	0.74099	TCC		0.612	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
SDC4	6385	broad.mit.edu	37	20	43964468	43964468	+	Silent	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:43964468G>A	ENST00000372733.3	-	2	192	c.153C>T	c.(151-153)ccC>ccT	p.P51P	SDC4_ENST00000537976.1_Intron	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	51					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.P51P(1)	SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				ATTCCTGCCCGGGCCCCACTA	0.582			T	ROS1	NSCLC																																p.P51P			Dom	yes		20	20q12	6385	syndecan 4		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C153T	20						.						76.0	69.0	71.0					20																	43964468		2203	4300	6503	43397882	SO:0001819	synonymous_variant	6385	exon2			X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.153C>T	20.37:g.43964468G>A			43397882	NM_002999	O00773|Q16833|Q53FN9|Q6FGN3	Silent	SNP	ENST00000372733.3	37	CCDS13350.1																																																																																				0.582	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
ZNF334	55713	broad.mit.edu	37	20	45130557	45130557	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:45130557G>T	ENST00000347606.4	-	5	1603	c.1421C>A	c.(1420-1422)tCa>tAa	p.S474*	ZNF334_ENST00000593880.1_Nonsense_Mutation_p.S497*|ZNF334_ENST00000457685.2_Nonsense_Mutation_p.S436*	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S474*(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				AGTGAGTGTTGACTTATGGCA	0.368																																					p.S474X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1421A	20						.						102.0	99.0	100.0					20																	45130557		2203	4299	6502	44563964	SO:0001587	stop_gained	55713	exon5			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1421C>A	20.37:g.45130557G>T	ENSP00000255129:p.Ser474*		44563964	NM_018102	Q5T6U2|Q9NVW4	Nonsense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	G	47	13.397747	0.99739	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	.	.	.	3.45	1.28	0.21552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3034	0.21125	0.1174:0.1906:0.692:0.0	.	.	.	.	X	436;474	.	ENSP00000255129:S474X	S	-	2	0	ZNF334	44563964	0.000000	0.05858	0.360000	0.25837	0.991000	0.79684	-0.068000	0.11561	0.778000	0.33520	0.591000	0.81541	TCA		0.368	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
PHACTR3	116154	broad.mit.edu	37	20	58381232	58381232	+	Silent	SNP	C	C	T	rs200786094	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr20:58381232C>T	ENST00000371015.1	+	8	1778	c.1311C>T	c.(1309-1311)atC>atT	p.I437I	PHACTR3_ENST00000359926.3_Silent_p.I434I|PHACTR3_ENST00000355648.4_Silent_p.I396I|PHACTR3_ENST00000395636.2_Silent_p.I396I|PHACTR3_ENST00000361300.4_Silent_p.I326I|PHACTR3_ENST00000395639.4_Silent_p.I326I|PHACTR3_ENST00000541461.1_Silent_p.I396I	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	437						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.I437I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GGCAGCAGATCGAGATGAAGC	0.567													C|||	3	0.000599042	0.0	0.0043	5008	,	,		18975	0.0		0.0	False		,,,				2504	0.0				p.I437I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1311T	20						.	C	,,,,	2,4404	4.2+/-10.8	0,2,2201	76.0	79.0	78.0		1302,1188,1311,1188,978	-8.6	0.2	20		78	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PHACTR3	NM_001199505.1,NM_001199506.1,NM_080672.3,NM_183244.1,NM_183246.1	,,,,	0,6,6497	TT,TC,CC		0.0465,0.0454,0.0461	,,,,	434/557,396/519,437/560,396/519,326/449	58381232	6,13000	2203	4300	6503	57814627	SO:0001819	synonymous_variant	116154	exon8			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1311C>T	20.37:g.58381232C>T			57814627	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	ENST00000371015.1	37	CCDS13480.1																																																																																				0.567	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
DSCAM	1826	broad.mit.edu	37	21	41559141	41559141	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr21:41559141C>T	ENST00000400454.1	-	14	3173	c.2696G>A	c.(2695-2697)cGc>cAc	p.R899H		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	899	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R899H(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGTAATTGTGCGTGCTTTGAC	0.438																																					p.R899H	Melanoma(134;970 1778 1785 21664 32388)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2696A	21						.						170.0	170.0	170.0					21																	41559141		1947	4143	6090	40481011	SO:0001583	missense	1826	exon14			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2696G>A	21.37:g.41559141C>T	ENSP00000383303:p.Arg899His		40481011	NM_001389	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261595	0.95368	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.57436	0.4;0.4	5.18	5.18	0.71444	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	M	0.62016	1.91	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	T	0.73310	-0.4023	10	0.62326	D	0.03	.	19.0429	0.93008	0.0:1.0:0.0:0.0	.	899	O60469	DSCAM_HUMAN	H	899;651	ENSP00000383303:R899H;ENSP00000385342:R651H	ENSP00000383303:R899H	R	-	2	0	DSCAM	40481011	1.000000	0.71417	0.984000	0.44739	0.975000	0.68041	7.678000	0.84035	2.563000	0.86464	0.561000	0.74099	CGC		0.438	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
KRTAP12-4	386684	broad.mit.edu	37	21	46074522	46074522	+	Missense_Mutation	SNP	T	T	G	rs76605324		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr21:46074522T>G	ENST00000391618.1	-	1	54	c.10A>C	c.(10-12)Acc>Ccc	p.T4P	TSPEAR_ENST00000323084.4_Intron	NM_198698.1	NP_941971.1	P60329	KR124_HUMAN	keratin associated protein 12-4	4						keratin filament (GO:0045095)				lung(4)|ovary(1)|prostate(1)	6						GAGTGGCTGGTGTGGCACATG	0.652																																					p.T4P												.	.	0			c.A10C	21						.						10.0	14.0	13.0					21																	46074522		2033	4170	6203	44898950	SO:0001583	missense	386684	exon1			AB076360	CCDS42963.1	21q22.3	2006-03-13			ENSG00000212933	ENSG00000212933		"""Keratin associated proteins"""	20532	protein-coding gene	gene with protein product							Standard	NM_198698		Approved	KRTAP12.4	uc002zfs.1	P60329	OTTHUMG00000057633	ENST00000391618.1:c.10A>C	21.37:g.46074522T>G	ENSP00000375476:p.Thr4Pro		44898950	NM_198698	Q08AF5	Missense_Mutation	SNP	ENST00000391618.1	37	CCDS42963.1	.	.	.	.	.	.	.	.	.	.	t	12.57	1.978775	0.34942	.	.	ENSG00000212933	ENST00000391618	T	0.02216	4.39	4.93	1.08	0.20341	.	.	.	.	.	T	0.04048	0.0113	L	0.55213	1.73	0.29008	N	0.887068	P	0.36587	0.559	P	0.44647	0.456	T	0.30707	-0.9969	9	0.72032	D	0.01	.	4.452	0.11624	0.0:0.1817:0.1673:0.651	.	4	P60329	KR124_HUMAN	P	4	ENSP00000375476:T4P	ENSP00000375476:T4P	T	-	1	0	KRTAP12-4	44898950	0.027000	0.19231	0.970000	0.41538	0.028000	0.11728	0.154000	0.16343	0.005000	0.14708	0.383000	0.25322	ACC		0.652	KRTAP12-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128036.1		
ZC3H7B	23264	broad.mit.edu	37	22	41728267	41728268	+	Intron	INS	-	-	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr22:41728267_41728268insC	ENST00000352645.4	+	7	839				ZC3H7B_ENST00000351589.4_Intron	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B						viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TCTCAGTTTATCCATTATGAGA	0.559																																					.												.	.	0			.	22						.																																			40058214	SO:0001627	intron_variant	23264	.				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.582+36->C	22.37:g.41728269_41728269dupC			40058213	.	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Frame_Shift_Ins	INS	ENST00000352645.4	37	CCDS14013.1																																																																																				0.559	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
LARGE	9215	broad.mit.edu	37	22	33670427	33670427	+	Missense_Mutation	SNP	C	C	T	rs139853494		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr22:33670427C>T	ENST00000354992.2	-	16	2828	c.2257G>A	c.(2257-2259)Gag>Aag	p.E753K	LARGE_ENST00000437602.2_Missense_Mutation_p.E704K|LARGE_ENST00000337431.2_Missense_Mutation_p.E701K|LARGE_ENST00000397394.2_Missense_Mutation_p.E753K|LARGE_ENST00000452586.2_Missense_Mutation_p.E552K|LARGE_ENST00000402320.1_Missense_Mutation_p.E701K	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	753					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.E753K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CTGTTGTTCTCGGCTGTGAGA	0.532											OREG0026497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E753K	Colon(70;397 1175 4573 19089 45288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2257A	22						.	C	LYS/GLU,LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	123.0	113.0	116.0		2257,2257	6.2	1.0	22	dbSNP_134	116	0,8600		0,0,4300	no	missense,missense	LARGE	NM_004737.4,NM_133642.3	56,56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	753/757,753/757	33670427	2,13004	2203	4300	6503	32000427	SO:0001583	missense	9215	exon15			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.2257G>A	22.37:g.33670427C>T	ENSP00000347088:p.Glu753Lys	841	32000427	NM_133642	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.370831	0.82573	4.54E-4	0.0	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.52983	1.07;1.14;1.07;1.14;0.65;0.64	6.16	6.16	0.99307	.	0.087960	0.85682	D	0.000000	T	0.49881	0.1583	L	0.48642	1.525	0.80722	D	1	P;P;P;P	0.51147	0.904;0.865;0.942;0.816	B;B;P;B	0.44860	0.273;0.199;0.462;0.178	T	0.37478	-0.9704	10	0.37606	T	0.19	-18.0513	20.8598	0.99761	0.0:1.0:0.0:0.0	.	704;552;701;753	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	K	753;701;753;701;552;704	ENSP00000347088:E753K;ENSP00000336636:E701K;ENSP00000380549:E753K;ENSP00000385223:E701K;ENSP00000407917:E552K;ENSP00000388544:E704K	ENSP00000336636:E701K	E	-	1	0	LARGE	32000427	0.963000	0.33076	0.994000	0.49952	0.995000	0.86356	2.250000	0.43178	2.937000	0.99478	0.650000	0.86243	GAG		0.532	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
FBLN1	2192	broad.mit.edu	37	22	45970414	45970414	+	Missense_Mutation	SNP	C	C	T	rs200901023	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr22:45970414C>T	ENST00000327858.6	+	15	1816	c.1721C>T	c.(1720-1722)aCg>aTg	p.T574M	FBLN1_ENST00000348697.2_Intron	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	574	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.T574M(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		AAGACAGACACGGTCCGCTGC	0.642													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17323	0.001		0.0	False		,,,				2504	0.0				p.T574M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1721T	22						.						182.0	100.0	127.0					22																	45970414		2203	4300	6503	44349078	SO:0001583	missense	2192	exon15				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1721C>T	22.37:g.45970414C>T	ENSP00000331544:p.Thr574Met		44349078	NM_006486	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.96	2.987935	0.53934	.	.	ENSG00000077942	ENST00000327858	D	0.83992	-1.79	4.99	4.99	0.66335	Epidermal growth factor-like (1);	0.061241	0.64402	D	0.000004	D	0.89054	0.6606	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.89055	0.3458	10	0.48119	T	0.1	.	16.0349	0.80617	0.0:1.0:0.0:0.0	.	574	P23142	FBLN1_HUMAN	M	574	ENSP00000331544:T574M	ENSP00000331544:T574M	T	+	2	0	FBLN1	44349078	0.997000	0.39634	0.913000	0.36048	0.113000	0.19764	3.694000	0.54742	2.301000	0.77427	0.462000	0.41574	ACG		0.642	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
NCKAP5	344148	broad.mit.edu	37	2	133547627	133547627	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:133547627G>A	ENST00000409261.1	-	13	1434	c.1061C>T	c.(1060-1062)aCg>aTg	p.T354M	NCKAP5_ENST00000317721.6_Missense_Mutation_p.T354M|NCKAP5_ENST00000405974.3_Missense_Mutation_p.T354M|NCKAP5_ENST00000409213.1_Missense_Mutation_p.T354M	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	354	Ser-rich.							p.T354M(1)|p.T193M(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATCGTGCCACGTGTAGGAGGA	0.512																																					p.T354M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1061T	2						.						62.0	66.0	65.0					2																	133547627		2053	4201	6254	133264097	SO:0001583	missense	344148	exon13			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1061C>T	2.37:g.133547627G>A	ENSP00000387128:p.Thr354Met		133264097	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633206	0.87660	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.64438	1.82;-0.1;1.82;-0.1	5.12	5.12	0.69794	.	0.000000	0.32901	U	0.005501	T	0.70456	0.3226	L	0.29908	0.895	0.35784	D	0.821841	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	T	0.77991	-0.2379	10	0.87932	D	0	.	16.9089	0.86135	0.0:0.0:1.0:0.0	.	354;354	O14513-2;O14513	.;NCKP5_HUMAN	M	354	ENSP00000387128:T354M;ENSP00000386952:T354M;ENSP00000380603:T354M;ENSP00000385692:T354M	ENSP00000380603:T354M	T	-	2	0	NCKAP5	133264097	1.000000	0.71417	0.946000	0.38457	0.952000	0.60782	6.379000	0.73154	2.658000	0.90341	0.650000	0.86243	ACG		0.512	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
WDSUB1	151525	broad.mit.edu	37	2	160139504	160139504	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:160139504G>A	ENST00000409990.3	-	2	333	c.77C>T	c.(76-78)gCt>gTt	p.A26V	WDSUB1_ENST00000409124.1_Missense_Mutation_p.A26V|WDSUB1_ENST00000392796.3_Missense_Mutation_p.A26V|WDSUB1_ENST00000359774.4_Missense_Mutation_p.A26V|WDSUB1_ENST00000358147.4_Missense_Mutation_p.A26V	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	26							ubiquitin-protein transferase activity (GO:0004842)	p.A26V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GGAGCAAGTAGCCAAGAGGGA	0.433																																					p.A26V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C77T	2						.						119.0	114.0	115.0					2																	160139504		2203	4300	6503	159847750	SO:0001583	missense	151525	exon2			AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.77C>T	2.37:g.160139504G>A	ENSP00000387078:p.Ala26Val		159847750	NM_152528	Q53TI9|Q8N6N8	Missense_Mutation	SNP	ENST00000409990.3	37	CCDS2208.1	.	.	.	.	.	.	.	.	.	.	G	33	5.240782	0.95240	.	.	ENSG00000196151	ENST00000359774;ENST00000358147;ENST00000392796;ENST00000409990;ENST00000409124	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77116	0.4083	L	0.55103	1.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.91635	0.998;0.999;0.936	T	0.77648	-0.2509	10	0.62326	D	0.03	.	19.4966	0.95075	0.0:0.0:1.0:0.0	.	26;26;26	Q8N9V3-2;B8ZZF2;Q8N9V3	.;.;WSDU1_HUMAN	V	26	ENSP00000352820:A26V;ENSP00000350866:A26V;ENSP00000376545:A26V;ENSP00000387078:A26V;ENSP00000386891:A26V	ENSP00000350866:A26V	A	-	2	0	WDSUB1	159847750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.879000	0.87236	2.616000	0.88540	0.650000	0.86243	GCT		0.433	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528	
ZDBF2	57683	broad.mit.edu	37	2	207175670	207175670	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:207175670C>T	ENST00000374423.3	+	5	6804	c.6418C>T	c.(6418-6420)Ctt>Ttt	p.L2140F		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2140							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.L2140F(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TGCTCGTGAGCTTCCAAAGAA	0.363																																					p.L2140F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6418T	2						.						46.0	46.0	46.0					2																	207175670		1812	4087	5899	206883915	SO:0001583	missense	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6418C>T	2.37:g.207175670C>T	ENSP00000363545:p.Leu2140Phe		206883915	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914901	0.52546	.	.	ENSG00000204186	ENST00000374423	T	0.46451	0.87	4.85	-1.7	0.08159	.	.	.	.	.	T	0.16257	0.0391	N	0.02011	-0.69	0.09310	N	1	B	0.21381	0.055	B	0.15484	0.013	T	0.18053	-1.0349	9	0.66056	D	0.02	.	7.6597	0.28396	0.5511:0.2369:0.212:0.0	.	2140	Q9HCK1	ZDBF2_HUMAN	F	2140	ENSP00000363545:L2140F	ENSP00000363545:L2140F	L	+	1	0	ZDBF2	206883915	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.511000	0.06321	-0.773000	0.04596	-2.554000	0.00176	CTT		0.363	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
HEATR5B	54497	broad.mit.edu	37	2	37234426	37234426	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:37234426T>A	ENST00000233099.5	-	29	4639	c.4544A>T	c.(4543-4545)gAa>gTa	p.E1515V	HEATR5B_ENST00000354531.2_Missense_Mutation_p.E1515V	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1515						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.E1515V(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				ATCAATAGTTTCAGGGGTATA	0.378																																					p.E1515V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4544T	2						.						65.0	65.0	65.0					2																	37234426		2203	4300	6503	37087930	SO:0001583	missense	54497	exon29			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.4544A>T	2.37:g.37234426T>A	ENSP00000233099:p.Glu1515Val		37087930	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.972980	0.92919	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.52526	0.66;0.66	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.111226	0.64402	D	0.000012	T	0.67543	0.2904	M	0.76574	2.34	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.65537	-0.6144	10	0.28530	T	0.3	-8.5697	16.1103	0.81259	0.0:0.0:0.0:1.0	.	1515	Q9P2D3	HTR5B_HUMAN	V	1515	ENSP00000233099:E1515V;ENSP00000346531:E1515V	ENSP00000233099:E1515V	E	-	2	0	HEATR5B	37087930	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.809000	0.86057	2.207000	0.71202	0.482000	0.46254	GAA		0.378	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
PSME4	23198	broad.mit.edu	37	2	54101492	54101492	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:54101492T>A	ENST00000404125.1	-	43	5139	c.5084A>T	c.(5083-5085)gAg>gTg	p.E1695V	PSME4_ENST00000476586.1_Intron|PSME4_ENST00000421748.2_Missense_Mutation_p.E839V	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1695	Bromodomain-like (BRDL).				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.E1581V(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TTGTTCGTCCTCCAAAAGACT	0.353																																					p.E1695V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5084T	2						.						90.0	94.0	92.0					2																	54101492		2203	4300	6503	53954996	SO:0001583	missense	23198	exon43			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.5084A>T	2.37:g.54101492T>A	ENSP00000384211:p.Glu1695Val		53954996	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	18.81	3.704003	0.68501	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.66638	-0.22;-0.22	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74275	0.3695	L	0.60845	1.875	0.80722	D	1	D;P;D	0.58268	0.982;0.458;0.982	P;B;P	0.56163	0.793;0.083;0.489	T	0.71721	-0.4507	10	0.29301	T	0.29	-6.842	16.3979	0.83621	0.0:0.0:0.0:1.0	.	1070;839;1695	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	V	839;1695	ENSP00000410830:E839V;ENSP00000384211:E1695V	ENSP00000384211:E1695V	E	-	2	0	PSME4	53954996	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.655000	0.83696	2.333000	0.79357	0.533000	0.62120	GAG		0.353	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
REG1B	5968	broad.mit.edu	37	2	79313940	79313940	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:79313940C>A	ENST00000305089.3	-	3	261	c.181G>T	c.(181-183)Gat>Tat	p.D61Y		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	61	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.D61Y(2)|p.D61H(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						TCACTCACATCTGCATCAACC	0.507																																					p.D61Y												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G181T	2						.						140.0	134.0	136.0					2																	79313940		2203	4300	6503	79167448	SO:0001583	missense	5968	exon3				CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.181G>T	2.37:g.79313940C>A	ENSP00000303206:p.Asp61Tyr		79167448	NM_006507		Missense_Mutation	SNP	ENST00000305089.3	37	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.077046	0.76415	.	.	ENSG00000172023	ENST00000454188;ENST00000305089	T;T	0.07800	3.16;3.16	3.74	3.74	0.42951	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.369581	0.19616	N	0.110007	T	0.24624	0.0597	M	0.69463	2.115	0.34030	D	0.653679	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.985	T	0.27739	-1.0065	10	0.87932	D	0	.	11.2197	0.48846	0.0:1.0:0.0:0.0	.	61;61	Q6ICS1;P48304	.;REG1B_HUMAN	Y	12;61	ENSP00000387410:D12Y;ENSP00000303206:D61Y	ENSP00000303206:D61Y	D	-	1	0	REG1B	79167448	0.003000	0.15002	0.933000	0.37362	0.677000	0.39632	0.215000	0.17562	2.087000	0.62958	0.561000	0.74099	GAT		0.507	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507	
SCLY	51540	broad.mit.edu	37	2	238990351	238990351	+	Splice_Site	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr2:238990351G>A	ENST00000555827.1	+	5	550	c.486G>A	c.(484-486)gcG>gcA	p.A162A	SCLY_ENST00000429612.2_Intron|SCLY_ENST00000480859.1_3'UTR|SCLY_ENST00000422984.2_Splice_Site_p.A68A|SCLY_ENST00000254663.6_Splice_Site_p.A170A|SCLY_ENST00000409736.2_Splice_Site_p.A162A|SCLY_ENST00000373332.3_Splice_Site_p.T80T			Q96I15	SCLY_HUMAN	selenocysteine lyase	162					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)	p.A162A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		GTTTCCCAGCGGTCACCTTTG	0.532																																					p.A162A	Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G486A	2						.						88.0	83.0	85.0					2																	238990351		2203	4300	6503	238655090	SO:0001630	splice_region_variant	51540	exon5			AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.485-1G>A	2.37:g.238990351G>A			238655090	NM_016510	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Silent	SNP	ENST00000555827.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.057|8.057	0.767303|0.767303	0.15983|0.15983	.|.	.|.	ENSG00000132330|ENSG00000132330	ENST00000437134|ENST00000431487	.|.	.|.	.|.	5.84|5.84	-1.94|-1.94	0.07571|0.07571	.|.	.|.	.|.	.|.	.|.	T|T	0.38348|0.38348	0.1037|0.1037	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31943|0.31943	-0.9925|-0.9925	4|4	.|.	.|.	.|.	.|.	0.4396|0.4396	0.00484|0.00484	0.3449:0.2738:0.1718:0.2096|0.3449:0.2738:0.1718:0.2096	.|.	.|.	.|.	.|.	S|Q	6|8	.|.	.|.	G|R	+|+	1|2	0|0	SCLY|SCLY	238655090|238655090	0.016000|0.016000	0.18221|0.18221	0.698000|0.698000	0.30274|0.30274	0.336000|0.336000	0.28762|0.28762	-0.726000|-0.726000	0.04936|0.04936	-0.215000|-0.215000	0.10063|0.10063	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.532	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	Silent
ACKR4	51554	broad.mit.edu	37	3	132319804	132319804	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:132319804T>C	ENST00000249887.2	+	2	659	c.563T>C	c.(562-564)tTc>tCc	p.F188S	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000264990.6_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	188					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.F188S(2)									ATTCCCATTTTCCCCCGCTAC	0.428																																					p.F188S												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.T563C	3						.						17.0	16.0	16.0					3																	132319804		2197	4275	6472	133802494	SO:0001583	missense	51554	exon1			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.563T>C	3.37:g.132319804T>C	ENSP00000249887:p.Phe188Ser		133802494	NM_178445	B2R9U7	Missense_Mutation	SNP	ENST00000249887.2	37	CCDS3075.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.296532	0.60086	.	.	ENSG00000129048	ENST00000249887;ENST00000424114	T	0.38401	1.14	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.056613	0.64402	D	0.000001	T	0.55561	0.1928	M	0.78344	2.41	0.43000	D	0.994513	D	0.60575	0.988	P	0.59357	0.856	T	0.61724	-0.7004	10	0.72032	D	0.01	.	11.201	0.48741	0.1369:0.0:0.0:0.8631	.	188	Q9NPB9	CCRL1_HUMAN	S	188	ENSP00000249887:F188S	ENSP00000249887:F188S	F	+	2	0	CCRL1	133802494	0.995000	0.38212	0.728000	0.30774	0.726000	0.41606	2.643000	0.46604	2.206000	0.71126	0.533000	0.62120	TTC		0.428	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
SCN11A	11280	broad.mit.edu	37	3	38908898	38908898	+	Missense_Mutation	SNP	C	C	T	rs536925812	byFrequency	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:38908898C>T	ENST00000302328.3	-	23	4063	c.3865G>A	c.(3865-3867)Gta>Ata	p.V1289I	SCN11A_ENST00000450244.1_Missense_Mutation_p.V1289I|SCN11A_ENST00000456224.3_Missense_Mutation_p.V1251I|SCN11A_ENST00000444237.2_Missense_Mutation_p.V1289I	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1289					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V1289I(2)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATAAAGACTACGAAGTAAATG	0.338													C|||	3	0.000599042	0.0	0.0014	5008	,	,		19155	0.0		0.001	False		,,,				2504	0.001				p.V1289I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3865A	3						.						133.0	129.0	130.0					3																	38908898		2203	4300	6503	38883902	SO:0001583	missense	11280	exon23			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3865G>A	3.37:g.38908898C>T	ENSP00000307599:p.Val1289Ile		38883902	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424285	0.25639	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0	5.27	3.48	0.39840	Ion transport (1);	0.126562	0.53938	N	0.000059	D	0.96636	0.8902	L	0.61218	1.895	0.42202	D	0.991773	P	0.38504	0.634	B	0.39419	0.299	D	0.94349	0.7577	10	0.40728	T	0.16	.	10.9198	0.47158	0.0:0.8467:0.0:0.1533	.	1289	Q9UI33	SCNBA_HUMAN	I	1289;1289;1251;1289	ENSP00000307599:V1289I;ENSP00000400945:V1289I;ENSP00000416757:V1251I;ENSP00000408028:V1289I	ENSP00000307599:V1289I	V	-	1	0	SCN11A	38883902	1.000000	0.71417	0.296000	0.24974	0.161000	0.22273	2.730000	0.47335	0.615000	0.30124	0.561000	0.74099	GTA		0.338	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
ACKR2	1238	broad.mit.edu	37	3	42906014	42906014	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:42906014C>T	ENST00000422265.1	+	3	195	c.20C>T	c.(19-21)cCg>cTg	p.P7L	ACKR2_ENST00000273145.2_Missense_Mutation_p.P7L|RP11-141M3.5_ENST00000471537.1_RNA|ACKR2_ENST00000442925.1_Missense_Mutation_p.P7L|KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Intron	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	7					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.P7L(1)									ACTGCCTCTCCGCAGCCACTC	0.537																																					p.P7L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C20T	3						.						52.0	53.0	52.0					3																	42906014		2203	4300	6503	42881018	SO:0001583	missense	1238	exon3			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.20C>T	3.37:g.42906014C>T	ENSP00000416996:p.Pro7Leu		42881018	NM_001296	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.170398	0.38315	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.72167	-0.63;-0.63;-0.63	5.31	4.44	0.53790	.	2.567660	0.01690	N	0.026633	T	0.67363	0.2885	L	0.47716	1.5	0.26890	N	0.967348	B;B	0.26635	0.155;0.001	B;B	0.13407	0.009;0.002	T	0.52003	-0.8633	10	0.40728	T	0.16	.	10.2149	0.43162	0.0:0.908:0.0:0.092	.	7;7	O00590;Q7Z7I1	CCBP2_HUMAN;.	L	7	ENSP00000396150:P7L;ENSP00000416996:P7L;ENSP00000273145:P7L	ENSP00000273145:P7L	P	+	2	0	CCBP2	42881018	0.000000	0.05858	0.010000	0.14722	0.014000	0.08584	0.601000	0.24119	1.252000	0.44001	-0.217000	0.12591	CCG		0.537	ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296	
SHISA5	51246	broad.mit.edu	37	3	48538723	48538723	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:48538723C>T	ENST00000296444.2	-	2	416	c.80G>A	c.(79-81)cGt>cAt	p.R27H	SHISA5_ENST00000442747.1_De_novo_Start_OutOfFrame|SHISA5_ENST00000443308.2_Missense_Mutation_p.R27H|SHISA5_ENST00000444115.1_De_novo_Start_OutOfFrame	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	27					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.R27H(1)		large_intestine(1)|lung(1)	2						CACCTCACCACGTGCTGGAGA	0.597																																					p.R27H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G80A	3						.						138.0	104.0	115.0					3																	48538723		2203	4300	6503	48513727	SO:0001583	missense	51246	exon2			AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.80G>A	3.37:g.48538723C>T	ENSP00000296444:p.Arg27His		48513727	NM_016479	B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	De_novo_Start_OutOfFrame	SNP	ENST00000296444.2	37	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.354044	0.24512	.	.	ENSG00000164054	ENST00000296444;ENST00000443308	T;T	0.41758	0.99;0.99	4.58	-9.16	0.00694	.	3.050000	0.00841	N	0.001745	T	0.14141	0.0342	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14615	-1.0466	10	0.15066	T	0.55	.	2.3675	0.04323	0.2434:0.4054:0.1245:0.2267	.	27;27	F8W9N8;Q8N114	.;SHSA5_HUMAN	H	27	ENSP00000296444:R27H;ENSP00000395373:R27H	ENSP00000296444:R27H	R	-	2	0	SHISA5	48513727	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.942000	0.03921	-1.909000	0.01085	-0.247000	0.11927	CGT		0.597	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479	
IFRD2	7866	broad.mit.edu	37	3	50325919	50325919	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:50325919C>T	ENST00000429673.2	-	11	1360	c.1361G>A	c.(1360-1362)cGt>cAt	p.R454H	IFRD2_ENST00000417626.2_Missense_Mutation_p.R390H|IFRD2_ENST00000484043.1_5'Flank|IFRD2_ENST00000336089.4_Missense_Mutation_p.R556H|IFRD2_ENST00000436390.1_Missense_Mutation_p.R390H			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	454						nucleus (GO:0005634)		p.R556H(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AAAGATGTCACGGAGTAGCTC	0.607																																					p.R454H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1361A	3						.						50.0	61.0	58.0					3																	50325919		2133	4236	6369	50300923	SO:0001583	missense	7866	exon11			U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.1361G>A	3.37:g.50325919C>T	ENSP00000398971:p.Arg454His		50300923	NM_006764	Q9BVB4|Q9UJ88	Missense_Mutation	SNP	ENST00000429673.2	37	CCDS46831.1	.	.	.	.	.	.	.	.	.	.	C	34	5.295804	0.95574	.	.	ENSG00000214706	ENST00000417626;ENST00000426499;ENST00000436390;ENST00000336089;ENST00000429673	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.93	5.93	0.95920	Interferon-related developmental regulator, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84672	0.0712	10	0.51188	T	0.08	-14.543	17.8477	0.88736	0.0:1.0:0.0:0.0	.	454;556	Q12894;Q9UJ88	IFRD2_HUMAN;.	H	390;25;390;556;454	ENSP00000402849:R390H;ENSP00000408549:R25H;ENSP00000392316:R390H;ENSP00000336936:R556H;ENSP00000398971:R454H	ENSP00000336936:R556H	R	-	2	0	IFRD2	50300923	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.295000	0.78780	2.826000	0.97356	0.655000	0.94253	CGT		0.607	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006764	
TLR9	54106	broad.mit.edu	37	3	52257576	52257576	+	Silent	SNP	G	G	A	rs200139837		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:52257576G>A	ENST00000360658.2	-	2	1389	c.756C>T	c.(754-756)ggC>ggT	p.G252G	TLR9_ENST00000494383.1_Missense_Mutation_p.R406W|TLR9_ENST00000597542.1_Silent_p.G276G	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	252					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.G252G(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GGCAATTTCCGCCCACATCGA	0.622																																					p.G252G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C756T	3						.						37.0	30.0	33.0					3																	52257576		2203	4300	6503	52232616	SO:0001819	synonymous_variant	54106	exon2			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.756C>T	3.37:g.52257576G>A			52232616	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Silent	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.421777	0.01126	.	.	ENSG00000173366	ENST00000494383	.	.	.	5.38	-10.8	0.00216	.	.	.	.	.	T	0.21145	0.0509	.	.	.	0.24063	N	0.996002	.	.	.	.	.	.	T	0.07481	-1.0770	4	.	.	.	.	5.24	0.15467	0.2978:0.2198:0.4096:0.0728	.	.	.	.	W	406	.	.	R	-	1	2	RP11-330H6.5	52232616	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-5.442000	0.00122	-3.879000	0.00096	-2.902000	0.00092	CGG		0.622	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
STAG1	10274	broad.mit.edu	37	3	136261013	136261013	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr3:136261013C>T	ENST00000383202.2	-	6	675	c.419G>A	c.(418-420)cGa>cAa	p.R140Q	STAG1_ENST00000236698.5_Missense_Mutation_p.R140Q|STAG1_ENST00000480733.1_Missense_Mutation_p.R140Q|STAG1_ENST00000434713.2_5'UTR	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	140					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.R140Q(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CTGCATATTTCGAAACATCTC	0.308																																					p.R140Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G419A	3						.						142.0	136.0	138.0					3																	136261013		2202	4287	6489	137743703	SO:0001583	missense	10274	exon6			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.419G>A	3.37:g.136261013C>T	ENSP00000372689:p.Arg140Gln		137743703	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.266115	0.40095	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000480733	T;T	0.22945	1.93;1.94	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.17831	0.0428	L	0.31207	0.915	0.80722	D	1	B;B;P;B	0.39250	0.007;0.165;0.665;0.007	B;B;B;B	0.32583	0.005;0.015;0.148;0.005	T	0.05517	-1.0880	10	0.11794	T	0.64	.	18.3821	0.90454	0.0:1.0:0.0:0.0	.	157;140;140;140	Q4LE48;C9JJQ0;Q6P275;Q8WVM7	.;.;.;STAG1_HUMAN	Q	140	ENSP00000372689:R140Q;ENSP00000236698:R140Q	ENSP00000236698:R140Q	R	-	2	0	STAG1	137743703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.513000	0.73742	2.501000	0.84356	0.462000	0.41574	CGA		0.308	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
FAM47E-STBD1	100631383	broad.mit.edu	37	4	77230986	77230986	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr4:77230986G>A	ENST00000237642.6	+	2	1654	c.910G>A	c.(910-912)Gat>Aat	p.D304N	FAM47E_ENST00000515604.1_3'UTR|FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.D155N	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough									p.D304N(1)									CTATAACAAGGATGGGTTCTG	0.473																																					p.D304N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G910A	4						.						194.0	178.0	183.0					4																	77230986		2203	4300	6503	77450010	SO:0001583	missense	8987	exon2				CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.910G>A	4.37:g.77230986G>A	ENSP00000237642:p.Asp304Asn		77450010	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220655	0.58560	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	D;D	0.88277	-2.36;-2.36	5.4	5.4	0.78164	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (2);Immunoglobulin-like fold (1);	0.286278	0.26948	N	0.021685	D	0.89629	0.6770	N	0.20685	0.6	0.48696	D	0.999695	D	0.63880	0.993	D	0.63113	0.911	D	0.88838	0.3310	10	0.36615	T	0.2	-16.2132	19.3673	0.94469	0.0:0.0:1.0:0.0	.	304	O95210	STBD1_HUMAN	N	155;304	ENSP00000442265:D155N;ENSP00000237642:D304N	ENSP00000237642:D304N	D	+	1	0	STBD1	77450010	1.000000	0.71417	0.020000	0.16555	0.004000	0.04260	8.580000	0.90784	2.805000	0.96524	0.655000	0.94253	GAT		0.473	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
TACR3	6870	broad.mit.edu	37	4	104640590	104640590	+	Silent	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr4:104640590C>T	ENST00000304883.2	-	1	383	c.243G>A	c.(241-243)ccG>ccA	p.P81P		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	81					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.P81P(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TGCGCCAGGACGGCTGCACGA	0.647																																					p.P81P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G243A	4						.						85.0	83.0	84.0					4																	104640590		2203	4300	6503	104860039	SO:0001819	synonymous_variant	6870	exon1			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.243G>A	4.37:g.104640590C>T			104860039	NM_001059	Q0P510	Silent	SNP	ENST00000304883.2	37	CCDS3664.1																																																																																				0.647	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
CDC25C	995	broad.mit.edu	37	5	137622869	137622869	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:137622869C>T	ENST00000323760.6	-	11	1293	c.1015G>A	c.(1015-1017)Gga>Aga	p.G339R	CDC25C_ENST00000513970.1_Missense_Mutation_p.G339R|CDC25C_ENST00000357274.3_Missense_Mutation_p.G296R|CDC25C_ENST00000415130.2_Missense_Mutation_p.G266R|CDC25C_ENST00000348983.3_Missense_Mutation_p.G266R|CDC25C_ENST00000356505.3_Missense_Mutation_p.G309R|CDC25C_ENST00000514555.1_Missense_Mutation_p.G309R	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	339	HIV-1 Vpr binding site.|Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)	p.G339R(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TGGATGTGTCCTCCCAGATAC	0.473																																					p.G339R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1015A	5						.						107.0	104.0	105.0					5																	137622869		2203	4300	6503	137650768	SO:0001583	missense	995	exon11			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.1015G>A	5.37:g.137622869C>T	ENSP00000321656:p.Gly339Arg		137650768	NM_001790	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	37	CCDS4202.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.481148|4.481148	0.84747|0.84747	.|.	.|.	ENSG00000158402|ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555|ENST00000514017	T;T;T;T;T;T;T|.	0.52057|.	0.68;0.68;0.68;0.68;0.68;0.68;0.68|.	4.98|4.98	4.98|4.98	0.66077|0.66077	Rhodanese-like (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88481|0.88481	0.6448|0.6448	H|H	0.97390|0.97390	3.995|3.995	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	D|D	0.92221|0.92221	0.5784|0.5784	10|5	0.87932|.	D|.	0|.	-19.9208|-19.9208	17.5534|17.5534	0.87884|0.87884	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	356;309;266;339|.	G3V1P6;P30307-2;P30307-4;P30307|.	.;.;.;MPIP3_HUMAN|.	R|K	339;309;296;266;266;339;356;309|140	ENSP00000321656:G339R;ENSP00000348898:G309R;ENSP00000349821:G296R;ENSP00000345205:G266R;ENSP00000392631:G266R;ENSP00000424795:G339R;ENSP00000425470:G309R|.	ENSP00000321656:G339R|.	G|R	-|-	1|2	0|0	CDC25C|CDC25C	137650768|137650768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.055000|6.055000	0.71103|0.71103	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GGA|AGG		0.473	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1		
PCDHB5	26167	broad.mit.edu	37	5	140516749	140516749	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:140516749C>T	ENST00000231134.5	+	1	1950	c.1733C>T	c.(1732-1734)gCg>gTg	p.A578V		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	578	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A578V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGCCCCGGGCGGCCGAGCCG	0.701																																					p.A578V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1733T	5						.						18.0	24.0	22.0					5																	140516749		2101	4167	6268	140496933	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1733C>T	5.37:g.140516749C>T	ENSP00000231134:p.Ala578Val		140496933	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.93|11.93	1.786516|1.786516	0.31593|0.31593	.|.	.|.	ENSG00000113209|ENSG00000113209	ENST00000231134|ENST00000537936	T|.	0.20463|.	2.07|.	4.48|4.48	3.53|3.53	0.40419|0.40419	Cadherin (2);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.36496|0.36496	0.0969|0.0969	L|L	0.35341|0.35341	1.055|1.055	0.09310|0.09310	N|N	1|1	B|.	0.29085|.	0.232|.	B|.	0.30572|.	0.117|.	T|T	0.27297|0.27297	-1.0078|-1.0078	9|6	0.56958|0.87932	D|D	0.05|0	.|.	6.4474|6.4474	0.21883|0.21883	0.0:0.6833:0.1805:0.1362|0.0:0.6833:0.1805:0.1362	.|.	578|.	Q9Y5E4|.	PCDB5_HUMAN|.	V|W	578|362	ENSP00000231134:A578V|.	ENSP00000231134:A578V|ENSP00000446220:R362W	A|R	+|+	2|1	0|2	PCDHB5|PCDHB5	140496933|140496933	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.789000|0.789000	0.44602|0.44602	0.115000|0.115000	0.15540|0.15540	2.214000|2.214000	0.71695|0.71695	0.194000|0.194000	0.17425|0.17425	GCG|CGG		0.701	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHGA7	56108	broad.mit.edu	37	5	140762870	140762870	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:140762870C>T	ENST00000518325.1	+	1	404	c.404C>T	c.(403-405)aCg>aTg	p.T135M	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	135	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T135M(1)		NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATTCTTGACGGAAGAAATA	0.408																																					p.T135M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C404T	5						.						60.0	66.0	64.0					5																	140762870		1910	4145	6055	140743054	SO:0001583	missense	56108	exon1			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.404C>T	5.37:g.140762870C>T	ENSP00000430024:p.Thr135Met		140743054	NM_032087	B2RN87|Q9Y5D0	Missense_Mutation	SNP	ENST00000518325.1	37	CCDS54927.1	.	.	.	.	.	.	.	.	.	.	.	4.396	0.073047	0.08485	.	.	ENSG00000253537	ENST00000518325	T	0.20200	2.09	5.01	-0.531	0.11894	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.12263	0.0298	L	0.43152	1.355	0.09310	N	1	B;B	0.34372	0.302;0.451	B;B	0.25884	0.026;0.064	T	0.23476	-1.0187	9	0.51188	T	0.08	.	1.3133	0.02102	0.1927:0.3885:0.1058:0.313	.	135;135	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	M	135	ENSP00000430024:T135M	ENSP00000430024:T135M	T	+	2	0	PCDHGA7	140743054	0.000000	0.05858	0.035000	0.18076	0.794000	0.44872	-2.819000	0.00750	-0.038000	0.13624	-0.345000	0.07892	ACG		0.408	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920	
TENM2	57451	broad.mit.edu	37	5	167489220	167489220	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:167489220G>A	ENST00000518659.1	+	7	1504	c.1465G>A	c.(1465-1467)Gct>Act	p.A489T	TENM2_ENST00000403607.2_Missense_Mutation_p.A322T|TENM2_ENST00000519204.1_Missense_Mutation_p.A368T|TENM2_ENST00000545108.1_Missense_Mutation_p.A489T|TENM2_ENST00000520394.1_Missense_Mutation_p.A257T	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	489					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.A322T(1)|p.A489T(1)									CGGGAAGGACGCTCTCTTTGG	0.433																																					p.A489T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1465A	5						.						118.0	116.0	117.0					5																	167489220		1917	4130	6047	167421798	SO:0001583	missense	57451	exon7			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1465G>A	5.37:g.167489220G>A	ENSP00000429430:p.Ala489Thr		167421798	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.507786	0.96386	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.47	5.47	0.80525	.	0.054564	0.64402	D	0.000001	T	0.56016	0.1957	M	0.82193	2.58	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.975;0.999	D;P;D	0.66847	0.932;0.533;0.947	T	0.61845	-0.6979	10	0.87932	D	0	.	19.3422	0.94347	0.0:0.0:1.0:0.0	.	489;257;368	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	T	489;489;368;257;322	ENSP00000429430:A489T;ENSP00000438635:A489T;ENSP00000428964:A368T;ENSP00000427874:A257T;ENSP00000384905:A322T	ENSP00000384905:A322T	A	+	1	0	ODZ2	167421798	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.804000	0.99143	2.567000	0.86603	0.655000	0.94253	GCT		0.433	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
DAB2	1601	broad.mit.edu	37	5	39394380	39394380	+	Missense_Mutation	SNP	C	C	T	rs201380557		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:39394380C>T	ENST00000320816.6	-	2	510	c.43G>A	c.(43-45)Gac>Aac	p.D15N	DAB2_ENST00000545653.1_Missense_Mutation_p.D15N|DAB2_ENST00000339788.6_Missense_Mutation_p.D15N|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000509337.1_Missense_Mutation_p.D15N	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	15					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.D15N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GCCTGTTGGTCGGGCTGACCA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		19060	0.001		0.0	False		,,,				2504	0.0				p.D15N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G43A	5						.						166.0	144.0	152.0					5																	39394380		2203	4300	6503	39430137	SO:0001583	missense	1601	exon2			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.43G>A	5.37:g.39394380C>T	ENSP00000313391:p.Asp15Asn		39430137	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	CCDS34149.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.69	3.451975	0.63290	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337;ENST00000511792;ENST00000503513;ENST00000515700	T;T;T;T	0.35236	1.33;1.35;1.32;1.32	5.87	5.87	0.94306	.	0.369878	0.33631	N	0.004710	T	0.38719	0.1051	L	0.36672	1.1	0.34525	D	0.708585	D;D	0.65815	0.995;0.981	P;P	0.48815	0.59;0.591	T	0.51196	-0.8736	10	0.56958	D	0.05	-12.9912	15.6516	0.77099	0.0:0.8635:0.1365:0.0	.	15;15	P98082;P98082-3	DAB2_HUMAN;.	N	15	ENSP00000313391:D15N;ENSP00000345508:D15N;ENSP00000439919:D15N;ENSP00000426245:D15N	ENSP00000313391:D15N	D	-	1	0	DAB2	39430137	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	5.154000	0.64894	2.782000	0.95742	0.561000	0.74099	GAC		0.502	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
RHOBTB3	22836	broad.mit.edu	37	5	95124549	95124549	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:95124549T>G	ENST00000379982.3	+	11	2215	c.1707T>G	c.(1705-1707)ttT>ttG	p.F569L	RHOBTB3_ENST00000504179.1_Missense_Mutation_p.F200L|GLRX_ENST00000508780.1_Intron|GLRX_ENST00000507605.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	569	Interaction with Rab9.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)	p.F569L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		AGCCTGAATTTCAGGATCTTT	0.333																																					p.F569L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1707G	5						.						124.0	116.0	119.0					5																	95124549		2203	4300	6503	95150305	SO:0001583	missense	22836	exon11			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.1707T>G	5.37:g.95124549T>G	ENSP00000369318:p.Phe569Leu		95150305	NM_014899	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	ENST00000379982.3	37	CCDS4077.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	15.10|15.10|15.10	2.732443|2.732443|2.732443	0.48939|0.48939|0.48939	.|.|.	.|.|.	ENSG00000164292|ENSG00000164292|ENSG00000164292	ENST00000510313;ENST00000502611|ENST00000379982;ENST00000504179|ENST00000503737;ENST00000513091;ENST00000514198	D|T;T|.	0.83992|0.74632|.	-1.79|-0.18;-0.86|.	5.57|5.57|5.57	4.37|4.37|4.37	0.52481|0.52481|0.52481	.|.|.	0.000000|0.000000|.	0.85682|0.85682|.	D|D|.	0.000000|0.000000|.	T|T|T	0.50069|0.50069|0.50069	0.1594|0.1594|0.1594	L|L|L	0.33485|0.33485|0.33485	1.01|1.01|1.01	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D|.	.|0.59357|.	.|0.985|.	.|P|.	.|0.56514|.	.|0.8|.	T|T|T	0.39761|0.39761|0.39761	-0.9598|-0.9598|-0.9598	8|10|5	0.87932|0.29301|.	D|T|.	0|0.29|.	-22.7337|-22.7337|-22.7337	8.7442|8.7442|8.7442	0.34575|0.34575|0.34575	0.0:0.1503:0.0:0.8497|0.0:0.1503:0.0:0.8497|0.0:0.1503:0.0:0.8497	.|.|.	.|569|.	.|O94955|.	.|RHBT3_HUMAN|.	C|L|A	151;7|569;200|72;11;9	ENSP00000424844:F151C|ENSP00000369318:F569L;ENSP00000422360:F200L|.	ENSP00000423891:F7C|ENSP00000369318:F569L|.	F|F|S	+|+|+	2|3|1	0|2|0	RHOBTB3|RHOBTB3|RHOBTB3	95150305|95150305|95150305	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	2.974000|2.974000|2.974000	0.49272|0.49272|0.49272	0.903000|0.903000|0.903000	0.36546|0.36546|0.36546	0.482000|0.482000|0.482000	0.46254|0.46254|0.46254	TTC|TTT|TCA		0.333	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241658.1	NM_014899	
APC	324	broad.mit.edu	37	5	112175223	112175224	+	Frame_Shift_Del	DEL	TT	TT	-	rs201706728		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	TT	TT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:112175223_112175224delTT	ENST00000457016.1	+	16	4312_4313	c.3932_3933delTT	c.(3931-3933)attfs	p.I1311fs	APC_ENST00000257430.4_Frame_Shift_Del_p.I1311fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.I1311fs			P25054	APC_HUMAN	adenomatous polyposis coli	1311	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.I1311fs*9(2)|p.I1311fs*3(1)|p.I1311fs*4(1)|p.?(1)|p.K1192fs*3(1)|p.I1311fs*12(1)|p.G1312fs*1(1)|p.G1312fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAAGAAAAGATTGGAACTAGGT	0.431		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.1293_1293del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	9	Deletion - Frameshift(5)|Insertion - Frameshift(3)|Unknown(1)	large_intestine(7)|soft_tissue(1)|skin(1)	c.3878_3879del	5	GRCh37	CD054294|CD086047	APC	D		.																																			112203123	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3932_3933delTT	5.37:g.112175223_112175224delTT	ENSP00000413133:p.Ile1311fs		112203122	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.431	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLIT3	6586	broad.mit.edu	37	5	168180901	168180901	+	Silent	SNP	G	G	A	rs559665628		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr5:168180901G>A	ENST00000519560.1	-	17	2216	c.1797C>T	c.(1795-1797)cgC>cgT	p.R599R	SLIT3_ENST00000332966.8_Silent_p.R599R|SLIT3_ENST00000404867.3_Silent_p.R599R	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	599					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.R599R(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACGGAACACGCGCCCGTGCA	0.617													g|||	1	0.000199681	0.0008	0.0	5008	,	,		19280	0.0		0.0	False		,,,				2504	0.0				p.R599R	Ovarian(29;311 847 10864 17279 24903)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1797T	5						.						52.0	49.0	50.0					5																	168180901		2203	4300	6503	168113479	SO:0001819	synonymous_variant	6586	exon17			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1797C>T	5.37:g.168180901G>A			168113479	NM_003062	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																				0.617	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
HIST1H2BG	8339	broad.mit.edu	37	6	26216635	26216635	+	Silent	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr6:26216635G>A	ENST00000244601.3	-	1	237	c.237C>T	c.(235-237)tcC>tcT	p.S79S	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	79					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S79S(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				GGGCCAGACGGGAAGCCTCGC	0.572																																					p.S79S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C237T	6						.						139.0	129.0	133.0					6																	26216635		2203	4300	6503	26324614	SO:0001819	synonymous_variant	8339	exon1			M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.237C>T	6.37:g.26216635G>A			26324614	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	CCDS4594.1																																																																																				0.572	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
MUC21	394263	broad.mit.edu	37	6	30954710	30954710	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr6:30954710G>A	ENST00000376296.3	+	2	999	c.758G>A	c.(757-759)gGc>gAc	p.G253D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	253	28 X 15 AA approximate tandem repeats.|Ser-rich.		G -> S (in dbSNP:rs41288655). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14574404}.		cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G253D(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTGGGGCCGGCACAGCCACC	0.637																																					p.G253D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G758A	6						.						136.0	139.0	138.0					6																	30954710		2203	4300	6503	31062689	SO:0001583	missense	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.758G>A	6.37:g.30954710G>A	ENSP00000365473:p.Gly253Asp		31062689	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462611	0.26248	.	.	ENSG00000204544	ENST00000376296	T	0.01767	4.65	4.3	0.0583	0.14327	.	.	.	.	.	T	0.00300	0.0009	N	0.08118	0	0.09310	N	1	B	0.26708	0.157	B	0.21917	0.037	T	0.38499	-0.9658	8	.	.	.	.	2.1953	0.03909	0.0974:0.2655:0.3359:0.3012	.	253	Q5SSG8	MUC21_HUMAN	D	253	ENSP00000365473:G253D	.	G	+	2	0	MUC21	31062689	0.000000	0.05858	0.001000	0.08648	0.075000	0.17131	-0.909000	0.04058	0.174000	0.19809	0.491000	0.48974	GGC		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
RIPPLY2	134701	broad.mit.edu	37	6	84567098	84567098	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr6:84567098G>C	ENST00000369689.1	+	4	528	c.377G>C	c.(376-378)tGt>tCt	p.C126S	RIPPLY2_ENST00000369687.1_Missense_Mutation_p.C68S|CYB5R4_ENST00000369679.4_5'Flank|CYB5R4_ENST00000369681.5_5'Flank	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	126					bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)		p.C126S(1)		large_intestine(2)|lung(4)|urinary_tract(1)	7						GATCTGACCTGTGAAAATTAA	0.284																																					p.C126S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G377C	6						.						54.0	59.0	57.0					6																	84567098		2194	4291	6485	84623817	SO:0001583	missense	134701	exon4			BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.377G>C	6.37:g.84567098G>C	ENSP00000358703:p.Cys126Ser		84623817	NM_001009994	Q5TAB6	Missense_Mutation	SNP	ENST00000369689.1	37	CCDS34493.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069064	0.36470	.	.	ENSG00000203877	ENST00000369689;ENST00000369687	.	.	.	5.31	2.31	0.28768	.	0.411423	0.25744	N	0.028587	T	0.14313	0.0346	L	0.47716	1.5	0.26904	N	0.96704	B	0.32467	0.372	B	0.32677	0.15	T	0.14090	-1.0485	9	0.87932	D	0	-8.0727	2.2141	0.03955	0.347:0.0:0.4186:0.2344	.	126	Q5TAB7	RIPP2_HUMAN	S	126;68	.	ENSP00000358701:C68S	C	+	2	0	RIPPLY2	84623817	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	0.956000	0.29202	0.783000	0.33636	-0.143000	0.13931	TGT		0.284	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041360.1	NM_001009994	
SLC35F1	222553	broad.mit.edu	37	6	118588218	118588218	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr6:118588218C>T	ENST00000360388.4	+	4	739	c.538C>T	c.(538-540)Cgg>Tgg	p.R180W		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	180					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.R180W(1)		breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		CCTGCTGATCCGGTACAAGGC	0.517																																					p.R180W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C538T	6						.						408.0	364.0	379.0					6																	118588218		2203	4300	6503	118694911	SO:0001583	missense	222553	exon4			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.538C>T	6.37:g.118588218C>T	ENSP00000353557:p.Arg180Trp		118694911	NM_001029858	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	ENST00000360388.4	37	CCDS34524.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657879	0.88154	.	.	ENSG00000196376	ENST00000360388	T	0.72282	-0.64	4.99	4.99	0.66335	.	0.066676	0.64402	D	0.000016	D	0.85022	0.5602	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86920	0.2066	10	0.87932	D	0	-20.5192	18.8278	0.92125	0.0:1.0:0.0:0.0	.	180	Q5T1Q4	S35F1_HUMAN	W	180	ENSP00000353557:R180W	ENSP00000353557:R180W	R	+	1	2	SLC35F1	118694911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.959000	0.40412	2.756000	0.94617	0.561000	0.74099	CGG		0.517	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044	
NYAP1	222950	broad.mit.edu	37	7	100087051	100087052	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr7:100087051_100087052insG	ENST00000300179.2	+	4	1866_1867	c.1707_1708insG	c.(1708-1710)gggfs	p.G570fs	NYAP1_ENST00000454988.1_Frame_Shift_Ins_p.G513fs|NYAP1_ENST00000423930.1_Frame_Shift_Ins_p.G570fs	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	570					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCCTCAAGGCTGGGGGGGTGCT	0.644																																					p.A569fs												.	.	0			c.1707_1708insG	7						.																																			99924988	SO:0001589	frameshift_variant	222950	exon4			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1714dupG	7.37:g.100087058_100087058dupG	ENSP00000300179:p.Gly570fs		99924987	NM_173564	Q6U9Y3|Q8N1V0	Frame_Shift_Ins	INS	ENST00000300179.2	37	CCDS5696.1																																																																																				0.644	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
DNAH11	8701	broad.mit.edu	37	7	21657313	21657313	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr7:21657313C>A	ENST00000409508.3	+	23	4203	c.4172C>A	c.(4171-4173)aCa>aAa	p.T1391K	DNAH11_ENST00000328843.6_Missense_Mutation_p.T1396K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1396	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1396K(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AAGGACATGACAGCCTCCCTG	0.522									Kartagener syndrome																												p.T1396K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4187A	7						.						61.0	60.0	60.0					7																	21657313		1934	4135	6069	21623838	SO:0001583	missense	8701	exon23	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4172C>A	7.37:g.21657313C>A	ENSP00000475939:p.Thr1391Lys		21623838	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	10.53	1.376000	0.24857	.	.	ENSG00000105877	ENST00000328843	T	0.56776	0.44	5.48	-6.17	0.02091	Dynein heavy chain, domain-2 (1);	0.875794	0.09865	N	0.745691	T	0.20780	0.0500	.	.	.	0.09310	N	1	B	0.24768	0.111	B	0.22152	0.038	T	0.37430	-0.9706	9	0.02654	T	1	.	9.032	0.36264	0.0:0.1246:0.2229:0.6525	.	1396	Q96DT5	DYH11_HUMAN	K	1396	ENSP00000330671:T1396K	ENSP00000330671:T1396K	T	+	2	0	DNAH11	21623838	0.003000	0.15002	0.000000	0.03702	0.098000	0.18820	1.510000	0.35790	-1.051000	0.03226	-0.414000	0.06135	ACA		0.522	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
TRRAP	8295	broad.mit.edu	37	7	98550868	98550868	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr7:98550868G>T	ENST00000359863.4	+	39	5730	c.5521G>T	c.(5521-5523)Gag>Tag	p.E1841*	TRRAP_ENST00000446306.3_Nonsense_Mutation_p.E1822*|TRRAP_ENST00000355540.3_Nonsense_Mutation_p.E1823*	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1841					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.E1823*(1)|p.E1841*(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCTGCTGGTGGAGCACGCCCC	0.642																																					p.E1823X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G5467T	7						.						114.0	91.0	99.0					7																	98550868		2203	4300	6503	98388804	SO:0001587	stop_gained	8295	exon38			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5521G>T	7.37:g.98550868G>T	ENSP00000352925:p.Glu1841*		98388804	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Nonsense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	48|48	14.416124|14.416124	0.99794|0.99794	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80053	.|0.4553	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77595	.|-0.2529	.|3	0.09338|.	T|.	0.73|.	.|.	20.1184|20.1184	0.97949|0.97949	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|C	1841;1823;1821|1562	.|.	ENSP00000347733:E1823X|.	E|W	+|+	1|3	0|0	TRRAP|TRRAP	98388804|98388804	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.869000|9.869000	0.99810|0.99810	2.769000|2.769000	0.95229|0.95229	0.655000|0.655000	0.94253|0.94253	GAG|TGG		0.642	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
FAM69B	138311	broad.mit.edu	37	9	139617732	139617733	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr9:139617732_139617733insG	ENST00000371692.4	+	5	898_899	c.802_803insG	c.(802-804)tggfs	p.W268fs	SNHG7_ENST00000362567.2_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA|SNHG7_ENST00000436596.1_RNA|FAM69B_ENST00000371691.1_Frame_Shift_Ins_p.W181fs|SNHG7_ENST00000447221.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	268						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P269fs*29(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		GGGGCCTGCGTGGCCTTGGCGG	0.683																																					p.W268fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.802_803insG	9						.																																			138737554	SO:0001589	frameshift_variant	138311	exon5				CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.804dupG	9.37:g.139617734_139617734dupG	ENSP00000360757:p.Trp268fs		138737553	NM_152421	Q5VUD7|Q8N5N0|Q8WYU5	Frame_Shift_Ins	INS	ENST00000371692.4	37	CCDS7004.1																																																																																				0.683	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421	
S1PR3	1903	broad.mit.edu	37	9	91617087	91617087	+	Silent	SNP	C	C	T	rs201820975		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chr9:91617087C>T	ENST00000375846.3	+	1	5667	c.972C>T	c.(970-972)cgC>cgT	p.R324R	S1PR3_ENST00000358157.2_Silent_p.R324R			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	324					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.R324R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						GGGGGGCCCGCGCCTCACCCA	0.627													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15947	0.0		0.0	False		,,,				2504	0.0				p.R324R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C972T	9						.	C		0,4406		0,0,2203	43.0	47.0	45.0		972	-3.7	0.0	9		45	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	S1PR3	NM_005226.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		324/379	91617087	1,13005	2203	4300	6503	90806907	SO:0001819	synonymous_variant	1903	exon2			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.972C>T	9.37:g.91617087C>T			90806907	NM_005226	Q5SQD8|Q7Z5I2	Silent	SNP	ENST00000375846.3	37	CCDS6680.1																																																																																				0.627	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226	
GPR112	139378	broad.mit.edu	37	X	135431090	135431090	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:135431090C>G	ENST00000394143.1	+	6	5516	c.5225C>G	c.(5224-5226)tCc>tGc	p.S1742C	GPR112_ENST00000394141.1_Missense_Mutation_p.S1537C|GPR112_ENST00000287534.4_Missense_Mutation_p.S1679C|GPR112_ENST00000370652.1_Missense_Mutation_p.S1742C|GPR112_ENST00000412101.1_Missense_Mutation_p.S1537C	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1742					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1742C(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GATACTTATTCCAGAATCACT	0.423																																					p.S1742C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5225G	X						.						144.0	130.0	134.0					X																	135431090		2203	4300	6503	135258756	SO:0001583	missense	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5225C>G	X.37:g.135431090C>G	ENSP00000377699:p.Ser1742Cys		135258756	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	11.17	1.560301	0.27827	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.33438	1.44;1.44;1.41;1.54;1.41	3.46	2.59	0.31030	.	.	.	.	.	T	0.37433	0.1003	L	0.32530	0.975	0.09310	N	1	D;D;D	0.76494	0.999;0.995;0.992	D;P;P	0.64237	0.923;0.785;0.615	T	0.11518	-1.0584	9	0.72032	D	0.01	.	6.5281	0.22312	0.0:0.8528:0.0:0.1472	.	1679;1537;1742	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	C	1742;1742;1537;1679;1537	ENSP00000377699:S1742C;ENSP00000359686:S1742C;ENSP00000416526:S1537C;ENSP00000287534:S1679C;ENSP00000377697:S1537C	ENSP00000287534:S1679C	S	+	2	0	GPR112	135258756	0.047000	0.20315	0.006000	0.13384	0.030000	0.12068	0.905000	0.28504	0.457000	0.26962	-0.393000	0.06486	TCC		0.423	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GPR112	139378	broad.mit.edu	37	X	135432290	135432290	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:135432290T>G	ENST00000394143.1	+	6	6716	c.6425T>G	c.(6424-6426)gTt>gGt	p.V2142G	GPR112_ENST00000394141.1_Missense_Mutation_p.V1937G|GPR112_ENST00000287534.4_Missense_Mutation_p.V2079G|GPR112_ENST00000370652.1_Missense_Mutation_p.V2142G|GPR112_ENST00000412101.1_Missense_Mutation_p.V1937G	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2142					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V2142G(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTCTATCTGTTGGTGCCATG	0.453																																					p.V2142G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6425G	X						.						162.0	117.0	132.0					X																	135432290		2203	4300	6503	135259956	SO:0001583	missense	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6425T>G	X.37:g.135432290T>G	ENSP00000377699:p.Val2142Gly		135259956	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	t	1.449	-0.565485	0.03939	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.34275	1.41;1.41;1.37;1.52;1.37	3.52	-0.297	0.12820	.	.	.	.	.	T	0.17746	0.0426	N	0.19112	0.55	0.09310	N	1	B;B;B	0.29037	0.231;0.144;0.089	B;B;B	0.24848	0.056;0.056;0.017	T	0.19095	-1.0316	9	0.29301	T	0.29	.	2.9105	0.05736	0.0:0.2773:0.2371:0.4856	.	2079;1937;2142	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	G	2142;2142;1937;2079;1937	ENSP00000377699:V2142G;ENSP00000359686:V2142G;ENSP00000416526:V1937G;ENSP00000287534:V2079G;ENSP00000377697:V1937G	ENSP00000287534:V2079G	V	+	2	0	GPR112	135259956	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.700000	0.25601	-0.001000	0.14495	-1.695000	0.00724	GTT		0.453	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
PPEF1	5475	broad.mit.edu	37	X	18807256	18807256	+	Silent	SNP	A	A	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:18807256A>C	ENST00000361511.4	+	13	1424	c.930A>C	c.(928-930)atA>atC	p.I310I	PPEF1_ENST00000359763.6_Silent_p.I257I|PPEF1_ENST00000544635.1_Silent_p.I245I|PPEF1_ENST00000349874.5_Silent_p.I310I|PPEF1_ENST00000543630.1_Silent_p.I310I	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	310	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.I310I(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					CTGTGCTGATACCACCAACGG	0.408																																					p.I310I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A930C	X						.						141.0	119.0	126.0					X																	18807256		2203	4300	6503	18717177	SO:0001819	synonymous_variant	5475	exon13			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.930A>C	X.37:g.18807256A>C			18717177	NM_152226	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Silent	SNP	ENST00000361511.4	37	CCDS14188.1																																																																																				0.408	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240	
FAM47A	158724	broad.mit.edu	37	X	34148354	34148354	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:34148354G>A	ENST00000346193.3	-	1	2093	c.2042C>T	c.(2041-2043)aCg>aTg	p.T681M		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	681								p.T681M(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ATTCGATGGCGTGTGGAATTT	0.443																																					p.T681M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2042T	X						.						84.0	82.0	82.0					X																	34148354		2202	4300	6502	34058275	SO:0001583	missense	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2042C>T	X.37:g.34148354G>A	ENSP00000345029:p.Thr681Met		34058275	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	3.363	-0.130133	0.06753	.	.	ENSG00000185448	ENST00000346193	T	0.42513	0.97	1.49	-1.88	0.07713	.	.	.	.	.	T	0.34135	0.0887	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.57324	0.818	T	0.16748	-1.0392	9	0.54805	T	0.06	.	2.1521	0.03802	0.2816:0.0:0.301:0.4174	.	681	Q5JRC9	FA47A_HUMAN	M	681	ENSP00000345029:T681M	ENSP00000345029:T681M	T	-	2	0	FAM47A	34058275	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.062000	0.03468	-0.503000	0.06586	-0.424000	0.05967	ACG		0.443	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
UXT	8409	broad.mit.edu	37	X	47516689	47516689	+	Splice_Site	SNP	G	G	C			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:47516689G>C	ENST00000333119.3	-	5	304	c.249C>G	c.(247-249)gtC>gtG	p.V83V	UXT_ENST00000335890.2_Splice_Site_p.V95V|RP1-212G6.7_ENST00000591832.1_RNA|UXT_ENST00000460840.1_5'UTR|RP1-212G6.7_ENST00000590504.1_RNA	NM_004182.3	NP_004173.1	Q9UBK9	UXT_HUMAN	ubiquitously-expressed, prefoldin-like chaperone	83					centrosome organization (GO:0051297)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)|microtubule binding (GO:0008017)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.V95V(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(1)	6						AAGTATCTGGGCTGAGGAAAG	0.483																																					p.V83V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C249G	X						.						51.0	39.0	43.0					X																	47516689		2203	4300	6503	47401633	SO:0001630	splice_region_variant	8409	exon5			AF092737	CCDS14284.1, CCDS14285.1	Xp11.23-p11.22	2011-11-21	2011-11-21		ENSG00000126756	ENSG00000126756			12641	protein-coding gene	gene with protein product	"""androgen receptor trapped clone 27"", ""SKP2-associated alpha PFD 1"""	300234	"""ubiquitously-expressed transcript"""			10087202, 16221885	Standard	NM_004182		Approved	ART-27, STAP1	uc004dim.3	Q9UBK9	OTTHUMG00000021453	ENST00000333119.3:c.249-1C>G	X.37:g.47516689G>C			47401633	NM_004182	B2R561|Q5JZG3|Q9Y6E5	Silent	SNP	ENST00000333119.3	37	CCDS14285.1																																																																																				0.483	UXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056440.1	NM_153477	Silent
RLIM	51132	broad.mit.edu	37	X	73811990	73811990	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:73811990C>T	ENST00000332687.6	-	4	1378	c.1160G>A	c.(1159-1161)cGt>cAt	p.R387H	RLIM_ENST00000349225.2_Missense_Mutation_p.R387H	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	387					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R387H(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TAAGATTCTACGAATGGGAAT	0.408																																					p.R387H	Esophageal Squamous(169;1899 1923 14997 18818 32118)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1160A	X						.						102.0	93.0	96.0					X																	73811990		2203	4300	6503	73728715	SO:0001583	missense	51132	exon5			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1160G>A	X.37:g.73811990C>T	ENSP00000328059:p.Arg387His		73728715	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.632610	0.29068	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.11063	2.81;2.81	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.27169	0.0666	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00681	-1.1612	10	0.29301	T	0.29	-2.7021	18.882	0.92358	0.0:1.0:0.0:0.0	.	387	Q9NVW2	RNF12_HUMAN	H	387	ENSP00000328059:R387H;ENSP00000253571:R387H	ENSP00000328059:R387H	R	-	2	0	RLIM	73728715	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.485000	0.81204	2.406000	0.81754	0.600000	0.82982	CGT		0.408	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
FATE1	89885	broad.mit.edu	37	X	150890399	150890399	+	Silent	SNP	G	G	A	rs139813476		TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3678-01A-01W-0900-09	TCGA-AA-3678-10A-01W-0900-09	g.chrX:150890399G>A	ENST00000370350.3	+	4	451	c.366G>A	c.(364-366)gcG>gcA	p.A122A		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	122						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A122A(2)		NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					ATGCAGTGGCGCAGACTAGCC	0.542																																					p.A122A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G366A	X						.	G		0,3835		0,0,1632,571	185.0	168.0	174.0		366	-8.7	0.0	X	dbSNP_134	174	2,6726		0,2,2426,1872	no	coding-synonymous	FATE1	NM_033085.2		0,2,4058,2443	AA,AG,GG,G		0.0297,0.0,0.0189		122/184	150890399	2,10561	2203	4300	6503	150641055	SO:0001819	synonymous_variant	89885	exon4			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.366G>A	X.37:g.150890399G>A			150641055	NM_033085		Silent	SNP	ENST00000370350.3	37	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	G	6.430	0.447397	0.12223	0.0	2.97E-4	ENSG00000147378	ENST00000417321	T	0.52057	0.68	4.34	-8.67	0.00863	.	0.652461	0.13509	N	0.382674	T	0.31389	0.0795	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.23547	-1.0185	7	0.32370	T	0.25	-3.6056	7.2266	0.26018	0.1412:0.0:0.4116:0.4472	.	.	.	.	T	79	ENSP00000400493:A79T	ENSP00000400493:A79T	A	+	1	0	FATE1	150641055	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-1.257000	0.02866	-2.620000	0.00440	-2.208000	0.00301	GCA		0.542	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
