#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf120	399814	broad.mit.edu	37	10	124457544	124457544	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:124457544C>G	ENST00000329446.4	-	3	744	c.713G>C	c.(712-714)aGa>aCa	p.R238T		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	238								p.R238T(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				TATTTCTCGTCTTTTTGTGTT	0.358																																					p.R238T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G713C	10						.						101.0	92.0	95.0					10																	124457544		2203	4300	6503	124447534	SO:0001583	missense	399814	exon3				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.713G>C	10.37:g.124457544C>G	ENSP00000331012:p.Arg238Thr		124447534	NM_001010912	B2RU17	Missense_Mutation	SNP	ENST00000329446.4	37	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.483288	0.26598	.	.	ENSG00000183559	ENST00000329446	T	0.32515	1.45	4.71	-1.88	0.07713	.	0.757532	0.12129	N	0.496944	T	0.20210	0.0486	L	0.46157	1.445	0.09310	N	1	B	0.27932	0.194	B	0.26094	0.066	T	0.25676	-1.0125	10	0.21540	T	0.41	-5.4676	5.0439	0.14473	0.0:0.3307:0.1608:0.5085	.	238	Q5SQS8	CJ120_HUMAN	T	238	ENSP00000331012:R238T	ENSP00000331012:R238T	R	-	2	0	C10orf120	124447534	0.000000	0.05858	0.001000	0.08648	0.459000	0.32528	-0.919000	0.04017	-0.221000	0.09973	-0.216000	0.12614	AGA		0.358	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
SFMBT2	57713	broad.mit.edu	37	10	7409836	7409836	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:7409836G>T	ENST00000361972.4	-	4	301	c.211C>A	c.(211-213)Cag>Aag	p.Q71K	SFMBT2_ENST00000379711.2_Missense_Mutation_p.Q71K|SFMBT2_ENST00000379713.3_Missense_Mutation_p.Q71K|SFMBT2_ENST00000397160.3_Missense_Mutation_p.Q71K|SFMBT2_ENST00000397167.1_Missense_Mutation_p.Q71K	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	71					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.Q71K(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						AAGTTGCTCTGAATGCTGATT	0.433																																					p.Q71K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C211A	10						.						61.0	60.0	60.0					10																	7409836		2203	4300	6503	7449842	SO:0001583	missense	57713	exon4			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.211C>A	10.37:g.7409836G>T	ENSP00000355109:p.Gln71Lys		7449842	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865705	0.51588	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.57;1.57	5.17	5.17	0.71159	.	0.186770	0.49305	D	0.000159	T	0.42517	0.1206	L	0.61387	1.9	0.45490	D	0.998452	B;P	0.38473	0.104;0.633	B;B	0.40228	0.016;0.323	T	0.21861	-1.0233	10	0.22706	T	0.39	.	13.5952	0.61984	0.0:0.0:0.8445:0.1555	.	71;71	Q5T981;Q5VUG0	.;SMBT2_HUMAN	K	71	ENSP00000355109:Q71K;ENSP00000380353:Q71K;ENSP00000369035:Q71K;ENSP00000369033:Q71K;ENSP00000380346:Q71K	ENSP00000355109:Q71K	Q	-	1	0	SFMBT2	7449842	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.731000	0.98807	2.567000	0.86603	0.484000	0.47621	CAG		0.433	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SYT15	83849	broad.mit.edu	37	10	46967629	46967629	+	Missense_Mutation	SNP	G	G	A	rs371278933		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:46967629G>A	ENST00000374321.4	-	4	514	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000503753.1_Missense_Mutation_p.R150W|SYT15_ENST00000374325.3_Missense_Mutation_p.R150W|SYT15_ENST00000374323.4_Missense_Mutation_p.R203W	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	150	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R150W(2)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						AACCACAGCCGCCCCAGGCAG	0.612																																					p.R150W	Ovarian(57;1152 1428 19651 37745)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C448T	10						.	G	TRP/ARG,TRP/ARG	0,4070		0,0,2035	63.0	76.0	72.0		448,448	2.9	1.0	10		72	1,8371		0,1,4185	no	missense,missense	SYT15	NM_031912.4,NM_181519.2	101,101	0,1,6220	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging	150/422,150/391	46967629	1,12441	2035	4186	6221	46387635	SO:0001583	missense	83849	exon4			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.448C>T	10.37:g.46967629G>A	ENSP00000363441:p.Arg150Trp		46387635	NM_181519	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	18.90	3.721606	0.68959	0.0	1.19E-4	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321;ENST00000512997	T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04	4.92	2.89	0.33648	C2 calcium/lipid-binding domain, CaLB (1);	0.055794	0.64402	D	0.000001	T	0.32010	0.0815	M	0.88775	2.98	0.48975	D	0.999733	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.27365	-1.0076	9	.	.	.	.	12.1994	0.54315	0.0:0.0:0.6968:0.3031	.	150;150	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	W	150;150;150;203;150;34	ENSP00000363445:R150W;ENSP00000427607:R150W;ENSP00000363443:R203W;ENSP00000363441:R150W;ENSP00000424803:R34W	.	R	-	1	2	SYT15	46387635	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	3.090000	0.50191	1.157000	0.42530	0.655000	0.94253	CGG		0.612	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912	
GRID1	2894	broad.mit.edu	37	10	87484145	87484145	+	Missense_Mutation	SNP	C	C	T	rs536754961	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:87484145C>T	ENST00000327946.7	-	11	1907	c.1822G>A	c.(1822-1824)Gcc>Acc	p.A608T	GRID1_ENST00000536331.1_Missense_Mutation_p.A179T	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	608					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A608T(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						ATCCAGATGGCGCTGTGCAGA	0.522										Multiple Myeloma(13;0.14)			C|||	3	0.000599042	0.0	0.0	5008	,	,		17587	0.0		0.0	False		,,,				2504	0.0031				p.A608T												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1822A	10						.						45.0	44.0	44.0					10																	87484145		2203	4300	6503	87474125	SO:0001583	missense	2894	exon11			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1822G>A	10.37:g.87484145C>T	ENSP00000330148:p.Ala608Thr		87474125	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562950	0.86335	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.53640	0.61;0.61	5.61	5.61	0.85477	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.60971	0.2310	L	0.33624	1.015	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.63457	-0.6633	10	0.87932	D	0	.	18.5989	0.91240	0.0:1.0:0.0:0.0	.	608	Q9ULK0	GRID1_HUMAN	T	608;179	ENSP00000330148:A608T;ENSP00000444455:A179T	ENSP00000330148:A608T	A	-	1	0	GRID1	87474125	1.000000	0.71417	0.994000	0.49952	0.649000	0.38597	7.487000	0.81328	2.624000	0.88883	0.650000	0.86243	GCC		0.522	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
MYOF	26509	broad.mit.edu	37	10	95121301	95121301	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:95121301G>A	ENST00000359263.4	-	28	2881	c.2882C>T	c.(2881-2883)gCa>gTa	p.A961V	MYOF_ENST00000371501.4_Missense_Mutation_p.A961V|MYOF_ENST00000371502.4_Missense_Mutation_p.A961V|MYOF_ENST00000358334.5_Missense_Mutation_p.A948V	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	961					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.A961V(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGGTGATGCTGCTTTATCGCC	0.418																																					p.A948V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2843T	10						.						167.0	159.0	161.0					10																	95121301		1977	4156	6133	95111291	SO:0001583	missense	26509	exon27			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2882C>T	10.37:g.95121301G>A	ENSP00000352208:p.Ala961Val		95111291	NM_133337	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	6.864	0.528822	0.13127	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.82526	-1.61;-1.62;-1.62;-1.61	5.81	5.81	0.92471	Ferlin/Peroxisome membrane (1);	0.428652	0.27595	N	0.018668	T	0.71143	0.3305	N	0.17564	0.495	0.47949	D	0.999558	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.002	T	0.66677	-0.5863	10	0.02654	T	1	-6.334	20.0912	0.97820	0.0:0.0:1.0:0.0	.	948;961	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	V	948;961;961;961	ENSP00000351094:A948V;ENSP00000352208:A961V;ENSP00000360556:A961V;ENSP00000360557:A961V	ENSP00000351094:A948V	A	-	2	0	MYOF	95111291	0.509000	0.26163	0.972000	0.41901	0.890000	0.51754	3.605000	0.54088	2.746000	0.94184	0.591000	0.81541	GCA		0.418	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
EBF3	253738	broad.mit.edu	37	10	131671828	131671828	+	Silent	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr10:131671828G>T	ENST00000355311.5	-	8	741	c.669C>A	c.(667-669)ggC>ggA	p.G223G	EBF3_ENST00000368648.3_Silent_p.G223G			Q9H4W6	COE3_HUMAN	early B-cell factor 3	223					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G223G(2)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CCAGCACGTGGCCGTCCACGT	0.522																																					p.G223G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C669A	10						.						54.0	52.0	53.0					10																	131671828		2203	4300	6503	131561818	SO:0001819	synonymous_variant	253738	exon8				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.669C>A	10.37:g.131671828G>T			131561818	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	37																																																																																					0.522	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
MUC5B	727897	broad.mit.edu	37	11	1268586	1268586	+	Silent	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:1268586C>A	ENST00000529681.1	+	31	10534	c.10476C>A	c.(10474-10476)tcC>tcA	p.S3492S	MUC5B_ENST00000447027.1_Silent_p.S3495S|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3492	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S3471S(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGGTGACTTCCCACACCCCAG	0.657																																					p.S3492S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C10476A	11						.						103.0	123.0	117.0					11																	1268586		2134	4215	6349	1225162	SO:0001819	synonymous_variant	727897	exon31			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10476C>A	11.37:g.1268586C>A			1225162	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR5AN1	390195	broad.mit.edu	37	11	59132299	59132299	+	Missense_Mutation	SNP	G	G	A	rs149354660		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:59132299G>A	ENST00000313940.2	+	1	415	c.368G>A	c.(367-369)cGt>cAt	p.R123H		NM_001004729.1	NP_001004729.1	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R123H(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	21						GCTTATGATCGTTATGCTGCC	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23462	0.0		0.0	False		,,,				2504	0.0				p.R123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368A	11						.	G	HIS/ARG	0,4402		0,0,2201	264.0	228.0	240.0		368	1.2	0.5	11	dbSNP_134	240	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR5AN1	NM_001004729.1	29	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	benign	123/312	59132299	1,12991	2201	4295	6496	58888875	SO:0001583	missense	390195	exon1			AB065806	CCDS31559.1	11q12.1	2012-08-09			ENSG00000176495	ENSG00000176495		"""GPCR / Class A : Olfactory receptors"""	15255	protein-coding gene	gene with protein product		615702					Standard	NM_001004729		Approved		uc010rks.2	Q8NGI8	OTTHUMG00000167337	ENST00000313940.2:c.368G>A	11.37:g.59132299G>A	ENSP00000320302:p.Arg123His		58888875	NM_001004729	B9EIS2|Q6IEV4	Missense_Mutation	SNP	ENST00000313940.2	37	CCDS31559.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.21	1.286649	0.23478	0.0	1.16E-4	ENSG00000176495	ENST00000313940	T	0.77489	-1.1	4.12	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	0.147317	0.30791	N	0.008861	T	0.77598	0.4154	M	0.88979	2.995	0.31777	N	0.631397	B	0.18610	0.029	B	0.12837	0.008	T	0.75382	-0.3337	10	0.72032	D	0.01	-6.6498	8.2932	0.31969	0.2718:0.0:0.7282:0.0	.	123	Q8NGI8	O5AN1_HUMAN	H	123	ENSP00000320302:R123H	ENSP00000320302:R123H	R	+	2	0	OR5AN1	58888875	0.834000	0.29399	0.536000	0.28039	0.103000	0.19146	4.303000	0.59098	0.140000	0.18849	-0.137000	0.14449	CGT		0.453	OR5AN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394231.1	NM_001004729	
SPTBN2	6712	broad.mit.edu	37	11	66457737	66457737	+	Silent	SNP	G	G	A	rs557448224		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:66457737G>A	ENST00000533211.1	-	28	5914	c.5583C>T	c.(5581-5583)gaC>gaT	p.D1861D	SPTBN2_ENST00000529997.1_Silent_p.D1861D|SPTBN2_ENST00000309996.2_Silent_p.D1861D			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1861					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.D1861D(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGTGGCCGTCGTCCTGCACCT	0.692													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14301	0.0		0.0	False		,,,				2504	0.0				p.D1861D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5583T	11						.						13.0	14.0	14.0					11																	66457737		2196	4289	6485	66214313	SO:0001819	synonymous_variant	6712	exon27			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5583C>T	11.37:g.66457737G>A			66214313	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																				0.692	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
XRRA1	143570	broad.mit.edu	37	11	74563070	74563070	+	Missense_Mutation	SNP	C	C	T	rs369302102		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:74563070C>T	ENST00000340360.6	-	13	1535	c.1204G>A	c.(1204-1206)Gtc>Atc	p.V402I	XRRA1_ENST00000321448.8_Missense_Mutation_p.V127I|XRRA1_ENST00000527087.1_Intron	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1									p.V402I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						TTATGAAAGACGAACTCGCAG	0.542																																					p.V402I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1204A	11						.	C	ILE/VAL	0,4054		0,0,2027	144.0	143.0	143.0		1204	-9.3	0.0	11		143	1,8357		0,1,4178	no	missense	XRRA1	NM_182969.1	29	0,1,6205	TT,TC,CC		0.012,0.0,0.0081	benign	402/793	74563070	1,12411	2027	4179	6206	74240718	SO:0001583	missense	143570	exon13			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.1204G>A	11.37:g.74563070C>T	ENSP00000339918:p.Val402Ile		74240718	NM_182969		Missense_Mutation	SNP	ENST00000340360.6	37	CCDS44680.1	.	.	.	.	.	.	.	.	.	.	C	7.792	0.711684	0.15306	0.0	1.2E-4	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418	T;T	0.30448	1.87;1.53	6.07	-9.26	0.00662	.	.	.	.	.	T	0.11750	0.0286	N	0.02721	-0.515	0.45822	D	0.998696	B;B;B	0.23316	0.029;0.034;0.083	B;B;B	0.14578	0.003;0.008;0.011	T	0.37641	-0.9697	9	0.08381	T	0.77	-0.9667	22.9129	0.99977	0.0:0.8199:0.0:0.1801	.	402;346;388	Q6P2D8;Q6P2D8-4;Q6P2D8-3	XRRA1_HUMAN;.;.	I	402;127;388;346	ENSP00000339918:V402I;ENSP00000319303:V127I	ENSP00000319303:V127I	V	-	1	0	XRRA1	74240718	0.000000	0.05858	0.040000	0.18447	0.839000	0.47603	-2.328000	0.01112	-1.635000	0.01535	-0.482000	0.04802	GTC		0.542	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384715.1	NM_182969	
PRKRIR	5612	broad.mit.edu	37	11	76063217	76063217	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:76063217C>T	ENST00000260045.3	-	5	1082	c.977G>A	c.(976-978)cGt>cAt	p.R326H	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	326					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R326H(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						AGCCTGGCCACGACAATACTC	0.393																																					p.R326H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G977A	11						.						29.0	30.0	29.0					11																	76063217		2131	4173	6304	75740865	SO:0001583	missense	5612	exon5			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.977G>A	11.37:g.76063217C>T	ENSP00000260045:p.Arg326His		75740865	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688093	0.68271	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.78	3.85	0.44370	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.56615	0.1997	L	0.50919	1.6	0.58432	D	0.999999	P	0.47106	0.89	P	0.45428	0.48	T	0.59852	-0.7376	9	0.48119	T	0.1	.	14.6961	0.69124	0.1463:0.8537:0.0:0.0	.	326	O43422	P52K_HUMAN	H	151;326	.	ENSP00000260045:R326H	R	-	2	0	PRKRIR	75740865	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.129000	0.77225	1.155000	0.42497	0.644000	0.83932	CGT		0.393	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
NAALAD2	10003	broad.mit.edu	37	11	89885603	89885603	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:89885603A>T	ENST00000534061.1	+	6	977	c.747A>T	c.(745-747)ttA>ttT	p.L249F	NAALAD2_ENST00000321955.4_Missense_Mutation_p.L249F|NAALAD2_ENST00000375944.3_Missense_Mutation_p.L249F|NAALAD2_ENST00000525171.1_Missense_Mutation_p.L249F	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	249					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.L249F(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GAAATGTGTTAAATTTGAATG	0.473																																					p.L249F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A747T	11						.						92.0	84.0	87.0					11																	89885603		2201	4299	6500	89525251	SO:0001583	missense	10003	exon6			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.747A>T	11.37:g.89885603A>T	ENSP00000432481:p.Leu249Phe		89525251	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.525507	0.64860	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.22	-1.14	0.09741	.	0.000000	0.51477	D	0.000096	T	0.49762	0.1576	L	0.53617	1.68	0.51233	D	0.999919	D;P;D;D;P	0.89917	0.997;0.575;0.999;1.0;0.864	D;P;D;D;P	0.91635	0.944;0.468;0.966;0.999;0.468	T	0.41288	-0.9517	9	.	.	.	-10.2418	6.2493	0.20837	0.4:0.2469:0.3531:0.0	.	249;249;249;249;249	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	F	249	ENSP00000432481:L249F;ENSP00000320083:L249F;ENSP00000435249:L249F;ENSP00000365111:L249F	.	L	+	3	2	NAALAD2	89525251	0.993000	0.37304	0.985000	0.45067	0.980000	0.70556	0.446000	0.21694	-0.223000	0.09943	-0.250000	0.11733	TTA		0.473	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
USP28	57646	broad.mit.edu	37	11	113700048	113700048	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr11:113700048A>C	ENST00000003302.4	-	10	998	c.930T>G	c.(928-930)aaT>aaG	p.N310K	USP28_ENST00000542033.1_5'Flank|USP28_ENST00000545540.1_Missense_Mutation_p.N185K|USP28_ENST00000537706.1_Missense_Mutation_p.N310K|USP28_ENST00000544967.1_Missense_Mutation_p.N18K|USP28_ENST00000260188.5_Missense_Mutation_p.N310K	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	310	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.N310K(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CGAAGGTCTCATTGTTACAAA	0.443																																					p.N310K	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T930G	11						.						135.0	125.0	129.0					11																	113700048		2201	4296	6497	113205258	SO:0001583	missense	57646	exon10			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.930T>G	11.37:g.113700048A>C	ENSP00000003302:p.Asn310Lys		113205258	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262759	0.39995	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475;ENST00000537706;ENST00000537642	T;T;T;T;T;T;T	0.41065	1.54;1.54;1.01;1.54;1.54;1.54;3.49	5.36	-4.56	0.03431	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.096722	0.64402	D	0.000002	T	0.17152	0.0412	N	0.05306	-0.075	0.31521	N	0.662376	B;B;B;B	0.25351	0.067;0.124;0.021;0.098	B;B;B;B	0.29440	0.05;0.102;0.065;0.049	T	0.32428	-0.9907	10	0.06236	T	0.91	-16.2755	14.6535	0.68814	0.5047:0.0:0.4953:0.0	.	185;310;310;18	B4E3L3;Q6NZX9;Q96RU2;G3V1N5	.;.;UBP28_HUMAN;.	K	310;310;18;185;74;310;209	ENSP00000003302:N310K;ENSP00000260188:N310K;ENSP00000442431:N18K;ENSP00000444991:N185K;ENSP00000442257:N74K;ENSP00000445743:N310K;ENSP00000440799:N209K	ENSP00000003302:N310K	N	-	3	2	USP28	113205258	0.133000	0.22466	0.950000	0.38849	0.930000	0.56654	-0.400000	0.07241	-0.947000	0.03673	-0.464000	0.05259	AAT		0.443	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
TAS2R30	259293	broad.mit.edu	37	12	11286358	11286358	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:11286358C>T	ENST00000539585.1	-	1	885	c.486G>A	c.(484-486)gtG>gtA	p.V162V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	162					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.V162V(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TCTTCCAAGTCACGTTTCCTT	0.388																																					p.V162V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G486A	12						.						154.0	163.0	160.0					12																	11286358		2202	4300	6502	11177625	SO:0001819	synonymous_variant	259293	exon1			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.486G>A	12.37:g.11286358C>T			11177625	NM_001097643	Q645X7	Silent	SNP	ENST00000539585.1	37	CCDS53750.1																																																																																				0.388	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
NCAPD2	9918	broad.mit.edu	37	12	6639919	6639919	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:6639919C>T	ENST00000315579.5	+	30	4699	c.3900C>T	c.(3898-3900)atC>atT	p.I1300I	NCAPD2_ENST00000545962.1_Silent_p.I1255I|RP5-940J5.3_ENST00000537921.1_RNA	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1300					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.I1300I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						TGGATGGAATCAAGGAGCTTG	0.522																																					p.I1300I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3900T	12						.						72.0	76.0	75.0					12																	6639919		2203	4300	6503	6510180	SO:0001819	synonymous_variant	9918	exon30			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3900C>T	12.37:g.6639919C>T			6510180	NM_014865	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																				0.522	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
CD163	9332	broad.mit.edu	37	12	7651613	7651614	+	Missense_Mutation	DNP	CC	CC	GA			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:7651613_7651614CC>GA	ENST00000359156.4	-	4	830_831	c.628_629GG>TC	c.(628-630)GGt>TCt	p.G210S	CD163_ENST00000541972.1_Missense_Mutation_p.G198S|CD163_ENST00000432237.2_Missense_Mutation_p.G210S|CD163_ENST00000396620.3_Missense_Mutation_p.G210S	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	210	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.G210>?(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	ATTAGATGAACCAGAGAAACTG	0.431																																					.												.	.	1	Complex(1)	large_intestine(1)	c.628_629TC	12						.																																			7542881	SO:0001583	missense	9332	exon4			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.628_629delinsGA	12.37:g.7651613_7651614delinsGA	ENSP00000352071:p.Gly210Ser		7542880	NM_203416	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	DNP	ENST00000359156.4	37	CCDS8578.1																																																																																				0.431	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
MAP3K12	7786	broad.mit.edu	37	12	53876708	53876708	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:53876708G>C	ENST00000267079.2	-	12	2005	c.1780C>G	c.(1780-1782)Ctc>Gtc	p.L594V	MAP3K12_ENST00000547035.1_Missense_Mutation_p.L627V|MAP3K12_ENST00000547488.1_Missense_Mutation_p.L627V	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	594					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.L594V(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						AGCCCACGGAGGGCGGGAGGG	0.672																																					p.L627V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1879G	12						.						39.0	44.0	42.0					12																	53876708		2203	4300	6503	52162975	SO:0001583	missense	7786	exon11			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1780C>G	12.37:g.53876708G>C	ENSP00000267079:p.Leu594Val		52162975	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	G	8.354	0.831546	0.16820	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	D;D;D	0.82711	-1.63;-1.64;-1.64	3.99	3.99	0.46301	.	0.000000	0.40640	N	0.001054	T	0.75361	0.3839	L	0.32530	0.975	0.30754	N	0.744775	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.003	T	0.70857	-0.4758	10	0.32370	T	0.25	.	16.0449	0.80714	0.0:0.0:1.0:0.0	.	627;594	G3V1Y2;Q12852	.;M3K12_HUMAN	V	594;627;627	ENSP00000267079:L594V;ENSP00000449038:L627V;ENSP00000448689:L627V	ENSP00000267079:L594V	L	-	1	0	MAP3K12	52162975	0.886000	0.30341	1.000000	0.80357	0.467000	0.32768	0.538000	0.23160	2.523000	0.85059	0.491000	0.48974	CTC		0.672	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
A2M	2	broad.mit.edu	37	12	9229357	9229357	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:9229357T>A	ENST00000318602.7	-	28	3834	c.3527A>T	c.(3526-3528)aAg>aTg	p.K1176M	A2M_ENST00000542567.1_5'Flank	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1176					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.K1176M(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CTCACCTTTCTTCACAGCTTC	0.493																																					p.K1176M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3527T	12						.						130.0	139.0	136.0					12																	9229357		2127	4263	6390	9120624	SO:0001583	missense	2	exon28			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3527A>T	12.37:g.9229357T>A	ENSP00000323929:p.Lys1176Met		9120624	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420957	0.42918	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.35048	1.33	5.52	5.52	0.82312	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.334050	0.30620	N	0.009227	T	0.61135	0.2323	M	0.86805	2.84	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.61019	-0.7147	10	0.87932	D	0	.	7.9343	0.29920	0.0:0.1546:0.0:0.8454	.	1176	P01023	A2MG_HUMAN	M	1176;1191	ENSP00000323929:K1176M	ENSP00000323929:K1176M	K	-	2	0	A2M	9120624	0.079000	0.21365	0.997000	0.53966	0.465000	0.32709	1.220000	0.32491	2.108000	0.64289	0.477000	0.44152	AAG		0.493	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
TMTC2	160335	broad.mit.edu	37	12	83290188	83290188	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:83290188G>C	ENST00000321196.3	+	3	1953	c.1246G>C	c.(1246-1248)Ggc>Cgc	p.G416R	TMTC2_ENST00000549919.1_Missense_Mutation_p.G410R|TMTC2_ENST00000548305.1_Missense_Mutation_p.G416R	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	416					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.G416R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TTTCTATGTCGGCTTTGTAAT	0.423																																					p.G416R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1246C	12						.						165.0	164.0	165.0					12																	83290188		2203	4300	6503	81814319	SO:0001583	missense	160335	exon3			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1246G>C	12.37:g.83290188G>C	ENSP00000322300:p.Gly416Arg		81814319	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403495	0.83230	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.76448	-1.02;-1.02;-1.02	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.90943	0.7153	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91849	0.5490	10	0.87932	D	0	-19.9405	20.1996	0.98256	0.0:0.0:1.0:0.0	.	416;171;416	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	R	416;416;410;171	ENSP00000322300:G416R;ENSP00000448292:G416R;ENSP00000447609:G410R	ENSP00000322300:G416R	G	+	1	0	TMTC2	81814319	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	9.476000	0.97823	2.776000	0.95493	0.650000	0.86243	GGC		0.423	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
KLRB1	3820	broad.mit.edu	37	12	9751098	9751098	+	Silent	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:9751098T>C	ENST00000229402.3	-	4	457	c.411A>G	c.(409-411)gaA>gaG	p.E137E		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	137	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.E137E(1)		endometrium(2)|large_intestine(6)|lung(4)	12						GATTTACCAATTCATCCTTAT	0.348																																					p.E137E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A411G	12						.						75.0	83.0	80.0					12																	9751098		2203	4299	6502	9642365	SO:0001819	synonymous_variant	3820	exon4			U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.411A>G	12.37:g.9751098T>C			9642365	NM_002258	Q24K24	Silent	SNP	ENST00000229402.3	37	CCDS8601.1																																																																																				0.348	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	
CDKN1B	1027	broad.mit.edu	37	12	12871182	12871182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:12871182delC	ENST00000228872.4	+	1	1125	c.409delC	c.(409-411)ccgfs	p.P137fs	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Frame_Shift_Del_p.P137fs	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	137					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.P137fs*8(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		AAAGACTGATCCGTCGGACAG	0.587																																					p.P137fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.409delC	12						.						34.0	35.0	35.0					12																	12871182		2203	4300	6503	12762449	SO:0001589	frameshift_variant	1027	exon1			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.409delC	12.37:g.12871182delC	ENSP00000228872:p.Pro137fs		12762449	NM_004064	Q16307|Q5U0H2|Q9BUS6	Frame_Shift_Del	DEL	ENST00000228872.4	37	CCDS8653.1																																																																																				0.587	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	
FGD6	55785	broad.mit.edu	37	12	95602872	95602872	+	Missense_Mutation	SNP	C	C	G	rs138805264	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr12:95602872C>G	ENST00000343958.4	-	2	2411	c.2188G>C	c.(2188-2190)Gag>Cag	p.E730Q	FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000546711.1_Missense_Mutation_p.E730Q|FGD6_ENST00000549499.1_Missense_Mutation_p.E730Q	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	730					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.E730Q(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						GATGATGACTCCCGGGAGAGC	0.478													C|||	5	0.000998403	0.0038	0.0	5008	,	,		19621	0.0		0.0	False		,,,				2504	0.0				p.E730Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2188C	12						.	C	GLN/GLU	7,4399	12.9+/-30.5	0,7,2196	88.0	86.0	86.0		2188	4.2	1.0	12	dbSNP_134	86	0,8600		0,0,4300	yes	missense	FGD6	NM_018351.3	29	0,7,6496	GG,GC,CC		0.0,0.1589,0.0538	probably-damaging	730/1431	95602872	7,12999	2203	4300	6503	94127003	SO:0001583	missense	55785	exon2			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.2188G>C	12.37:g.95602872C>G	ENSP00000344446:p.Glu730Gln		94127003	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	C	12.69	2.013152	0.35511	0.001589	0.0	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.70282	-0.37;-0.47;-0.4	6.04	4.17	0.49024	.	0.272149	0.26265	N	0.025371	T	0.60534	0.2276	L	0.53249	1.67	0.25648	N	0.986123	P	0.43094	0.799	B	0.40901	0.343	T	0.57648	-0.7775	10	0.40728	T	0.16	-2.87	16.1412	0.81522	0.0:0.6075:0.3925:0.0	.	730	Q6ZV73	FGD6_HUMAN	Q	730	ENSP00000344446:E730Q;ENSP00000450342:E730Q;ENSP00000449005:E730Q	ENSP00000344446:E730Q	E	-	1	0	FGD6	94127003	0.705000	0.27846	0.976000	0.42696	0.629000	0.37895	1.385000	0.34408	0.841000	0.35020	0.561000	0.74099	GAG		0.478	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
RNF17	56163	broad.mit.edu	37	13	25451141	25451141	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr13:25451141C>G	ENST00000255324.5	+	34	4642	c.4590C>G	c.(4588-4590)tgC>tgG	p.C1530W	RNF17_ENST00000381921.1_Missense_Mutation_p.C1488W|RNF17_ENST00000339524.3_Missense_Mutation_p.C540W	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1530	Tudor 4. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.C1530W(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ACAGACTGTGCCAAATTCCTT	0.408																																					p.C1526W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4578G	13						.						74.0	77.0	76.0					13																	25451141		2203	4300	6503	24349141	SO:0001583	missense	56163	exon34			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4590C>G	13.37:g.25451141C>G	ENSP00000255324:p.Cys1530Trp		24349141	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099431	0.37048	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000339524	T;T;T	0.09073	3.02;3.02;3.02	5.66	4.5	0.54988	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.211615	0.33732	N	0.004616	T	0.16041	0.0386	L	0.43152	1.355	0.80722	D	1	P;P;P;P	0.51057	0.924;0.899;0.846;0.941	P;P;B;P	0.62014	0.803;0.643;0.326;0.897	T	0.02282	-1.1183	10	0.37606	T	0.19	-3.4049	7.6232	0.28197	0.0:0.1697:0.0:0.8303	.	1526;540;1524;1530	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	W	1530;1488;540	ENSP00000255324:C1530W;ENSP00000371346:C1488W;ENSP00000344776:C540W	ENSP00000255324:C1530W	C	+	3	2	RNF17	24349141	1.000000	0.71417	0.998000	0.56505	0.633000	0.38033	0.767000	0.26575	0.993000	0.38866	-0.378000	0.06908	TGC		0.408	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
SOHLH2	54937	broad.mit.edu	37	13	36744739	36744739	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr13:36744739C>A	ENST00000379881.3	-	10	1274	c.1186G>T	c.(1186-1188)Gtc>Ttc	p.V396F	SOHLH2_ENST00000554962.1_Missense_Mutation_p.V473F|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.V473F	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	396					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V396F(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		AGCTTTGAGACCGGGGGCATG	0.483																																					p.V396F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1186T	13						.						101.0	88.0	93.0					13																	36744739		2203	4300	6503	35642739	SO:0001583	missense	54937	exon10			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1186G>T	13.37:g.36744739C>A	ENSP00000369210:p.Val396Phe		35642739	NM_017826	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678738	0.47886	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.50001	0.77;0.76;0.76	5.14	5.14	0.70334	.	0.000000	0.49305	D	0.000158	T	0.64713	0.2623	M	0.61703	1.905	0.37341	D	0.910377	D;D	0.76494	0.999;0.999	D;D	0.70716	0.97;0.97	T	0.72014	-0.4418	10	0.87932	D	0	2.6545	14.089	0.64977	0.0:1.0:0.0:0.0	.	473;396	B4DX90;Q9NX45	.;SOLH2_HUMAN	F	396;473;473	ENSP00000369210:V396F;ENSP00000451542:V473F;ENSP00000421868:V473F	ENSP00000421868:V473F	V	-	1	0	CCDC169-SOHLH2;SOHLH2	35642739	0.909000	0.30893	0.367000	0.25926	0.137000	0.21094	2.104000	0.41815	2.401000	0.81631	0.655000	0.94253	GTC		0.483	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
ARL11	115761	broad.mit.edu	37	13	50204781	50204781	+	Silent	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr13:50204781G>A	ENST00000282026.1	+	2	533	c.198G>A	c.(196-198)ggG>ggA	p.G66G	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	66					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.G66G(1)		kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		ACGTTGGGGGGCAGGCCCCGC	0.612																																					p.G66G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G198A	13						.						58.0	58.0	58.0					13																	50204781		2203	4300	6503	49102782	SO:0001819	synonymous_variant	115761	exon2			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.198G>A	13.37:g.50204781G>A			49102782	NM_138450		Silent	SNP	ENST00000282026.1	37	CCDS9419.1																																																																																				0.612	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450	
BORA	79866	broad.mit.edu	37	13	73320924	73320924	+	Missense_Mutation	SNP	G	G	A	rs200969838		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr13:73320924G>A	ENST00000390667.5	+	10	1254	c.1157G>A	c.(1156-1158)cGg>cAg	p.R386Q	BORA_ENST00000377815.3_Missense_Mutation_p.R316Q	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	386					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)	p.R386Q(1)									ATACACCTACGGCAGTTTAGT	0.433																																					p.R386Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1157A	13						.						110.0	106.0	107.0					13																	73320924		1935	4139	6074	72218925	SO:0001583	missense	79866	exon10			BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.1157G>A	13.37:g.73320924G>A	ENSP00000375082:p.Arg386Gln		72218925	NM_024808	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	ENST00000390667.5	37	CCDS9446.1	.	.	.	.	.	.	.	.	.	.	G	0.422	-0.907622	0.02434	.	.	ENSG00000136122	ENST00000377815;ENST00000390667	T;T	0.44482	0.92;0.92	5.72	-0.198	0.13224	.	1.019820	0.07771	N	0.951790	T	0.20618	0.0496	N	0.05383	-0.06	0.09310	N	1	B;B;B;B	0.17852	0.001;0.014;0.024;0.014	B;B;B;B	0.10450	0.002;0.003;0.005;0.003	T	0.28459	-1.0043	10	0.13108	T	0.6	2.0E-4	8.2587	0.31771	0.3406:0.1848:0.4745:0.0	.	316;386;446;386	B4DQ30;A8K631;B5LMG6;Q6PGQ7	.;.;.;BORA_HUMAN	Q	316;386	ENSP00000367046:R316Q;ENSP00000375082:R386Q	ENSP00000367046:R316Q	R	+	2	0	BORA	72218925	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.670000	0.05256	-0.704000	0.05042	-0.797000	0.03246	CGG		0.433	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045245.3	NM_024808	
AKAP6	9472	broad.mit.edu	37	14	32902867	32902867	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr14:32902867C>T	ENST00000280979.4	+	2	338	c.168C>T	c.(166-168)ccC>ccT	p.P56P	AKAP6_ENST00000557272.1_Silent_p.P56P|AKAP6_ENST00000557354.1_Silent_p.P56P|AKAP6_ENST00000554449.1_3'UTR	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	56					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.P56P(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAAAGCCACCCCCACTACACA	0.537																																					p.P56P	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C168T	14						.						163.0	127.0	139.0					14																	32902867		2203	4300	6503	31972618	SO:0001819	synonymous_variant	9472	exon2			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.168C>T	14.37:g.32902867C>T			31972618	NM_004274	A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	CCDS9644.1																																																																																				0.537	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
TRIM9	114088	broad.mit.edu	37	14	51448791	51448791	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr14:51448791G>A	ENST00000298355.3	-	8	2755	c.1634C>T	c.(1633-1635)gCg>gTg	p.A545V	TRIM9_ENST00000557456.1_5'Flank|TRIM9_ENST00000338969.5_Missense_Mutation_p.A626V	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	545	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A626V(1)|p.A545V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					GTCCGAGTGCGCCGAGCCAGG	0.527																																					p.A545V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1634T	14						.						72.0	60.0	64.0					14																	51448791		2203	4300	6503	50518541	SO:0001583	missense	114088	exon8			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1634C>T	14.37:g.51448791G>A	ENSP00000298355:p.Ala545Val		50518541	NM_015163	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	ENST00000298355.3	37	CCDS9703.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.474882	0.63737	.	.	ENSG00000100505	ENST00000298355;ENST00000338969	T;T	0.76448	-1.02;-0.75	6.08	6.08	0.98989	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.044027	0.85682	D	0.000000	D	0.89887	0.6845	M	0.86573	2.825	0.80722	D	1	D;D	0.76494	0.999;0.971	D;P	0.68765	0.96;0.508	D	0.90354	0.4368	10	0.72032	D	0.01	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	626;545	Q9C026-4;Q9C026	.;TRIM9_HUMAN	V	545;626	ENSP00000298355:A545V;ENSP00000342970:A626V	ENSP00000298355:A545V	A	-	2	0	TRIM9	50518541	1.000000	0.71417	0.097000	0.21041	0.001000	0.01503	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GCG		0.527	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276874.1	NM_015163	
GRAMD2	196996	broad.mit.edu	37	15	72454682	72454682	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr15:72454682C>T	ENST00000309731.7	-	11	1006	c.993G>A	c.(991-993)gcG>gcA	p.A331A	GRAMD2_ENST00000564184.1_5'Flank	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	331						integral component of membrane (GO:0016021)		p.A331A(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						AAATACGGAACGCCAGGTAGG	0.478																																					p.A331A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G993A	15						.						88.0	80.0	82.0					15																	72454682		2199	4297	6496	70241736	SO:0001819	synonymous_variant	196996	exon11			AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.993G>A	15.37:g.72454682C>T			70241736	NM_001012642	B3KT68	Silent	SNP	ENST00000309731.7	37	CCDS32283.1																																																																																				0.478	GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420040.1	NM_001012642	
IDH2	3418	broad.mit.edu	37	15	90630361	90630361	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr15:90630361G>C	ENST00000330062.3	-	7	1063	c.950C>G	c.(949-951)tCa>tGa	p.S317*	IDH2_ENST00000539790.1_Nonsense_Mutation_p.S187*|IDH2_ENST00000559482.1_Nonsense_Mutation_p.S208*|IDH2_ENST00000540499.2_Nonsense_Mutation_p.S265*	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	317					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.S317*(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTCTGACTGCACATC	0.567			M		GBM						OREG0023466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S317X			Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C950G	15						.						133.0	117.0	123.0					15																	90630361		2200	4298	6498	88431365	SO:0001587	stop_gained	3418	exon7				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.950C>G	15.37:g.90630361G>C	ENSP00000331897:p.Ser317*	1276	88431365	NM_002168	B2R6L6|B4DFL2|Q96GT3	Nonsense_Mutation	SNP	ENST00000330062.3	37	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300004	0.95574	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6797	0.88239	0.0:0.0:1.0:0.0	.	.	.	.	X	317;187;265	.	ENSP00000331897:S317X	S	-	2	0	IDH2	88431365	1.000000	0.71417	0.966000	0.40874	0.101000	0.19017	9.827000	0.99397	2.777000	0.95525	0.591000	0.81541	TCA		0.567	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
PDILT	204474	broad.mit.edu	37	16	20370764	20370764	+	Silent	SNP	G	G	A	rs374255958		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:20370764G>A	ENST00000302451.4	-	12	1880	c.1632C>T	c.(1630-1632)taC>taT	p.Y544Y		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	544					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.Y544Y(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						GCTTGGATACGTACTTGGTCA	0.512																																					p.Y544Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1632T	16						.						230.0	205.0	213.0					16																	20370764		2203	4300	6503	20278265	SO:0001819	synonymous_variant	204474	exon12				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1632C>T	16.37:g.20370764G>A			20278265	NM_174924	Q8IVQ5	Silent	SNP	ENST00000302451.4	37	CCDS10584.1																																																																																				0.512	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
SETD1A	9739	broad.mit.edu	37	16	30977492	30977492	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:30977492G>C	ENST00000262519.8	+	8	2976	c.2290G>C	c.(2290-2292)Gtc>Ctc	p.V764L		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	764					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V764L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CTCCTCCTCAGTCTCGGGAGA	0.672																																					p.V764L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2290C	16						.						17.0	19.0	19.0					16																	30977492		2178	4266	6444	30884993	SO:0001583	missense	9739	exon8			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.2290G>C	16.37:g.30977492G>C	ENSP00000262519:p.Val764Leu		30884993	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	3.985	-0.005676	0.07773	.	.	ENSG00000099381	ENST00000262519	D	0.94092	-3.35	5.59	3.64	0.41730	.	0.426176	0.20822	N	0.085057	D	0.85221	0.5647	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.67719	-0.5598	10	0.10111	T	0.7	.	6.2574	0.20881	0.1556:0.2909:0.5535:0.0	.	764	O15047	SET1A_HUMAN	L	764	ENSP00000262519:V764L	ENSP00000262519:V764L	V	+	1	0	SETD1A	30884993	0.025000	0.19082	0.930000	0.37139	0.650000	0.38633	1.243000	0.32767	0.730000	0.32425	-0.150000	0.13652	GTC		0.672	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
CHD9	80205	broad.mit.edu	37	16	53288353	53288353	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:53288353C>A	ENST00000398510.3	+	17	3952	c.3865C>A	c.(3865-3867)Caa>Aaa	p.Q1289K	CHD9_ENST00000566029.1_Missense_Mutation_p.Q1289K|CHD9_ENST00000447540.1_Missense_Mutation_p.Q1289K|CHD9_ENST00000564845.1_Missense_Mutation_p.Q1289K			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1289	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q1289K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TTTATAGGCCCAAGCTCGTTG	0.343																																					p.Q1289K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3865A	16						.						111.0	106.0	108.0					16																	53288353		1825	4090	5915	51845854	SO:0001583	missense	80205	exon18			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.3865C>A	16.37:g.53288353C>A	ENSP00000381522:p.Gln1289Lys		51845854	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	C	28.8	4.950055	0.92660	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	T;T	0.75260	-0.92;-0.92	5.28	5.28	0.74379	Helicase, C-terminal (3);	0.000000	0.52532	D	0.000066	D	0.87208	0.6120	M	0.82132	2.575	0.80722	D	1	P;D;D;P	0.54047	0.944;0.964;0.963;0.954	P;D;D;D	0.71414	0.836;0.936;0.973;0.954	D	0.88700	0.3215	10	0.87932	D	0	-13.1213	18.9109	0.92485	0.0:1.0:0.0:0.0	.	815;1289;1289;1289	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	K	1289;1289;815	ENSP00000396345:Q1289K;ENSP00000381522:Q1289K	ENSP00000219084:Q815K	Q	+	1	0	CHD9	51845854	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.770000	0.85390	2.474000	0.83562	0.650000	0.86243	CAA		0.343	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CSNK2A2	1459	broad.mit.edu	37	16	58201680	58201680	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:58201680C>T	ENST00000262506.3	-	7	716	c.533G>A	c.(532-534)gGt>gAt	p.G178D	CSNK2A2_ENST00000566813.1_5'UTR	NM_001896.2	NP_001887.1	P19784	CSK22_HUMAN	casein kinase 2, alpha prime polypeptide	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G178D(1)		central_nervous_system(1)	1						TTCTGCCAGACCCCAATCTAT	0.458																																					p.G178D	Melanoma(54;119 1219 18349 35700 39738)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G533A	16						.						87.0	80.0	83.0					16																	58201680		2198	4300	6498	56759181	SO:0001583	missense	1459	exon7			M55268	CCDS10794.1	16q21	2013-01-17			ENSG00000070770	ENSG00000070770			2459	protein-coding gene	gene with protein product		115442				2174700, 1766873	Standard	NM_001896		Approved	CSNK2A1	uc002enc.3	P19784	OTTHUMG00000133488	ENST00000262506.3:c.533G>A	16.37:g.58201680C>T	ENSP00000262506:p.Gly178Asp		56759181	NM_001896		Missense_Mutation	SNP	ENST00000262506.3	37	CCDS10794.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997343	0.54147	.	.	ENSG00000070770	ENST00000262506	T	0.61158	0.13	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84552	0.5497	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89947	0.4077	10	0.87932	D	0	-9.1253	17.8511	0.88747	0.0:1.0:0.0:0.0	.	178	P19784	CSK22_HUMAN	D	178	ENSP00000262506:G178D	ENSP00000262506:G178D	G	-	2	0	CSNK2A2	56759181	1.000000	0.71417	0.988000	0.46212	0.978000	0.69477	7.749000	0.85096	2.467000	0.83353	0.467000	0.42956	GGT		0.458	CSNK2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257386.2	NM_001896	
E2F4	1874	broad.mit.edu	37	16	67234854	67234855	+	IGR	DNP	AG	AG	GC			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:67234854_67234855AG>GC	ENST00000379378.3	+	0	2096				ELMO3_ENST00000393997.2_Missense_Mutation_p.S296A|ELMO3_ENST00000571638.1_3'UTR|ELMO3_ENST00000360833.1_Missense_Mutation_p.S279A|ELMO3_ENST00000477898.1_Missense_Mutation_p.S130A|MIR328_ENST00000385213.1_RNA	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S296>?(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		GCAGGGGGCCAGCCCTGTGGAA	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.886_887GC	16						.																																			65792356	SO:0001628	intergenic_variant	79767	exon8			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	Exception_encountered	16.37:g.67234854_67234855delinsGC			65792355	NM_024712	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	DNP	ENST00000379378.3	37	CCDS32464.1																																																																																				0.614	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
NFATC3	4775	broad.mit.edu	37	16	68225305	68225305	+	Missense_Mutation	SNP	A	A	T	rs145880907	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr16:68225305A>T	ENST00000346183.3	+	9	2757	c.2733A>T	c.(2731-2733)caA>caT	p.Q911H	NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000349223.5_Missense_Mutation_p.Q911H|SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000575270.1_Missense_Mutation_p.Q911H|NFATC3_ENST00000329524.4_Missense_Mutation_p.Q911H	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	911					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q911H(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTCAGTTACAACCTATTACAT	0.468																																					p.Q911H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2733T	16						.						97.0	93.0	94.0					16																	68225305		2198	4300	6498	66782806	SO:0001583	missense	4775	exon9			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2733A>T	16.37:g.68225305A>T	ENSP00000300659:p.Gln911His		66782806	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.832088	0.32421	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.14266	2.52;2.53;2.53	5.49	-7.68	0.01268	.	0.220615	0.43579	D	0.000545	T	0.23330	0.0564	L	0.34521	1.04	0.22719	N	0.998818	D;D;D;D	0.71674	0.996;0.998;0.996;0.996	D;D;D;D	0.80764	0.986;0.994;0.986;0.986	T	0.41556	-0.9502	10	0.59425	D	0.04	-6.607	22.1146	0.99966	0.229:0.0:0.771:0.0	.	911;911;911;911	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	H	911;911;911;432	ENSP00000264008:Q911H;ENSP00000300659:Q911H;ENSP00000331324:Q911H	ENSP00000331324:Q911H	Q	+	3	2	NFATC3	66782806	0.002000	0.14202	0.386000	0.26170	0.149000	0.21700	-0.887000	0.04152	-1.812000	0.01227	-0.451000	0.05528	CAA		0.468	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
VTN	7448	broad.mit.edu	37	17	26696345	26696345	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:26696345G>A	ENST00000226218.4	-	4	1252	c.634C>T	c.(634-636)Cgc>Tgc	p.R212C	TMEM199_ENST00000509083.1_Intron|VTN_ENST00000438614.1_5'Flank|CTB-96E2.2_ENST00000555059.2_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_5'Flank|VTN_ENST00000536498.1_5'UTR|SARM1_ENST00000379061.4_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	212					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R212C(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CAGTTGATGCGGGTGAAGGCG	0.587																																					p.R212C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C634T	17						.						88.0	86.0	87.0					17																	26696345		2203	4300	6503	23720472	SO:0001583	missense	7448	exon4			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.634C>T	17.37:g.26696345G>A	ENSP00000226218:p.Arg212Cys		23720472	NM_000638	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	.	.	.	.	.	.	.	.	.	.	G	34	5.315282	0.95655	.	.	ENSG00000255604	ENST00000226218	T	0.02631	4.22	5.66	5.66	0.87406	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.13683	-1.0500	10	0.87932	D	0	-27.016	19.7366	0.96208	0.0:0.0:1.0:0.0	.	212	P04004	VTNC_HUMAN	C	212	ENSP00000226218:R212C	ENSP00000226218:R212C	R	-	1	0	AC002094.1	23720472	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.567000	0.82357	2.667000	0.90743	0.462000	0.41574	CGC		0.587	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
CDK12	51755	broad.mit.edu	37	17	37687087	37687087	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:37687087C>T	ENST00000447079.4	+	14	4024	c.3991C>T	c.(3991-3993)Cga>Tga	p.R1331*	CDK12_ENST00000430627.2_Nonsense_Mutation_p.R1322*	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1331					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.R1331*(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GTACTCCACCCGACCCCGTCC	0.552			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.R1331X			Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3991T	17						.						83.0	84.0	84.0					17																	37687087		2203	4300	6503	34940613	SO:0001587	stop_gained	51755	exon14			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.3991C>T	17.37:g.37687087C>T	ENSP00000398880:p.Arg1331*		34940613	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Nonsense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	40	7.951323	0.98577	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	.	.	.	5.45	4.43	0.53597	.	0.000000	0.39909	N	0.001225	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-6.7355	11.0563	0.47920	0.3083:0.6917:0.0:0.0	.	.	.	.	X	1322;1331	.	ENSP00000407720:R1322X	R	+	1	2	CDK12	34940613	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.335000	0.33839	2.836000	0.97738	0.655000	0.94253	CGA		0.552	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
KRT9	3857	broad.mit.edu	37	17	39727959	39727959	+	Missense_Mutation	SNP	C	C	T	rs145530082		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:39727959C>T	ENST00000246662.4	-	1	351	c.286G>A	c.(286-288)Ggt>Agt	p.G96S	KRT9_ENST00000588431.1_Intron	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	96	Head.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.G96S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				ccaccaaaacctctggaacca	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		12548	0.0		0.001	False		,,,				2504	0.0				p.G96S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	17						.	C	SER/GLY	0,4404		0,0,2202	125.0	139.0	134.0		286	-2.0	0.0	17	dbSNP_134	134	3,8597	3.0+/-9.4	0,3,4297	yes	missense	KRT9	NM_000226.3	56	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	benign	96/624	39727959	3,13001	2202	4300	6502	36981485	SO:0001583	missense	3857	exon1				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.286G>A	17.37:g.39727959C>T	ENSP00000246662:p.Gly96Ser		36981485	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.89	1.775020	0.31411	0.0	3.49E-4	ENSG00000171403	ENST00000246662	D	0.88509	-2.39	4.21	-2.03	0.07365	.	.	.	.	.	T	0.78848	0.4348	L	0.39147	1.195	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.60110	-0.7327	9	0.11794	T	0.64	.	4.6363	0.12527	0.2597:0.5421:0.0:0.1982	.	96	P35527	K1C9_HUMAN	S	96	ENSP00000246662:G96S	ENSP00000246662:G96S	G	-	1	0	KRT9	36981485	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.305000	0.08188	-0.325000	0.08577	-1.297000	0.01338	GGT		0.577	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
MAPT	4137	broad.mit.edu	37	17	44061110	44061110	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:44061110G>C	ENST00000571987.1	+	5	940	c.940G>C	c.(940-942)Gag>Cag	p.E314Q	MAPT_ENST00000420682.2_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.E314Q|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.E314Q|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.E314Q|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000576518.1_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	314					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.E314Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	CGTGCAGAAGGAGCAGGCGCA	0.647																																					p.E314Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G940C	17						.						38.0	45.0	42.0					17																	44061110		2203	4300	6503	41416947	SO:0001583	missense	4137	exon6			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.940G>C	17.37:g.44061110G>C	ENSP00000458742:p.Glu314Gln		41416947	NM_016835	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	37	CCDS11501.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687789	0.68271	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.14266	2.54;2.52;2.54	5.28	5.28	0.74379	.	0.175410	0.27415	N	0.019467	T	0.23727	0.0574	L	0.40543	1.245	0.80722	D	1	P;D	0.67145	0.839;0.996	P;P	0.60012	0.506;0.867	T	0.00621	-1.1640	10	0.25106	T	0.35	-12.0846	14.7492	0.69513	0.0:0.0:1.0:0.0	.	314;314	P10636-9;P10636	.;TAU_HUMAN	Q	314	ENSP00000340820:E314Q;ENSP00000262410:E314Q;ENSP00000410838:E314Q	ENSP00000262410:E314Q	E	+	1	0	MAPT	41416947	1.000000	0.71417	0.894000	0.35097	0.229000	0.25112	2.958000	0.49145	2.638000	0.89438	0.561000	0.74099	GAG		0.647	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
OSBPL7	114881	broad.mit.edu	37	17	45886483	45886483	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:45886483T>C	ENST00000007414.3	-	20	2320	c.2129A>G	c.(2128-2130)tAc>tGc	p.Y710C	OSBPL7_ENST00000392507.3_Missense_Mutation_p.Y710C	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	710					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.Y710C(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						GGGTCCCCGGTACAGCCCCTC	0.632																																					p.Y710C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2129G	17						.						51.0	55.0	54.0					17																	45886483		2203	4300	6503	43241482	SO:0001583	missense	114881	exon20			AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.2129A>G	17.37:g.45886483T>C	ENSP00000007414:p.Tyr710Cys		43241482	NM_145798	D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	37	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.883774	0.51908	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.32515	1.45;1.45	5.2	4.12	0.48240	.	0.181927	0.49916	D	0.000131	T	0.43656	0.1257	M	0.81341	2.54	0.37442	D	0.914441	D	0.61697	0.99	P	0.53722	0.733	T	0.51268	-0.8727	10	0.54805	T	0.06	-14.5071	5.4515	0.16568	0.1535:0.0838:0.0:0.7627	.	710	Q9BZF2	OSBL7_HUMAN	C	710	ENSP00000007414:Y710C;ENSP00000376295:Y710C	ENSP00000007414:Y710C	Y	-	2	0	OSBPL7	43241482	1.000000	0.71417	0.987000	0.45799	0.726000	0.41606	2.350000	0.44063	0.829000	0.34733	0.459000	0.35465	TAC		0.632	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
TP53	7157	broad.mit.edu	37	17	7579317	7579317	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:7579317A>C	ENST00000269305.4	-	4	559	c.370T>G	c.(370-372)Tgc>Ggc	p.C124G	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C124G|TP53_ENST00000420246.2_Missense_Mutation_p.C124G|TP53_ENST00000359597.4_Missense_Mutation_p.C124G|TP53_ENST00000445888.2_Missense_Mutation_p.C124G|TP53_ENST00000413465.2_Missense_Mutation_p.C124G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C124G(4)|p.C124R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124fs*46(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124fs*48(1)|p.C124fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGACCGTGCAAGTCACAGAC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C124G	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,ovary,NS,Substitution - Missense,0 	.	28	Deletion - Frameshift(9)|Substitution - Missense(8)|Whole gene deletion(8)|Insertion - Frameshift(2)|Deletion - In frame(1)	ovary(5)|upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)	c.T370G	17						.						66.0	62.0	63.0					17																	7579317		2203	4300	6503	7520042	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.370T>G	17.37:g.7579317A>C	ENSP00000269305:p.Cys124Gly		7520042	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089257	0.76756	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99758	-6.65;-6.65;-6.65;-6.65;-6.65;-6.65;-6.65;-6.65	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.099990	0.64402	D	0.000002	D	0.99674	0.9878	M	0.78049	2.395	0.58432	D	0.999999	P;P;P;B;P;D;P	0.55172	0.71;0.877;0.762;0.016;0.519;0.97;0.666	P;P;D;B;D;D;P	0.87578	0.576;0.661;0.989;0.412;0.982;0.998;0.74	D	0.97401	0.9996	10	0.56958	D	0.05	-11.7577	12.5363	0.56144	1.0:0.0:0.0:0.0	.	85;124;124;124;124;124;124	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	124;124;124;124;124;124;113;124;124	ENSP00000410739:C124G;ENSP00000352610:C124G;ENSP00000269305:C124G;ENSP00000398846:C124G;ENSP00000391127:C124G;ENSP00000391478:C124G;ENSP00000424104:C124G;ENSP00000426252:C124G	ENSP00000269305:C124G	C	-	1	0	TP53	7520042	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	5.673000	0.68109	2.125000	0.65367	0.533000	0.62120	TGC		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CD300C	10871	broad.mit.edu	37	17	72540958	72540958	+	Nonsense_Mutation	SNP	G	G	A	rs59461308	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr17:72540958G>A	ENST00000330793.1	-	2	550	c.190C>T	c.(190-192)Cga>Tga	p.R64*		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	64	Ig-like V-type.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.R64*(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						TTGTCACATCGGAGAATCTGT	0.562													G|||	9	0.00179712	0.0038	0.0014	5008	,	,		20112	0.002		0.0	False		,,,				2504	0.001				p.R64X	Esophageal Squamous(66;421 1121 20537 25337 27468)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C190T	17						.	G	stop/ARG	9,4397	15.5+/-35.6	0,9,2194	150.0	122.0	131.0		190	-2.0	0.0	17	dbSNP_129	131	0,8600		0,0,4300	yes	stop-gained	CD300C	NM_006678.3		0,9,6494	AA,AG,GG		0.0,0.2043,0.0692		64/225	72540958	9,12997	2203	4300	6503	70052553	SO:0001587	stop_gained	10871	exon2			BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.190C>T	17.37:g.72540958G>A	ENSP00000329507:p.Arg64*		70052553	NM_006678		Nonsense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	4	0.0018315018315018315	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	0	0.0	G	26.1	4.708428	0.89018	0.002043	0.0	ENSG00000167850	ENST00000330793	.	.	.	3.28	-2.04	0.07343	.	5.059290	0.00616	N	0.000433	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	1.9169	0.03299	0.1286:0.3747:0.3064:0.1902	rs59461308	.	.	.	X	64	.	ENSP00000329507:R64X	R	-	1	2	CD300C	70052553	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.875000	0.04205	-0.111000	0.12001	0.306000	0.20318	CGA		0.562	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
LAMA1	284217	broad.mit.edu	37	18	6943326	6943326	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr18:6943326C>T	ENST00000389658.3	-	62	9013	c.8920G>A	c.(8920-8922)Gat>Aat	p.D2974N		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2974	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.D2974N(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CATTTTCCATCACAGAGCACA	0.473																																					p.D2974N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8920A	18						.						250.0	213.0	226.0					18																	6943326		2203	4300	6503	6933326	SO:0001583	missense	284217	exon62			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8920G>A	18.37:g.6943326C>T	ENSP00000374309:p.Asp2974Asn		6933326	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.642925	0.67244	.	.	ENSG00000101680	ENST00000389658	T	0.59906	0.23	5.56	5.56	0.83823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.133597	0.48767	D	0.000166	D	0.82976	0.5154	M	0.93328	3.405	0.58432	D	0.999991	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.988	D	0.85902	0.1435	10	0.51188	T	0.08	.	19.5255	0.95203	0.0:1.0:0.0:0.0	.	2974;304	P25391;B3KSD8	LAMA1_HUMAN;.	N	2974	ENSP00000374309:D2974N	ENSP00000374309:D2974N	D	-	1	0	LAMA1	6933326	1.000000	0.71417	0.999000	0.59377	0.027000	0.11550	3.028000	0.49705	2.627000	0.88993	0.563000	0.77884	GAT		0.473	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ASXL3	80816	broad.mit.edu	37	18	31324443	31324443	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr18:31324443C>A	ENST00000269197.5	+	12	4631	c.4631C>A	c.(4630-4632)gCa>gAa	p.A1544E		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1544					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1544E(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCTGCTTCGGCAGCAAAACAA	0.502											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1544E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4631A	18						.						34.0	34.0	34.0					18																	31324443		2031	4190	6221	29578441	SO:0001583	missense	80816	exon12			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4631C>A	18.37:g.31324443C>A	ENSP00000269197:p.Ala1544Glu	823	29578441	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	3.072	-0.190877	0.06299	.	.	ENSG00000141431	ENST00000269197	T	0.14391	2.51	6.17	2.49	0.30216	.	.	.	.	.	T	0.08313	0.0207	N	0.19112	0.55	0.09310	N	1	B	0.24823	0.112	B	0.21708	0.036	T	0.34378	-0.9831	9	0.45353	T	0.12	.	5.2487	0.15510	0.1257:0.547:0.0:0.3273	.	1544	Q9C0F0	ASXL3_HUMAN	E	1544	ENSP00000269197:A1544E	ENSP00000269197:A1544E	A	+	2	0	ASXL3	29578441	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.138000	0.16016	0.190000	0.20209	0.655000	0.94253	GCA		0.502	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
NWD1	284434	broad.mit.edu	37	19	16910774	16910774	+	Silent	SNP	C	C	T	rs370525441		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:16910774C>T	ENST00000552788.1	+	15	3537	c.3537C>T	c.(3535-3537)cgC>cgT	p.R1179R	CTD-2538G9.6_ENST00000601661.1_RNA|NWD1_ENST00000379808.3_Silent_p.R1179R|NWD1_ENST00000549814.1_Intron|NWD1_ENST00000339803.6_Silent_p.R1044R|NWD1_ENST00000524140.2_Silent_p.R1179R|NWD1_ENST00000523826.1_Silent_p.R973R			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1179							ATP binding (GO:0005524)	p.R1044R(2)|p.R1179R(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGCTGGCCCGCGGCGGGGCTT	0.627																																					p.R1179R												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C3537T	19						.	C		1,4405	2.1+/-5.4	0,1,2202	43.0	45.0	44.0		3537	-3.8	0.0	19		44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NWD1	NM_001007525.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		1179/1433	16910774	2,13004	2203	4300	6503	16771774	SO:0001819	synonymous_variant	284434	exon17			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3537C>T	19.37:g.16910774C>T			16771774	NM_001007525	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																					0.627	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
ZNF100	163227	broad.mit.edu	37	19	21910441	21910441	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:21910441T>C	ENST00000358296.6	-	5	871	c.673A>G	c.(673-675)Aga>Gga	p.R225G	ZNF100_ENST00000305570.6_Missense_Mutation_p.R161G	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R225G(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						ATATGAAATCTTTTATGTTGA	0.328																																					p.R225G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A673G	19						.						52.0	55.0	54.0					19																	21910441		2050	4232	6282	21702281	SO:0001583	missense	163227	exon5			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.673A>G	19.37:g.21910441T>C	ENSP00000351042:p.Arg225Gly		21702281	NM_173531	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	2.240	-0.374015	0.05034	.	.	ENSG00000197020	ENST00000358296	T	0.02421	4.3	0.832	0.832	0.18867	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06050	0.0157	M	0.86651	2.83	0.31845	N	0.623035	B;B	0.10296	0.002;0.003	B;B	0.11329	0.0;0.006	T	0.01661	-1.1301	9	0.56958	D	0.05	.	6.5582	0.22471	0.0:0.0:0.0:1.0	.	225;279	Q8IYN0;Q4G131	ZN100_HUMAN;.	G	225	ENSP00000351042:R225G	ENSP00000351042:R225G	R	-	1	2	ZNF100	21702281	.	.	0.271000	0.24616	0.405000	0.30901	.	.	0.148000	0.19059	0.147000	0.16070	AGA		0.328	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
SYNE4	163183	broad.mit.edu	37	19	36494270	36494270	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:36494270A>G	ENST00000324444.3	-	8	1295	c.1184T>C	c.(1183-1185)cTc>cCc	p.L395P	SYNE4_ENST00000340477.5_Missense_Mutation_p.L282P	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	395	KASH. {ECO:0000255|PROSITE- ProRule:PRU00385}.				establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)		p.L395P(1)									GACATAGCTGAGCACCAGGTA	0.542																																					p.L395P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1184C	19						.						50.0	50.0	50.0					19																	36494270		2030	4191	6221	41186110	SO:0001583	missense	163183	exon8			BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.1184T>C	19.37:g.36494270A>G	ENSP00000316130:p.Leu395Pro		41186110	NM_001039876	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	ENST00000324444.3	37	CCDS42553.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.038484	0.75617	.	.	ENSG00000181392	ENST00000503121;ENST00000340477;ENST00000324444	T;T	0.66638	-0.22;-0.22	6.07	6.07	0.98685	Klarsicht/ANC-1/syne-1 homology (2);	0.942707	0.08448	N	0.944432	T	0.76227	0.3958	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.68450	-0.5405	10	0.87932	D	0	-34.6905	13.0206	0.58784	1.0:0.0:0.0:0.0	.	282;395	Q8N205-2;Q8N205	.;SYNE4_HUMAN	P	132;282;395	ENSP00000343152:L282P;ENSP00000316130:L395P	ENSP00000316130:L395P	L	-	2	0	C19orf46	41186110	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	4.185000	0.58330	2.326000	0.78906	0.533000	0.62120	CTC		0.542	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109525.3	NM_001039876	
ZNF420	147923	broad.mit.edu	37	19	37618236	37618236	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:37618236G>A	ENST00000337995.3	+	5	558	c.343G>A	c.(343-345)Gac>Aac	p.D115N	ZNF420_ENST00000304239.7_Missense_Mutation_p.D115N|ZNF585A_ENST00000588723.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D115N(1)		breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATCATATATGACAAAATGTC	0.373																																					p.D115N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G343A	19						.						102.0	100.0	101.0					19																	37618236		2203	4300	6503	42310076	SO:0001583	missense	147923	exon5			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.343G>A	19.37:g.37618236G>A	ENSP00000338770:p.Asp115Asn		42310076	NM_144689	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	G	3.840	-0.033956	0.07543	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.06687	3.27;3.41	3.77	1.63	0.23807	.	.	.	.	.	T	0.04182	0.0116	N	0.05487	-0.04	0.25315	N	0.989166	B	0.06786	0.001	B	0.04013	0.001	T	0.36407	-0.9749	9	0.54805	T	0.06	.	5.5282	0.16970	0.2534:0.0:0.7466:0.0	.	115	Q8TAQ5	ZN420_HUMAN	N	115	ENSP00000306102:D115N;ENSP00000338770:D115N	ENSP00000306102:D115N	D	+	1	0	ZNF420	42310076	0.000000	0.05858	0.488000	0.27440	0.329000	0.28539	0.002000	0.13061	0.914000	0.36822	-0.291000	0.09656	GAC		0.373	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
HKR1	284459	broad.mit.edu	37	19	37854559	37854559	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:37854559A>C	ENST00000324411.4	+	6	2131	c.1862A>C	c.(1861-1863)cAc>cCc	p.H621P	HKR1_ENST00000392153.3_Missense_Mutation_p.H602P|HKR1_ENST00000541583.2_Missense_Mutation_p.H560P|HKR1_ENST00000591471.1_Missense_Mutation_p.H348P|HKR1_ENST00000544914.1_Missense_Mutation_p.H348P|HKR1_ENST00000589392.1_Missense_Mutation_p.H603P|HKR1_ENST00000591134.1_Intron	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	621					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H621P(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CGGCAGTCACACCTCATTAGA	0.498																																					p.H621P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1862C	19						.						75.0	77.0	76.0					19																	37854559		2203	4300	6503	42546399	SO:0001583	missense	284459	exon6			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1862A>C	19.37:g.37854559A>C	ENSP00000315505:p.His621Pro		42546399	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.935|8.935	0.964476|0.964476	0.18583|0.18583	.|.	.|.	ENSG00000181666|ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000324411;ENST00000541583|ENST00000542144	T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6|.	2.82|2.82	2.82|2.82	0.32997|0.32997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.41328|0.41328	0.1154|0.1154	L|L	0.53671|0.53671	1.685|1.685	0.09310|0.09310	N|N	1|1	D;P;D;P|.	0.56746|.	0.977;0.922;0.973;0.701|.	P;P;P;B|.	0.62184|.	0.899;0.708;0.865;0.321|.	T|T	0.27331|0.27331	-1.0077|-1.0077	9|5	0.41790|.	T|.	0.15|.	.|.	6.1535|6.1535	0.20324|0.20324	0.8701:0.0:0.1299:0.0|0.8701:0.0:0.1299:0.0	.|.	560;602;621;603|.	Q7Z6E1;P10072-2;P10072;B4DSY3|.	.;.;HKR1_HUMAN;.|.	P|P	348;400;602;621;560|656	ENSP00000437774:H348P;ENSP00000375994:H602P;ENSP00000315505:H621P;ENSP00000438261:H560P|.	ENSP00000315505:H621P|.	H|T	+|+	2|1	0|0	HKR1|HKR1	42546399|42546399	0.000000|0.000000	0.05858|0.05858	0.943000|0.943000	0.38184|0.38184	0.979000|0.979000	0.70002|0.70002	-1.044000|-1.044000	0.03532|0.03532	1.291000|1.291000	0.44653|0.44653	0.529000|0.529000	0.55759|0.55759	CAC|ACC		0.498	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
ZNF780A	284323	broad.mit.edu	37	19	40580904	40580904	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:40580904A>C	ENST00000595687.2	-	6	1654	c.1445T>G	c.(1444-1446)tTc>tGc	p.F482C	ZNF780A_ENST00000414720.2_Intron|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000450241.2_Missense_Mutation_p.F448C|ZNF780A_ENST00000340963.5_Missense_Mutation_p.F482C|ZNF780A_ENST00000594395.1_Missense_Mutation_p.F483C|ZNF780A_ENST00000455521.1_Missense_Mutation_p.F483C	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	482					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F448C(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GCCACGATTGAAGGCCTTCCC	0.423																																					p.F482C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1445G	19						.						117.0	113.0	115.0					19																	40580904		2203	4300	6503	45272744	SO:0001583	missense	284323	exon6			AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1445T>G	19.37:g.40580904A>C	ENSP00000472189:p.Phe482Cys		45272744	NM_001142578	E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630177	0.67015	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.48201	0.82;0.82	1.93	1.93	0.25924	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71256	0.3318	M	0.92077	3.27	0.31794	N	0.629238	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72846	-0.4169	9	0.87932	D	0	.	7.4565	0.27270	1.0:0.0:0.0:0.0	.	483;482	E9PB48;O75290	.;Z780A_HUMAN	C	482;483;482	ENSP00000400997:F483C;ENSP00000341507:F482C	ENSP00000341507:F482C	F	-	2	0	ZNF780A	45272744	1.000000	0.71417	0.045000	0.18777	0.682000	0.39822	7.291000	0.78721	0.866000	0.35629	0.260000	0.18958	TTC		0.423	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
CEACAM20	125931	broad.mit.edu	37	19	45021083	45021083	+	RNA	SNP	G	G	A	rs559550466		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:45021083G>A	ENST00000454753.1	-	0	1511							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TGTAGATCCCGTCGTGTTCCC	0.587													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19203	0.0		0.0	False		,,,				2504	0.0				p.D411D												.	.	0			c.C1233T	19						.						60.0	65.0	63.0					19																	45021083		2057	4191	6248	49712923			125931	exon6			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45021083G>A			49712923	NM_001102597		Silent	SNP	ENST00000454753.1	37																																																																																					0.587	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
SYT5	6861	broad.mit.edu	37	19	55686338	55686338	+	Silent	SNP	G	G	A	rs141734238		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:55686338G>A	ENST00000354308.3	-	7	1107	c.738C>T	c.(736-738)tcC>tcT	p.S246S	SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000590851.1_Silent_p.S242S|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000537500.1_Silent_p.S246S	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	246					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.S246S(1)		kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CATAGCGGAGGGAGAAGCAGA	0.597																																					p.S246S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C738T	19						.						86.0	83.0	84.0					19																	55686338		2203	4300	6503	60378150	SO:0001819	synonymous_variant	6861	exon7			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.738C>T	19.37:g.55686338G>A			60378150	NM_003180	B3KWJ8|B7Z300|Q86X72	Silent	SNP	ENST00000354308.3	37	CCDS12919.1																																																																																				0.597	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
COL5A3	50509	broad.mit.edu	37	19	10071546	10071546	+	Silent	SNP	G	G	A	rs201892356		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:10071546G>A	ENST00000264828.3	-	66	4957	c.4872C>T	c.(4870-4872)gaC>gaT	p.D1624D		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1624	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.D1624D(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTGGGGACCCGTCGGCGTCCA	0.592																																					p.D1624D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4872T	19						.						80.0	76.0	77.0					19																	10071546		2203	4300	6503	9932546	SO:0001819	synonymous_variant	50509	exon66			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4872C>T	19.37:g.10071546G>A			9932546	NM_015719	Q9NZQ6	Silent	SNP	ENST00000264828.3	37	CCDS12222.1																																																																																				0.592	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
PPP6R1	22870	broad.mit.edu	37	19	55748137	55748137	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr19:55748137T>C	ENST00000412770.2	-	17	2428	c.1862A>G	c.(1861-1863)gAt>gGt	p.D621G	PPP6R1_ENST00000587283.1_Missense_Mutation_p.D621G|AC010327.1_ENST00000581390.1_RNA	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	621					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)	p.D621G(1)		breast(1)	1						CTCATCATCATCAAACTGCTG	0.632																																					p.D621G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1862G	19						.						85.0	86.0	86.0					19																	55748137		2037	4180	6217	60439949	SO:0001583	missense	22870	exon17			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1862A>G	19.37:g.55748137T>C	ENSP00000414202:p.Asp621Gly		60439949	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505436	0.85282	.	.	ENSG00000105063	ENST00000412770	T	0.68181	-0.31	4.69	4.69	0.59074	.	0.000000	0.64402	D	0.000007	T	0.71913	0.3396	L	0.32530	0.975	0.53688	D	0.999978	D	0.89917	1.0	D	0.69654	0.965	T	0.74556	-0.3626	10	0.59425	D	0.04	-24.7567	13.5413	0.61674	0.0:0.0:0.0:1.0	.	621	Q9UPN7	PP6R1_HUMAN	G	621	ENSP00000414202:D621G	ENSP00000414202:D621G	D	-	2	0	PPP6R1	60439949	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	7.201000	0.77847	2.092000	0.63282	0.460000	0.39030	GAT		0.632	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
CD101	9398	broad.mit.edu	37	1	117560815	117560815	+	Silent	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:117560815G>A	ENST00000256652.4	+	6	1708	c.1650G>A	c.(1648-1650)ccG>ccA	p.P550P	CD101_ENST00000369470.1_Silent_p.P550P	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	550	Ig-like C2-type 5.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.P550P(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GCCGTCAGCCGCAAGTGATGT	0.438																																					p.P550P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1650A	1						.						100.0	78.0	85.0					1																	117560815		2203	4300	6503	117362338	SO:0001819	synonymous_variant	9398	exon6			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1650G>A	1.37:g.117560815G>A			117362338	NM_004258	Q15856	Silent	SNP	ENST00000256652.4	37	CCDS891.1																																																																																				0.438	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
SPAG17	200162	broad.mit.edu	37	1	118550765	118550765	+	Missense_Mutation	SNP	G	G	A	rs139932174		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:118550765G>A	ENST00000336338.5	-	31	4554	c.4489C>T	c.(4489-4491)Cgc>Tgc	p.R1497C		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1497						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R1497C(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GTGGCATAGCGTGAGCTTTCT	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19681	0.0		0.0	False		,,,				2504	0.001				p.R1497C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4489T	1						.	G	CYS/ARG	0,4406		0,0,2203	142.0	114.0	124.0		4489	0.1	0.3	1	dbSNP_134	124	5,8595	4.3+/-15.6	0,5,4295	yes	missense	SPAG17	NM_206996.2	180	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign	1497/2224	118550765	5,13001	2203	4300	6503	118352288	SO:0001583	missense	200162	exon31				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4489C>T	1.37:g.118550765G>A	ENSP00000337804:p.Arg1497Cys		118352288	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298000	0.23650	0.0	5.81E-4	ENSG00000155761	ENST00000336338	T	0.17691	2.26	5.83	0.0893	0.14458	.	0.472749	0.25073	N	0.033360	T	0.02193	0.0068	N	0.08118	0	0.23661	N	0.997177	P	0.37864	0.61	B	0.36885	0.235	T	0.36986	-0.9725	10	0.56958	D	0.05	.	3.7029	0.08389	0.074:0.2532:0.3517:0.3212	.	1497	Q6Q759	SPG17_HUMAN	C	1497	ENSP00000337804:R1497C	ENSP00000337804:R1497C	R	-	1	0	SPAG17	118352288	0.977000	0.34250	0.330000	0.25442	0.027000	0.11550	2.018000	0.40991	0.377000	0.24735	-0.309000	0.09137	CGC		0.502	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
UBAP2L	9898	broad.mit.edu	37	1	154226479	154226479	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:154226479C>T	ENST00000361546.2	+	14	1810	c.1768C>T	c.(1768-1770)Cct>Tct	p.P590S	UBAP2L_ENST00000428931.1_Missense_Mutation_p.P590S|AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000271877.7_Missense_Mutation_p.P601S|UBAP2L_ENST00000343815.6_Missense_Mutation_p.P590S			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	590					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.P86S(1)|p.P590S(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGCTCAGGGCCCTCTTTATGA	0.493																																					p.P590S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1768T	1						.						85.0	82.0	83.0					1																	154226479		2203	4300	6503	152493103	SO:0001583	missense	9898	exon15			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1768C>T	1.37:g.154226479C>T	ENSP00000355343:p.Pro590Ser		152493103	NM_014847	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.314953	0.60524	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.14391	2.52;2.51;2.57;2.51	4.75	4.75	0.60458	.	0.428243	0.25768	N	0.028433	T	0.05731	0.0150	N	0.26042	0.785	0.47341	D	0.999392	B;P;P;P;P	0.50528	0.365;0.936;0.648;0.648;0.629	B;P;B;B;B	0.47673	0.18;0.554;0.334;0.334;0.18	T	0.03969	-1.0988	10	0.02654	T	1	-8.2169	17.2672	0.87090	0.0:1.0:0.0:0.0	.	504;601;583;590;590	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	S	590;590;86;86;601;590	ENSP00000345308:P590S;ENSP00000389445:P590S;ENSP00000271877:P601S;ENSP00000355343:P590S	ENSP00000271877:P601S	P	+	1	0	UBAP2L	152493103	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.551000	0.53698	2.623000	0.88846	0.655000	0.94253	CCT		0.493	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
CASQ1	844	broad.mit.edu	37	1	160164823	160164823	+	Silent	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:160164823T>C	ENST00000368078.3	+	4	683	c.487T>C	c.(487-489)Ttg>Ctg	p.L163L	CASQ1_ENST00000368079.3_Silent_p.L157L			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	163					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)	p.L157L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCCTGTGGAATTGATTGAAGG	0.473																																					p.L163L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T487C	1						.						126.0	117.0	120.0					1																	160164823		2203	4300	6503	158431447	SO:0001819	synonymous_variant	844	exon4			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.487T>C	1.37:g.160164823T>C			158431447	NM_001231	B1AKZ2|B2R863|Q8TBW7	Silent	SNP	ENST00000368078.3	37	CCDS1198.2																																																																																				0.473	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231	
TNFSF18	8995	broad.mit.edu	37	1	173019886	173019886	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:173019886A>T	ENST00000404377.3	-	1	217	c.217T>A	c.(217-219)Tta>Ata	p.L73I	RP1-15D23.2_ENST00000432694.2_lincRNA|TNFSF18_ENST00000239468.2_Missense_Mutation_p.L51I	NM_005092.3	NP_005083.2	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily, member 18	73					cell-cell signaling (GO:0007267)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of T cell proliferation (GO:0042129)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.L51I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	9						CTTACCTCTAATTGGAGAAAA	0.358																																					p.L73I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T217A	1						.						48.0	43.0	45.0					1																	173019886		2202	4298	6500	171286509	SO:0001583	missense	8995	exon1			AF117713	CCDS1305.2	1q23	2008-02-05			ENSG00000120337	ENSG00000120337		"""Tumor necrosis factor (ligand) superfamily"""	11932	protein-coding gene	gene with protein product		603898				10037686, 10074428	Standard	NM_005092		Approved	AITRL, TL6, hGITRL	uc001giu.2	Q9UNG2	OTTHUMG00000034835	ENST00000404377.3:c.217T>A	1.37:g.173019886A>T	ENSP00000385470:p.Leu73Ile		171286509	NM_005092	A9IQG8|O95852|Q6ISV1	Missense_Mutation	SNP	ENST00000404377.3	37	CCDS1305.2	.	.	.	.	.	.	.	.	.	.	A	12.28	1.891244	0.33442	.	.	ENSG00000120337	ENST00000404377;ENST00000239468	.	.	.	5.38	-2.3	0.06785	Tumour necrosis factor-like (1);	0.522375	0.15293	N	0.270074	T	0.12305	0.0299	L	0.27053	0.805	0.09310	N	1	B	0.26081	0.141	B	0.31016	0.123	T	0.33214	-0.9877	9	0.40728	T	0.16	-4.1241	10.4734	0.44650	0.5752:0.0:0.4248:0.0	.	73	Q9UNG2	TNF18_HUMAN	I	73;51	.	ENSP00000239468:L51I	L	-	1	2	TNFSF18	171286509	0.001000	0.12720	0.006000	0.13384	0.009000	0.06853	-0.842000	0.04354	-0.365000	0.08076	-0.375000	0.07067	TTA		0.358	TNFSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084268.2	NM_005092	
ABL2	27	broad.mit.edu	37	1	179078307	179078307	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:179078307C>T	ENST00000502732.1	-	12	2298	c.2095G>A	c.(2095-2097)Gat>Aat	p.D699N	ABL2_ENST00000344730.3_Intron|ABL2_ENST00000507173.1_Intron|ABL2_ENST00000408940.3_Missense_Mutation_p.D663N|ABL2_ENST00000512653.1_Missense_Mutation_p.D684N|ABL2_ENST00000511413.1_Intron|ABL2_ENST00000367623.4_Missense_Mutation_p.D678N|ABL2_ENST00000504405.1_Intron	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	699	F-actin-binding. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.D663N(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GAGAACCCATCAGCATGCTGT	0.527			T	ETV6	AML																																p.D678N			Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2032A	1						.						124.0	127.0	126.0					1																	179078307		2203	4300	6503	177344930	SO:0001583	missense	27	exon11			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2095G>A	1.37:g.179078307C>T	ENSP00000427562:p.Asp699Asn		177344930	NM_001168236	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483257	0.63962	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000512653;ENST00000367623	T;T;T;T	0.09350	2.99;2.99;2.99;2.99	5.7	5.7	0.88788	.	0.000000	0.45361	U	0.000368	T	0.25494	0.0620	L	0.50333	1.59	0.58432	D	0.999995	D;B;D;B	0.76494	0.999;0.264;0.999;0.264	D;B;D;B	0.68943	0.961;0.085;0.961;0.085	T	0.02294	-1.1181	10	0.10377	T	0.69	.	18.8208	0.92096	0.0:1.0:0.0:0.0	.	678;699;684;663	P42684-6;P42684;P42684-3;D1MPS6	.;ABL2_HUMAN;.;.	N	699;663;684;678	ENSP00000427562:D699N;ENSP00000386152:D663N;ENSP00000423578:D684N;ENSP00000356595:D678N	ENSP00000356595:D678N	D	-	1	0	ABL2	177344930	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	6.940000	0.75917	2.686000	0.91538	0.591000	0.81541	GAT		0.527	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
CACNA1E	777	broad.mit.edu	37	1	181764127	181764127	+	Missense_Mutation	SNP	G	G	A	rs192353760		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:181764127G>A	ENST00000367573.2	+	46	6155	c.6155G>A	c.(6154-6156)cGg>cAg	p.R2052Q	CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1616Q|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1990Q|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R2009Q|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R2003Q|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2033Q|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1941Q	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2052					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R2009Q(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCCCGTCGCCGGAGTTACCAC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		7363	0.0		0.0	False		,,,				2504	0.001				p.R2009Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6026A	1						.						66.0	69.0	68.0					1																	181764127		1940	4132	6072	180030750	SO:0001583	missense	777	exon45			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6155G>A	1.37:g.181764127G>A	ENSP00000356545:p.Arg2052Gln		180030750	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	33	5.208159	0.95033	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98264	-4.69;-4.68;-4.49;-4.67;-4.83;-4.49;-4.49	5.91	5.91	0.95273	.	0.690066	0.14408	N	0.321454	D	0.97148	0.9068	L	0.27053	0.805	0.42012	D	0.990947	P;D	0.62365	0.645;0.991	B;P	0.49708	0.104;0.62	D	0.97515	1.0069	10	0.72032	D	0.01	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	1990;2009	Q15878-2;Q15878-3	.;.	Q	2009;1990;2003;1941;1616;2033;2052	ENSP00000356542:R2009Q;ENSP00000434814:R1990Q;ENSP00000350183:R2003Q;ENSP00000351101:R1941Q;ENSP00000356539:R1616Q;ENSP00000353222:R2033Q;ENSP00000356545:R2052Q	ENSP00000350183:R2003Q	R	+	2	0	CACNA1E	180030750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.220000	0.65267	2.793000	0.96121	0.655000	0.94253	CGG		0.532	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CFH	3075	broad.mit.edu	37	1	196715082	196715082	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:196715082G>A	ENST00000367429.4	+	21	3686	c.3446G>A	c.(3445-3447)cGa>cAa	p.R1149Q		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1149	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.R1149Q(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GGTAACAAGCGAATAACATGT	0.403																																					p.R1149Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3446A	1						.						105.0	100.0	101.0					1																	196715082		2202	4280	6482	194981705	SO:0001583	missense	3075	exon21			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3446G>A	1.37:g.196715082G>A	ENSP00000356399:p.Arg1149Gln		194981705	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	10.96	1.498267	0.26861	.	.	ENSG00000000971	ENST00000367429	T	0.65364	-0.15	4.97	-9.94	0.00449	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.33904	0.0879	N	0.21142	0.635	0.09310	N	1	B	0.23377	0.084	B	0.15484	0.013	T	0.13683	-1.0500	9	0.27785	T	0.31	.	1.6528	0.02775	0.1416:0.3357:0.2299:0.2929	.	1149	P08603	CFAH_HUMAN	Q	1149	ENSP00000356399:R1149Q	ENSP00000356399:R1149Q	R	+	2	0	CFH	194981705	0.000000	0.05858	0.000000	0.03702	0.765000	0.43378	-4.774000	0.00187	-4.855000	0.00029	-0.310000	0.09108	CGA		0.403	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
PRELP	5549	broad.mit.edu	37	1	203453253	203453253	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:203453253A>G	ENST00000343110.2	+	2	1068	c.941A>G	c.(940-942)gAa>gGa	p.E314G		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	314					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.E314G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			AACAGGCTGGAACACCTGTAC	0.572																																					p.E314G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A941G	1						.						31.0	34.0	33.0					1																	203453253		2197	4282	6479	201719876	SO:0001583	missense	5549	exon2			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.941A>G	1.37:g.203453253A>G	ENSP00000343924:p.Glu314Gly		201719876	NM_002725	Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.976178	0.74360	.	.	ENSG00000188783	ENST00000343110	T	0.05382	3.45	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.02326	-1.1176	10	0.56958	D	0.05	-23.0368	12.8329	0.57756	1.0:0.0:0.0:0.0	.	314	P51888	PRELP_HUMAN	G	314	ENSP00000343924:E314G	ENSP00000343924:E314G	E	+	2	0	PRELP	201719876	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.327000	0.79147	1.731000	0.51592	0.379000	0.24179	GAA		0.572	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
LRRIQ3	127255	broad.mit.edu	37	1	74649127	74649127	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:74649127C>T	ENST00000395089.1	-	1	241	c.242G>A	c.(241-243)gGa>gAa	p.G81E	LRRIQ3_ENST00000370909.2_Missense_Mutation_p.G81E|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.G81E|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.G81E			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	81								p.G81E(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TACCTGATTTCCATGGAGATC	0.299																																					p.G81E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242A	1						.						62.0	67.0	65.0					1																	74649127		2199	4296	6495	74421715	SO:0001583	missense	127255	exon2			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.242G>A	1.37:g.74649127C>T	ENSP00000378524:p.Gly81Glu		74421715	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.01|19.01	3.743686|3.743686	0.69418|0.69418	.|.	.|.	ENSG00000162620|ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972;ENST00000370911|ENST00000444984	T;T;T;T|.	0.31510|.	3.0;3.0;1.49;3.0|.	5.27|5.27	4.3|4.3	0.51218|0.51218	.|.	0.234694|.	0.27618|.	N|.	0.018564|.	T|.	0.39489|.	0.1080|.	L|L	0.47716|0.47716	1.5|1.5	0.31173|0.31173	N|N	0.703|0.703	D|.	0.65815|.	0.995|.	D|.	0.63381|.	0.914|.	T|.	0.22347|.	-1.0219|.	10|.	0.59425|.	D|.	0.04|.	.|.	15.4587|15.4587	0.75336|0.75336	0.0:0.8609:0.1391:0.0|0.0:0.8609:0.1391:0.0	.|.	81|.	A6PVS8|.	LRIQ3_HUMAN|.	E|X	81|23	ENSP00000378524:G81E;ENSP00000346414:G81E;ENSP00000359946:G81E;ENSP00000359948:G81E|.	ENSP00000346414:G81E|.	G|W	-|-	2|3	0|0	LRRIQ3|LRRIQ3	74421715|74421715	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.518000|3.518000	0.53451|0.53451	2.601000|2.601000	0.87937|0.87937	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.299	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
ASB17	127247	broad.mit.edu	37	1	76397848	76397848	+	Silent	SNP	G	G	A	rs199681630		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:76397848G>A	ENST00000284142.6	-	1	268	c.129C>T	c.(127-129)taC>taT	p.Y43Y		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	43					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.Y43Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TCCTTGGTTCGTAACAGTGAT	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19247	0.0		0.0	False		,,,				2504	0.0				p.Y43Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C129T	1						.	G		1,4405	2.1+/-5.4	0,1,2202	131.0	126.0	128.0		129	-1.7	1.0	1	dbSNP_134	128	0,8600		0,0,4300	no	coding-synonymous	ASB17	NM_080868.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		43/296	76397848	1,13005	2203	4300	6503	76170436	SO:0001819	synonymous_variant	127247	exon1			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.129C>T	1.37:g.76397848G>A			76170436	NM_080868	B1APB8|Q8N0X5	Silent	SNP	ENST00000284142.6	37	CCDS671.1																																																																																				0.393	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
PTGFR	5737	broad.mit.edu	37	1	78958727	78958727	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:78958727G>A	ENST00000370757.3	+	2	536	c.299G>A	c.(298-300)cGc>cAc	p.R100H	PTGFR_ENST00000370756.3_Missense_Mutation_p.R100H|PTGFR_ENST00000370758.1_Missense_Mutation_p.R100H	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	100					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.R100H(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GAATGGATCCGCTTTGACCAA	0.448																																					p.R100H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G299A	1						.						137.0	126.0	130.0					1																	78958727		2203	4300	6503	78731315	SO:0001583	missense	5737	exon2			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.299G>A	1.37:g.78958727G>A	ENSP00000359793:p.Arg100His		78731315	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269544	0.40095	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	D;D;T	0.90133	-2.62;-2.62;-1.04	5.85	3.95	0.45737	GPCR, rhodopsin-like superfamily (1);	0.314666	0.35291	N	0.003317	T	0.78162	0.4240	N	0.20685	0.6	0.40139	D	0.976813	D;D	0.60160	0.96;0.987	P;P	0.49387	0.454;0.609	T	0.76033	-0.3107	10	0.15499	T	0.54	-3.6524	11.7169	0.51659	0.1457:0.0:0.8543:0.0	.	100;100	P43088;P43088-2	PF2R_HUMAN;.	H	100	ENSP00000359794:R100H;ENSP00000359793:R100H;ENSP00000359792:R100H	ENSP00000359792:R100H	R	+	2	0	PTGFR	78731315	0.994000	0.37717	1.000000	0.80357	0.526000	0.34562	1.899000	0.39818	0.903000	0.36546	0.655000	0.94253	CGC		0.448	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
SNX7	51375	broad.mit.edu	37	1	99150599	99150599	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:99150599C>A	ENST00000306121.3	+	2	348	c.339C>A	c.(337-339)ttC>ttA	p.F113L	SNX7_ENST00000370189.5_Missense_Mutation_p.F49L|SNX7_ENST00000529992.1_Missense_Mutation_p.F113L	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	49	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.F113L(1)|p.F49L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TAGAAACTTTCATTACGTATA	0.308																																					p.F113L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C339A	1						.						74.0	68.0	70.0					1																	99150599		2203	4300	6503	98923187	SO:0001583	missense	51375	exon2			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.339C>A	1.37:g.99150599C>A	ENSP00000304429:p.Phe113Leu		98923187	NM_152238	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	ENST00000306121.3	37	CCDS755.2	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837017	0.50951	.	.	ENSG00000162627	ENST00000370189;ENST00000529992;ENST00000306121;ENST00000454199	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.39	2.44	0.29823	.	0.049090	0.85682	D	0.000000	T	0.42017	0.1184	M	0.76170	2.325	0.43947	D	0.996619	D;D;P	0.76494	0.999;0.986;0.939	D;P;P	0.68483	0.958;0.786;0.582	T	0.41288	-0.9517	10	0.87932	D	0	-20.4125	7.543	0.27751	0.0:0.492:0.0:0.508	.	113;113;49	E9PNL2;Q9UNH6-3;Q9UNH6-2	.;.;.	L	49;113;113;49	ENSP00000359208:F49L;ENSP00000434731:F113L;ENSP00000304429:F113L;ENSP00000388266:F49L	ENSP00000304429:F113L	F	+	3	2	SNX7	98923187	0.380000	0.25131	0.998000	0.56505	0.289000	0.27227	-0.269000	0.08596	0.228000	0.21019	-0.143000	0.13931	TTC		0.308	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
PLPPR4	9890	broad.mit.edu	37	1	99771917	99771917	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:99771917C>T	ENST00000370185.3	+	7	2140	c.1643C>T	c.(1642-1644)cCc>cTc	p.P548L	LPPR4_ENST00000457765.1_Missense_Mutation_p.P490L|LPPR4_ENST00000370184.1_Missense_Mutation_p.P390L	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		548					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.P548L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AGCACCTCCCCCAAAAGCAGC	0.547																																					p.P548L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1643T	1						.						81.0	87.0	85.0					1																	99771917		2203	4300	6503	99544505	SO:0001583	missense	9890	exon7																														ENST00000370185.3:c.1643C>T	1.37:g.99771917C>T	ENSP00000359204:p.Pro548Leu		99544505	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554816	0.65425	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.26373	2.31;2.24;1.74	5.62	5.62	0.85841	.	0.239219	0.45126	D	0.000398	T	0.39118	0.1066	L	0.58810	1.83	0.80722	D	1	D;D	0.76494	0.999;0.992	D;D	0.64776	0.929;0.92	T	0.03287	-1.1052	9	.	.	.	-28.5348	19.6433	0.95764	0.0:1.0:0.0:0.0	.	490;548	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	L	548;490;548;390	ENSP00000359204:P548L;ENSP00000394913:P490L;ENSP00000359203:P390L	.	P	+	2	0	RP4-788L13.1	99544505	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	4.887000	0.63156	2.638000	0.89438	0.591000	0.81541	CCC		0.547	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
SLC30A10	55532	broad.mit.edu	37	1	220089002	220089002	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr1:220089002G>A	ENST00000366926.3	-	4	1408	c.1247C>T	c.(1246-1248)cCc>cTc	p.P416L	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Missense_Mutation_p.P171L	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	416					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.P416L(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TGCCCCGGGGGGACAACACAG	0.557																																					p.P416L	Colon(76;360 1614 43677 51136)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1247T	1						.						92.0	88.0	90.0					1																	220089002		2203	4300	6503	218155625	SO:0001583	missense	55532	exon4			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1247C>T	1.37:g.220089002G>A	ENSP00000355893:p.Pro416Leu		218155625	NM_018713	Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913988	0.52546	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.65549	-0.16;0.45	6.02	2.94	0.34122	.	0.399851	0.25490	N	0.030307	T	0.53174	0.1780	L	0.29908	0.895	0.80722	D	1	D	0.63880	0.993	P	0.53954	0.738	T	0.51795	-0.8660	9	.	.	.	-36.066	3.2409	0.06780	0.1568:0.2349:0.496:0.1124	.	416	Q6XR72	ZNT10_HUMAN	L	416;171	ENSP00000355893:P416L;ENSP00000439489:P171L	.	P	-	2	0	SLC30A10	218155625	0.777000	0.28628	0.975000	0.42487	0.357000	0.29423	1.061000	0.30542	1.558000	0.49541	0.650000	0.86243	CCC		0.557	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	
ADRA1D	146	broad.mit.edu	37	20	4202679	4202680	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:4202679_4202680insG	ENST00000379453.4	-	2	1325_1326	c.1209_1210insC	c.(1207-1212)ccctgtfs	p.C404fs		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	404					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)	p.C404fs*>170(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CGGCTGGAACAGGGGTAGATGA	0.653																																					p.C404fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1210_1211insC	20						.																																			4150680	SO:0001589	frameshift_variant	146	exon2			U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.1210dupC	20.37:g.4202683_4202683dupG	ENSP00000368766:p.Cys404fs		4150679	NM_000678	Q9NPY0	Frame_Shift_Ins	INS	ENST00000379453.4	37	CCDS13079.1																																																																																				0.653	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077812.2	NM_000678	
DTD1	92675	broad.mit.edu	37	20	18724808	18724808	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:18724808C>G	ENST00000377452.3	+	5	722	c.542C>G	c.(541-543)tCa>tGa	p.S181*		NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	181					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)	p.S181*(1)		large_intestine(4)|lung(1)|ovary(2)	7						CCTTCTGAATCAAGCAAGGAA	0.473																																					p.S181X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C542G	20						.						57.0	55.0	56.0					20																	18724808		2203	4300	6503	18672808	SO:0001587	stop_gained	92675	exon5			AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.542C>G	20.37:g.18724808C>G	ENSP00000366672:p.Ser181*		18672808	NM_080820	A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Nonsense_Mutation	SNP	ENST00000377452.3	37	CCDS13138.1	.	.	.	.	.	.	.	.	.	.	C	37	6.292533	0.97449	.	.	ENSG00000125821	ENST00000377452	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-6.4813	17.0144	0.86414	0.0:1.0:0.0:0.0	.	.	.	.	X	181	.	ENSP00000366672:S181X	S	+	2	0	DTD1	18672808	1.000000	0.71417	0.976000	0.42696	0.922000	0.55478	7.122000	0.77169	2.619000	0.88677	0.462000	0.41574	TCA		0.473	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078189.3	NM_080820	
ZNF341	84905	broad.mit.edu	37	20	32369099	32369099	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:32369099G>T	ENST00000375200.1	+	11	1990	c.1625G>T	c.(1624-1626)tGt>tTt	p.C542F	ZNF341_ENST00000342427.2_Missense_Mutation_p.C535F	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	542					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C535F(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CCACTTAGGTGTGTCAAATGT	0.587																																					p.C535F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1604T	20						.						206.0	174.0	185.0					20																	32369099		2203	4300	6503	31832760	SO:0001583	missense	84905	exon11			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1625G>T	20.37:g.32369099G>T	ENSP00000364346:p.Cys542Phe		31832760	NM_032819	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		.	.	.	.	.	.	.	.	.	.	G	25.1	4.604086	0.87157	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.25414	2.01;1.8	5.25	5.25	0.73442	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.40222	0.1108	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.996;0.996;0.998	P;P;D	0.64877	0.853;0.853;0.93	T	0.29397	-1.0013	10	0.87932	D	0	-7.3633	19.2076	0.93739	0.0:0.0:1.0:0.0	.	483;542;535	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	F	535;542	ENSP00000344308:C535F;ENSP00000364346:C542F	ENSP00000344308:C535F	C	+	2	0	ZNF341	31832760	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.402000	0.97298	2.602000	0.87976	0.655000	0.94253	TGT		0.587	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
MATN4	8785	broad.mit.edu	37	20	43932966	43932966	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:43932966C>T	ENST00000372754.1	-	2	553	c.545G>A	c.(544-546)cGc>cAc	p.R182H	MATN4_ENST00000353917.5_Missense_Mutation_p.R182H|MATN4_ENST00000372751.4_Intron|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000537548.1_Missense_Mutation_p.R182H|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000372756.1_Missense_Mutation_p.R182H|MATN4_ENST00000342716.4_Missense_Mutation_p.R182H|MATN4_ENST00000360607.6_Missense_Mutation_p.R182H|RBPJL_ENST00000372743.1_5'Flank			O95460	MATN4_HUMAN	matrilin 4	182	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.R182H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				TGCCATGGCGCGCAGGGAGCC	0.697																																					p.R182H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G545A	20						.						29.0	28.0	28.0					20																	43932966		2199	4293	6492	43366380	SO:0001583	missense	8785	exon3			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.545G>A	20.37:g.43932966C>T	ENSP00000361840:p.Arg182His		43366380	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.325331	0.95708	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	4.6	4.6	0.57074	.	0.000000	0.44902	D	0.000411	D	0.89815	0.6824	L	0.46819	1.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.995	D	0.90869	0.4744	10	0.72032	D	0.01	.	16.6432	0.85134	0.0:1.0:0.0:0.0	.	182;182;182	A6NNA4;O95460-4;O95460-2	.;.;.	H	182	ENSP00000361840:R182H;ENSP00000361842:R182H;ENSP00000243983:R182H;ENSP00000353819:R182H;ENSP00000343164:R182H;ENSP00000440328:R182H	ENSP00000255132:R182H	R	-	2	0	MATN4	43366380	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.632000	0.83247	2.419000	0.82065	0.456000	0.33151	CGC		0.697	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
ZNF335	63925	broad.mit.edu	37	20	44586515	44586515	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:44586515C>A	ENST00000322927.2	-	16	2406	c.2306G>T	c.(2305-2307)tGt>tTt	p.C769F	ZNF335_ENST00000426788.1_Missense_Mutation_p.C614F	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	769					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.C769F(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGTGTCAGAACAGAGCAATGA	0.592																																					p.C769F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2306T	20						.						99.0	95.0	96.0					20																	44586515		2203	4300	6503	44019922	SO:0001583	missense	63925	exon16			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2306G>T	20.37:g.44586515C>A	ENSP00000325326:p.Cys769Phe		44019922	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013004	0.54468	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.08807	3.18;3.05	4.86	4.86	0.63082	.	0.068414	0.64402	D	0.000013	T	0.12178	0.0296	N	0.22421	0.69	0.32970	D	0.522161	D;D	0.64830	0.994;0.99	P;P	0.56865	0.808;0.758	T	0.03784	-1.1004	10	0.52906	T	0.07	-9.6898	11.4687	0.50254	0.0:0.8031:0.1969:0.0	.	614;769	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	F	769;546;614	ENSP00000325326:C769F;ENSP00000397098:C614F	ENSP00000243961:C546F	C	-	2	0	ZNF335	44019922	0.956000	0.32656	0.998000	0.56505	0.712000	0.41017	1.818000	0.39012	2.528000	0.85240	0.563000	0.77884	TGT		0.592	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZNF335	63925	broad.mit.edu	37	20	44598328	44598328	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr20:44598328C>T	ENST00000322927.2	-	3	304	c.204G>A	c.(202-204)gaG>gaA	p.E68E	ZNF335_ENST00000494955.1_5'Flank|ZNF335_ENST00000426788.1_Intron	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	68					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.E68E(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CAGATACCTCCTCCTGAGGGG	0.597											OREG0025987	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E68E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G204A	20						.						57.0	63.0	61.0					20																	44598328		2203	4299	6502	44031735	SO:0001819	synonymous_variant	63925	exon3			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.204G>A	20.37:g.44598328C>T		925	44031735	NM_022095	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	37	CCDS13389.1																																																																																				0.597	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
TIAM1	7074	broad.mit.edu	37	21	32595759	32595759	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr21:32595759C>T	ENST00000286827.3	-	9	2429	c.1958G>A	c.(1957-1959)cGc>cAc	p.R653H	TIAM1_ENST00000541036.1_Missense_Mutation_p.R653H|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	653					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R653H(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GATTCCAAGGCGGCCCATGGC	0.483																																					p.R653H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1958A	21						.						85.0	88.0	87.0					21																	32595759		2203	4300	6503	31517630	SO:0001583	missense	7074	exon9				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1958G>A	21.37:g.32595759C>T	ENSP00000286827:p.Arg653His		31517630	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	35	5.506908	0.96386	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.59502	0.26;0.32	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.72078	0.3416	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	P;P;P;P	0.60886	0.88;0.761;0.856;0.761	T	0.76547	-0.2919	10	0.87932	D	0	.	17.7573	0.88453	0.0:1.0:0.0:0.0	.	653;653;494;653	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	H	653;494;653	ENSP00000286827:R653H;ENSP00000441570:R653H	ENSP00000286827:R653H	R	-	2	0	TIAM1	31517630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.551000	0.82182	2.496000	0.84212	0.655000	0.94253	CGC		0.483	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
PDE9A	5152	broad.mit.edu	37	21	44119120	44119120	+	Splice_Site	SNP	C	C	T	rs74697345	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr21:44119120C>T	ENST00000291539.6	+	4	321	c.261C>T	c.(259-261)tcC>tcT	p.S87S	PDE9A_ENST00000328862.6_Splice_Site_p.S61S|PDE9A_ENST00000335440.6_Splice_Site_p.R64*|PDE9A_ENST00000398227.3_Intron|PDE9A_ENST00000335512.4_Splice_Site_p.S87S|PDE9A_ENST00000398236.3_Splice_Site_p.S61S|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000539837.1_Intron|PDE9A_ENST00000398225.3_Splice_Site_p.S46S|PDE9A_ENST00000398232.3_Splice_Site_p.S20S|PDE9A_ENST00000349112.3_Splice_Site_p.R38*|PDE9A_ENST00000398234.3_Splice_Site_p.S46S|PDE9A_ENST00000380328.2_Splice_Site_p.R113*|PDE9A_ENST00000398229.3_Intron|PDE9A_ENST00000398224.3_Splice_Site_p.S20S	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	87					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)	p.S87S(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	AGCAACTCTCCGGTAAGGCCC	0.448													T|||	49	0.00978435	0.0348	0.0043	5008	,	,		14460	0.0		0.0	False		,,,				2504	0.0				p.R113X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C337T	21						.	T	,,stop/ARG,stop/ARG,,,,,,,,stop/ARG,,,,,,,,	155,4251	812.6+/-416.1	1,153,2049	85.0	78.0	80.0		261,60,112,337,138,,,183,,,,190,,,60,138,183,,,261	-4.7	0.9	21	dbSNP_132	80	3,8597	819.0+/-406.8	0,3,4297	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,stop-gained-near-splice,stop-gained-near-splice,coding-synonymous-near-splice,intron,intron,coding-synonymous-near-splice,intron,utr-5,intron,stop-gained-near-splice,utr-5,intron,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,utr-5,utr-5,coding-synonymous-near-splice	PDE9A	NM_001001567.1,NM_001001568.1,NM_001001569.1,NM_001001570.1,NM_001001571.1,NM_001001572.1,NM_001001573.1,NM_001001574.1,NM_001001575.1,NM_001001576.1,NM_001001577.1,NM_001001578.1,NM_001001579.1,NM_001001580.1,NM_001001581.1,NM_001001582.1,NM_001001583.1,NM_001001584.2,NM_001001585.1,NM_002606.2	,,,,,,,,,,,,,,,,,,,	1,156,6346	TT,TC,CC		0.0349,3.5179,1.2148	,,,,,,,,,,,,,,,,,,,	87/534,20/467,38/466,113/541,46/493,,,61/508,,,,64/492,,,20/527,46/553,61/568,,,87/594	44119120	158,12848	2203	4300	6503	42992189	SO:0001630	splice_region_variant	5152	exon5			AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.262+1C>T	21.37:g.44119120C>T			42992189	NM_001001570	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Nonsense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	18	0.008241758241758242	18	0.036585365853658534	0	0.0	0	0.0	0	0.0	t	15.04	2.716118	0.48622	0.035179	3.49E-4	ENSG00000160191	ENST00000380328;ENST00000335440;ENST00000349112	.	.	.	4.19	-4.74	0.03249	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8976	0.29715	0.1418:0.5569:0.0:0.3013	.	.	.	.	X	113;64;38	.	ENSP00000335365:R64X	R	+	1	2	PDE9A	42992189	0.847000	0.29606	0.876000	0.34364	0.886000	0.51366	-0.556000	0.05992	-1.122000	0.02945	-0.439000	0.05793	CGA		0.448	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		Silent
RAB36	9609	broad.mit.edu	37	22	23487624	23487624	+	Silent	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr22:23487624G>A	ENST00000263116.2	+	1	112	c.72G>A	c.(70-72)acG>acA	p.T24T	RTDR1_ENST00000406876.1_5'Flank|RAB36_ENST00000341989.4_Silent_p.T24T	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	24					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.T24T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		CGCCCACGACGTCGACGATTC	0.682																																					p.T24T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G72A	22						.						50.0	56.0	54.0					22																	23487624		2203	4298	6501	21817624	SO:0001819	synonymous_variant	9609	exon1			AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.72G>A	22.37:g.23487624G>A			21817624	NM_004914	Q2M390|Q7Z4A9|Q9UHP5	Silent	SNP	ENST00000263116.2	37	CCDS13805.1																																																																																				0.682	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319046.1	NM_004914	
ACVR1C	130399	broad.mit.edu	37	2	158390508	158390508	+	Silent	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:158390508G>A	ENST00000243349.8	-	9	1764	c.1404C>T	c.(1402-1404)aaC>aaT	p.N468N	ACVR1C_ENST00000348328.5_Silent_p.N311N|ACVR1C_ENST00000409680.3_Silent_p.N418N|ACVR1C_ENST00000335450.7_Silent_p.N388N	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.N468N(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GGGCCGCTCCGTTGGCATACC	0.388																																					p.N418N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	2						.						89.0	98.0	94.0					2																	158390508		2203	4300	6503	158098754	SO:0001819	synonymous_variant	130399	exon9			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1404C>T	2.37:g.158390508G>A			158098754	NM_001111031		Silent	SNP	ENST00000243349.8	37	CCDS2205.1																																																																																				0.388	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
TTN	7273	broad.mit.edu	37	2	179659911	179659911	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:179659911C>T	ENST00000591111.1	-	7	1207	c.983G>A	c.(982-984)cGt>cAt	p.R328H	TTN_ENST00000342992.6_Missense_Mutation_p.R328H|TTN_ENST00000359218.5_Missense_Mutation_p.R328H|TTN_ENST00000589042.1_Missense_Mutation_p.R328H|TTN_ENST00000342175.6_Missense_Mutation_p.R328H|TTN_ENST00000460472.2_Missense_Mutation_p.R328H|TTN_ENST00000360870.5_Missense_Mutation_p.R328H			Q8WZ42	TITIN_HUMAN	titin	0	ZIS1.		R -> C (in dbSNP:rs16866538). {ECO:0000269|PubMed:11846417, ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R328H(10)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGAGTCTTACGCATGAGCAA	0.552																																					p.R328H												.	.	10	Substitution - Missense(10)	large_intestine(10)	c.G983A	2						.						104.0	95.0	98.0					2																	179659911		2203	4300	6503	179368156	SO:0001583	missense	7273	exon7			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.983G>A	2.37:g.179659911C>T	ENSP00000465570:p.Arg328His		179368156	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.21	2.169654	0.38315	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.72725	-0.68;-0.31;-0.36;-0.37;-0.33	6.17	6.17	0.99709	.	.	.	.	.	T	0.78742	0.4331	L	0.29908	0.895	0.39535	D	0.968721	D;D;D;D;D	0.89917	0.996;0.996;0.996;0.998;1.0	P;P;P;P;D	0.69824	0.72;0.72;0.72;0.72;0.966	T	0.79957	-0.1584	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	328;328;328;328;328	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	328	ENSP00000343764:R328H;ENSP00000434586:R328H;ENSP00000340554:R328H;ENSP00000352154:R328H;ENSP00000354117:R328H	ENSP00000340554:R328H	R	-	2	0	TTN	179368156	1.000000	0.71417	0.108000	0.21378	0.035000	0.12851	7.224000	0.78042	2.941000	0.99782	0.655000	0.94253	CGT		0.552	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GTF2A1L	11036	broad.mit.edu	37	2	48848080	48848080	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:48848080G>A	ENST00000403751.3	+	2	149	c.112G>A	c.(112-114)Gac>Aac	p.D38N	GTF2A1L_ENST00000468326.1_3'UTR|GTF2A1L_ENST00000430487.2_Intron|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.D742N|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.D742N|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.D742N|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.D742N|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.D742N	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	38					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.D742N(1)|p.D742Y(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGTTTTAAAAGACTTGAAGCA	0.328																																					p.D38N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G112A	2						.						54.0	54.0	54.0					2																	48848080		2203	4298	6501	48701584	SO:0001583	missense	286749	exon2			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.112G>A	2.37:g.48848080G>A	ENSP00000384597:p.Asp38Asn		48701584	NM_006872	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034729	0.54896	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000437125;ENST00000403751	T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51	4.7	4.7	0.59300	Transcription factor IIA, alpha subunit, N-terminal (1);Transcription factor IIA, helical (1);	0.129372	0.51477	D	0.000100	T	0.65923	0.2738	L	0.58669	1.825	0.80722	D	1	B;P;D;B	0.76494	0.11;0.747;0.999;0.346	B;P;D;B	0.75020	0.016;0.548;0.985;0.128	T	0.63413	-0.6643	10	0.38643	T	0.18	.	12.6651	0.56837	0.0834:0.0:0.9166:0.0	.	742;742;38;742	A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;TF2AY_HUMAN;.	N	742;742;742;742;742;37;38;38	ENSP00000385499:D742N;ENSP00000385701:D742N;ENSP00000378236:D742N;ENSP00000311493:D742N;ENSP00000378234:D742N;ENSP00000396702:D38N;ENSP00000384597:D38N	ENSP00000384597:D38N	D	+	1	0	STON1-GTF2A1L;GTF2A1L	48701584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.149000	0.71795	2.611000	0.88343	0.561000	0.74099	GAC		0.328	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
EFEMP1	2202	broad.mit.edu	37	2	56145146	56145146	+	Silent	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:56145146A>T	ENST00000394555.2	-	4	606	c.171T>A	c.(169-171)ggT>ggA	p.G57G	EFEMP1_ENST00000424836.2_5'UTR|EFEMP1_ENST00000355426.3_Silent_p.G57G|EFEMP1_ENST00000394554.1_Silent_p.G57G	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	57	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.G57G(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACTTCATTCCACCTTTACAAG	0.403																																					p.G57G	GBM(92;934 1319 7714 28760 40110)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T171A	2						.						93.0	93.0	93.0					2																	56145146		2203	4300	6503	55998650	SO:0001819	synonymous_variant	2202	exon5			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.171T>A	2.37:g.56145146A>T			55998650	NM_001039348	A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	ENST00000394555.2	37	CCDS1857.1																																																																																				0.403	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
MCEE	84693	broad.mit.edu	37	2	71351507	71351508	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:71351507_71351508CA>AG	ENST00000244217.5	-	2	223_224	c.206_207TG>CT	c.(205-207)cTG>cCT	p.L69P	AC007881.1_ENST00000578636.1_RNA	NM_032601.3	NP_115990.3	Q96PE7	MCEE_HUMAN	methylmalonyl CoA epimerase	69					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|L-methylmalonyl-CoA metabolic process (GO:0046491)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|methylmalonyl-CoA epimerase activity (GO:0004493)	p.L69>?(1)		kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						CCTGGGCCCCCAGAATATTCTT	0.47																																					.												.	.	1	Complex(1)	large_intestine(1)	c.206_207CT	2						.																																			71205016	SO:0001583	missense	84693	exon2			AF364547	CCDS1915.1	2p13.3	2011-05-12			ENSG00000124370	ENSG00000124370	5.1.99.1		16732	protein-coding gene	gene with protein product	"""glyoxalase domain containing 2"""	608419				16697227, 16752391, 16843692	Standard	NM_032601		Approved	GLOD2	uc002shs.2	Q96PE7	OTTHUMG00000129709	ENST00000244217.5:c.206_207delinsAG	2.37:g.71351507_71351508delinsAG	ENSP00000244217:p.Leu69Pro		71205015	NM_032601	Q53TP1|Q8WW63	Missense_Mutation	DNP	ENST00000244217.5	37	CCDS1915.1																																																																																				0.470	MCEE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251917.3	NM_032601	
EVA1A	84141	broad.mit.edu	37	2	75720463	75720463	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:75720463G>A	ENST00000233712.1	-	4	795	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C	EVA1A_ENST00000393913.3_Missense_Mutation_p.R120C|EVA1A_ENST00000490746.1_Intron|EVA1A_ENST00000410010.1_Missense_Mutation_p.R108C|EVA1A_ENST00000410071.1_Missense_Mutation_p.R120C|EVA1A_ENST00000410113.1_Missense_Mutation_p.R120C	NM_032181.2	NP_115557.1	Q9H8M9	EVA1A_HUMAN	eva-1 homolog A (C. elegans)	120					apoptotic process (GO:0006915)|autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.R120C(1)									CGCTGGGCGCGCTCCAGCTCC	0.612																																					p.R120C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C358T	2						.						43.0	46.0	45.0					2																	75720463		2203	4300	6503	75573971	SO:0001583	missense	84141	exon4			BC016157	CCDS1959.1	2p12	2012-11-05	2012-11-05	2012-11-05	ENSG00000115363	ENSG00000115363			25816	protein-coding gene	gene with protein product			"""transmembrane protein 166"", ""family with sequence similarity 176, member A"""	TMEM166, FAM176A		12477932	Standard	NM_001135032		Approved	FLJ13391	uc002sni.2	Q9H8M9	OTTHUMG00000129991	ENST00000233712.1:c.358C>T	2.37:g.75720463G>A	ENSP00000233712:p.Arg120Cys		75573971	NM_032181	D6W5J3|Q9HC41	Missense_Mutation	SNP	ENST00000233712.1	37	CCDS1959.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021919	0.75275	.	.	ENSG00000115363	ENST00000393913;ENST00000233712;ENST00000410113;ENST00000410010;ENST00000410071;ENST00000432649	T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.74129	0.3676	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77765	-0.2465	10	0.72032	D	0.01	-0.8177	11.7321	0.51744	0.0:0.0:0.8233:0.1767	.	120	Q9H8M9	F176A_HUMAN	C	120;120;120;108;120;120	ENSP00000377490:R120C;ENSP00000233712:R120C;ENSP00000386435:R120C;ENSP00000386835:R108C;ENSP00000386930:R120C;ENSP00000398249:R120C	ENSP00000233712:R120C	R	-	1	0	FAM176A	75573971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.235000	0.32671	2.722000	0.93159	0.655000	0.94253	CGC		0.612	EVA1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328707.1	NM_032181	
PROM2	150696	broad.mit.edu	37	2	95947058	95947058	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:95947058G>T	ENST00000317620.9	+	12	1629	c.1496G>T	c.(1495-1497)gGt>gTt	p.G499V	PROM2_ENST00000403131.2_Missense_Mutation_p.G499V|PROM2_ENST00000317668.4_Missense_Mutation_p.G499V|PROM2_ENST00000542147.1_Missense_Mutation_p.G499V	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	499					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.G499V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						TTCCTGGTGGGTGGCAACGTG	0.637																																					p.G499V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1496T	2						.						83.0	77.0	79.0					2																	95947058		2203	4300	6503	95310785	SO:0001583	missense	150696	exon12			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1496G>T	2.37:g.95947058G>T	ENSP00000318270:p.Gly499Val		95310785	NM_144707	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.256960	0.59321	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000002	T	0.76227	0.3958	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79063	-0.1957	10	0.59425	D	0.04	-19.5901	13.9557	0.64147	0.0:0.0:1.0:0.0	.	499	Q8N271	PROM2_HUMAN	V	499	ENSP00000385716:G499V;ENSP00000318520:G499V;ENSP00000318270:G499V;ENSP00000442542:G499V	ENSP00000318270:G499V	G	+	2	0	PROM2	95310785	1.000000	0.71417	0.980000	0.43619	0.441000	0.31987	7.284000	0.78650	2.353000	0.79882	0.561000	0.74099	GGT		0.637	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
ASB18	401036	broad.mit.edu	37	2	237103669	237103669	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr2:237103669G>T	ENST00000409749.3	-	6	1246	c.1247C>A	c.(1246-1248)gCc>gAc	p.A416D	AC079135.1_ENST00000415226.1_RNA|AC079135.1_ENST00000483218.1_RNA|ASB18_ENST00000330842.6_Missense_Mutation_p.A387D	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	416	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.A416D(1)		large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		GAGGGCCAAGGCAAAGAGGGA	0.542																																					p.A416D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1247A	2						.						64.0	78.0	74.0					2																	237103669		2117	4246	6363	236768408	SO:0001583	missense	401036	exon6			AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.1247C>A	2.37:g.237103669G>T	ENSP00000386532:p.Ala416Asp		236768408	NM_212556	B6ZDL7	Missense_Mutation	SNP	ENST00000409749.3	37	CCDS46548.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878758	0.51801	.	.	ENSG00000182177	ENST00000330842;ENST00000409749	T;T	0.38722	1.12;1.2	4.65	2.61	0.31194	SOCS protein, C-terminal (1);	.	.	.	.	T	0.48926	0.1527	L	0.48986	1.54	0.09310	N	1	D	0.65815	0.995	P	0.61592	0.891	T	0.27331	-1.0077	9	0.23891	T	0.37	.	7.4684	0.27334	0.0986:0.3231:0.5784:0.0	.	416	Q6ZVZ8	ASB18_HUMAN	D	387;416	ENSP00000329970:A387D;ENSP00000386532:A416D	ENSP00000329970:A387D	A	-	2	0	ASB18	236768408	0.527000	0.26306	0.148000	0.22405	0.772000	0.43724	0.957000	0.29215	1.130000	0.42092	0.561000	0.74099	GCC		0.542	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329436.1	NM_212556	
ILDR1	286676	broad.mit.edu	37	3	121712379	121712379	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:121712379G>C	ENST00000344209.5	-	7	1343	c.1217C>G	c.(1216-1218)tCt>tGt	p.S406C	ILDR1_ENST00000462014.1_Missense_Mutation_p.S374C|ILDR1_ENST00000273691.3_Missense_Mutation_p.S362C|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000393631.1_Missense_Mutation_p.S317C	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	406					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)	p.S362C(1)|p.S406C(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		ATTCAGCCTAGAGCTACGGTG	0.597																																					p.S362C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1085G	3						.						75.0	69.0	71.0					3																	121712379		2203	4300	6503	123195069	SO:0001583	missense	286676	exon6			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.1217C>G	3.37:g.121712379G>C	ENSP00000345667:p.Ser406Cys		123195069	NM_175924	Q6ZP61|Q7Z578	Missense_Mutation	SNP	ENST00000344209.5	37	CCDS56271.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691613	0.48097	.	.	ENSG00000145103	ENST00000273691;ENST00000344209;ENST00000393631;ENST00000462014	T;T;T;T	0.80994	-0.93;-0.71;-1.44;-0.53	5.2	3.28	0.37604	.	0.624603	0.18425	N	0.141602	D	0.86678	0.5990	M	0.73598	2.24	0.34241	D	0.677668	D;P;D;D	0.89917	1.0;0.934;0.998;0.998	D;B;P;P	0.69479	0.964;0.436;0.847;0.891	D	0.88846	0.3316	10	0.62326	D	0.03	-10.2752	8.0932	0.30813	0.0901:0.1613:0.7486:0.0	.	317;406;362;374	Q86SU0-5;Q86SU0;Q86SU0-2;Q86SU0-6	.;ILDR1_HUMAN;.;.	C	362;406;317;374	ENSP00000273691:S362C;ENSP00000345667:S406C;ENSP00000377251:S317C;ENSP00000419414:S374C	ENSP00000273691:S362C	S	-	2	0	ILDR1	123195069	1.000000	0.71417	0.689000	0.30133	0.610000	0.37248	2.210000	0.42816	1.177000	0.42855	0.655000	0.94253	TCT		0.597	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	NM_175924	
ESYT3	83850	broad.mit.edu	37	3	138195689	138195689	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:138195689G>C	ENST00000389567.4	+	23	2840	c.2654G>C	c.(2653-2655)aGa>aCa	p.R885T	ESYT3_ENST00000460133.1_Intron	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	885					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.R885T(1)		breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGACAGCCCAGAAGCTGATGA	0.343																																					p.R885T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2654C	3						.						97.0	92.0	94.0					3																	138195689		1965	4156	6121	139678379	SO:0001583	missense	83850	exon23			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2654G>C	3.37:g.138195689G>C	ENSP00000374218:p.Arg885Thr		139678379	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	37	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	G	6.383	0.438813	0.12104	.	.	ENSG00000158220	ENST00000389567	T	0.40225	1.04	4.96	3.15	0.36227	.	0.141461	0.24988	U	0.034014	T	0.17619	0.0423	N	0.03608	-0.345	0.80722	D	1	B	0.27498	0.18	B	0.21546	0.035	T	0.04840	-1.0923	10	0.46703	T	0.11	-0.5002	6.2761	0.20981	0.0935:0.0:0.7262:0.1803	.	885	A0FGR9	ESYT3_HUMAN	T	885	ENSP00000374218:R885T	ENSP00000374218:R885T	R	+	2	0	ESYT3	139678379	0.999000	0.42202	1.000000	0.80357	0.094000	0.18550	2.698000	0.47068	0.675000	0.31264	-0.314000	0.08810	AGA		0.343	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
PCOLCE2	26577	broad.mit.edu	37	3	142567061	142567061	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:142567061C>A	ENST00000295992.3	-	3	752	c.446G>T	c.(445-447)aGa>aTa	p.R149I	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.R149I	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	149					positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.R149I(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						AACAGTACCTCTTTCGTTTGG	0.433																																					p.R149I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446T	3						.						66.0	67.0	67.0					3																	142567061		2203	4300	6503	144049751	SO:0001583	missense	26577	exon3			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.446G>T	3.37:g.142567061C>A	ENSP00000295992:p.Arg149Ile		144049751	NM_013363	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709905	0.48517	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.21543	2.08;2.0	5.39	3.61	0.41365	.	0.180655	0.64402	D	0.000013	T	0.16214	0.0390	L	0.33485	1.01	0.58432	D	0.999996	B	0.14012	0.009	B	0.17722	0.019	T	0.04593	-1.0940	10	0.30078	T	0.28	-17.9843	11.6463	0.51263	0.0:0.8576:0.0:0.1424	.	149	Q9UKZ9	PCOC2_HUMAN	I	149	ENSP00000295992:R149I;ENSP00000419842:R149I	ENSP00000295992:R149I	R	-	2	0	PCOLCE2	144049751	1.000000	0.71417	0.998000	0.56505	0.853000	0.48598	4.539000	0.60657	0.860000	0.35481	0.644000	0.83932	AGA		0.433	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	
SATB1	6304	broad.mit.edu	37	3	18436105	18436105	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:18436105G>A	ENST00000338745.6	-	7	2789	c.1055C>T	c.(1054-1056)cCt>cTt	p.P352L	TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.P352L|SATB1_ENST00000417717.2_Missense_Mutation_p.P352L|SATB1_ENST00000475083.1_5'Flank	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	352					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P352L(1)		NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						TCTACTGACAGGGGGAGGGTG	0.488																																					p.P352L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1055T	3						.						191.0	188.0	189.0					3																	18436105		2203	4300	6503	18411109	SO:0001583	missense	6304	exon7				CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1055C>T	3.37:g.18436105G>A	ENSP00000341024:p.Pro352Leu		18411109	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883837	0.51908	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	T;T;T	0.43688	0.95;0.95;0.94	5.75	5.75	0.90469	.	0.170169	0.52532	D	0.000071	T	0.46151	0.1378	M	0.61703	1.905	0.80722	D	1	B;B	0.23128	0.08;0.027	B;B	0.23275	0.045;0.027	T	0.31916	-0.9926	10	0.41790	T	0.15	-14.5361	19.9522	0.97203	0.0:0.0:1.0:0.0	.	352;352	Q01826-2;Q01826	.;SATB1_HUMAN	L	352	ENSP00000341024:P352L;ENSP00000399708:P352L;ENSP00000399518:P352L	ENSP00000341024:P352L	P	-	2	0	SATB1	18411109	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.295000	0.78780	2.725000	0.93324	0.655000	0.94253	CCT		0.488	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
FNDC3B	64778	broad.mit.edu	37	3	172070687	172070687	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:172070687T>A	ENST00000336824.4	+	22	2708	c.2609T>A	c.(2608-2610)cTg>cAg	p.L870Q	FNDC3B_ENST00000416957.1_Missense_Mutation_p.L870Q|FNDC3B_ENST00000415807.2_Missense_Mutation_p.L870Q	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	870					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CTCTGTGTCCTGGAGGAGGAG	0.562																																					p.L870Q												.	.	0			c.T2609A	3						.						93.0	84.0	87.0					3																	172070687		2203	4300	6503	173553381	SO:0001583	missense	64778	exon22			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.2609T>A	3.37:g.172070687T>A	ENSP00000338523:p.Leu870Gln		173553381	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.220718	0.58560	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.54675	0.56;0.56;0.56	5.9	4.71	0.59529	Fibronectin, type III (3);	0.133495	0.52532	N	0.000077	T	0.50820	0.1638	M	0.72353	2.195	0.80722	D	1	B	0.29301	0.241	B	0.32149	0.141	T	0.51624	-0.8682	10	0.56958	D	0.05	-11.6382	7.4802	0.27400	0.1281:0.0685:0.0:0.8033	.	870	Q53EP0	FND3B_HUMAN	Q	870	ENSP00000411242:L870Q;ENSP00000338523:L870Q;ENSP00000389094:L870Q	ENSP00000338523:L870Q	L	+	2	0	FNDC3B	173553381	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	3.897000	0.56273	1.008000	0.39264	0.460000	0.39030	CTG		0.562	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
RBMS3	27303	broad.mit.edu	37	3	29781236	29781236	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:29781236T>A	ENST00000383767.2	+	5	761	c.425T>A	c.(424-426)cTa>cAa	p.L142Q	RBMS3_ENST00000383766.2_Missense_Mutation_p.L141Q|RBMS3_ENST00000396583.3_Missense_Mutation_p.L142Q|RBMS3_ENST00000434693.2_Missense_Mutation_p.L141Q|RBMS3_ENST00000445033.1_Missense_Mutation_p.L142Q|RBMS3_ENST00000452462.1_Missense_Mutation_p.L142Q|RBMS3_ENST00000273139.9_Missense_Mutation_p.L142Q|RBMS3_ENST00000456853.1_Missense_Mutation_p.L142Q			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	142	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)	p.L142Q(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CCAACAAACCTATACATCTCA	0.378																																					p.L142Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T425A	3						.						169.0	163.0	165.0					3																	29781236		2203	4300	6503	29756240	SO:0001583	missense	27303	exon5			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.425T>A	3.37:g.29781236T>A	ENSP00000373277:p.Leu142Gln		29756240	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.815013	0.90790	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	D;T;D;D;D;T;D;T	0.82526	-1.62;1.7;-1.62;-1.62;-1.62;1.7;-1.62;1.7	5.52	5.52	0.82312	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000001	D	0.95169	0.8434	H	0.99169	4.455	0.80722	D	1	D;D;D;D	0.89917	0.999;0.993;1.0;0.995	D;D;D;D	0.83275	0.984;0.984;0.996;0.984	D	0.97323	0.9945	9	.	.	.	.	15.6346	0.76941	0.0:0.0:0.0:1.0	.	142;142;141;142	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	Q	141;142;142;142;142;141;142;142	ENSP00000395592:L141Q;ENSP00000379828:L142Q;ENSP00000373277:L142Q;ENSP00000391934:L142Q;ENSP00000273139:L142Q;ENSP00000373276:L141Q;ENSP00000397926:L142Q;ENSP00000400519:L142Q	.	L	+	2	0	RBMS3	29756240	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	8.029000	0.88807	2.093000	0.63338	0.460000	0.39030	CTA		0.378	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
SCN11A	11280	broad.mit.edu	37	3	38962577	38962577	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:38962577C>T	ENST00000302328.3	-	6	1080	c.882G>A	c.(880-882)ccG>ccA	p.P294P	SCN11A_ENST00000444237.2_Silent_p.P294P|SCN11A_ENST00000456224.3_Silent_p.P294P|SCN11A_ENST00000450244.1_Silent_p.P294P	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	294					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P294P(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATAAGCTTCCGGGTTACTGA	0.443																																					p.P294P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G882A	3						.						238.0	248.0	245.0					3																	38962577		2203	4300	6503	38937581	SO:0001819	synonymous_variant	11280	exon6			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.882G>A	3.37:g.38962577C>T			38937581	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																				0.443	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
LIMD1	8994	broad.mit.edu	37	3	45636917	45636917	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:45636917C>T	ENST00000273317.4	+	1	567	c.546C>T	c.(544-546)aaC>aaT	p.N182N	LIMD1_ENST00000440097.1_Silent_p.N182N|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	182					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.N182N(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		ATTATGACAACCTCTCCTTGG	0.597																																					p.N182N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C546T	3						.						93.0	90.0	91.0					3																	45636917		2203	4300	6503	45611921	SO:0001819	synonymous_variant	8994	exon1			AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.546C>T	3.37:g.45636917C>T			45611921	NM_014240	Q17RQ1|Q9BQQ9|Q9NQ47	Silent	SNP	ENST00000273317.4	37	CCDS2729.1																																																																																				0.597	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
SLC26A6	65010	broad.mit.edu	37	3	48667388	48667388	+	Silent	SNP	C	C	A	rs199499595		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:48667388C>A	ENST00000395550.2	-	13	1493	c.1446G>T	c.(1444-1446)acG>acT	p.T482T	SLC26A6_ENST00000420764.2_Silent_p.T482T|SLC26A6_ENST00000383733.3_Silent_p.T482T|SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000337000.8_Silent_p.T375T|SLC26A6_ENST00000358747.6_Silent_p.T461T|SLC26A6_ENST00000455886.2_Silent_p.T446T			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	482					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.T482T(1)	SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		AGATGGTGGCCGTGAAGGTCA	0.632																																					p.T461T	NSCLC(13;369 479 28271 30152 44026)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1383T	3						.						71.0	83.0	79.0					3																	48667388		2137	4228	6365	48642392	SO:0001819	synonymous_variant	1951	exon12			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1446G>T	3.37:g.48667388C>A			48642392	NM_001040454	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Silent	SNP	ENST00000395550.2	37	CCDS43087.1																																																																																				0.632	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911	
POLR2H	5437	broad.mit.edu	37	3	184081335	184081335	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr3:184081335G>A	ENST00000456318.1	+	2	1104	c.55G>A	c.(55-57)Ggc>Agc	p.G19S	POLR2H_ENST00000429568.1_Missense_Mutation_p.G19S|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000423355.2_5'Flank|CLCN2_ENST00000457512.1_5'Flank|CLCN2_ENST00000344937.7_5'Flank|POLR2H_ENST00000438240.1_Intron|POLR2H_ENST00000296223.3_Missense_Mutation_p.G19S|POLR2H_ENST00000443489.1_5'UTR|CLCN2_ENST00000434054.2_5'Flank|POLR2H_ENST00000452961.1_5'UTR|POLR2H_ENST00000430783.1_Missense_Mutation_p.G19S|CLCN2_ENST00000265593.4_5'Flank	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	19	Non-specific ssDNA binding.			G -> A (in Ref. 1; AAA91458). {ECO:0000305}.	7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.G19S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGACCCGGAGGGCAAGAAGTT	0.592											OREG0015950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G19S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G55A	3						.						95.0	87.0	90.0					3																	184081335		2203	4300	6503	185564029	SO:0001583	missense	5437	exon1				CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.55G>A	3.37:g.184081335G>A	ENSP00000392913:p.Gly19Ser	1989	185564029	NM_006232	C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Missense_Mutation	SNP	ENST00000456318.1	37	CCDS3264.1	.	.	.	.	.	.	.	.	.	.	g	37	6.210981	0.97380	.	.	ENSG00000163882	ENST00000456318;ENST00000455712;ENST00000430783;ENST00000296223;ENST00000429568	.	.	.	6.04	6.04	0.98038	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.87289	0.6140	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89356	0.3664	9	0.59425	D	0.04	-17.3054	18.0887	0.89466	0.0:0.0:1.0:0.0	.	19	P52434	RPAB3_HUMAN	S	19	.	ENSP00000296223:G19S	G	+	1	0	POLR2H	185564029	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.039000	0.93777	2.873000	0.98535	0.563000	0.77884	GGC		0.592	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345558.1	NM_006232	
UGT8	7368	broad.mit.edu	37	4	115597133	115597133	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:115597133C>T	ENST00000310836.6	+	6	1837	c.1315C>T	c.(1315-1317)Cac>Tac	p.H439Y	UGT8_ENST00000394511.3_Missense_Mutation_p.H439Y	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	439					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)	p.H439Y(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		TCAACCTGGTCACCCTGTCAA	0.433																																					p.H439Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1315T	4						.						123.0	118.0	120.0					4																	115597133		2203	4300	6503	115816582	SO:0001583	missense	7368	exon6			AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.1315C>T	4.37:g.115597133C>T	ENSP00000311648:p.His439Tyr		115816582	NM_001128174	B3KXU7|O00196	Missense_Mutation	SNP	ENST00000310836.6	37	CCDS3705.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451922	0.84209	.	.	ENSG00000174607	ENST00000310836;ENST00000394511	T;T	0.59502	0.26;0.26	5.77	4.01	0.46588	.	0.086142	0.85682	D	0.000000	T	0.67420	0.2891	L	0.58810	1.83	0.51233	D	0.999916	D	0.54397	0.966	P	0.61132	0.884	T	0.68428	-0.5411	10	0.87932	D	0	.	10.6614	0.45704	0.1329:0.7988:0.0:0.0683	.	439	Q16880	CGT_HUMAN	Y	439	ENSP00000311648:H439Y;ENSP00000378019:H439Y	ENSP00000311648:H439Y	H	+	1	0	UGT8	115816582	1.000000	0.71417	0.445000	0.26908	0.979000	0.70002	7.457000	0.80775	0.748000	0.32831	0.561000	0.74099	CAC		0.433	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256426.2	NM_003360	
PLK4	10733	broad.mit.edu	37	4	128807261	128807261	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:128807261C>T	ENST00000270861.5	+	5	1010	c.736C>T	c.(736-738)Ctt>Ttt	p.L246F	PLK4_ENST00000514379.1_Missense_Mutation_p.L205F|PLK4_ENST00000507249.1_Missense_Mutation_p.L246F|PLK4_ENST00000515069.1_Missense_Mutation_p.L246F|PLK4_ENST00000513090.1_Missense_Mutation_p.L214F	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	246	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L246F(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TCACCAGTTACTTCGTAGAAA	0.363																																					p.L205F	Colon(135;508 1718 19061 31832 42879)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C613T	4						.						154.0	163.0	160.0					4																	128807261		2203	4300	6503	129026711	SO:0001583	missense	10733	exon5			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.736C>T	4.37:g.128807261C>T	ENSP00000270861:p.Leu246Phe		129026711	NM_001190801	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124722	0.77436	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87485	0.6189	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89168	0.3535	10	0.87932	D	0	-8.7692	19.7186	0.96134	0.0:1.0:0.0:0.0	.	214;246	O00444-2;O00444	.;PLK4_HUMAN	F	246;246;214;246;205	ENSP00000270861:L246F;ENSP00000421774:L246F;ENSP00000427554:L214F;ENSP00000423412:L246F;ENSP00000423582:L205F	ENSP00000270861:L246F	L	+	1	0	PLK4	129026711	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.415000	0.59809	2.659000	0.90383	0.655000	0.94253	CTT		0.363	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
KIT	3815	broad.mit.edu	37	4	55561719	55561719	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:55561719C>G	ENST00000288135.5	+	2	206	c.109C>G	c.(109-111)Cca>Gca	p.P37A		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	37	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P37A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACCGTCTCCACCATCCATCCA	0.473		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.P37A		yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C109G	4						.						86.0	77.0	80.0					4																	55561719		2203	4300	6503	55256476	SO:0001583	missense	3815	exon2	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.109C>G	4.37:g.55561719C>G	ENSP00000288135:p.Pro37Ala		55256476	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617959	0.46736	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.77489	-1.1;-1.1	5.36	5.36	0.76844	Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000046	D	0.88724	0.6514	M	0.84585	2.705	0.41919	D	0.990505	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.89956	0.4083	10	0.72032	D	0.01	.	14.4558	0.67416	0.0:1.0:0.0:0.0	.	37;37	P10721-2;P10721	.;KIT_HUMAN	A	37	ENSP00000288135:P37A;ENSP00000390987:P37A	ENSP00000288135:P37A	P	+	1	0	KIT	55256476	0.990000	0.36364	0.873000	0.34254	0.046000	0.14306	3.643000	0.54374	2.788000	0.95919	0.650000	0.86243	CCA		0.473	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
COQ2	27235	broad.mit.edu	37	4	84194659	84194659	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:84194659T>G	ENST00000311469.4	-	3	681	c.682A>C	c.(682-684)Aat>Cat	p.N228H	COQ2_ENST00000514935.1_5'Flank|COQ2_ENST00000439031.2_Missense_Mutation_p.N191H|COQ2_ENST00000311461.7_Missense_Mutation_p.N178H	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	178					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)	p.N228H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				CTGTAGTAATTTAGACACAGA	0.368																																					p.N228H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A682C	4						.						97.0	98.0	98.0					4																	84194659		1825	4073	5898	84413683	SO:0001583	missense	27235	exon3				CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.682A>C	4.37:g.84194659T>G	ENSP00000310873:p.Asn228His		84413683	NM_015697	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498661	0.85069	.	.	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	D;D;D	0.93307	-3.2;-3.2;-3.2	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.97688	0.9242	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.97110	0.807;1.0	D	0.98847	1.0757	10	0.87932	D	0	-41.055	14.9917	0.71393	0.0:0.0:0.0:1.0	.	178;178	E2QRG7;Q96H96	.;COQ2_HUMAN	H	228;191;178	ENSP00000310873:N228H;ENSP00000409275:N191H;ENSP00000311835:N178H	ENSP00000311835:N178H	N	-	1	0	COQ2	84413683	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.576000	0.82467	2.242000	0.73789	0.482000	0.46254	AAT		0.368	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
DMP1	1758	broad.mit.edu	37	4	88583222	88583222	+	Nonsense_Mutation	SNP	G	G	T	rs576066727	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:88583222G>T	ENST00000339673.6	+	6	391	c.292G>T	c.(292-294)Gga>Tga	p.G98*	RP11-742B18.1_ENST00000507894.1_RNA|RP11-742B18.1_ENST00000506814.1_RNA|DMP1_ENST00000282479.7_Nonsense_Mutation_p.G82*|RP11-742B18.1_ENST00000506480.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	98					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)	p.G98*(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		CACAGGAAAAGGAGGAGATGA	0.507																																					p.G82X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.G244T	4						.						73.0	72.0	72.0					4																	88583222		2203	4300	6503	88802246	SO:0001587	stop_gained	1758	exon5			U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.292G>T	4.37:g.88583222G>T	ENSP00000340935:p.Gly98*		88802246	NM_001079911	A1L4L3|O43265	Nonsense_Mutation	SNP	ENST00000339673.6	37	CCDS3623.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.407230	0.25378	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	.	.	.	4.73	1.53	0.23141	.	0.700255	0.12252	N	0.485529	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	0.3075	7.1139	0.25407	0.4027:0.0:0.5973:0.0	.	.	.	.	X	98;82	.	ENSP00000282479:G82X	G	+	1	0	DMP1	88802246	0.091000	0.21658	0.001000	0.08648	0.005000	0.04900	1.585000	0.36600	0.441000	0.26529	0.455000	0.32223	GGA		0.507	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
RAB33B	83452	broad.mit.edu	37	4	140394211	140394211	+	Silent	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr4:140394211T>C	ENST00000305626.5	+	2	1010	c.621T>C	c.(619-621)ctT>ctC	p.L207L		NM_031296.1	NP_112586.1	Q9H082	RB33B_HUMAN	RAB33B, member RAS oncogene family	207					autophagy (GO:0006914)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of retrograde vesicle-mediated transport, Golgi to ER (GO:2000156)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L207L(1)		large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4	all_hematologic(180;0.162)					CATTAATGCTTAGTCAGCCCC	0.383																																					p.L207L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T621C	4						.						77.0	76.0	76.0					4																	140394211		2203	4300	6503	140613661	SO:0001819	synonymous_variant	83452	exon2			AF350420	CCDS3747.1	4q28	2008-02-05			ENSG00000172007	ENSG00000172007		"""RAB, member RAS oncogene"""	16075	protein-coding gene	gene with protein product		605950					Standard	NM_031296		Approved	DKFZP434G099	uc003ihv.3	Q9H082	OTTHUMG00000133384	ENST00000305626.5:c.621T>C	4.37:g.140394211T>C			140613661	NM_031296	B2R987|Q4W5B0	Silent	SNP	ENST00000305626.5	37	CCDS3747.1																																																																																				0.383	RAB33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257235.2	NM_031296	
ST8SIA4	7903	broad.mit.edu	37	5	100222080	100222080	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:100222080C>G	ENST00000231461.5	-	3	780	c.470G>C	c.(469-471)gGa>gCa	p.G157A	ST8SIA4_ENST00000507360.2_5'UTR|ST8SIA4_ENST00000451528.2_Missense_Mutation_p.G157A	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	157					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.G157A(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		AATCTCCTTTCCACATTCACT	0.383																																					p.G157A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G470C	5						.						79.0	80.0	80.0					5																	100222080		2203	4300	6503	100249979	SO:0001583	missense	7903	exon3			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.470G>C	5.37:g.100222080C>G	ENSP00000231461:p.Gly157Ala		100249979	NM_175052	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028431	0.93518	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	D;D	0.86865	-2.18;-2.18	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.95204	0.8445	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95429	0.8514	10	0.72032	D	0.01	-8.26	19.3049	0.94157	0.0:1.0:0.0:0.0	.	157	Q92187	SIA8D_HUMAN	A	157	ENSP00000231461:G157A;ENSP00000428914:G157A	ENSP00000231461:G157A	G	-	2	0	ST8SIA4	100249979	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.456000	0.80751	2.809000	0.96659	0.557000	0.71058	GGA		0.383	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
WDR36	134430	broad.mit.edu	37	5	110428248	110428248	+	Silent	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:110428248C>A	ENST00000513710.2	+	1	266	c.262C>A	c.(262-264)Cgg>Agg	p.R88R	WDR36_ENST00000505303.1_Silent_p.R32R|CTC-551A13.2_ENST00000507269.3_RNA|WDR36_ENST00000506538.2_Silent_p.R88R			Q8NI36	WDR36_HUMAN	WD repeat domain 36	88					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.R88R(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		ACACGTGGTGCGGTTCAGCGC	0.577																																					p.R88R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C262A	5						.						39.0	40.0	40.0					5																	110428248		2202	4300	6502	110456147	SO:0001819	synonymous_variant	134430	exon1			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.262C>A	5.37:g.110428248C>A			110456147	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	ENST00000513710.2	37	CCDS4102.1																																																																																				0.577	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
PCDHB2	56133	broad.mit.edu	37	5	140476395	140476396	+	Missense_Mutation	DNP	TG	TG	CT	rs384081|rs429198|rs71574501	byFrequency	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	TG	TG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:140476395_140476396TG>CT	ENST00000194155.4	+	1	2169_2170	c.2021_2022TG>CT	c.(2020-2022)cTG>cCT	p.L674P		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	674			L -> P (in dbSNP:rs384081).		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L674R(1)|p.L674>?(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTACCTGCTGCTCCCGGAGG	0.688																																					.												.	.	2	Substitution - Missense(1)|Complex(1)	large_intestine(1)|prostate(1)	c.2021_2022CT	5						.																																			140456580	SO:0001583	missense	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	Exception_encountered	5.37:g.140476395_140476396delinsCT	ENSP00000194155:p.Leu674Pro		140456579	NM_018936	Q4KMU1	Missense_Mutation	DNP	ENST00000194155.4	37	CCDS4244.1																																																																																				0.688	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB16	57717	broad.mit.edu	37	5	140567292	140567292	+	IGR	SNP	C	C	T	rs369464914		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:140567292C>T	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCAGTGTTTCGGCACAAAGA	0.413																																					p.R134W												.	.	0			c.C400T	5						.	C	TRP/ARG	0,4364		0,0,2182	77.0	81.0	80.0		400	1.3	0.0	5		80	1,8591		0,1,4295	no	missense	PCDHB9	NM_019119.3	101	0,1,6477	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	134/798	140567292	1,12955	2182	4296	6478	140547476	SO:0001628	intergenic_variant	56127	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567292C>T			140547476	NM_019119	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1																																																																																				0.413	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB14	56122	broad.mit.edu	37	5	140605330	140605330	+	Silent	SNP	C	C	T	rs567138525		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:140605330C>T	ENST00000239449.4	+	1	2253	c.2253C>T	c.(2251-2253)taC>taT	p.Y751Y	PCDHB14_ENST00000515856.2_Silent_p.Y598Y	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	751					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y751Y(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTACCAATACGAGGTGTGTC	0.577													c|||	1	0.000199681	0.0	0.0	5008	,	,		15683	0.0		0.001	False		,,,				2504	0.0				p.Y751Y	Ovarian(141;50 1831 27899 33809 37648)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2253T	5						.						96.0	109.0	105.0					5																	140605330		2203	4300	6503	140585514	SO:0001819	synonymous_variant	56122	exon1			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2253C>T	5.37:g.140605330C>T			140585514	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	37	CCDS4256.1																																																																																				0.577	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
RNF180	285671	broad.mit.edu	37	5	63509985	63509985	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:63509985T>A	ENST00000389100.4	+	4	904	c.832T>A	c.(832-834)Tat>Aat	p.Y278N	RNF180_ENST00000381081.2_Intron|RNF180_ENST00000296615.6_Missense_Mutation_p.Y278N	NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	278					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y278N(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TAAAAATAGCTATTCCTTTCA	0.393																																					p.Y278N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T832A	5						.						84.0	92.0	89.0					5																	63509985		2203	4300	6503	63545741	SO:0001583	missense	285671	exon4			AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.832T>A	5.37:g.63509985T>A	ENSP00000373752:p.Tyr278Asn		63545741	NM_178532	Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	ENST00000389100.4	37	CCDS47219.1	.	.	.	.	.	.	.	.	.	.	T	8.370	0.835067	0.16820	.	.	ENSG00000164197	ENST00000296615;ENST00000389100	T	0.40756	1.02	5.98	2.19	0.27852	.	0.123452	0.56097	D	0.000021	T	0.19765	0.0475	N	0.08118	0	0.58432	D	0.999999	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.04840	-1.0923	10	0.87932	D	0	-1.0381	4.9269	0.13898	0.1341:0.2873:0.0:0.5785	.	278;278	Q86T96;Q86T96-2	RN180_HUMAN;.	N	278	ENSP00000373752:Y278N	ENSP00000296615:Y278N	Y	+	1	0	RNF180	63545741	0.950000	0.32346	1.000000	0.80357	0.965000	0.64279	0.341000	0.19909	0.497000	0.27926	0.533000	0.62120	TAT		0.393	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532	
ARHGEF28	64283	broad.mit.edu	37	5	73179619	73179619	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:73179619C>T	ENST00000426542.2	+	23	2985	c.2965C>T	c.(2965-2967)Cgc>Tgc	p.R989C	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.R989C|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.R989C|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.R989C|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.R676C|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.R989C|ARHGEF28_ENST00000512883.1_5'Flank|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.R989C			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	989	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.R989C(1)									TTTGGCTCGACGCCGAGGAAT	0.368																																					p.R989C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2965T	5						.						46.0	44.0	44.0					5																	73179619		1829	4068	5897	73215375	SO:0001583	missense	64283	exon24				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2965C>T	5.37:g.73179619C>T	ENSP00000412175:p.Arg989Cys		73215375	NM_001177693	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	De_novo_Start_OutOfFrame	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085800	0.76642	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.74	4.87	0.63330	Dbl homology (DH) domain (5);	.	.	.	.	T	0.81408	0.4816	M	0.85041	2.73	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;0.997;0.997	D;D;D;D	0.97110	1.0;1.0;0.977;0.96	D	0.85133	0.0976	9	0.87932	D	0	.	16.1751	0.81845	0.1345:0.8655:0.0:0.0	.	676;989;989;989	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	C	989;989;989;989;989;989;676	ENSP00000296794:R989C;ENSP00000441913:R989C;ENSP00000441436:R989C;ENSP00000287898:R989C;ENSP00000411459:R989C;ENSP00000412175:R989C;ENSP00000296799:R676C	ENSP00000287898:R989C	R	+	1	0	RP11-428C6.1	73215375	0.997000	0.39634	0.965000	0.40720	0.953000	0.61014	3.487000	0.53222	1.416000	0.47057	0.650000	0.86243	CGC		0.368	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
APC	324	broad.mit.edu	37	5	112175175	112175175	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:112175175delA	ENST00000457016.1	+	16	4264	c.3884delA	c.(3883-3885)gaafs	p.E1295fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.E1295fs|APC_ENST00000508376.2_Frame_Shift_Del_p.E1295fs			P25054	APC_HUMAN	adenomatous polyposis coli	1295	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.T1293fs*2(1)|p.A1296fs*9(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACGACACAGGAAGCAGATTCT	0.383		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1277fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,+1 	.	4	Deletion - Frameshift(3)|Unknown(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.3830delA	5						.						55.0	57.0	56.0					5																	112175175		2202	4300	6502	112203074	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3884delA	5.37:g.112175175delA	ENSP00000413133:p.Glu1295fs		112203074	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.383	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGB6	56100	broad.mit.edu	37	5	140788206	140788206	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr5:140788206C>A	ENST00000520790.1	+	1	437	c.437C>A	c.(436-438)gCa>gAa	p.A146E	PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	146	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGAATCTGCATCCGCTGGT	0.343																																					p.A146E												.	.	0			c.C437A	5						.						78.0	77.0	78.0					5																	140788206		1838	4106	5944	140768390	SO:0001583	missense	56100	exon1			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.437C>A	5.37:g.140788206C>A	ENSP00000428603:p.Ala146Glu		140768390	NM_018926	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	c	12.97	2.098424	0.37048	.	.	ENSG00000253305	ENST00000520790	T	0.54071	0.59	5.16	0.0661	0.14360	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.60560	0.2278	M	0.86573	2.825	0.09310	N	1	B;B	0.25272	0.122;0.1	B;B	0.35899	0.213;0.078	T	0.60596	-0.7232	9	0.59425	D	0.04	.	9.7797	0.40640	0.0:0.6483:0.0:0.3517	.	146;146	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	E	146	ENSP00000428603:A146E	ENSP00000428603:A146E	A	+	2	0	PCDHGB6	140768390	0.000000	0.05858	0.858000	0.33744	0.955000	0.61496	0.302000	0.19192	-0.002000	0.14469	0.467000	0.42956	GCA		0.343	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
KIAA1244	57221	broad.mit.edu	37	6	138582683	138582683	+	Missense_Mutation	SNP	G	G	A	rs368160702		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:138582683G>A	ENST00000251691.4	+	11	1290	c.1124G>A	c.(1123-1125)cGt>cAt	p.R375H		NM_020340.4	NP_065073.3			KIAA1244									p.R304H(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGCCCACAGCGTCTCTGTGAC	0.373																																					p.R375H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1124A	6						.	G	HIS/ARG	0,4404		0,0,2202	45.0	44.0	44.0		1124	5.8	1.0	6		44	1,8595		0,1,4297	no	missense	KIAA1244	NM_020340.4	29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	375/2178	138582683	1,12999	2202	4298	6500	138624376	SO:0001583	missense	57221	exon11			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1124G>A	6.37:g.138582683G>A	ENSP00000251691:p.Arg375His		138624376	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515175	0.64634	0.0	1.16E-4	ENSG00000112379	ENST00000251691	T	0.04654	3.58	5.83	5.83	0.93111	.	0.213517	0.45867	D	0.000325	T	0.06554	0.0168	M	0.73962	2.25	0.48135	D	0.999599	D	0.60575	0.988	P	0.45506	0.483	T	0.03249	-1.1056	10	0.87932	D	0	-38.5204	15.2407	0.73468	0.0687:0.0:0.9313:0.0	.	375	Q5TH69	BIG3_HUMAN	H	375	ENSP00000251691:R375H	ENSP00000251691:R375H	R	+	2	0	KIAA1244	138624376	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.004000	0.63966	2.763000	0.94921	0.563000	0.77884	CGT		0.373	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
SYNE1	23345	broad.mit.edu	37	6	152652460	152652460	+	Missense_Mutation	SNP	C	C	T	rs192299401		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:152652460C>T	ENST00000367255.5	-	78	13961	c.13360G>A	c.(13360-13362)Gag>Aag	p.E4454K	SYNE1_ENST00000448038.1_Missense_Mutation_p.E4383K|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.E4454K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E4383K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4454					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E4454K(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGGTTTTCTCGGACAAGGCT	0.473										HNSCC(10;0.0054)			C|||	1	0.000199681	0.0	0.0	5008	,	,		22605	0.001		0.0	False		,,,				2504	0.0				p.E4383K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G13147A	6						.						101.0	93.0	96.0					6																	152652460		2203	4300	6503	152694153	SO:0001583	missense	23345	exon77			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13360G>A	6.37:g.152652460C>T	ENSP00000356224:p.Glu4454Lys		152694153	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.76	3.212022	0.58452	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.57107	0.51;0.51;0.42;0.51	5.84	4.97	0.65823	.	0.000000	0.64402	D	0.000008	T	0.60130	0.2245	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.998	T	0.59252	-0.7489	10	0.18276	T	0.48	.	16.9476	0.86233	0.0:0.8722:0.1278:0.0	.	4454;4454;4454;4383	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	4454;4383;4454;4383	ENSP00000356224:E4454K;ENSP00000396024:E4383K;ENSP00000265368:E4454K;ENSP00000390975:E4383K	ENSP00000265368:E4454K	E	-	1	0	SYNE1	152694153	1.000000	0.71417	0.991000	0.47740	0.795000	0.44927	7.818000	0.86416	1.449000	0.47699	0.655000	0.94253	GAG		0.473	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
IRF4	3662	broad.mit.edu	37	6	401645	401645	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:401645G>A	ENST00000380956.4	+	7	1093	c.967G>A	c.(967-969)Ggg>Agg	p.G323R		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	323					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G323R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GGCCCCCGACGGGCTCTATGC	0.612			T	IGH@	MM																																p.G322R			Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G964A	6						.						46.0	48.0	47.0					6																	401645		2203	4300	6503	346645	SO:0001583	missense	3662	exon7			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.967G>A	6.37:g.401645G>A	ENSP00000370343:p.Gly323Arg		346645	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833109	0.91036	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.96522	-4.04	5.76	5.76	0.90799	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.98292	0.9434	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98264	1.0500	10	0.56958	D	0.05	-32.0017	19.9857	0.97347	0.0:0.0:1.0:0.0	.	323;353;322;323	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	R	323;352	ENSP00000370343:G323R	ENSP00000370343:G323R	G	+	1	0	IRF4	346645	1.000000	0.71417	0.985000	0.45067	0.615000	0.37417	9.414000	0.97362	2.706000	0.92434	0.655000	0.94253	GGG		0.612	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
TAP1	6890	broad.mit.edu	37	6	32815315	32815315	+	Silent	SNP	A	A	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:32815315A>G	ENST00000354258.4	-	9	2219	c.2058T>C	c.(2056-2058)tcT>tcC	p.S686S	PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Silent_p.S425S|PSMB8_ENST00000374881.2_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	686	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)	p.S686S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GAGGGAGTCCAGAGATGAAAC	0.488																																					p.S686S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2058C	6						.						129.0	129.0	129.0					6																	32815315		2203	4300	6503	32923293	SO:0001819	synonymous_variant	6890	exon9				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.2058T>C	6.37:g.32815315A>G			32923293	NM_000593	Q16149|Q96CP4	Silent	SNP	ENST00000354258.4	37	CCDS4758.1																																																																																				0.488	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
SYNGAP1	8831	broad.mit.edu	37	6	33412341	33412341	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:33412341G>A	ENST00000418600.2	+	16	3630	c.3529G>A	c.(3529-3531)Gag>Aag	p.E1177K	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.E1118K|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.E1177K	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1177					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.E1162K(1)|p.E1177K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CGAGCGGGAAGAGTACAAGCT	0.562																																					p.E1177K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3529A	6						.						78.0	65.0	69.0					6																	33412341		2203	4300	6503	33520319	SO:0001583	missense	8831	exon16			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3529G>A	6.37:g.33412341G>A	ENSP00000403636:p.Glu1177Lys		33520319	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033776	0.93575	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.81330	-1.48;-1.48;-1.48	4.61	4.61	0.57282	.	0.132682	0.49916	D	0.000133	T	0.73401	0.3582	L	0.33485	1.01	0.50313	D	0.999865	P;P;P	0.48089	0.905;0.884;0.884	P;P;P	0.50314	0.637;0.503;0.503	T	0.78615	-0.2135	10	0.72032	D	0.01	.	14.9805	0.71309	0.0:0.0:1.0:0.0	.	1177;1177;1177	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	K	1177;1177;1163;1118	ENSP00000293748:E1177K;ENSP00000403636:E1177K;ENSP00000412475:E1118K	ENSP00000293748:E1177K	E	+	1	0	SYNGAP1	33520319	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.784000	0.91818	2.389000	0.81357	0.655000	0.94253	GAG		0.562	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
PNLDC1	154197	broad.mit.edu	37	6	160239667	160239667	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr6:160239667G>A	ENST00000610273.1	+	16	1376	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	PNLDC1_ENST00000392167.3_Missense_Mutation_p.R413Q	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	402						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R402Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AACCTCATCCGAGCGGGGGTC	0.577																																					p.R402Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1205A	6						.						74.0	71.0	72.0					6																	160239667		2203	4300	6503	160159657	SO:0001583	missense	154197	exon16			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1205G>A	6.37:g.160239667G>A	ENSP00000476448:p.Arg402Gln		160159657	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173144	0.78452	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.66	4.78	0.61160	.	0.000000	0.56097	D	0.000036	T	0.51363	0.1670	L	0.29908	0.895	0.36676	D	0.878767	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.54689	-0.8256	9	0.51188	T	0.08	.	13.3215	0.60436	0.0749:0.0:0.9251:0.0	.	413;402	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	Q	402;413	.	ENSP00000275275:R402Q	R	+	2	0	PNLDC1	160159657	1.000000	0.71417	0.914000	0.36105	0.541000	0.35023	6.065000	0.71176	2.662000	0.90505	0.561000	0.74099	CGA		0.577	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
PLXNA4	91584	broad.mit.edu	37	7	131895861	131895861	+	Silent	SNP	G	G	A	rs369845177		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:131895861G>A	ENST00000359827.3	-	10	3101	c.2139C>T	c.(2137-2139)ccC>ccT	p.P713P	PLXNA4_ENST00000321063.4_Silent_p.P713P			Q9HCM2	PLXA4_HUMAN	plexin A4	713					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.P713P(4)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TCACCTCCACGGGCACCAGGA	0.617																																					p.P713P												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.C2139T	7						.						21.0	23.0	23.0					7																	131895861		2103	4243	6346	131546401	SO:0001819	synonymous_variant	91584	exon10			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2139C>T	7.37:g.131895861G>A			131546401	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																				0.617	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CREB5	9586	broad.mit.edu	37	7	28610098	28610098	+	Missense_Mutation	SNP	C	C	T	rs555693522		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:28610098C>T	ENST00000357727.2	+	5	797	c.407C>T	c.(406-408)cCg>cTg	p.P136L	CREB5_ENST00000409603.1_Missense_Mutation_p.P103L|CREB5_ENST00000396299.2_Missense_Mutation_p.P103L|CREB5_ENST00000396300.2_Missense_Mutation_p.P129L	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	136					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P136L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						CAAGCCATGCCGTCGCCTCAG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18485	0.0		0.0	False		,,,				2504	0.001				p.P129L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386T	7						.						119.0	103.0	109.0					7																	28610098		2203	4300	6503	28576623	SO:0001583	missense	9586	exon5			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.407C>T	7.37:g.28610098C>T	ENSP00000350359:p.Pro136Leu		28576623	NM_004904	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091635	0.76756	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T	0.69306	-0.39;-0.34;-0.32;-0.39	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.82926	0.5143	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.84772	0.0768	10	0.87932	D	0	-15.204	19.2936	0.94112	0.0:1.0:0.0:0.0	.	136	Q02930	CREB5_HUMAN	L	103;136;129;103	ENSP00000379593:P103L;ENSP00000350359:P136L;ENSP00000379594:P129L;ENSP00000387197:P103L	ENSP00000350359:P136L	P	+	2	0	CREB5	28576623	1.000000	0.71417	0.998000	0.56505	0.810000	0.45777	7.205000	0.77881	2.583000	0.87209	0.650000	0.86243	CCG		0.617	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904	
FAM183B	340286	broad.mit.edu	37	7	38725276	38725276	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:38725276G>T	ENST00000409072.3	-	2	1264	c.330C>A	c.(328-330)aaC>aaA	p.N110K				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	110										endometrium(1)|lung(7)	8						CCCTGAAGTGGTTCATCCTGT	0.527																																					.												.	.	0			.	7						.						202.0	201.0	201.0					7																	38725276		2010	4179	6189	38691801	SO:0001583	missense	340286	.			AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.330C>A	7.37:g.38725276G>T	ENSP00000386657:p.Asn110Lys		38691801	.	A4D1Y1	Missense_Mutation	SNP	ENST00000409072.3	37		.	.	.	.	.	.	.	.	.	.	G	11.27	1.588392	0.28357	.	.	ENSG00000164556	ENST00000409072	.	.	.	1.62	0.661	0.17874	.	0.270493	0.29676	N	0.011499	T	0.32285	0.0824	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15694	-1.0428	6	0.41790	T	0.15	.	4.5745	0.12226	0.2358:0.0:0.7642:0.0	.	.	.	.	K	110	.	ENSP00000386657:N110K	N	-	3	2	FAM183B	38691801	0.005000	0.15991	0.026000	0.17262	0.003000	0.03518	-0.040000	0.12104	-0.019000	0.14055	-0.253000	0.11424	AAC		0.527	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331972.1	NM_001105282	
MAGI2	9863	broad.mit.edu	37	7	77764411	77764411	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:77764411C>A	ENST00000354212.4	-	17	3211	c.2958G>T	c.(2956-2958)atG>atT	p.M986I	MAGI2_ENST00000522391.1_Missense_Mutation_p.M986I|MAGI2_ENST00000419488.1_Missense_Mutation_p.M972I	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	986	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.M986I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CAGCGTGAGGCATGTTGATGA	0.522																																					p.M986I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2958T	7						.						263.0	198.0	220.0					7																	77764411		2203	4300	6503	77602347	SO:0001583	missense	9863	exon17			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2958G>T	7.37:g.77764411C>A	ENSP00000346151:p.Met986Ile		77602347	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958290	0.92726	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.27890	1.64;1.64;1.64	6.06	6.06	0.98353	PDZ/DHR/GLGF (4);	0.000000	0.44097	U	0.000487	T	0.37517	0.1006	N	0.17345	0.48	0.80722	D	1	P;P;P	0.42649	0.646;0.478;0.786	P;P;P	0.55087	0.621;0.512;0.768	T	0.03384	-1.1042	10	0.26408	T	0.33	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	986;972;986	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	I	972;986;986;986	ENSP00000405766:M972I;ENSP00000346151:M986I;ENSP00000428389:M986I	ENSP00000346151:M986I	M	-	3	0	MAGI2	77602347	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	ATG		0.522	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
SEMA3A	10371	broad.mit.edu	37	7	83606493	83606493	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:83606493T>A	ENST00000265362.4	-	15	1986	c.1672A>T	c.(1672-1674)Ata>Tta	p.I558L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.I558L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	558					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.I558L(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCATTTCTTATATCTTGTCGT	0.348																																					p.I558L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1672T	7						.						242.0	213.0	223.0					7																	83606493		2203	4300	6503	83444429	SO:0001583	missense	10371	exon15			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1672A>T	7.37:g.83606493T>A	ENSP00000265362:p.Ile558Leu		83444429	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866736	0.72065	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.21932	1.98;1.98	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	L	0.60957	1.885	0.58432	D	0.999999	P	0.38582	0.638	B	0.39904	0.313	T	0.03249	-1.1056	10	0.49607	T	0.09	.	14.4187	0.67168	0.0:0.0:0.0:1.0	.	558	Q14563	SEM3A_HUMAN	L	558	ENSP00000265362:I558L;ENSP00000415260:I558L	ENSP00000265362:I558L	I	-	1	0	SEMA3A	83444429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.961000	0.63681	1.886000	0.54624	0.477000	0.44152	ATA		0.348	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
DYNC1I1	1780	broad.mit.edu	37	7	95616429	95616429	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:95616429A>T	ENST00000324972.6	+	9	1049	c.856A>T	c.(856-858)Aag>Tag	p.K286*	DYNC1I1_ENST00000447467.2_Nonsense_Mutation_p.K269*|DYNC1I1_ENST00000359388.4_Nonsense_Mutation_p.K249*|DYNC1I1_ENST00000537881.1_Nonsense_Mutation_p.K249*|DYNC1I1_ENST00000437599.1_Nonsense_Mutation_p.K266*|DYNC1I1_ENST00000457059.1_Nonsense_Mutation_p.K269*	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	286					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.K286*(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			ACATTGGTCCAAGCATCGAGT	0.438																																					p.K286X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A856T	7						.						267.0	258.0	261.0					7																	95616429		2203	4300	6503	95454365	SO:0001587	stop_gained	1780	exon9			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.856A>T	7.37:g.95616429A>T	ENSP00000320130:p.Lys286*		95454365	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Nonsense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	A	38	7.170316	0.98111	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	.	.	.	3.86	3.86	0.44501	.	0.118143	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5696	13.7339	0.62807	1.0:0.0:0.0:0.0	.	.	.	.	X	269;286;249;266;249;269	.	ENSP00000320130:K286X	K	+	1	0	DYNC1I1	95454365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.021000	0.93673	1.984000	0.57885	0.460000	0.39030	AAG		0.438	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
STAG3	10734	broad.mit.edu	37	7	99795492	99795492	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:99795492G>A	ENST00000426455.1	+	11	1564	c.1157G>A	c.(1156-1158)cGc>cAc	p.R386H	STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000394018.2_Missense_Mutation_p.R328H|GATS_ENST00000543273.1_RNA|STAG3_ENST00000317296.5_Missense_Mutation_p.R386H	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	386	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.R386H(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCACCAGCCGCTTCAAGGTA	0.547																																					p.R386H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1157A	7						.						66.0	69.0	68.0					7																	99795492		2203	4300	6503	99633428	SO:0001583	missense	10734	exon11			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1157G>A	7.37:g.99795492G>A	ENSP00000400359:p.Arg386His		99633428	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	35	5.418878	0.96092	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000317296	T;T;T	0.34275	1.37;1.37;1.37	5.71	4.83	0.62350	Stromalin conservative domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.128942	0.35772	N	0.003000	T	0.51941	0.1704	M	0.86343	2.81	0.53688	D	0.999973	P;D	0.54772	0.943;0.968	B;P	0.49597	0.382;0.616	T	0.61407	-0.7069	10	0.87932	D	0	-13.8523	11.7272	0.51716	0.0844:0.0:0.9156:0.0	.	328;386	B4DZ10;Q9UJ98	.;STAG3_HUMAN	H	386;328;344;386	ENSP00000400359:R386H;ENSP00000377586:R328H;ENSP00000319318:R386H	ENSP00000319318:R386H	R	+	2	0	STAG3	99633428	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.794000	0.85869	2.695000	0.91970	0.650000	0.86243	CGC		0.547	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
CALD1	800	broad.mit.edu	37	7	134632261	134632261	+	Missense_Mutation	SNP	G	G	A	rs555670514		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr7:134632261G>A	ENST00000361675.2	+	8	1764	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	CALD1_ENST00000361388.2_Missense_Mutation_p.R283H|CALD1_ENST00000424922.1_Missense_Mutation_p.R251H|CALD1_ENST00000422748.1_Missense_Mutation_p.R283H|CALD1_ENST00000393118.2_Missense_Mutation_p.R277H|CALD1_ENST00000417172.1_Missense_Mutation_p.R257H|CALD1_ENST00000361901.2_Missense_Mutation_p.R257H|CALD1_ENST00000495522.1_Missense_Mutation_p.R277H|CALD1_ENST00000543443.1_Missense_Mutation_p.R262H			Q05682	CALD1_HUMAN	caldesmon 1	512					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.R512H(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						AACCACAGCCGCCCTGGAGGG	0.652																																					p.R283H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G848A	7						.						11.0	11.0	11.0					7																	134632261		2183	4273	6456	134282801	SO:0001583	missense	800	exon8			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1535G>A	7.37:g.134632261G>A	ENSP00000354826:p.Arg512His		134282801	NM_033157	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716635	0.30413	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.22	4.33	0.51752	.	0.173153	0.27896	N	0.017404	T	0.63355	0.2504	L	0.52364	1.645	0.45272	D	0.998273	D;D;D;D;D;D;D;D;D;D	0.76494	0.992;0.994;0.992;0.999;0.99;0.994;0.99;0.99;0.999;0.995	P;P;P;D;P;P;P;P;D;P	0.64687	0.873;0.799;0.873;0.928;0.799;0.799;0.799;0.799;0.928;0.873	T	0.63238	-0.6682	10	0.48119	T	0.1	-6.2543	12.367	0.55234	0.0:0.0:0.8306:0.1694	.	206;262;283;277;251;277;257;283;512;257	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	H	257;257;283;283;512;257;277;251;277;262	ENSP00000398826:R257H;ENSP00000411476:R257H;ENSP00000355000:R283H;ENSP00000395710:R283H;ENSP00000354826:R512H;ENSP00000354513:R257H;ENSP00000376826:R277H;ENSP00000393621:R251H;ENSP00000419673:R277H;ENSP00000445641:R262H	ENSP00000355000:R283H	R	+	2	0	CALD1	134282801	1.000000	0.71417	0.889000	0.34880	0.032000	0.12392	4.037000	0.57311	1.167000	0.42706	-0.309000	0.09137	CGC		0.652	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
PREX2	80243	broad.mit.edu	37	8	68930087	68930087	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr8:68930087T>G	ENST00000288368.4	+	2	425	c.148T>G	c.(148-150)Tta>Gta	p.L50V	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	50	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.L50V(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GCAGGCATTCTTACACAGAAT	0.378																																					p.L50V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T148G	8						.						125.0	105.0	112.0					8																	68930087		2203	4300	6503	69092641	SO:0001583	missense	80243	exon2			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.148T>G	8.37:g.68930087T>G	ENSP00000288368:p.Leu50Val		69092641	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839866	0.71488	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.63417	-0.04	5.85	5.85	0.93711	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000007	T	0.71617	0.3361	L	0.56769	1.78	0.52099	D	0.999941	P;P	0.41232	0.683;0.743	P;P	0.53593	0.73;0.547	T	0.72465	-0.4285	10	0.52906	T	0.07	.	14.1993	0.65690	0.0:0.0:0.0:1.0	.	50;50	Q70Z35;Q70Z35-3	PREX2_HUMAN;.	V	50	ENSP00000288368:L50V	ENSP00000288368:L50V	L	+	1	2	PREX2	69092641	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.657000	0.46724	2.238000	0.73509	0.533000	0.62120	TTA		0.378	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
ZFHX4	79776	broad.mit.edu	37	8	77616659	77616659	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr8:77616659C>T	ENST00000521891.2	+	2	784	c.336C>T	c.(334-336)aaC>aaT	p.N112N	ZFHX4_ENST00000518282.1_Silent_p.N112N|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.N112N|ZFHX4_ENST00000455469.2_Silent_p.N112N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N112N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGGATGACAACGAGAGCGAGA	0.483										HNSCC(33;0.089)																											p.N112N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C336T	8						.						161.0	156.0	158.0					8																	77616659		2016	4170	6186	77779214	SO:0001819	synonymous_variant	79776	exon2				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.336C>T	8.37:g.77616659C>T			77779214	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
E2F5	1875	broad.mit.edu	37	8	86119724	86119724	+	Splice_Site	DEL	G	G	-			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr8:86119724delG	ENST00000416274.2	+	5	649	c.615delG	c.(613-615)atg>at	p.M205fs	E2F5_ENST00000418930.2_Splice_Site_p.M205fs|E2F5_ENST00000517476.1_Splice_Site_p.M44fs|E2F5_ENST00000256117.5_Splice_Site_p.M206fs|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000521429.1_Splice_Site_p.M32fs	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	205	Dimerization. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G206fs*12(1)		NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TTCCAGAAATGGTATGTAGGA	0.338																																					p.M205fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.615delG	8						.						39.0	40.0	40.0					8																	86119724		1817	4062	5879	86306976	SO:0001630	splice_region_variant	1875	exon5			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.615+1G>-	8.37:g.86119724delG			86306976	NM_001083588	E9PBN9|Q16601|Q92756	Frame_Shift_Del	DEL	ENST00000416274.2	37	CCDS47885.1																																																																																				0.338	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	Frame_Shift_Del
EFR3A	23167	broad.mit.edu	37	8	132999909	132999909	+	Silent	SNP	T	T	C			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr8:132999909T>C	ENST00000254624.5	+	18	2250	c.2025T>C	c.(2023-2025)agT>agC	p.S675S	EFR3A_ENST00000334503.4_Silent_p.S675S|EFR3A_ENST00000519656.1_Silent_p.S639S	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	675						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.S675S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GTGGATATAGTGTTGAGAGAT	0.373																																					p.S675S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2025C	8						.						104.0	85.0	91.0					8																	132999909		2201	4299	6500	133069091	SO:0001819	synonymous_variant	23167	exon18			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.2025T>C	8.37:g.132999909T>C			133069091	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	ENST00000254624.5	37	CCDS34942.2																																																																																				0.373	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
ZNF462	58499	broad.mit.edu	37	9	109773303	109773303	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:109773303A>T	ENST00000277225.5	+	13	7802	c.7513A>T	c.(7513-7515)Aaa>Taa	p.K2505*	ZNF462_ENST00000457913.1_Nonsense_Mutation_p.K2565*|ZNF462_ENST00000441147.2_Nonsense_Mutation_p.K1411*|RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000542028.1_Nonsense_Mutation_p.K462*			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2505					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K2505*(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AGAGGCCAAAAAAGAATGAGC	0.448																																					p.K2505X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A7513T	9						.						63.0	60.0	61.0					9																	109773303		2203	4300	6503	108813124	SO:0001587	stop_gained	58499	exon13			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.7513A>T	9.37:g.109773303A>T	ENSP00000277225:p.Lys2505*		108813124	NM_021224	Q5T0T4|Q8N408	Nonsense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	A	49	15.582486	0.99838	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	.	.	.	5.75	5.75	0.90469	.	0.602001	0.17126	N	0.186024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	16.0707	0.80928	1.0:0.0:0.0:0.0	.	.	.	.	X	2505;2565;1448;1411;462	.	ENSP00000277225:K2505X	K	+	1	0	ZNF462	108813124	1.000000	0.71417	0.982000	0.44146	0.962000	0.63368	6.072000	0.71238	2.194000	0.70268	0.533000	0.62120	AAA		0.448	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
PAPPA	5069	broad.mit.edu	37	9	118982351	118982351	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:118982351C>T	ENST00000328252.3	+	5	2423	c.2054C>T	c.(2053-2055)aCa>aTa	p.T685I	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	685					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T685I(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CTGGGCCACACAACGGACTCT	0.572																																					p.T685I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2054T	9						.						158.0	150.0	152.0					9																	118982351		2203	4300	6503	118022172	SO:0001583	missense	5069	exon5				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2054C>T	9.37:g.118982351C>T	ENSP00000330658:p.Thr685Ile		118022172	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	9.619	1.133248	0.21041	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02067	4.47	5.75	2.93	0.34026	.	0.344574	0.37393	N	0.002118	T	0.02380	0.0073	L	0.35341	1.055	0.80722	D	1	B;B	0.21071	0.051;0.004	B;B	0.13407	0.009;0.003	T	0.51403	-0.8710	10	0.72032	D	0.01	-1.7116	10.3743	0.44073	0.0:0.7913:0.0:0.2087	.	129;685	E7EMD3;Q13219	.;PAPP1_HUMAN	I	685;129	ENSP00000330658:T685I	ENSP00000330658:T685I	T	+	2	0	PAPPA	118022172	0.038000	0.19896	0.635000	0.29338	0.209000	0.24338	0.370000	0.20433	0.792000	0.33850	0.655000	0.94253	ACA		0.572	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
NPR2	4882	broad.mit.edu	37	9	35807327	35807327	+	Splice_Site	SNP	G	G	A	rs55700371		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:35807327G>A	ENST00000342694.2	+	18	2899	c.2644G>A	c.(2644-2646)Gta>Ata	p.V882I	SPAG8_ENST00000479751.1_5'Flank	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	882	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.		V -> I (in dbSNP:rs55700371). {ECO:0000269|PubMed:17344846}.		bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.V882I(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TCCCTTTTAGGTAGTGACACT	0.423																																					p.V882I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2644A	9						.	G	ILE/VAL	0,4406		0,0,2203	207.0	208.0	208.0		2644	6.2	1.0	9	dbSNP_129	208	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice	NPR2	NM_003995.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	882/1048	35807327	1,13005	2203	4300	6503	35797327	SO:0001630	splice_region_variant	4882	exon18			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2644-1G>A	9.37:g.35807327G>A			35797327	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647722	0.67358	0.0	1.16E-4	ENSG00000159899	ENST00000342694;ENST00000447210	D;D	0.81499	-1.5;-1.5	6.17	6.17	0.99709	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.40818	N	0.001005	D	0.88347	0.6412	L	0.58302	1.8	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.79108	0.986;0.992	D	0.85949	0.1463	9	.	.	.	.	19.4575	0.94900	0.0:0.0:1.0:0.0	rs55700371	882;882	P20594-2;P20594	.;ANPRB_HUMAN	I	882;141	ENSP00000341083:V882I;ENSP00000393029:V141I	.	V	+	1	0	NPR2	35797327	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.851000	0.86920	2.941000	0.99782	0.655000	0.94253	GTA		0.423	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		Missense_Mutation
ABHD17B	51104	broad.mit.edu	37	9	74485083	74485083	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:74485083A>T	ENST00000333421.6	-	3	674	c.563T>A	c.(562-564)gTt>gAt	p.V188D	ABHD17B_ENST00000377041.2_Missense_Mutation_p.V188D	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	188						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.V188D(1)									ATGAAGAATAACAGCAGCACT	0.428																																					p.V188D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T563A	9						.						171.0	156.0	161.0					9																	74485083		2203	4300	6503	73674903	SO:0001583	missense	51104	exon3			AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.563T>A	9.37:g.74485083A>T	ENSP00000330222:p.Val188Asp		73674903	NM_001025780	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	37	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563506	0.86335	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.52526	0.66;0.66	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.81069	0.4746	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	D	0.88720	0.3229	10	0.87932	D	0	-16.9129	15.6113	0.76721	1.0:0.0:0.0:0.0	.	188;188	Q5VST6;Q5VST6-2	F108B_HUMAN;.	D	188	ENSP00000366240:V188D;ENSP00000330222:V188D	ENSP00000330222:V188D	V	-	2	0	FAM108B1	73674903	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	9.152000	0.94680	2.151000	0.67156	0.533000	0.62120	GTT		0.428	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
DIRAS2	54769	broad.mit.edu	37	9	93375656	93375656	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:93375656C>T	ENST00000375765.3	-	2	842	c.454G>A	c.(454-456)Gcc>Acc	p.A152T		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	152					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.A152T(1)		kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						TTGAGCTTGGCTGAGGTCTCC	0.592																																					p.A152T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G454A	9						.						106.0	97.0	100.0					9																	93375656		2203	4300	6503	92415476	SO:0001583	missense	54769	exon2			AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.454G>A	9.37:g.93375656C>T	ENSP00000364919:p.Ala152Thr		92415476	NM_017594	B3KVM2	Missense_Mutation	SNP	ENST00000375765.3	37	CCDS6687.1	.	.	.	.	.	.	.	.	.	.	C	34	5.408965	0.96072	.	.	ENSG00000165023	ENST00000375765	D	0.88741	-2.42	5.07	5.07	0.68467	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.94964	0.8371	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95239	0.8349	10	0.72032	D	0.01	.	17.9957	0.89182	0.0:1.0:0.0:0.0	.	152	Q96HU8	DIRA2_HUMAN	T	152	ENSP00000364919:A152T	ENSP00000364919:A152T	A	-	1	0	DIRAS2	92415476	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.473000	0.81007	2.804000	0.96469	0.655000	0.94253	GCC		0.592	DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053012.1		
PTCH1	5727	broad.mit.edu	37	9	98209656	98209656	+	Silent	SNP	A	A	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:98209656A>T	ENST00000331920.6	-	23	4181	c.3882T>A	c.(3880-3882)ccT>ccA	p.P1294P	PTCH1_ENST00000429896.2_Silent_p.P1143P|PTCH1_ENST00000430669.2_Silent_p.P1228P|PTCH1_ENST00000437951.1_Silent_p.P1228P|PTCH1_ENST00000418258.1_Silent_p.P1143P|PTCH1_ENST00000421141.1_Silent_p.P1143P|PTCH1_ENST00000375274.2_Silent_p.P1293P	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1294					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.P1293P(2)|p.P1294P(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GCCGTCCGGGAGGCAGGGACC	0.647																																					p.P1143P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T3429A	9						.						46.0	58.0	54.0					9																	98209656		2172	4279	6451	97249477	SO:0001819	synonymous_variant	5727	exon23			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3882T>A	9.37:g.98209656A>T			97249477	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																				0.647	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
LMX1B	4010	broad.mit.edu	37	9	129453257	129453257	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chr9:129453257G>A	ENST00000373474.4	+	3	476	c.469G>A	c.(469-471)Gtg>Atg	p.V157M	LMX1B_ENST00000561065.1_Missense_Mutation_p.V134M|LMX1B_ENST00000425646.2_Missense_Mutation_p.V134M|LMX1B_ENST00000355497.5_Missense_Mutation_p.V157M|LMX1B_ENST00000526117.1_Missense_Mutation_p.V157M			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	157	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V134M(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CGACGAATTCGTGCTCAAGGA	0.642									Nail-Patella Syndrome																												p.V157M	Pancreas(110;1796 2278 18357 20466)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G469A	9						.						84.0	64.0	71.0					9																	129453257		2203	4300	6503	128493078	SO:0001583	missense	4010	exon3	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.469G>A	9.37:g.129453257G>A	ENSP00000362573:p.Val157Met		128493078	NM_002316	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533024	0.85812	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	4.91	4.91	0.64330	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.90960	0.7158	L	0.47190	1.495	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.932;1.0;1.0	D	0.89952	0.4080	10	0.34782	T	0.22	.	17.0706	0.86572	0.0:0.0:1.0:0.0	.	134;134;157	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	M	157;157;157;134	ENSP00000436930:V157M;ENSP00000362573:V157M;ENSP00000347684:V157M;ENSP00000390923:V134M	ENSP00000347684:V157M	V	+	1	0	LMX1B	128493078	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.856000	0.99531	2.243000	0.73865	0.491000	0.48974	GTG		0.642	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
CSF2RA	1438	broad.mit.edu	37	X	1407701	1407701	+	Silent	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:1407701G>A	ENST00000381524.3	+	6	579	c.393G>A	c.(391-393)gcG>gcA	p.A131A	CSF2RA_ENST00000501036.2_5'UTR|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000355432.3_Silent_p.A131A|CSF2RA_ENST00000432318.2_Silent_p.A131A|CSF2RA_ENST00000361536.3_Silent_p.A131A|CSF2RA_ENST00000381509.3_Silent_p.A131A|CSF2RA_ENST00000355805.2_Silent_p.A131A|CSF2RA_ENST00000381500.1_Silent_p.A131A|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381529.3_Silent_p.A131A|CSF2RA_ENST00000417535.2_Silent_p.A131A			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	131					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A131A(4)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TCTACAATGCGGATTTAATGA	0.473													g|||	6	0.00119808	0.0045	0.0	5008	,	,		17032	0.0		0.0	False		,,,				2504	0.0				p.A131A	Esophageal Squamous(131;723 1707 25334 40494 41806)											.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.G393A	X						.	G	,,,,,,,,	13,4393		0,13,2190	174.0	183.0	180.0		393,393,393,,393,393,393,393,393	-4.0	0.0	X	dbSNP_134	180	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,utr-5,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CSF2RA	NM_001161529.1,NM_001161530.1,NM_001161531.1,NM_001161532.1,NM_006140.4,NM_172245.2,NM_172246.2,NM_172247.2,NM_172249.2	,,,,,,,,	0,13,6486	AA,AG,GG		0.0,0.2951,0.1	,,,,,,,,	131/401,131/435,131/411,,131/401,131/401,131/378,131/334,131/234	1407701	13,12985	2203	4296	6499	1367701	SO:0001819	synonymous_variant	1438	exon6			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.393G>A	X.37:g.1407701G>A			1367701	NM_172245	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	ENST00000381524.3	37	CCDS35191.1																																																																																				0.473	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2		
MAGEC1	9947	broad.mit.edu	37	X	140996491	140996491	+	Missense_Mutation	SNP	T	T	A	rs559034130		TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:140996491T>A	ENST00000285879.4	+	4	3587	c.3301T>A	c.(3301-3303)Tcc>Acc	p.S1101T	MAGEC1_ENST00000406005.2_Missense_Mutation_p.S168T	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1101	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.S1101T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TACCTTTCCATCCTCTTACAA	0.453										HNSCC(15;0.026)																											p.S1101T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3301A	X						.						134.0	122.0	126.0					X																	140996491		2203	4300	6503	140824157	SO:0001583	missense	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3301T>A	X.37:g.140996491T>A	ENSP00000285879:p.Ser1101Thr		140824157	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	0.017	-1.495379	0.01009	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05258	4.43;3.47	1.06	-2.12	0.07165	.	.	.	.	.	T	0.04907	0.0132	L	0.49778	1.585	0.09310	N	1	B	0.31931	0.347	B	0.23150	0.044	T	0.20438	-1.0275	9	0.48119	T	0.1	.	2.5899	0.04839	0.2276:0.2213:0.0:0.5511	.	1101	O60732	MAGC1_HUMAN	T	1101;168	ENSP00000285879:S1101T;ENSP00000385500:S168T	ENSP00000285879:S1101T	S	+	1	0	MAGEC1	140824157	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.449000	0.00232	-2.087000	0.00862	-0.831000	0.03077	TCC		0.453	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
CTPS2	56474	broad.mit.edu	37	X	16707627	16707627	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:16707627G>A	ENST00000443824.1	-	8	1561	c.818C>T	c.(817-819)cCc>cTc	p.P273L	CTPS2_ENST00000380241.3_Missense_Mutation_p.P273L|CTPS2_ENST00000359276.4_Missense_Mutation_p.P273L	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	273					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)	p.P273L(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					ATCACCGATGGGCAGGTGCAA	0.358																																					p.P273L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C818T	X						.						133.0	123.0	126.0					X																	16707627		2203	4300	6503	16617548	SO:0001583	missense	56474	exon8			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.818C>T	X.37:g.16707627G>A	ENSP00000401264:p.Pro273Leu		16617548	NM_001144002	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	ENST00000443824.1	37	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	g	14.23	2.474824	0.43942	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	T;T;T	0.44083	0.93;0.93;0.93	5.83	5.83	0.93111	CTP synthase, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.41282	0.1152	L	0.44542	1.39	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.15925	-1.0420	10	0.52906	T	0.07	-13.4748	19.121	0.93364	0.0:0.0:1.0:0.0	.	273	Q9NRF8	PYRG2_HUMAN	L	273	ENSP00000401264:P273L;ENSP00000369590:P273L;ENSP00000352222:P273L	ENSP00000352222:P273L	P	-	2	0	CTPS2	16617548	1.000000	0.71417	0.934000	0.37439	0.108000	0.19459	9.350000	0.97070	2.466000	0.83321	0.597000	0.82753	CCC		0.358	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
SYTL5	94122	broad.mit.edu	37	X	37984553	37984553	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:37984553A>G	ENST00000357972.5	+	16	2390	c.1844A>G	c.(1843-1845)tAc>tGc	p.Y615C	SYTL5_ENST00000297875.2_Missense_Mutation_p.Y615C|SYTL5_ENST00000456733.2_Missense_Mutation_p.Y637C|TM4SF2_ENST00000465127.1_Intron			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	615	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.Y615C(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TCATGCAGCTACCTGCTCCCT	0.403																																					p.Y615C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1844G	X						.						76.0	67.0	70.0					X																	37984553		2202	4300	6502	37869497	SO:0001583	missense	94122	exon16				CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1844A>G	X.37:g.37984553A>G	ENSP00000350657:p.Tyr615Cys		37869497	NM_138780	A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921370	0.73213	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.63580	-0.05;-0.05;-0.05	5.57	5.57	0.84162	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.79522	0.4460	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.97110	1.0;0.912	T	0.80365	-0.1413	10	0.41790	T	0.15	-7.7719	14.7801	0.69760	1.0:0.0:0.0:0.0	.	637;615	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	C	615;615;637	ENSP00000297875:Y615C;ENSP00000350657:Y615C;ENSP00000395220:Y637C	ENSP00000297875:Y615C	Y	+	2	0	SYTL5	37869497	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	9.298000	0.96132	1.872000	0.54250	0.417000	0.27973	TAC		0.403	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
CCDC120	90060	broad.mit.edu	37	X	48924963	48924963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:48924963C>T	ENST00000376396.3	+	10	1427	c.1208C>T	c.(1207-1209)cCa>cTa	p.P403L	CCDC120_ENST00000496529.2_Missense_Mutation_p.P403L|CCDC120_ENST00000422185.2_Missense_Mutation_p.P403L|CCDC120_ENST00000536628.2_Missense_Mutation_p.P391L|CCDC120_ENST00000603986.1_Missense_Mutation_p.P438L|CCDC120_ENST00000597275.1_Missense_Mutation_p.P403L	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	403	Pro-rich.							p.P403L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						CGCCCCCAACCAACCCCTGCC	0.736																																					p.P391L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1172T	X						.						9.0	8.0	8.0					X																	48924963		2178	4223	6401	48811907	SO:0001583	missense	90060	exon10			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.1208C>T	X.37:g.48924963C>T	ENSP00000365577:p.Pro403Leu		48811907	NM_001163323	B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566817	0.45694	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	4.89	3.92	0.45320	.	0.183959	0.40469	N	0.001096	T	0.50888	0.1642	L	0.36672	1.1	0.32690	N	0.514294	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.76071	0.987;0.987;0.987;0.987	T	0.54669	-0.8259	9	0.14252	T	0.57	-23.7541	7.8917	0.29682	0.0:0.8757:0.0:0.1243	.	391;438;391;403	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	L	403;403;391	.	ENSP00000365577:P403L	P	+	2	0	CCDC120	48811907	0.464000	0.25807	0.833000	0.33012	0.785000	0.44390	2.724000	0.47285	0.895000	0.36342	0.529000	0.55759	CCA		0.736	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626	
WNK3	65267	broad.mit.edu	37	X	54319392	54319392	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:54319392C>T	ENST00000375159.2	-	9	1965	c.1966G>A	c.(1966-1968)Gtc>Atc	p.V656I	WNK3_ENST00000375169.3_Missense_Mutation_p.V656I|WNK3_ENST00000354646.2_Missense_Mutation_p.V656I			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	656					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V656I(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GGTCCAAGGACATGTACAGGT	0.423																																					p.V656I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1966A	X						.						101.0	88.0	92.0					X																	54319392		2203	4300	6503	54336117	SO:0001583	missense	65267	exon10			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1966G>A	X.37:g.54319392C>T	ENSP00000364301:p.Val656Ile		54336117	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	C	3.706	-0.060608	0.07317	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.42131	0.98;0.98;0.98	5.21	2.4	0.29515	.	2.060710	0.02642	N	0.105459	T	0.24470	0.0593	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.15636	-1.0430	10	0.26408	T	0.33	7.5319	4.9435	0.13978	0.0:0.6302:0.1704:0.1994	.	656;656	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	I	656	ENSP00000364312:V656I;ENSP00000346667:V656I;ENSP00000364301:V656I	ENSP00000346667:V656I	V	-	1	0	WNK3	54336117	0.338000	0.24775	0.048000	0.18961	0.707000	0.40811	0.581000	0.23819	0.140000	0.18849	-0.248000	0.11899	GTC		0.423	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
AR	367	broad.mit.edu	37	X	66937453	66937453	+	Silent	SNP	G	G	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:66937453G>T	ENST00000374690.3	+	5	2831	c.2307G>T	c.(2305-2307)ctG>ctT	p.L769L	AR_ENST00000396043.2_Silent_p.L237L|AR_ENST00000396044.3_Intron	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	768	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L769L(1)|p.L579L(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CCCCTGATCTGGTTTTCAATG	0.537									Androgen Insensitivity Syndrome																												p.L237L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G711T	X						.						101.0	74.0	83.0					X																	66937453		2203	4300	6503	66854178	SO:0001819	synonymous_variant	367	exon5	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2307G>T	X.37:g.66937453G>T			66854178	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	37	CCDS14387.1																																																																																				0.537	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
KIAA2022	340533	broad.mit.edu	37	X	73961715	73961715	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:73961715C>A	ENST00000055682.6	-	3	3288	c.2677G>T	c.(2677-2679)Gct>Tct	p.A893S		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	893					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.A893S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CCAGAAGTAGCCTTGTTGGGC	0.483																																					p.A893S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2677T	X						.						61.0	51.0	54.0					X																	73961715		2203	4300	6503	73878440	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2677G>T	X.37:g.73961715C>A	ENSP00000055682:p.Ala893Ser		73878440	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.719607	0.00700	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29917	1.55;1.55	5.26	-2.13	0.07144	.	0.659654	0.16484	N	0.212411	T	0.07143	0.0181	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21724	-1.0237	10	0.09338	T	0.73	1.1858	0.9912	0.01457	0.4092:0.2432:0.1268:0.2209	.	893	Q5QGS0	K2022_HUMAN	S	893	ENSP00000362567:A893S;ENSP00000055682:A893S	ENSP00000055682:A893S	A	-	1	0	KIAA2022	73878440	0.001000	0.12720	0.016000	0.15963	0.417000	0.31264	-0.306000	0.08178	-1.311000	0.02309	-0.295000	0.09555	GCT		0.483	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
DACH2	117154	broad.mit.edu	37	X	85950141	85950141	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:85950141C>A	ENST00000373125.4	+	5	890	c.890C>A	c.(889-891)cCa>cAa	p.P297Q	DACH2_ENST00000508860.1_Missense_Mutation_p.P130Q|DACH2_ENST00000510272.1_Missense_Mutation_p.P78Q|DACH2_ENST00000373131.1_Missense_Mutation_p.P284Q	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	297					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P284Q(1)|p.P297Q(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GGGGGTGCTCCAACCCTCAAT	0.493																																					p.P297Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C890A	X						.						63.0	47.0	52.0					X																	85950141		2203	4300	6503	85836797	SO:0001583	missense	117154	exon5			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.890C>A	X.37:g.85950141C>A	ENSP00000362217:p.Pro297Gln		85836797	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	c	4.654	0.121655	0.08881	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.81996	-1.56;-1.56	4.99	4.03	0.46877	.	0.215882	0.31797	N	0.007046	T	0.67316	0.2880	N	0.22421	0.69	0.25472	N	0.987817	B;B;B	0.26744	0.083;0.092;0.158	B;B;B	0.20767	0.02;0.018;0.031	T	0.51317	-0.8721	10	0.12766	T	0.61	.	9.5587	0.39355	0.5307:0.4693:0.0:0.0	.	163;284;297	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	Q	297;284;297;130;78;130	ENSP00000362223:P284Q;ENSP00000362217:P297Q	ENSP00000345134:P297Q	P	+	2	0	DACH2	85836797	0.999000	0.42202	0.036000	0.18154	0.007000	0.05969	4.018000	0.57174	2.050000	0.60909	0.509000	0.49947	CCA		0.493	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
HCFC1	3054	broad.mit.edu	37	X	153229676	153229676	+	Silent	SNP	C	C	T			TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3693-01A-01W-0900-09	TCGA-AA-3693-10A-01W-0900-09	g.chrX:153229676C>T	ENST00000310441.7	-	3	1368	c.402G>A	c.(400-402)ccG>ccA	p.P134P	HCFC1_ENST00000369984.4_Silent_p.P134P|HCFC1_ENST00000354233.3_Silent_p.P134P|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	134					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.P35P(1)|p.P134P(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCGAGGACACGGAGGGGGCC	0.552																																					p.P134P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G402A	X						.						159.0	166.0	163.0					X																	153229676		1944	4119	6063	152882870	SO:0001819	synonymous_variant	3054	exon3				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.402G>A	X.37:g.153229676C>T			152882870	NM_005334	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1																																																																																				0.552	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
