#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KCNMA1	3778	broad.mit.edu	37	10	79397264	79397266	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	GAG	GAG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr10:79397264_79397266delGAG	ENST00000286628.8	-	1	134_136	c.135_137delCTC	c.(133-138)tcctct>tct	p.45_46SS>S	KCNMA1_ENST00000372440.1_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000286627.5_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000372443.1_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000404771.3_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000404857.1_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000354353.5_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000480683.1_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000406533.3_In_Frame_Del_p.45_46SS>S|KCNMA1_ENST00000481070.1_In_Frame_Del_p.45_46SS>S	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	45	Poly-Ser.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.S60delS(2)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	agaagaggaagaggaggaggagg	0.621																																					p.45_46del												.	.	2	Deletion - In frame(2)	large_intestine(2)	c.135_137del	10						.																																			79067272	SO:0001651	inframe_deletion	3778	exon1			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.135_137delCTC	10.37:g.79397273_79397275delGAG	ENSP00000286628:p.Ser60del		79067270	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	In_Frame_Del	DEL	ENST00000286628.8	37																																																																																					0.621	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
PPAPDC1A	196051	broad.mit.edu	37	10	122334686	122334686	+	Silent	SNP	C	C	A	rs371267002		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr10:122334686C>A	ENST00000398250.1	+	6	841	c.489C>A	c.(487-489)ggC>ggA	p.G163G	PPAPDC1A_ENST00000541332.1_Silent_p.G163G|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000369073.3_Silent_p.G153G|PPAPDC1A_ENST00000439221.1_Silent_p.G100G	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	163					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)	p.G163G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		ACTTGGCGGGCAAGCTGCACT	0.592																																					p.G163G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C489A	10						.						113.0	115.0	114.0					10																	122334686		2123	4251	6374	122324676	SO:0001819	synonymous_variant	196051	exon6			AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.489C>A	10.37:g.122334686C>A			122324676	NM_001030059	A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Missense_Mutation	SNP	ENST00000398250.1	37	CCDS41573.1																																																																																				0.592	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_113641	
CDON	50937	broad.mit.edu	37	11	125831796	125831796	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr11:125831796G>A	ENST00000392693.3	-	19	3581	c.3454C>T	c.(3454-3456)Ctc>Ttc	p.L1152F	CDON_ENST00000531738.1_Missense_Mutation_p.L529F|CDON_ENST00000263577.7_Missense_Mutation_p.L1152F	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1152					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1152F(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ACGTGACTGAGGGGCTTCATT	0.552																																					p.L1152F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3454T	11						.						92.0	79.0	84.0					11																	125831796		2201	4299	6500	125337006	SO:0001583	missense	50937	exon19			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3454C>T	11.37:g.125831796G>A	ENSP00000376458:p.Leu1152Phe		125337006	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125740	0.56721	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.80304	-1.34;-0.75;-1.36	6.07	4.19	0.49359	.	0.152178	0.30620	N	0.009225	T	0.72851	0.3512	L	0.45137	1.4	0.40590	D	0.98147	P;P;B	0.43431	0.707;0.807;0.215	B;B;B	0.41412	0.194;0.356;0.124	T	0.72191	-0.4365	10	0.54805	T	0.06	-14.7359	7.7566	0.28927	0.1409:0.1344:0.7246:0.0	.	1152;1152;529	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	F	1152;529;1152	ENSP00000376458:L1152F;ENSP00000432901:L529F;ENSP00000263577:L1152F	ENSP00000263577:L1152F	L	-	1	0	CDON	125337006	0.989000	0.36119	0.984000	0.44739	0.903000	0.53119	1.561000	0.36342	0.875000	0.35847	0.655000	0.94253	CTC		0.552	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
LDHA	3939	broad.mit.edu	37	11	18421013	18421013	+	Silent	SNP	C	C	T	rs200075826		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr11:18421013C>T	ENST00000422447.3	+	3	435	c.162C>T	c.(160-162)atC>atT	p.I54I	LDHA_ENST00000227157.4_Silent_p.I54I|LDHA_ENST00000430553.2_Silent_p.I54I|LDHA_ENST00000540430.1_Silent_p.I83I|LDHA_ENST00000379412.5_Silent_p.I54I|LDHA_ENST00000396222.2_Silent_p.I54I|LDHA_ENST00000542179.1_Silent_p.I54I	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	54					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)	p.I83I(1)|p.I54I(1)		central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						TTGATGTCATCGAAGACAAAT	0.378																																					p.I54I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C162T	11						.						140.0	129.0	133.0					11																	18421013		2199	4293	6492	18377589	SO:0001819	synonymous_variant	3939	exon3			X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.162C>T	11.37:g.18421013C>T			18377589	NM_001135239	B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Silent	SNP	ENST00000422447.3	37	CCDS7839.1																																																																																				0.378	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566	
SYT7	9066	broad.mit.edu	37	11	61318907	61318907	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr11:61318907G>A	ENST00000263846.4	-	3	491	c.164C>T	c.(163-165)aCg>aTg	p.T55M	SYT7_ENST00000535826.1_Missense_Mutation_p.T55M|SYT7_ENST00000542836.1_Missense_Mutation_p.T55M|SYT7_ENST00000540677.1_Missense_Mutation_p.T55M|SYT7_ENST00000539008.1_Missense_Mutation_p.T55M|SYT7_ENST00000542670.1_Missense_Mutation_p.T55M	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	55					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.T55M(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGTGCCCACCGTCTCCAAGGA	0.592																																					p.T55M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C164T	11						.						155.0	121.0	132.0					11																	61318907		2202	4299	6501	61075483	SO:0001583	missense	9066	exon3			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.164C>T	11.37:g.61318907G>A	ENSP00000263846:p.Thr55Met		61075483	NM_004200	F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954294	0.73902	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826;ENST00000545053	T;T;T;T;T;T;T	0.63580	0.32;-0.05;0.26;0.13;0.04;0.11;1.54	3.36	3.36	0.38483	.	0.407864	0.23365	N	0.048972	T	0.60104	0.2243	N	0.24115	0.695	0.34723	D	0.728942	D;D	0.62365	0.991;0.985	P;P	0.56343	0.796;0.63	T	0.70890	-0.4749	10	0.48119	T	0.1	.	13.108	0.59257	0.0:0.0:1.0:0.0	.	55;55	F5GZU9;O43581	.;SYT7_HUMAN	M	55	ENSP00000263846:T55M;ENSP00000444201:T55M;ENSP00000439694:T55M;ENSP00000444568:T55M;ENSP00000444019:T55M;ENSP00000437720:T55M;ENSP00000443576:T55M	ENSP00000263846:T55M	T	-	2	0	SYT7	61075483	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	6.838000	0.75359	1.892000	0.54788	0.456000	0.33151	ACG		0.592	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
KDM2A	22992	broad.mit.edu	37	11	67017923	67017923	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr11:67017923A>G	ENST00000529006.2	+	17	2868	c.2422A>G	c.(2422-2424)Aaa>Gaa	p.K808E	KDM2A_ENST00000398645.2_Intron|KDM2A_ENST00000530342.1_Missense_Mutation_p.K369E|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_Missense_Mutation_p.K266E	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	808					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.K808E(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GAGGCCCACCAAAGAGCTCCA	0.582																																					p.K808E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2422G	11						.						65.0	73.0	70.0					11																	67017923		2125	4228	6353	66774499	SO:0001583	missense	22992	exon17			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2422A>G	11.37:g.67017923A>G	ENSP00000432786:p.Lys808Glu		66774499	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.168520	0.78339	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000446134;ENST00000308783	T;T;T	0.33438	1.94;1.41;1.51	5.91	5.91	0.95273	.	0.099289	0.64402	D	0.000001	T	0.42854	0.1221	L	0.36672	1.1	0.58432	D	0.999996	P;P	0.52842	0.956;0.956	P;P	0.62184	0.899;0.899	T	0.13045	-1.0524	9	.	.	.	-13.8639	14.9163	0.70801	1.0:0.0:0.0:0.0	.	266;808	D4QA03;Q9Y2K7	.;KDM2A_HUMAN	E	808;369;369;266	ENSP00000432786:K808E;ENSP00000435776:K369E;ENSP00000309302:K266E	.	K	+	1	0	KDM2A	66774499	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.494000	0.90477	2.261000	0.74972	0.533000	0.62120	AAA		0.582	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
RPUSD4	84881	broad.mit.edu	37	11	126075636	126075636	+	Missense_Mutation	SNP	C	C	T	rs574615517		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr11:126075636C>T	ENST00000298317.4	-	4	651	c.598G>A	c.(598-600)Gtg>Atg	p.V200M	RPUSD4_ENST00000534393.1_5'UTR|RPUSD4_ENST00000533628.1_Missense_Mutation_p.V200M|RP11-50B3.4_ENST00000532866.1_RNA	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	200					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.V200M(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		GGGATGTCCACGACTCCTGCT	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19435	0.0		0.0	False		,,,				2504	0.0				p.V200M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G598A	11						.						63.0	52.0	56.0					11																	126075636		2201	4299	6500	125580846	SO:0001583	missense	84881	exon4			BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.598G>A	11.37:g.126075636C>T	ENSP00000298317:p.Val200Met		125580846	NM_032795	E9PML2|Q96K56	Missense_Mutation	SNP	ENST00000298317.4	37	CCDS8469.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844494	0.71488	.	.	ENSG00000165526	ENST00000298317;ENST00000533628	T;T	0.14516	2.5;2.5	5.89	4.8	0.61643	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.207640	0.42821	D	0.000657	T	0.35248	0.0925	M	0.79475	2.455	0.36133	D	0.846261	D;D	0.63880	0.987;0.993	P;D	0.63793	0.764;0.918	T	0.41610	-0.9499	10	0.87932	D	0	-36.7149	13.1865	0.59684	0.0:0.9139:0.0:0.0861	.	200;200	E9PML2;Q96CM3	.;RUSD4_HUMAN	M	200	ENSP00000298317:V200M;ENSP00000433065:V200M	ENSP00000298317:V200M	V	-	1	0	RPUSD4	125580846	0.986000	0.35501	0.990000	0.47175	0.862000	0.49288	2.480000	0.45206	2.783000	0.95769	0.655000	0.94253	GTG		0.582	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
A2ML1	144568	broad.mit.edu	37	12	9000239	9000239	+	Missense_Mutation	SNP	C	C	T	rs199779757		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:9000239C>T	ENST00000299698.7	+	15	1958	c.1778C>T	c.(1777-1779)gCg>gTg	p.A593V	A2ML1_ENST00000539547.1_Missense_Mutation_p.A102V|A2ML1_ENST00000540049.1_3'UTR	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.A593V(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GCGCTCCGGGCGGTGGATGAG	0.607																																					p.A593V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1778T	12						.						100.0	100.0	100.0					12																	9000239		1949	4142	6091	8891506	SO:0001583	missense	144568	exon15			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1778C>T	12.37:g.9000239C>T	ENSP00000299698:p.Ala593Val		8891506	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098039	0.37048	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547;ENST00000545692	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	3.63	3.63	0.41609	Alpha-2-macroglobulin, N-terminal 2 (1);	0.000000	0.51477	D	0.000090	T	0.54711	0.1875	L	0.50847	1.595	0.38297	D	0.942863	P	0.38129	0.619	B	0.40565	0.333	T	0.57940	-0.7724	10	0.35671	T	0.21	.	8.9371	0.35706	0.0:0.8934:0.0:0.1065	.	593	A8K2U0	A2ML1_HUMAN	V	593;593;143;102;105	ENSP00000299698:A593V;ENSP00000443174:A143V;ENSP00000438292:A102V;ENSP00000440057:A105V	ENSP00000299698:A593V	A	+	2	0	A2ML1	8891506	0.766000	0.28496	0.952000	0.39060	0.726000	0.41606	1.394000	0.34509	2.337000	0.79520	0.637000	0.83480	GCG		0.607	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
TAS2R8	50836	broad.mit.edu	37	12	10959265	10959265	+	Silent	SNP	G	G	T	rs201347044		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:10959265G>T	ENST00000240615.2	-	1	627	c.315C>A	c.(313-315)gtC>gtA	p.V105V		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	105					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.V105V(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GAAAATAGAAGACATTAAGGC	0.388																																					p.V105V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C315A	12						.						86.0	85.0	86.0					12																	10959265		2203	4300	6503	10850532	SO:0001819	synonymous_variant	50836	exon1			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.315C>A	12.37:g.10959265G>T			10850532	NM_023918	Q4KN29|Q645Y2	Silent	SNP	ENST00000240615.2	37	CCDS8632.1																																																																																				0.388	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399932.1		
DHH	50846	broad.mit.edu	37	12	49485013	49485013	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:49485013C>T	ENST00000266991.2	-	2	769	c.463G>A	c.(463-465)Gac>Aac	p.D155N	RP11-386G11.8_ENST00000548030.1_RNA|RP11-386G11.8_ENST00000553174.1_RNA	NM_021044.2	NP_066382.1	O43323	DHH_HUMAN	desert hedgehog	155					cell-cell signaling (GO:0007267)|Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|myelination (GO:0042552)|regulation of steroid biosynthetic process (GO:0050810)|response to estradiol (GO:0032355)|spermatid development (GO:0007286)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.D155N(1)		breast(1)|large_intestine(3)|lung(4)	8						TTGTTGCGGTCGCGGTCAGAC	0.622																																					p.D155N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	12						.						171.0	138.0	150.0					12																	49485013		2203	4300	6503	47771280	SO:0001583	missense	50846	exon2			AB010994	CCDS8779.1	12q13.1	2010-06-24	2010-06-24			ENSG00000139549			2865	protein-coding gene	gene with protein product		605423	"""desert hedgehog (Drosophila) homolog"""			10773676, 10640830	Standard	NM_021044		Approved	HHG-3, MGC35145	uc001rtf.3	O43323	OTTHUMG00000170408	ENST00000266991.2:c.463G>A	12.37:g.49485013C>T	ENSP00000266991:p.Asp155Asn		47771280	NM_021044	Q15794	Missense_Mutation	SNP	ENST00000266991.2	37	CCDS8779.1	.	.	.	.	.	.	.	.	.	.	C	34	5.410848	0.96072	.	.	ENSG00000139549	ENST00000266991	D	0.99656	-6.31	5.27	5.27	0.74061	Hedgehog/DD-peptidase (2);Hedgehog, N-terminal signaling domain (1);	0.050637	0.85682	D	0.000000	D	0.99609	0.9858	M	0.90977	3.165	0.80722	D	1	D	0.65815	0.995	P	0.57679	0.825	D	0.98113	1.0421	10	0.87932	D	0	-1.1167	18.0388	0.89313	0.0:1.0:0.0:0.0	.	155	O43323	DHH_HUMAN	N	155	ENSP00000266991:D155N	ENSP00000266991:D155N	D	-	1	0	DHH	47771280	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.921000	0.63397	2.645000	0.89757	0.650000	0.86243	GAC		0.622	DHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408973.1	NM_021044	
KCNH3	23416	broad.mit.edu	37	12	49943983	49943983	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:49943983G>A	ENST00000257981.6	+	10	2049	c.1789G>A	c.(1789-1791)Gcc>Acc	p.A597T		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	597					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.A597T(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						ACTGTCTCTGGCCCTGCGGCC	0.672																																					p.A597T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1789A	12						.						35.0	35.0	35.0					12																	49943983		2201	4299	6500	48230250	SO:0001583	missense	23416	exon10			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1789G>A	12.37:g.49943983G>A	ENSP00000257981:p.Ala597Thr		48230250	NM_012284	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138613	0.56936	.	.	ENSG00000135519	ENST00000257981	D	0.96830	-4.14	5.48	5.48	0.80851	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.48286	D	0.000195	D	0.91650	0.7361	N	0.14661	0.345	0.34251	D	0.678755	B	0.10296	0.003	B	0.22753	0.041	D	0.90907	0.4773	10	0.62326	D	0.03	.	12.8924	0.58080	0.0:0.1634:0.8365:0.0	.	597	Q9ULD8	KCNH3_HUMAN	T	597	ENSP00000257981:A597T	ENSP00000257981:A597T	A	+	1	0	KCNH3	48230250	0.276000	0.24211	1.000000	0.80357	0.827000	0.46813	0.730000	0.26043	2.755000	0.94549	0.655000	0.94253	GCC		0.672	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
ACVR1B	91	broad.mit.edu	37	12	52374827	52374827	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:52374827G>T	ENST00000257963.4	+	4	732	c.655G>T	c.(655-657)Ggg>Tgg	p.G219W	ACVR1B_ENST00000542485.1_Missense_Mutation_p.G167W|ACVR1B_ENST00000426655.2_Missense_Mutation_p.G219W|ACVR1B_ENST00000541224.1_Missense_Mutation_p.G219W|ACVR1B_ENST00000415850.2_Missense_Mutation_p.G219W	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.G219W(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GGGTCGGTTTGGGGAAGTATG	0.507											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G167W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G499T	12						.						70.0	72.0	71.0					12																	52374827		2203	4300	6503	50661094	SO:0001583	missense	91	exon4				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.655G>T	12.37:g.52374827G>T	ENSP00000257963:p.Gly219Trp	984	50661094	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937186	0.92458	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95191	0.8441	H	0.99874	4.875	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97732	1.0203	10	0.87932	D	0	.	18.9637	0.92687	0.0:0.0:1.0:0.0	.	219;219;219;219	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	W	219;219;219;219;167	ENSP00000257963:G219W;ENSP00000442656:G219W;ENSP00000390477:G219W;ENSP00000397550:G219W;ENSP00000442885:G167W	ENSP00000257963:G219W	G	+	1	0	ACVR1B	50661094	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.563000	0.86464	0.650000	0.86243	GGG		0.507	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
NAV3	89795	broad.mit.edu	37	12	78591117	78591117	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:78591117C>G	ENST00000397909.2	+	35	6555	c.6382C>G	c.(6382-6384)Ctt>Gtt	p.L2128V	NAV3_ENST00000228327.6_Missense_Mutation_p.L2106V|NAV3_ENST00000541270.1_5'Flank|NAV3_ENST00000536525.2_Missense_Mutation_p.L2106V|NAV3_ENST00000266692.7_Missense_Mutation_p.L1929V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2128						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L2106V(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCTTGATAATCTTCATCATGT	0.333										HNSCC(70;0.22)																											p.L2106V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6316G	12						.						127.0	116.0	119.0					12																	78591117		1831	4081	5912	77115248	SO:0001583	missense	89795	exon34			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6382C>G	12.37:g.78591117C>G	ENSP00000381007:p.Leu2128Val		77115248	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.366239|4.366239	0.82463|0.82463	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.87412|.	-2.25;-2.25;-2.25;-2.25;-2.25|.	5.35|5.35	5.35|5.35	0.76521|0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.36167|.	U|.	0.002750|.	T|T	0.65770|0.65770	0.2723|0.2723	L|L	0.37507|0.37507	1.11|1.11	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.996;1.0;0.998|.	D;D;D;D|.	0.91635|.	0.999;0.986;0.999;0.996|.	T|T	0.60505|0.60505	-0.7250|-0.7250	10|5	0.49607|.	T|.	0.09|.	-12.651|-12.651	19.4322|19.4322	0.94775|0.94775	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2106;1929;2128;2106|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|C	2106;2128;2106;1929;720;728|1000	ENSP00000446132:L2106V;ENSP00000381007:L2128V;ENSP00000228327:L2106V;ENSP00000266692:L1929V;ENSP00000448303:L728V|.	ENSP00000228327:L2106V|.	L|S	+|+	1|2	0|0	NAV3|NAV3	77115248|77115248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.776000|7.776000	0.85560|0.85560	2.649000|2.649000	0.89929|0.89929	0.655000|0.655000	0.94253|0.94253	CTT|TCT		0.333	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
SLC6A15	55117	broad.mit.edu	37	12	85266981	85266981	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:85266981A>T	ENST00000266682.5	-	7	1535	c.994T>A	c.(994-996)Ttt>Att	p.F332I	SLC6A15_ENST00000309283.7_Missense_Mutation_p.F40I|SLC6A15_ENST00000551388.1_5'UTR|SLC6A15_ENST00000552192.1_Missense_Mutation_p.F225I	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	332					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.F332I(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						ACAGCATCAAAGTGGCAGTTG	0.443																																					p.F332I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T994A	12						.						171.0	163.0	166.0					12																	85266981		2203	4300	6503	83791112	SO:0001583	missense	55117	exon7			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.994T>A	12.37:g.85266981A>T	ENSP00000266682:p.Phe332Ile		83791112	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	A	32	5.152773	0.94645	.	.	ENSG00000072041	ENST00000309283;ENST00000266682;ENST00000318721;ENST00000552192;ENST00000551818;ENST00000551612	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	5.72	5.72	0.89469	.	0.094625	0.85682	D	0.000000	D	0.82756	0.5106	L	0.52206	1.635	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.979;0.992	T	0.82989	-0.0183	10	0.48119	T	0.1	.	15.9959	0.80243	1.0:0.0:0.0:0.0	.	40;332	F8WJN6;Q9H2J7	.;S6A15_HUMAN	I	40;332;48;225;40;48	ENSP00000311645:F40I;ENSP00000266682:F332I;ENSP00000450145:F225I;ENSP00000449263:F48I	ENSP00000266682:F332I	F	-	1	0	SLC6A15	83791112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.173000	0.68751	0.482000	0.46254	TTT		0.443	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
NTN4	59277	broad.mit.edu	37	12	96131893	96131893	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:96131893G>T	ENST00000343702.4	-	3	1063	c.615C>A	c.(613-615)taC>taA	p.Y205*	NTN4_ENST00000538383.1_Nonsense_Mutation_p.Y168*|NTN4_ENST00000344911.4_Nonsense_Mutation_p.Y168*|NTN4_ENST00000553059.1_Nonsense_Mutation_p.Y205*|NTN4_ENST00000552603.1_5'UTR	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	205	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.		Y -> H (in dbSNP:rs17288108).		axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)		p.Y205*(1)		NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TCTCTGTATCGTATGGTGGTG	0.453																																					p.Y205X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C615A	12						.						152.0	141.0	145.0					12																	96131893		2203	4300	6503	94656024	SO:0001587	stop_gained	59277	exon3			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.615C>A	12.37:g.96131893G>T	ENSP00000340998:p.Tyr205*		94656024	NM_021229	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Nonsense_Mutation	SNP	ENST00000343702.4	37	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389469	0.61956	.	.	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059;ENST00000547980	.	.	.	5.51	-0.594	0.11664	.	0.390669	0.28436	N	0.015352	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8472	0.52391	0.7258:0.0:0.2742:0.0	.	.	.	.	X	205;168;168;205;168	.	ENSP00000340998:Y205X	Y	-	3	2	NTN4	94656024	0.000000	0.05858	0.021000	0.16686	0.690000	0.40134	-0.361000	0.07612	-0.343000	0.08351	0.555000	0.69702	TAC		0.453	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229	
C12orf42	374470	broad.mit.edu	37	12	103700001	103700001	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr12:103700001G>A	ENST00000378113.2	-	5	607	c.382C>T	c.(382-384)Cgt>Tgt	p.R128C	C12orf42_ENST00000548048.1_Missense_Mutation_p.R61C|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000548883.1_Missense_Mutation_p.R128C	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	128								p.R128C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						GGAGAGGAACGGAATTCTTCA	0.468																																					p.R128C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C382T	12						.						82.0	83.0	83.0					12																	103700001		1853	4095	5948	102224131	SO:0001583	missense	374470	exon5			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.382C>T	12.37:g.103700001G>A	ENSP00000367353:p.Arg128Cys		102224131	NM_001099336	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	G	9.071	0.996871	0.19043	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.34	-4.98	0.03019	.	2.752080	0.01310	N	0.010595	T	0.18882	0.0453	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06679	-1.0813	10	0.36615	T	0.2	2.5403	0.9617	0.01397	0.2166:0.215:0.351:0.2173	.	128	Q96LP6	CL042_HUMAN	C	128;61;128;128	ENSP00000447908:R128C;ENSP00000449362:R61C;ENSP00000367353:R128C;ENSP00000447795:R128C	ENSP00000367353:R128C	R	-	1	0	C12orf42	102224131	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.882000	0.04174	-0.785000	0.04522	-0.492000	0.04666	CGT		0.468	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
PCDH9	5101	broad.mit.edu	37	13	67799776	67799776	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr13:67799776G>C	ENST00000377865.2	-	1	2931	c.2797C>G	c.(2797-2799)Cct>Gct	p.P933A	PCDH9_ENST00000456367.1_Missense_Mutation_p.P933A|PCDH9_ENST00000544246.1_Missense_Mutation_p.P933A|PCDH9_ENST00000377861.3_Missense_Mutation_p.P933A|PCDH9_ENST00000328454.5_Missense_Mutation_p.P933A			Q9HC56	PCDH9_HUMAN	protocadherin 9	933					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P933A(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GCCAGGTCAGGACTGTTAGGC	0.498																																					p.P933A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2797G	13						.						140.0	138.0	139.0					13																	67799776		2203	4300	6503	66697777	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2797C>G	13.37:g.67799776G>C	ENSP00000367096:p.Pro933Ala		66697777	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202376	0.58234	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	5.73	5.73	0.89815	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.62723	1.935	0.80722	D	1	P;P;P;P	0.49447	0.924;0.722;0.907;0.924	P;P;P;P	0.60415	0.791;0.498;0.686;0.874	T	0.74127	-0.3765	10	0.72032	D	0.01	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	933;933;933;933	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	A	933	ENSP00000442186:P933A;ENSP00000367096:P933A;ENSP00000401699:P933A;ENSP00000332060:P933A;ENSP00000367092:P933A	ENSP00000332060:P933A	P	-	1	0	PCDH9	66697777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.709000	0.92574	0.655000	0.94253	CCT		0.498	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
CDC42BPB	9578	broad.mit.edu	37	14	103478476	103478476	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr14:103478476G>T	ENST00000361246.2	-	2	513	c.225C>A	c.(223-225)gaC>gaA	p.D75E		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)									p.D75E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTATTTCAAAGTCTTCTCGAT	0.338																																					p.D75E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C225A	14						.						110.0	105.0	106.0					14																	103478476		2203	4299	6502	102548229	SO:0001583	missense	9578	exon2			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.225C>A	14.37:g.103478476G>T	ENSP00000355237:p.Asp75Glu		102548229	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449910	0.84101	.	.	ENSG00000198752	ENST00000361246	T	0.40756	1.02	5.5	4.61	0.57282	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68906	0.3052	M	0.91300	3.195	0.80722	D	1	D	0.61697	0.99	D	0.65874	0.939	T	0.76597	-0.2901	10	0.87932	D	0	.	12.9023	0.58133	0.0792:0.0:0.9208:0.0	.	75	Q9Y5S2	MRCKB_HUMAN	E	75	ENSP00000355237:D75E	ENSP00000355237:D75E	D	-	3	2	CDC42BPB	102548229	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.325000	0.59234	1.318000	0.45170	0.655000	0.94253	GAC		0.338	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
CASC5	57082	broad.mit.edu	37	15	40944216	40944216	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr15:40944216G>A	ENST00000346991.5	+	22	6796	c.6406G>A	c.(6406-6408)Gat>Aat	p.D2136N	CASC5_ENST00000399668.2_Missense_Mutation_p.D2110N			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	2136	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D2136N(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GTCTGAGTGGGATGTCGTTGA	0.378																																					p.D2136N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6406A	15						.						116.0	101.0	106.0					15																	40944216		1879	4113	5992	38731508	SO:0001583	missense	57082	exon22			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.6406G>A	15.37:g.40944216G>A	ENSP00000335463:p.Asp2136Asn		38731508	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475155	0.84640	.	.	ENSG00000137812	ENST00000346991;ENST00000399668	T;T	0.05580	3.42;3.42	5.1	5.1	0.69264	.	0.343135	0.29480	N	0.012023	T	0.11750	0.0286	L	0.34521	1.04	0.30914	N	0.728737	P;P	0.51351	0.944;0.944	P;P	0.52957	0.714;0.714	T	0.00577	-1.1662	10	0.56958	D	0.05	.	15.7894	0.78343	0.0:0.0:1.0:0.0	.	2110;2136	Q8NG31-2;Q8NG31	.;CASC5_HUMAN	N	2136;2110	ENSP00000335463:D2136N;ENSP00000382576:D2110N	ENSP00000335463:D2136N	D	+	1	0	CASC5	38731508	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.895000	0.56258	2.523000	0.85059	0.655000	0.94253	GAT		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
SMAD3	4088	broad.mit.edu	37	15	67473723	67473723	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr15:67473723G>A	ENST00000327367.4	+	6	1113	c.803G>A	c.(802-804)cGc>cAc	p.R268H	SMAD3_ENST00000439724.3_Missense_Mutation_p.R224H|SMAD3_ENST00000537194.2_Missense_Mutation_p.R73H|SMAD3_ENST00000540846.2_Missense_Mutation_p.R163H	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	268	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R268H(2)|p.R224H(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		AATTCGGAGCGCTTCTGCCTA	0.607																																					p.R224H												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G671A	15						.						64.0	61.0	62.0					15																	67473723		2201	4299	6500	65260777	SO:0001583	missense	4088	exon6			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.803G>A	15.37:g.67473723G>A	ENSP00000332973:p.Arg268His		65260777	NM_001145103	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	G	35	5.513463	0.96402	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.98120	-4.73;-4.73;-4.73;-4.73	5.1	5.1	0.69264	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99096	0.9689	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99406	1.0929	10	0.87932	D	0	.	18.8753	0.92332	0.0:0.0:1.0:0.0	.	224;268	B7Z4Z5;P84022	.;SMAD3_HUMAN	H	268;268;163;224;73	ENSP00000332973:R268H;ENSP00000437757:R163H;ENSP00000401133:R224H;ENSP00000445348:R73H	ENSP00000332973:R268H	R	+	2	0	SMAD3	65260777	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.682000	0.98655	2.515000	0.84797	0.555000	0.69702	CGC		0.607	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
TEKT5	146279	broad.mit.edu	37	16	10788482	10788482	+	Silent	SNP	G	G	A	rs370028779	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr16:10788482G>A	ENST00000283025.2	-	1	320	c.249C>T	c.(247-249)tcC>tcT	p.S83S	RP11-109M19.1_ENST00000576710.1_RNA	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	83						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.S83S(2)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						AGAAGAGTGCGGAGCGCAGTG	0.677													T|||	2	0.000399361	0.0	0.0	5008	,	,		18259	0.0		0.0	False		,,,				2504	0.002				p.S83S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.C249T	16						.	T		0,4394		0,0,2197	80.0	93.0	89.0		249	-10.6	0.0	16		89	1,8599		0,1,4299	no	coding-synonymous	TEKT5	NM_144674.1		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		83/486	10788482	1,12993	2197	4300	6497	10695983	SO:0001819	synonymous_variant	146279	exon1				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.249C>T	16.37:g.10788482G>A			10695983	NM_144674	A1L3Z3	Silent	SNP	ENST00000283025.2	37	CCDS10542.1																																																																																				0.677	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674	
SPNS1	83985	broad.mit.edu	37	16	28990559	28990559	+	Silent	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr16:28990559C>T	ENST00000311008.11	+	4	905	c.528C>T	c.(526-528)gcC>gcT	p.A176A	RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000323081.8_Silent_p.A103A|SPNS1_ENST00000565975.1_Silent_p.A221A|SPNS1_ENST00000561868.1_3'UTR|SPNS1_ENST00000334536.8_Silent_p.A176A|RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000352260.7_Silent_p.A154A	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	176					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)		p.A176A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						CTCTCATTGCCGACCTCTTTG	0.652																																					p.A154A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C462T	16						.						67.0	69.0	68.0					16																	28990559		2197	4300	6497	28898060	SO:0001819	synonymous_variant	83985	exon3			BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.528C>T	16.37:g.28990559C>T			28898060	NM_001142449	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Silent	SNP	ENST00000311008.11	37	CCDS10646.1																																																																																				0.652	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
PLEKHG4	25894	broad.mit.edu	37	16	67322413	67322413	+	Missense_Mutation	SNP	C	C	T	rs145498856	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr16:67322413C>T	ENST00000360461.5	+	20	6011	c.3476C>T	c.(3475-3477)tCg>tTg	p.S1159L	PLEKHG4_ENST00000379344.3_Missense_Mutation_p.S1159L|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.S1159L|PLEKHG4_ENST00000450733.1_Missense_Mutation_p.S1078L	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	1159							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1159L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		TCAGAGATCTCGTCCCAATGC	0.632													C|||	4	0.000798722	0.0	0.0	5008	,	,		18740	0.001		0.003	False		,,,				2504	0.0				p.S1159L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3476T	16						.	C	LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER	1,4395	2.1+/-5.4	0,1,2197	119.0	119.0	119.0		3476,3476,3476,3233,3476	5.1	0.9	16	dbSNP_134	119	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense,missense,missense,missense	PLEKHG4	NM_001129727.1,NM_001129728.1,NM_001129729.1,NM_001129731.1,NM_015432.3	145,145,145,145,145	0,7,6491	TT,TC,CC		0.0698,0.0227,0.0539	benign,benign,benign,benign,benign	1159/1192,1159/1192,1159/1192,1078/1111,1159/1192	67322413	7,12989	2198	4300	6498	65879914	SO:0001583	missense	25894	exon22			AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.3476C>T	16.37:g.67322413C>T	ENSP00000353646:p.Ser1159Leu		65879914	NM_001129727	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	37	CCDS32466.1	4	0.0018315018315018315	0	0.0	0	0.0	1	0.0017482517482517483	3	0.00395778364116095	C	17.27	3.346276	0.61073	2.27E-4	6.98E-4	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	5.12	5.12	0.69794	.	.	.	.	.	T	0.27866	0.0686	L	0.35723	1.085	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.01692	-1.1294	9	0.24483	T	0.36	.	17.536	0.87832	0.0:1.0:0.0:0.0	.	1078;1159	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	L	1159;1159;1159;1078	ENSP00000353646:S1159L;ENSP00000401118:S1159L;ENSP00000368649:S1159L;ENSP00000398030:S1078L	ENSP00000353646:S1159L	S	+	2	0	PLEKHG4	65879914	0.995000	0.38212	0.889000	0.34880	0.486000	0.33341	3.433000	0.52834	2.360000	0.80028	0.462000	0.41574	TCG		0.632	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
DHX38	9785	broad.mit.edu	37	16	72139929	72139929	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr16:72139929A>G	ENST00000268482.3	+	19	3022	c.2513A>G	c.(2512-2514)gAt>gGt	p.D838G	DHX38_ENST00000536867.1_Missense_Mutation_p.D150G	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	838	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.D838G(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				ATTGGCATGGATGCTCTGCAG	0.587																																					p.D838G	Melanoma(97;711 1442 7855 13832 28836)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2513G	16						.						91.0	82.0	85.0					16																	72139929		2198	4300	6498	70697430	SO:0001583	missense	9785	exon19			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2513A>G	16.37:g.72139929A>G	ENSP00000268482:p.Asp838Gly		70697430	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	37	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.025013	0.93518	.	.	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.02682	4.2;4.2	5.95	5.95	0.96441	Helicase, C-terminal (3);	0.114078	0.64402	D	0.000019	T	0.19327	0.0464	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.83275	0.954;0.996	T	0.00408	-1.1758	10	0.87932	D	0	.	16.078	0.80980	1.0:0.0:0.0:0.0	.	150;838	B4DVG8;Q92620	.;PRP16_HUMAN	G	838;150	ENSP00000268482:D838G;ENSP00000437898:D150G	ENSP00000268482:D838G	D	+	2	0	DHX38	70697430	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.895000	0.92512	2.277000	0.76020	0.533000	0.62120	GAT		0.587	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
GINS2	51659	broad.mit.edu	37	16	85711861	85711861	+	Missense_Mutation	SNP	G	G	A	rs192318511		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr16:85711861G>A	ENST00000253462.3	-	5	615	c.515C>T	c.(514-516)aCg>aTg	p.T172M		NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	172					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)		p.T172M(1)		endometrium(2)|large_intestine(2)|lung(2)	6						CTGGAGGTTCGTGCGGAGTTT	0.532																																					p.T172M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C515T	16						.						100.0	95.0	97.0					16																	85711861		2198	4300	6498	84269362	SO:0001583	missense	51659	exon5			BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.515C>T	16.37:g.85711861G>A	ENSP00000253462:p.Thr172Met		84269362	NM_016095	D3DUM5|Q6IAG9	Missense_Mutation	SNP	ENST00000253462.3	37	CCDS10953.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	16.49	3.137832	0.56936	.	.	ENSG00000131153	ENST00000253462	.	.	.	5.18	5.18	0.71444	.	0.053956	0.85682	D	0.000000	T	0.44767	0.1309	N	0.24115	0.695	0.54753	D	0.999981	B	0.29612	0.251	B	0.15484	0.013	T	0.40478	-0.9561	9	0.46703	T	0.11	-14.4434	18.6696	0.91506	0.0:0.0:1.0:0.0	.	172	Q9Y248	PSF2_HUMAN	M	172	.	ENSP00000253462:T172M	T	-	2	0	GINS2	84269362	1.000000	0.71417	0.932000	0.37286	0.567000	0.35839	9.114000	0.94329	2.575000	0.86900	0.655000	0.94253	ACG		0.532	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269098.1	NM_016095	
SOX9	6662	broad.mit.edu	37	17	70120131	70120132	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr17:70120131_70120132insGG	ENST00000245479.2	+	3	1505_1506	c.1133_1134insGG	c.(1132-1137)caggcgfs	p.A379fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	379					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A379fs*5(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			cagcagccacaggcgcACACGC	0.767																																					p.Q378fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1133_1134insGG	17						.																																			67631727	SO:0001589	frameshift_variant	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1134_1135dupGG	17.37:g.70120132_70120133dupGG	ENSP00000245479:p.Ala379fs		67631726	NM_000346	Q53Y80	Frame_Shift_Ins	INS	ENST00000245479.2	37	CCDS11689.1																																																																																				0.767	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
ALDOC	230	broad.mit.edu	37	17	26901737	26901737	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr17:26901737G>A	ENST00000226253.4	-	5	992	c.517C>T	c.(517-519)Cgt>Tgt	p.R173C	ALDOC_ENST00000395321.2_Missense_Mutation_p.R173C|RP11-192H23.5_ENST00000585189.1_RNA|ALDOC_ENST00000395319.3_Missense_Mutation_p.R173C|PIGS_ENST00000308360.7_5'Flank	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	173					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)	p.R173C(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					CTGGCATAACGGGCCAGCACG	0.557											OREG0024278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	17						.						97.0	80.0	86.0					17																	26901737		2203	4300	6503	23925864	SO:0001583	missense	230	exon5			AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.517C>T	17.37:g.26901737G>A	ENSP00000226253:p.Arg173Cys	790	23925864	NM_005165	B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	ENST00000226253.4	37	CCDS11236.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623742	0.87460	.	.	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321	D;D;D	0.89050	-2.46;-2.46;-2.46	5.5	5.5	0.81552	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.95271	0.8466	M	0.87097	2.86	0.80722	D	1	P;D	0.89917	0.757;1.0	B;D	0.76575	0.192;0.988	D	0.95517	0.8591	10	0.72032	D	0.01	.	18.5367	0.91013	0.0:0.0:1.0:0.0	.	173;173	A8MVZ9;P09972	.;ALDOC_HUMAN	C	173	ENSP00000378729:R173C;ENSP00000226253:R173C;ENSP00000378731:R173C	ENSP00000226253:R173C	R	-	1	0	ALDOC	23925864	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.022000	0.88759	2.741000	0.93983	0.650000	0.86243	CGT		0.557	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255839.4		
EFCAB13	124989	broad.mit.edu	37	17	45412686	45412686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr17:45412686C>T	ENST00000331493.2	+	5	566	c.155C>T	c.(154-156)cCg>cTg	p.P52L	EFCAB13_ENST00000520802.1_Intron|ITGB3_ENST00000560629.1_3'UTR|EFCAB13_ENST00000517484.1_Missense_Mutation_p.P52L|ITGB3_ENST00000435993.2_3'UTR	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	52						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.P52L(1)									GAAATTTCACCGGAAATTAGG	0.303																																					p.P52L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C155T	17						.						55.0	57.0	56.0					17																	45412686		2202	4298	6500	42767685	SO:0001583	missense	124989	exon5			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.155C>T	17.37:g.45412686C>T	ENSP00000332111:p.Pro52Leu		42767685	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179026	0.38511	.	.	ENSG00000178852	ENST00000331493;ENST00000519772;ENST00000517484;ENST00000344176	T;T	0.75367	-0.26;-0.93	2.77	0.7	0.18099	.	1.160920	0.06802	N	0.788920	T	0.78181	0.4243	L	0.54323	1.7	0.09310	N	0.999998	D;D;D	0.76494	0.997;0.999;0.991	P;P;P	0.61477	0.623;0.889;0.485	T	0.61496	-0.7051	9	.	.	.	0.0609	3.4404	0.07461	0.2714:0.5877:0.0:0.1409	.	52;52;52	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	L	52	ENSP00000332111:P52L;ENSP00000430048:P52L	.	P	+	2	0	C17orf57	42767685	0.992000	0.36948	0.131000	0.22000	0.034000	0.12701	0.888000	0.28268	0.216000	0.20781	-0.127000	0.14921	CCG		0.303	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
ENPP7	339221	broad.mit.edu	37	17	77709136	77709136	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr17:77709136C>T	ENST00000328313.5	+	3	915	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.R232C(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GAGCATCGCGCGCAACCACCT	0.647																																					p.R232C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C694T	17						.						82.0	72.0	75.0					17																	77709136		2203	4300	6503	75323731	SO:0001583	missense	339221	exon3			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.694C>T	17.37:g.77709136C>T	ENSP00000332656:p.Arg232Cys		75323731	NM_178543		Missense_Mutation	SNP	ENST00000328313.5	37	CCDS11763.1	.	.	.	.	.	.	.	.	.	.	C	7.981	0.751239	0.15778	.	.	ENSG00000182156	ENST00000328313	T	0.73047	-0.71	5.14	-4.17	0.03857	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	2.196060	0.01468	N	0.016175	T	0.70237	0.3201	M	0.75615	2.305	0.09310	N	1	B	0.20052	0.041	B	0.21546	0.035	T	0.60969	-0.7157	10	0.62326	D	0.03	-5.1267	9.5996	0.39596	0.538:0.1534:0.3086:0.0	.	232	Q6UWV6	ENPP7_HUMAN	C	232	ENSP00000332656:R232C	ENSP00000332656:R232C	R	+	1	0	ENPP7	75323731	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.109000	0.10840	-0.411000	0.07530	-0.181000	0.13052	CGC		0.647	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
COLEC12	81035	broad.mit.edu	37	18	346562	346562	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr18:346562C>A	ENST00000400256.3	-	5	1267	c.1060G>T	c.(1060-1062)Gcc>Tcc	p.A354S		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	354					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.A354S(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				AGGTGGTGGGCTGTGTAACTG	0.458																																					p.A354S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1060T	18						.						187.0	152.0	164.0					18																	346562		2203	4300	6503	336562	SO:0001583	missense	81035	exon5			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1060G>T	18.37:g.346562C>A	ENSP00000383115:p.Ala354Ser		336562	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	37	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	C	6.826	0.521525	0.13005	.	.	ENSG00000158270	ENST00000400256	T	0.77620	-1.11	5.86	4.98	0.66077	.	0.045982	0.85682	D	0.000000	T	0.60792	0.2296	L	0.27053	0.805	0.40753	D	0.982931	P	0.39665	0.682	B	0.27380	0.079	T	0.62238	-0.6896	10	0.10111	T	0.7	-20.7948	17.0223	0.86437	0.0:0.8727:0.1273:0.0	.	354	Q5KU26	COL12_HUMAN	S	354	ENSP00000383115:A354S	ENSP00000383115:A354S	A	-	1	0	COLEC12	336562	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	3.727000	0.54984	1.467000	0.48044	-0.176000	0.13171	GCC		0.458	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
ZNF24	7572	broad.mit.edu	37	18	32917197	32917197	+	Nonstop_Mutation	SNP	T	T	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr18:32917197T>A	ENST00000261332.6	-	4	1285	c.1106A>T	c.(1105-1107)tAa>tTa	p.*369L	ZNF24_ENST00000589881.1_3'UTR|ZNF24_ENST00000399061.3_Nonstop_Mutation_p.*369L	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	0					myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.*369L(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						TTCAATTTCTTAAACTTTCAC	0.308																																					p.X369L	Colon(42;769 913 8916 19469 46270)											.	.	1	Nonstop extension(1)	large_intestine(1)	c.A1106T	18						.						46.0	49.0	48.0					18																	32917197		2198	4296	6494	31171195	SO:0001578	stop_lost	7572	exon4			AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.1106A>T	18.37:g.32917197T>A			31171195	NM_006965	O14754|Q53YE4|Q6ICR5|Q8IZN4	Nonstop_Mutation	SNP	ENST00000261332.6	37	CCDS11912.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.777263	0.31411	.	.	ENSG00000172466	ENST00000261332;ENST00000399061	.	.	.	4.48	3.29	0.37713	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0907	0.25282	0.0:0.1016:0.0:0.8984	.	.	.	.	L	369	.	.	X	-	2	2	ZNF24	31171195	.	.	0.991000	0.47740	0.632000	0.37999	.	.	1.017000	0.39495	0.533000	0.62120	TAA		0.308	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255769.1	NM_006965	
MAST1	22983	broad.mit.edu	37	19	12981912	12981912	+	Silent	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:12981912C>T	ENST00000251472.4	+	24	3228	c.3189C>T	c.(3187-3189)ccC>ccT	p.P1063P	AC020934.1_ENST00000578125.1_RNA	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.P1063P(2)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GCATTGGTCCCGCAAGGCGCA	0.582																																					p.P1063P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3189T	19						.						82.0	82.0	82.0					19																	12981912		2203	4300	6503	12842912	SO:0001819	synonymous_variant	22983	exon24			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.3189C>T	19.37:g.12981912C>T			12842912	NM_014975		Silent	SNP	ENST00000251472.4	37	CCDS32921.1																																																																																				0.582	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
NWD1	284434	broad.mit.edu	37	19	16860310	16860310	+	Missense_Mutation	SNP	C	C	T	rs375674809		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:16860310C>T	ENST00000552788.1	+	4	857	c.857C>T	c.(856-858)aCg>aTg	p.T286M	NWD1_ENST00000524140.2_Missense_Mutation_p.T286M|NWD1_ENST00000549814.1_Missense_Mutation_p.T286M|NWD1_ENST00000523826.1_Missense_Mutation_p.T80M|NWD1_ENST00000339803.6_Missense_Mutation_p.T151M|NWD1_ENST00000379808.3_Missense_Mutation_p.T286M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	286							ATP binding (GO:0005524)	p.T286M(1)|p.T151M(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GAGCTGGATACGGCCGGACAG	0.602																																					p.T286M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C857T	19						.	C	MET/THR	1,4405		0,1,2202	46.0	44.0	44.0		857	-6.4	0.0	19		44	0,8600		0,0,4300	no	missense	NWD1	NM_001007525.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	286/1433	16860310	1,13005	2203	4300	6503	16721310	SO:0001583	missense	284434	exon6			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.857C>T	19.37:g.16860310C>T	ENSP00000447224:p.Thr286Met		16721310	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	N	3.248	-0.153894	0.06585	2.27E-4	0.0	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.59083	0.29;0.35;0.29;0.33;0.35;0.38	4.36	-6.42	0.01932	.	1.185900	0.06235	N	0.689408	T	0.22936	0.0554	N	0.08118	0	0.09310	N	1	P;P;P	0.47677	0.53;0.899;0.838	B;B;B	0.31191	0.04;0.125;0.058	T	0.34950	-0.9808	10	0.48119	T	0.1	-0.2759	3.4066	0.07343	0.1681:0.5667:0.1248:0.1405	.	286;286;151	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	151;286;286;286;80;286;151	ENSP00000428579:T286M;ENSP00000447548:T286M;ENSP00000369136:T286M;ENSP00000428955:T80M;ENSP00000447224:T286M;ENSP00000340159:T151M	ENSP00000340159:T151M	T	+	2	0	NWD1	16721310	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.733000	0.04898	-0.571000	0.06014	-1.126000	0.01995	ACG		0.602	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
ZNF536	9745	broad.mit.edu	37	19	30935837	30935837	+	Silent	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:30935837C>T	ENST00000355537.3	+	2	1515	c.1368C>T	c.(1366-1368)ggC>ggT	p.G456G		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	456					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G456G(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ATGGCAAGGGCGAGCTGCCCA	0.647																																					p.G456G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1368T	19						.						28.0	30.0	29.0					19																	30935837		2199	4298	6497	35627677	SO:0001819	synonymous_variant	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1368C>T	19.37:g.30935837C>T			35627677	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																				0.647	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
KMT2B	9757	broad.mit.edu	37	19	36210698	36210698	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:36210698G>A	ENST00000222270.7	+	3	449	c.449G>A	c.(448-450)cGa>cAa	p.R150Q	KMT2B_ENST00000341701.1_Missense_Mutation_p.R150Q|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.R150Q	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	150					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R150Q(1)									CGAGCGCCCCGAGGTCGGGGT	0.617																																					p.R150Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G449A	19						.						71.0	77.0	75.0					19																	36210698		1912	4119	6031	40902538	SO:0001583	missense	9757	exon3			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.449G>A	19.37:g.36210698G>A	ENSP00000222270:p.Arg150Gln		40902538	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239624	0.79800	.	.	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.90444	-2.67;-2.67;0.05	5.06	5.06	0.68205	AT hook, DNA-binding motif (1);	0.000000	0.34676	N	0.003777	D	0.89825	0.6827	N	0.14661	0.345	0.31964	N	0.608004	D	0.69078	0.997	D	0.70227	0.968	D	0.89250	0.3590	10	0.40728	T	0.16	.	13.7987	0.63186	0.0:0.0:1.0:0.0	.	150	Q9UMN6	MLL4_HUMAN	Q	150	ENSP00000222270:R150Q;ENSP00000398837:R150Q;ENSP00000345761:R150Q	ENSP00000222270:R150Q	R	+	2	0	AD000671.1	40902538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.072000	0.50049	2.632000	0.89209	0.561000	0.74099	CGA		0.617	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
KIRREL2	84063	broad.mit.edu	37	19	36357117	36357117	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:36357117A>G	ENST00000360202.5	+	15	2048	c.1850A>G	c.(1849-1851)gAa>gGa	p.E617G	KIRREL2_ENST00000262625.7_Intron|APLP1_ENST00000221891.4_5'Flank|KIRREL2_ENST00000592409.1_Missense_Mutation_p.E582G|KIRREL2_ENST00000347900.6_Intron|APLP1_ENST00000537454.2_5'Flank|NPHS1_ENST00000591817.1_Intron	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	617					cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)		p.E617G(1)		breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCCTTGGCGAAGCCCCTGGA	0.607																																					p.E617G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1850G	19						.						82.0	80.0	80.0					19																	36357117		2203	4300	6503	41048957	SO:0001583	missense	84063	exon15			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1850A>G	19.37:g.36357117A>G	ENSP00000353331:p.Glu617Gly		41048957	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.689522	0.48097	.	.	ENSG00000126259	ENST00000360202;ENST00000341658;ENST00000270294	T	0.69561	-0.41	5.1	4.01	0.46588	.	0.292675	0.24539	N	0.037645	T	0.44498	0.1296	N	0.14661	0.345	0.80722	D	1	B;P;B	0.35272	0.361;0.493;0.361	B;B;B	0.34242	0.086;0.178;0.039	T	0.35450	-0.9788	9	.	.	.	-4.4252	8.2909	0.31956	0.7992:0.2008:0.0:0.0	.	617;597;617	F1T0I2;Q6UWL6-4;Q6UWL6	.;.;KIRR2_HUMAN	G	617;597;128	ENSP00000353331:E617G	.	E	+	2	0	KIRREL2	41048957	0.995000	0.38212	0.999000	0.59377	0.990000	0.78478	2.157000	0.42320	1.920000	0.55613	0.459000	0.35465	GAA		0.607	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
APLP1	333	broad.mit.edu	37	19	36365713	36365713	+	Missense_Mutation	SNP	G	G	A	rs568306221		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:36365713G>A	ENST00000221891.4	+	10	1478	c.1286G>A	c.(1285-1287)cGc>cAc	p.R429H	APLP1_ENST00000586861.1_Missense_Mutation_p.R423H|APLP1_ENST00000589298.2_3'UTR|APLP1_ENST00000537454.2_Missense_Mutation_p.R390H	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	429	Heparin-binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.R429H(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CACACGCTGCGCCACTACCAG	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16272	0.0		0.0	False		,,,				2504	0.0				p.R429H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1286A	19						.						59.0	48.0	52.0					19																	36365713		2203	4300	6503	41057553	SO:0001583	missense	333	exon10			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1286G>A	19.37:g.36365713G>A	ENSP00000221891:p.Arg429His		41057553	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962492	0.74016	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	T;T	0.49139	0.79;0.79	4.72	4.72	0.59763	Amyloidogenic glycoprotein, E2 domain (2);	0.290209	0.24251	N	0.040180	T	0.62134	0.2403	L	0.52759	1.655	0.29116	N	0.880522	D;P;D;D	0.89917	0.998;0.854;1.0;1.0	P;B;D;D	0.71414	0.842;0.236;0.954;0.973	T	0.60141	-0.7321	10	0.56958	D	0.05	-9.3952	15.1758	0.72910	0.0:0.0:1.0:0.0	.	423;390;429;429	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	H	390;429	ENSP00000441501:R390H;ENSP00000221891:R429H	ENSP00000221891:R429H	R	+	2	0	APLP1	41057553	1.000000	0.71417	0.091000	0.20842	0.899000	0.52679	6.989000	0.76219	2.171000	0.68590	0.555000	0.69702	CGC		0.642	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF221	7638	broad.mit.edu	37	19	44471500	44471500	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:44471500G>A	ENST00000251269.5	+	6	2174	c.1846G>A	c.(1846-1848)Gcc>Acc	p.A616T	ZNF221_ENST00000587682.1_Missense_Mutation_p.A616T|ZNF221_ENST00000592350.1_Missense_Mutation_p.A616T	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A616T(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TGGGAGAAAAGCCATATAAAT	0.428																																					p.A616T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1846A	19						.						52.0	54.0	53.0					19																	44471500		2201	4298	6499	49163340	SO:0001583	missense	7638	exon6			AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1846G>A	19.37:g.44471500G>A	ENSP00000251269:p.Ala616Thr		49163340	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	N	15.12	2.739844	0.49045	.	.	ENSG00000159905	ENST00000251269	T	0.05925	3.37	2.65	-5.31	0.02730	.	.	.	.	.	T	0.03220	0.0094	N	0.08118	0	0.23926	N	0.996443	P	0.47762	0.9	B	0.40940	0.344	T	0.37056	-0.9722	9	0.51188	T	0.08	.	10.641	0.45592	0.7148:0.0:0.2852:0.0	.	616	Q9UK13	ZN221_HUMAN	T	616	ENSP00000251269:A616T	ENSP00000251269:A616T	A	+	1	0	ZNF221	49163340	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.067000	0.01383	-1.305000	0.02327	-0.355000	0.07637	GCC		0.428	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
ZC3H4	23211	broad.mit.edu	37	19	47597686	47597686	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:47597686T>C	ENST00000253048.5	-	3	378	c.341A>G	c.(340-342)gAg>gGg	p.E114G	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	114							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E114G(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		CCTCCTTTTCTCTTTCTCCCG	0.547																																					p.E114G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A341G	19						.						328.0	343.0	338.0					19																	47597686		1949	4126	6075	52289526	SO:0001583	missense	23211	exon3			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.341A>G	19.37:g.47597686T>C	ENSP00000253048:p.Glu114Gly		52289526	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.278268	0.80692	.	.	ENSG00000130749	ENST00000253048	T	0.26957	1.7	6.05	6.05	0.98169	.	0.225342	0.38959	N	0.001513	T	0.33962	0.0881	M	0.67397	2.05	0.58432	D	0.999997	P	0.45396	0.857	B	0.42827	0.399	T	0.16424	-1.0403	10	0.72032	D	0.01	.	15.5818	0.76448	0.0:0.0:0.0:1.0	.	114	Q9UPT8	ZC3H4_HUMAN	G	114	ENSP00000253048:E114G	ENSP00000253048:E114G	E	-	2	0	ZC3H4	52289526	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.755000	0.68750	2.311000	0.77944	0.528000	0.53228	GAG		0.547	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
NUCB1	4924	broad.mit.edu	37	19	49422362	49422362	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:49422362G>T	ENST00000405315.4	+	9	1226	c.892G>T	c.(892-894)Gag>Tag	p.E298*	NUCB1_ENST00000407032.1_Nonsense_Mutation_p.E298*|NUCB1_ENST00000485798.1_Intron|NUCB1_ENST00000263273.5_Nonsense_Mutation_p.E298*|NUCB1-AS1_ENST00000416432.1_RNA	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	298	Binds to GNAI2 and GNAI3. {ECO:0000250}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.E298*(1)		cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GCGCATGCGGGAGCATGTGAT	0.617																																					p.E298X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G892T	19						.						47.0	51.0	50.0					19																	49422362		2203	4300	6503	54114174	SO:0001587	stop_gained	4924	exon9			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.892G>T	19.37:g.49422362G>T	ENSP00000385923:p.Glu298*		54114174	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Nonsense_Mutation	SNP	ENST00000405315.4	37	CCDS12740.1	.	.	.	.	.	.	.	.	.	.	G	38	6.758294	0.97817	.	.	ENSG00000104805	ENST00000405315;ENST00000407032;ENST00000263273	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	16.1855	0.81948	0.0:0.0:1.0:0.0	.	.	.	.	X	298	.	ENSP00000263273:E298X	E	+	1	0	NUCB1	54114174	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.353000	0.79414	2.514000	0.84764	0.591000	0.81541	GAG		0.617	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
SLC6A16	28968	broad.mit.edu	37	19	49814442	49814442	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:49814442G>A	ENST00000335875.4	-	2	404	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W	SLC6A16_ENST00000454748.3_Missense_Mutation_p.R55W|MIR4324_ENST00000584846.1_RNA	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	55					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.R55W(3)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		TCTGCAACCCGGGCTGCTGAA	0.542																																					p.R55W												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C163T	19						.						52.0	52.0	52.0					19																	49814442		1949	4136	6085	54506254	SO:0001583	missense	28968	exon2			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.163C>T	19.37:g.49814442G>A	ENSP00000338627:p.Arg55Trp		54506254	NM_014037	Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768601	0.49680	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.75154	-0.91;-0.88	4.16	3.13	0.36017	.	18.898000	0.00166	N	0.000000	T	0.64972	0.2647	L	0.29908	0.895	0.09310	N	1	B;B	0.30741	0.293;0.293	B;B	0.21708	0.036;0.036	T	0.56751	-0.7927	10	0.72032	D	0.01	.	7.7893	0.29110	0.1122:0.0:0.8878:0.0	.	55;55	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	W	55	ENSP00000338627:R55W;ENSP00000404022:R55W	ENSP00000338627:R55W	R	-	1	2	SLC6A16	54506254	0.007000	0.16637	0.005000	0.12908	0.005000	0.04900	1.203000	0.32284	1.355000	0.45865	0.585000	0.79938	CGG		0.542	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037	
SIGLEC8	27181	broad.mit.edu	37	19	51957994	51957994	+	Silent	SNP	G	G	A	rs373773537		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:51957994G>A	ENST00000321424.3	-	5	1158	c.1092C>T	c.(1090-1092)gtC>gtT	p.V364V	SIGLEC8_ENST00000430817.1_Silent_p.V255V|SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000340550.5_Silent_p.V271V	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	364					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.V364V(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGCTCCCCCGACTGCTGCCA	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18575	0.0		0.0	False		,,,				2504	0.0				p.V364V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1092T	19						.	G		2,4404		0,2,2201	121.0	109.0	113.0		1092	-4.6	0.0	19		113	0,8600		0,0,4300	no	coding-synonymous	SIGLEC8	NM_014442.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		364/500	51957994	2,13004	2203	4300	6503	56649806	SO:0001819	synonymous_variant	27181	exon5			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1092C>T	19.37:g.51957994G>A			56649806	NM_014442	Q7Z728	Silent	SNP	ENST00000321424.3	37	CCDS33086.1																																																																																				0.567	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
HAS1	3036	broad.mit.edu	37	19	52217143	52217143	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:52217143G>A	ENST00000222115.1	-	5	1308	c.1274C>T	c.(1273-1275)gCg>gTg	p.A425V	HAS1_ENST00000601714.1_Missense_Mutation_p.A432V|HAS1_ENST00000540069.2_Missense_Mutation_p.A424V	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	425					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.A425V(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGGGCGGCCCGCGTAGAACAG	0.706																																					p.A425V	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1274T	19						.						29.0	30.0	29.0					19																	52217143		2190	4296	6486	56908955	SO:0001583	missense	3036	exon5			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1274C>T	19.37:g.52217143G>A	ENSP00000222115:p.Ala425Val		56908955	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	g	8.554	0.876206	0.17395	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.58797	0.31;0.31	3.19	3.19	0.36642	.	0.221815	0.38111	U	0.001817	T	0.37945	0.1022	L	0.27053	0.805	0.26824	N	0.968739	B;B;B	0.28900	0.227;0.146;0.146	B;B;B	0.19148	0.024;0.011;0.011	T	0.22695	-1.0209	10	0.36615	T	0.2	-18.1561	8.547	0.33429	0.0:0.2393:0.7606:0.0	.	424;425;424	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	V	424;425	ENSP00000445021:A424V;ENSP00000222115:A425V	ENSP00000222115:A425V	A	-	2	0	HAS1	56908955	1.000000	0.71417	0.987000	0.45799	0.204000	0.24138	3.897000	0.56273	1.812000	0.52913	0.165000	0.16767	GCG		0.706	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF471	57573	broad.mit.edu	37	19	57029934	57029934	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:57029934A>G	ENST00000308031.5	+	4	377	c.244A>G	c.(244-246)Agc>Ggc	p.S82G	ZNF471_ENST00000591537.1_Missense_Mutation_p.S82G|ZNF471_ENST00000593197.1_Intron	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	82	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S82G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		GATGACAAGAAGCCCATTCTC	0.428																																					p.S82G	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A244G	19						.						103.0	89.0	94.0					19																	57029934		2203	4300	6503	61721746	SO:0001583	missense	57573	exon4			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.244A>G	19.37:g.57029934A>G	ENSP00000309161:p.Ser82Gly		61721746	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	37	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.504032	0.00155	.	.	ENSG00000196263	ENST00000308031	T	0.05258	3.47	4.18	0.157	0.14915	Krueppel-associated box (1);	.	.	.	.	T	0.01558	0.0050	N	0.00783	-1.19	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46275	-0.9203	9	0.02654	T	1	.	6.5568	0.22464	0.5781:0.0:0.4219:0.0	.	82	Q9BX82	ZN471_HUMAN	G	82	ENSP00000309161:S82G	ENSP00000309161:S82G	S	+	1	0	ZNF471	61721746	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	0.366000	0.20365	0.000000	0.14550	0.528000	0.53228	AGC		0.428	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ZNF835	90485	broad.mit.edu	37	19	57176313	57176313	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr19:57176313G>A	ENST00000537055.2	-	2	485	c.254C>T	c.(253-255)gCg>gTg	p.A85V		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A107V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CTCCCCAGGCGCGCTGCACCT	0.647																																					p.A107V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C320T	19						.						53.0	58.0	57.0					19																	57176313		2083	4230	6313	61868125	SO:0001583	missense	90485	exon2			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.254C>T	19.37:g.57176313G>A	ENSP00000444747:p.Ala85Val		61868125	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404645	0.25378	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.06768	3.26	2.58	-0.0592	0.13794	.	.	.	.	.	T	0.03477	0.0100	N	0.14661	0.345	0.09310	N	1	P	0.46859	0.885	B	0.35039	0.194	T	0.38373	-0.9664	9	0.56958	D	0.05	.	3.2604	0.06846	0.1931:0.2662:0.5407:0.0	.	107	Q9Y2P0	ZN835_HUMAN	V	107;85	ENSP00000444747:A85V	ENSP00000341756:A107V	A	-	2	0	ZNF835	61868125	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.134000	0.15932	-0.056000	0.13221	-0.367000	0.07326	GCG		0.647	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
PRAMEF22	653606	broad.mit.edu	37	1	13036687	13036687	+	Silent	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:13036687C>T	ENST00000376187.1	+	2	759	c.759C>T	c.(757-759)agC>agT	p.S253S	PRAMEF6_ENST00000376192.5_Intron	NM_001100631.1	NP_001094101.1	A3QJZ6	PRA22_HUMAN	PRAME family member 22	253					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.S253S(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)	5						GCTCTGACAGCCAAGAACAGT	0.493																																					p.S253S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C759T	1						.						1.0	1.0	1.0					1																	13036687		691	1407	2098	12959274	SO:0001819	synonymous_variant	653606	exon2					1p36.21	2013-01-17			ENSG00000204508			"""-"""	34393	protein-coding gene	gene with protein product							Standard	NM_001100631		Approved	PRAMEF3L	uc009vnq.1	A3QJZ6	OTTHUMG00000074726	ENST00000376187.1:c.759C>T	1.37:g.13036687C>T			12959274	NM_001100631	A6NMM3	Silent	SNP	ENST00000376187.1	37	CCDS41256.1																																																																																				0.493	PRAMEF22-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158511.1	NM_001100631	
FCGR3A	2214	broad.mit.edu	37	1	161569497	161569497	+	Intron	SNP	C	C	T	rs201572445	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:161569497C>T	ENST00000540048.1	-	2	94				RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000466542.2_RNA|FCGR2C_ENST00000543859.1_RNA|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000403078.3_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CAGCTGACGGCGGCTACATGA	0.458													.|||	3	0.000599042	0.0	0.0014	5008	,	,		13425	0.0		0.002	False		,,,				2504	0.0				p.G292G												.	.	0			c.C876T	1						.	T		3,4379		0,3,2188	59.0	66.0	63.0		876	0.6	0.0	1		63	3,8591		1,1,4295	no	coding-synonymous	FCGR2C	NM_201563.4		1,4,6483	TT,TC,CC		0.0349,0.0685,0.0462		292/324	161569497	6,12970	2191	4297	6488	159836121	SO:0001627	intron_variant	9103	exon7			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+30660G>A	1.37:g.161569497C>T			159836121	NM_201563	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	ENST00000540048.1	37																																																																																					0.458	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
LRRC52	440699	broad.mit.edu	37	1	165532891	165532891	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:165532891G>A	ENST00000294818.1	+	2	1062	c.772G>A	c.(772-774)Gcg>Acg	p.A258T	RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000438275.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	258					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A258S(1)|p.A258T(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CATCTTCGCCGCGGGAACTGT	0.587																																					p.A258T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G772A	1						.						63.0	52.0	56.0					1																	165532891		2203	4300	6503	163799515	SO:0001583	missense	440699	exon2			AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.772G>A	1.37:g.165532891G>A	ENSP00000294818:p.Ala258Thr		163799515	NM_001005214	A2RUN7|Q5T9K5	Missense_Mutation	SNP	ENST00000294818.1	37	CCDS30930.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513271	0.85389	.	.	ENSG00000162763	ENST00000294818	T	0.68903	-0.36	4.08	4.08	0.47627	.	0.177197	0.49916	D	0.000124	T	0.73481	0.3592	M	0.72894	2.215	0.30382	N	0.781873	D	0.89917	1.0	D	0.73380	0.98	T	0.78277	-0.2266	9	0.72032	D	0.01	.	12.1412	0.53998	0.0:0.0:1.0:0.0	.	258	Q8N7C0	LRC52_HUMAN	T	258	ENSP00000294818:A258T	ENSP00000294818:A258T	A	+	1	0	LRRC52	163799515	0.996000	0.38824	0.857000	0.33713	0.850000	0.48378	4.732000	0.62029	1.956000	0.56807	0.655000	0.94253	GCG		0.587	LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214	
CEP350	9857	broad.mit.edu	37	1	179993666	179993666	+	Missense_Mutation	SNP	C	C	A	rs549183005		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:179993666C>A	ENST00000367607.3	+	14	3917	c.3499C>A	c.(3499-3501)Cgt>Agt	p.R1167S		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1167	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R1167S(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGCATCGTCTCGTTCATCTAC	0.423																																					p.R1167S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3499A	1						.						82.0	70.0	74.0					1																	179993666		2203	4300	6503	178260289	SO:0001583	missense	9857	exon14			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3499C>A	1.37:g.179993666C>A	ENSP00000356579:p.Arg1167Ser		178260289	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	7.586	0.669791	0.14776	.	.	ENSG00000135837	ENST00000367607	T	0.60040	0.22	5.61	1.61	0.23674	.	0.841724	0.10119	N	0.713713	T	0.39279	0.1072	L	0.27053	0.805	0.09310	N	1	B;B	0.15719	0.014;0.014	B;B	0.13407	0.009;0.009	T	0.24297	-1.0164	9	.	.	.	.	5.048	0.14494	0.1451:0.6211:0.0:0.2338	.	1167;1167	E7EU22;Q5VT06	.;CE350_HUMAN	S	1167	ENSP00000356579:R1167S	.	R	+	1	0	CEP350	178260289	0.410000	0.25376	0.005000	0.12908	0.620000	0.37586	0.853000	0.27777	0.038000	0.15604	-0.244000	0.11960	CGT		0.423	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
SYT14	255928	broad.mit.edu	37	1	210273718	210273718	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:210273718T>C	ENST00000472886.1	+	6	1090	c.1076T>C	c.(1075-1077)gTg>gCg	p.V359A	SYT14_ENST00000537238.1_Missense_Mutation_p.V321A|SYT14_ENST00000271745.7_Intron|SYT14_ENST00000367015.1_Missense_Mutation_p.V321A|SYT14_ENST00000367019.1_Missense_Mutation_p.V359A|SYT14_ENST00000399639.2_Missense_Mutation_p.V359A|SYT14_ENST00000422431.1_Missense_Mutation_p.V404A|SYT14_ENST00000534859.1_Missense_Mutation_p.V359A			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	359	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)	p.V359A(1)		endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GAAAAGATTGTGGGGGAAAAG	0.318																																					p.V359A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1076C	1						.						42.0	44.0	44.0					1																	210273718		2203	4299	6502	208340341	SO:0001583	missense	255928	exon6			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1076T>C	1.37:g.210273718T>C	ENSP00000418901:p.Val359Ala		208340341	NM_153262	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.385788	0.61956	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04;3.04;3.04	6.07	6.07	0.98685	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.188863	0.46145	D	0.000310	T	0.10208	0.0250	L	0.38175	1.15	0.50632	D	0.99988	B;B;B;B	0.31817	0.14;0.063;0.341;0.182	B;B;B;B	0.32090	0.14;0.027;0.082;0.086	T	0.04885	-1.0920	10	0.87932	D	0	-5.7791	16.6268	0.84972	0.0:0.0:0.0:1.0	.	387;359;359;404	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	A	404;359;359;321;359;359;321	ENSP00000389039:V404A;ENSP00000442891:V359A;ENSP00000445837:V359A;ENSP00000437423:V321A;ENSP00000355986:V359A;ENSP00000418901:V359A;ENSP00000355982:V321A	ENSP00000355982:V321A	V	+	2	0	SYT14	208340341	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.317000	0.79018	2.326000	0.78906	0.528000	0.53228	GTG		0.318	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
TGFB2	7042	broad.mit.edu	37	1	218536732	218536732	+	Intron	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:218536732C>A	ENST00000366930.4	+	1	813				TGFB2_ENST00000366929.4_Missense_Mutation_p.Q135K	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2						activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)	p.Q135K(1)		breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GTGCTCCAGACAGTCCCAGGT	0.448																																					p.Q135K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C403A	1						.						165.0	146.0	152.0					1																	218536732		1568	3582	5150	216603355	SO:0001627	intron_variant	7042	exon2			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.346+16343C>A	1.37:g.218536732C>A			216603355	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	C	3.960	-0.010546	0.07727	.	.	ENSG00000092969	ENST00000366929	T	0.72942	-0.7	4.43	3.45	0.39498	.	0.690029	0.13447	N	0.387197	T	0.50069	0.1594	N	0.19112	0.55	0.20764	N	0.999857	B;B	0.11235	0.0;0.004	B;B	0.14023	0.0;0.01	T	0.29119	-1.0022	10	0.07030	T	0.85	.	9.2206	0.37375	0.2778:0.7222:0.0:0.0	.	135;136	P61812-2;Q59EG9	.;.	K	135	ENSP00000355896:Q135K	ENSP00000355896:Q135K	Q	+	1	0	TGFB2	216603355	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.942000	0.29017	1.301000	0.44836	0.655000	0.94253	CAG		0.448	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
NVL	4931	broad.mit.edu	37	1	224495771	224495771	+	Silent	SNP	T	T	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:224495771T>G	ENST00000281701.6	-	6	796	c.537A>C	c.(535-537)ccA>ccC	p.P179P	NVL_ENST00000361463.3_Silent_p.P73P|NVL_ENST00000482491.1_Intron|NVL_ENST00000469075.1_Intron|RNU6-1008P_ENST00000384160.1_RNA|NVL_ENST00000340871.4_Intron|NVL_ENST00000391875.2_Silent_p.P73P	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	179						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.P179P(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TCTTTACACTTGGGGTTTTGT	0.393																																					p.P179P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A537C	1						.						135.0	133.0	134.0					1																	224495771		2203	4300	6503	222562394	SO:0001819	synonymous_variant	4931	exon6			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.537A>C	1.37:g.224495771T>G			222562394	NM_002533	B4DMC4|B4DP98|Q96EM7	Silent	SNP	ENST00000281701.6	37	CCDS1541.1																																																																																				0.393	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
ARID1A	8289	broad.mit.edu	37	1	27088697	27088697	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:27088697C>A	ENST00000324856.7	+	7	2677	c.2306C>A	c.(2305-2307)tCa>tAa	p.S769*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.S769*|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.S386*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	769					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.S769*(2)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAGCCCGGCTCAGCCTTATCT	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S769X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	c.C2306A	1						.						82.0	86.0	84.0					1																	27088697		2203	4300	6503	26961284	SO:0001587	stop_gained	8289	exon7			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2306C>A	1.37:g.27088697C>A	ENSP00000320485:p.Ser769*		26961284	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	40	8.068552	0.98638	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.95	5.95	0.96441	.	0.058505	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-7.9632	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	X	769;769;386	.	ENSP00000320485:S769X	S	+	2	0	ARID1A	26961284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.824000	0.97209	0.655000	0.94253	TCA		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CACHD1	57685	broad.mit.edu	37	1	65141158	65141158	+	Silent	SNP	G	G	A	rs368306892		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:65141158G>A	ENST00000371073.2	+	20	2802	c.2802G>A	c.(2800-2802)gcG>gcA	p.A934A	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Silent_p.A883A			Q5VU97	CAHD1_HUMAN	cache domain containing 1	934					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.A883A(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GAACCAACGCGTTTGTTGGCA	0.488											OREG0013544	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A883A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2649A	1						.	G		2,4404	4.2+/-10.8	0,2,2201	234.0	205.0	214.0		2649	-11.7	0.0	1		214	0,8600		0,0,4300	no	coding-synonymous	CACHD1	NM_020925.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		883/1224	65141158	2,13004	2203	4300	6503	64913746	SO:0001819	synonymous_variant	57685	exon20			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.2802G>A	1.37:g.65141158G>A		1081	64913746	NM_020925	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Silent	SNP	ENST00000371073.2	37																																																																																					0.488	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
OR2L13	284521	broad.mit.edu	37	1	248262936	248262936	+	Missense_Mutation	SNP	G	G	A	rs377126567		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr1:248262936G>A	ENST00000358120.2	+	2	404	c.259G>A	c.(259-261)Ggc>Agc	p.G87S	OR2L13_ENST00000366478.2_Missense_Mutation_p.G87S			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G87S(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTTCCTGTCCGGCCAGAAAGG	0.537																																					p.G87S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G259A	1						.						232.0	207.0	215.0					1																	248262936		2203	4300	6503	246329559	SO:0001583	missense	284521	exon3			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.259G>A	1.37:g.248262936G>A	ENSP00000350836:p.Gly87Ser		246329559	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	G	8.072	0.770390	0.15983	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.03717	3.83;3.83	4.07	1.07	0.20283	GPCR, rhodopsin-like superfamily (1);	0.156674	0.29830	N	0.011087	T	0.02767	0.0083	L	0.48218	1.51	0.09310	N	1	P	0.49696	0.927	B	0.33799	0.17	T	0.47169	-0.9138	10	0.62326	D	0.03	.	5.6388	0.17552	0.2386:0.2716:0.4898:0.0	.	87	Q8N349	OR2LD_HUMAN	S	87	ENSP00000355434:G87S;ENSP00000350836:G87S	ENSP00000350836:G87S	G	+	1	0	OR2L13	246329559	0.001000	0.12720	0.002000	0.10522	0.151000	0.21798	1.012000	0.29924	0.372000	0.24591	-0.133000	0.14855	GGC		0.537	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
SDCBP2	27111	broad.mit.edu	37	20	1293005	1293005	+	Silent	SNP	G	G	A	rs142730951		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr20:1293005G>A	ENST00000360779.3	-	7	881	c.708C>T	c.(706-708)gaC>gaT	p.D236D	SDCBP2_ENST00000381812.1_Silent_p.D236D|SDCBP2_ENST00000381808.3_Silent_p.D151D|SDCBP2_ENST00000467129.1_5'Flank|SDCBP2_ENST00000339987.3_Silent_p.D236D	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	236	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D236D(2)|p.D151D(1)		endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						CATTCTGCCCGTCCACCTCAC	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		19112	0.0		0.0	False		,,,				2504	0.001				p.D236D												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C708T	20						.	G	,,	1,4403	2.1+/-5.4	0,1,2201	61.0	50.0	54.0		708,453,708	-3.6	0.8	20	dbSNP_134	54	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	SDCBP2	NM_001199784.1,NM_015685.5,NM_080489.4	,,	0,4,6498	AA,AG,GG		0.0349,0.0227,0.0308	,,	236/293,151/208,236/293	1293005	4,13000	2202	4300	6502	1241005	SO:0001819	synonymous_variant	27111	exon7			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.708C>T	20.37:g.1293005G>A			1241005	NM_080489	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Silent	SNP	ENST00000360779.3	37	CCDS42848.1																																																																																				0.612	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489	
ATP9A	10079	broad.mit.edu	37	20	50273506	50273506	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr20:50273506G>A	ENST00000338821.5	-	14	1741	c.1477C>T	c.(1477-1479)Cgc>Tgc	p.R493C	ATP9A_ENST00000311637.5_Missense_Mutation_p.R357C|ATP9A_ENST00000402822.1_Missense_Mutation_p.R372C	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	493					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R493C(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TGGTATACGCGGCAGGAGTCT	0.582																																					p.R493C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1477T	20						.						96.0	71.0	80.0					20																	50273506		2203	4300	6503	49706913	SO:0001583	missense	10079	exon14			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1477C>T	20.37:g.50273506G>A	ENSP00000342481:p.Arg493Cys		49706913	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690927	0.48097	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.62788	-0.0;-0.0;-0.0	4.89	3.87	0.44632	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.69575	0.3126	L	0.46885	1.475	0.80722	D	1	D;B	0.89917	1.0;0.078	D;B	0.76575	0.988;0.013	T	0.67377	-0.5686	10	0.37606	T	0.19	-10.8384	10.7146	0.46005	0.0:0.0:0.6061:0.3939	.	372;493	O75110-2;O75110	.;ATP9A_HUMAN	C	357;493;372	ENSP00000309086:R357C;ENSP00000342481:R493C;ENSP00000385875:R372C	ENSP00000309086:R357C	R	-	1	0	ATP9A	49706913	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	3.143000	0.50608	2.249000	0.74217	0.561000	0.74099	CGC		0.582	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
KRTAP12-1	353332	broad.mit.edu	37	21	46101829	46101829	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr21:46101829G>C	ENST00000391617.1	-	1	249	c.210C>G	c.(208-210)tgC>tgG	p.C70W	TSPEAR_ENST00000323084.4_Intron	NM_181686.1	NP_859014.1	P59990	KR121_HUMAN	keratin associated protein 12-1	70	14 X 5 AA approximate repeats.					keratin filament (GO:0045095)		p.C70W(1)		kidney(1)|large_intestine(1)|lung(1)|skin(2)	5						CAGAGGACTGGCAGGAGGGAG	0.647																																					p.C70W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C210G	21						.						52.0	64.0	60.0					21																	46101829		2162	4248	6410	44926257	SO:0001583	missense	353332	exon1			AJ566388	CCDS42966.1	21q22.3	2006-03-13			ENSG00000187175	ENSG00000187175		"""Keratin associated proteins"""	20529	protein-coding gene	gene with protein product							Standard	NM_181686		Approved	KRTAP12.1, KAP12.1	uc002zfv.3	P59990	OTTHUMG00000057639	ENST00000391617.1:c.210C>G	21.37:g.46101829G>C	ENSP00000375475:p.Cys70Trp		44926257	NM_181686	Q0VAS3	Missense_Mutation	SNP	ENST00000391617.1	37	CCDS42966.1	.	.	.	.	.	.	.	.	.	.	g	10.15	1.270755	0.23221	.	.	ENSG00000187175	ENST00000391617	T	0.16324	2.35	3.59	0.61	0.17580	.	0.000000	0.35407	U	0.003233	T	0.35799	0.0944	.	.	.	0.51482	D	0.999928	D	0.89917	1.0	D	0.91635	0.999	T	0.05550	-1.0878	9	0.87932	D	0	.	6.5962	0.22674	0.4433:0.0:0.5567:0.0	.	70	P59990	KR121_HUMAN	W	70	ENSP00000375475:C70W	ENSP00000375475:C70W	C	-	3	2	KRTAP12-1	44926257	1.000000	0.71417	0.962000	0.40283	0.190000	0.23558	0.173000	0.16724	-0.003000	0.14444	-0.513000	0.04457	TGC		0.647	KRTAP12-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128043.1	NM_181686	
SLC5A4	6527	broad.mit.edu	37	22	32630946	32630946	+	Nonsense_Mutation	SNP	G	G	A	rs76877500	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr22:32630946G>A	ENST00000266086.4	-	8	810	c.799C>T	c.(799-801)Cga>Tga	p.R267*	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	267					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.R267*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						ACAGCATCTCGGAAGATGTGG	0.502													G|||	41	0.0081869	0.0	0.0	5008	,	,		20639	0.0149		0.001	False		,,,				2504	0.0256				p.R267X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C799T	22						.	G	stop/ARG	3,4403		1,1,2201	200.0	183.0	189.0		799	4.8	1.0	22	dbSNP_131	189	1,8599		0,1,4299	yes	stop-gained	SLC5A4	NM_014227.2		1,2,6500	AA,AG,GG		0.0116,0.0681,0.0308		267/660	32630946	4,13002	2203	4300	6503	30960946	SO:0001587	stop_gained	6527	exon8			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.799C>T	22.37:g.32630946G>A	ENSP00000266086:p.Arg267*		30960946	NM_014227	O15279	Nonsense_Mutation	SNP	ENST00000266086.4	37	CCDS13903.1	7	0.003205128205128205	0	0.0	0	0.0	6	0.01048951048951049	1	0.0013192612137203166	.	17.54	3.414506	0.62511	6.81E-4	1.16E-4	ENSG00000100191	ENST00000266086	.	.	.	4.77	4.77	0.60923	.	0.110194	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6522	0.77108	0.0:0.0:1.0:0.0	.	.	.	.	X	267	.	ENSP00000266086:R267X	R	-	1	2	SLC5A4	30960946	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	3.299000	0.51826	2.640000	0.89533	0.637000	0.83480	CGA		0.502	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227	
WNT7B	7477	broad.mit.edu	37	22	46319028	46319028	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr22:46319028C>T	ENST00000339464.4	-	4	1132	c.758G>A	c.(757-759)cGc>cAc	p.R253H	WNT7B_ENST00000409496.3_Missense_Mutation_p.R257H|WNT7B_ENST00000410089.1_Missense_Mutation_p.R237H	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	253					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R253H(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		CTGTTTGATGCGCAGGAAGGT	0.632																																					p.R253H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G758A	22						.						54.0	52.0	52.0					22																	46319028		2203	4300	6503	44697692	SO:0001583	missense	7477	exon4			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.758G>A	22.37:g.46319028C>T	ENSP00000341032:p.Arg253His		44697692	NM_058238	B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	CCDS33667.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269255	0.40095	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	T;T;T	0.75704	-0.96;-0.96;-0.96	3.93	1.79	0.24919	.	0.142736	0.44688	U	0.000439	T	0.72598	0.3480	M	0.67625	2.065	0.80722	D	1	P;P	0.46512	0.668;0.879	P;P	0.50109	0.505;0.631	T	0.69946	-0.5007	10	0.37606	T	0.19	.	4.8641	0.13600	0.0:0.5816:0.0:0.4184	.	257;253	A8K0G1;P56706	.;WNT7B_HUMAN	H	253;237;257	ENSP00000341032:R253H;ENSP00000386781:R237H;ENSP00000386546:R257H	ENSP00000341032:R253H	R	-	2	0	WNT7B	44697692	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.095000	0.50235	1.746000	0.51805	0.561000	0.74099	CGC		0.632	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238	
MLC1	23209	broad.mit.edu	37	22	50515308	50515308	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr22:50515308C>T	ENST00000311597.5	-	7	1165	c.559G>A	c.(559-561)Gaa>Aaa	p.E187K	MLC1_ENST00000538737.1_Missense_Mutation_p.E153K|MLC1_ENST00000395876.2_Missense_Mutation_p.E187K|MLC1_ENST00000450140.2_Missense_Mutation_p.E135K|MLC1_ENST00000431262.2_Missense_Mutation_p.E157K|MLC1_ENST00000535444.1_Missense_Mutation_p.E108K	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	187					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.E187K(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		AATGGCACTTCGTCCAGAATG	0.542																																					p.E187K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	22						.						105.0	108.0	107.0					22																	50515308		2203	4300	6503	48857435	SO:0001583	missense	23209	exon7			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.559G>A	22.37:g.50515308C>T	ENSP00000310375:p.Glu187Lys		48857435	NM_015166	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680591	0.68042	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140;ENST00000442311	D;D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	5.22	4.13	0.48395	.	0.382450	0.30185	N	0.010220	D	0.89491	0.6730	L	0.57536	1.79	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.79108	0.992;0.992;0.988;0.992	T	0.80341	-0.1423	10	0.51188	T	0.08	-20.4404	4.7685	0.13144	0.0:0.7714:0.0:0.2286	.	153;157;135;187	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	K	187;187;153;157;108;135;157	ENSP00000379216:E187K;ENSP00000310375:E187K;ENSP00000445805:E153K;ENSP00000415877:E157K;ENSP00000438910:E108K;ENSP00000412448:E135K;ENSP00000401385:E157K	ENSP00000310375:E187K	E	-	1	0	MLC1	48857435	0.088000	0.21588	0.456000	0.27044	0.008000	0.06430	1.023000	0.30065	2.394000	0.81467	0.655000	0.94253	GAA		0.542	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166	
SELO	83642	broad.mit.edu	37	22	50649090	50649090	+	Silent	SNP	C	C	T	rs377648812		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr22:50649090C>T	ENST00000380903.2	+	5	1159	c.1101C>T	c.(1099-1101)tcC>tcT	p.S367S	RP3-402G11.28_ENST00000608016.1_RNA|SELO_ENST00000492092.1_3'UTR	NM_031454.1	NP_113642.1	Q9BVL4	SELO_HUMAN		367								p.S367S(1)					all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GCAATGCCTCCGACAACACCG	0.677											OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S367S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1101T	22						.						39.0	46.0	44.0					22																	50649090		2139	4244	6383	48991217	SO:0001819	synonymous_variant	83642	exon5																														ENST00000380903.2:c.1101C>T	22.37:g.50649090C>T		971	48991217	NM_031454	Q2TAL2|Q5JZ81|Q8WUI0	Silent	SNP	ENST00000380903.2	37	CCDS43034.1																																																																																				0.677	SELO-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000075003.2		
CFAP221	200373	broad.mit.edu	37	2	120388463	120388463	+	Missense_Mutation	SNP	C	C	A	rs377738201		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:120388463C>A	ENST00000413369.3	+	19	2047	c.1960C>A	c.(1960-1962)Cct>Act	p.P654T	PCDP1_ENST00000602047.1_Missense_Mutation_p.P368T	NM_001271049.1	NP_001257978												p.P368T(1)				Colorectal(110;0.196)					AGATTATGATCCTCTGTATGT	0.433																																					p.P368T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1102A	2						.	C	THR/PRO	1,4405	2.1+/-5.4	0,1,2202	182.0	170.0	174.0		1102	4.2	0.3	2		174	0,8600		0,0,4300	no	missense	PCDP1	NM_001029996.3	38	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging	368/555	120388463	1,13005	2203	4300	6503	120104933	SO:0001583	missense	200373	exon20																														ENST00000413369.3:c.1960C>A	2.37:g.120388463C>A	ENSP00000393222:p.Pro654Thr		120104933	NM_001029996		Missense_Mutation	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825401	0.50739	2.27E-4	0.0	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.37235	1.21	5.06	4.16	0.48862	.	0.303983	0.28589	N	0.014811	T	0.50446	0.1616	L	0.57536	1.79	0.24440	N	0.994537	D;D	0.76494	0.999;0.999	D;D	0.69479	0.932;0.964	T	0.32903	-0.9889	10	0.48119	T	0.1	-3.4166	9.5391	0.39240	0.0:0.9025:0.0:0.0975	.	498;654	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	T	368;654	ENSP00000393222:P654T	ENSP00000295220:P368T	P	+	1	0	AC069154.2	120104933	0.595000	0.26857	0.280000	0.24747	0.141000	0.21300	2.241000	0.43097	2.635000	0.89317	0.563000	0.77884	CCT		0.433	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
CXCR4	7852	broad.mit.edu	37	2	136872957	136872957	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:136872957C>T	ENST00000241393.3	-	2	645	c.541G>A	c.(541-543)Gat>Aat	p.D181N	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Missense_Mutation_p.D185N	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	181					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)	p.D185N(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TATCTGTCATCTGCCTCACTG	0.502																																					p.D181N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G541A	2						.						136.0	120.0	125.0					2																	136872957		2203	4300	6503	136589427	SO:0001583	missense	7852	exon2			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.541G>A	2.37:g.136872957C>T	ENSP00000241393:p.Asp181Asn		136589427	NM_003467	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	C	4.218	0.039212	0.08148	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.71817	-0.6;-0.6	6.17	5.29	0.74685	GPCR, rhodopsin-like superfamily (1);	1.745880	0.02470	N	0.087394	T	0.60011	0.2236	N	0.25485	0.75	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.14578	0.011;0.001	T	0.50276	-0.8847	10	0.05721	T	0.95	.	12.0539	0.53522	0.0:0.8684:0.0:0.1316	.	181;185	P61073;P61073-2	CXCR4_HUMAN;.	N	185;181;51	ENSP00000386884:D185N;ENSP00000241393:D181N	ENSP00000241393:D181N	D	-	1	0	CXCR4	136589427	0.019000	0.18553	0.500000	0.27589	0.115000	0.19883	0.821000	0.27338	2.941000	0.99782	0.655000	0.94253	GAT		0.502	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
SCN1A	6323	broad.mit.edu	37	2	166859133	166859133	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:166859133T>C	ENST00000303395.4	-	21	4132	c.4133A>G	c.(4132-4134)aAc>aGc	p.N1378S	SCN1A_ENST00000423058.2_Missense_Mutation_p.N1378S|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.N1350S|SCN1A_ENST00000375405.3_Missense_Mutation_p.N1367S|AC010127.3_ENST00000597623.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1378					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.N1367S(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTTGTGGTGTTAATACAGTG	0.383																																					p.N1350S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4049G	2						.						112.0	108.0	109.0					2																	166859133		2203	4300	6503	166567379	SO:0001583	missense	6323	exon21			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4133A>G	2.37:g.166859133T>C	ENSP00000303540:p.Asn1378Ser		166567379	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.671299	0.67814	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.54	5.54	0.83059	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98760	0.9583	M	0.73753	2.245	0.47621	D	0.999472	D;P;D	0.76494	0.962;0.856;0.999	P;P;D	0.76575	0.587;0.551;0.988	D	0.99871	1.1096	10	0.87932	D	0	.	15.9597	0.79918	0.0:0.0:0.0:1.0	.	1367;1350;1378	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	S	1378;1378;1367;1350	ENSP00000407030:N1378S;ENSP00000303540:N1378S;ENSP00000364554:N1367S;ENSP00000386312:N1350S	ENSP00000303540:N1378S	N	-	2	0	SCN1A	166567379	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.189000	0.72051	2.226000	0.72624	0.482000	0.46254	AAC		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
TTN	7273	broad.mit.edu	37	2	179395587	179395587	+	Missense_Mutation	SNP	C	C	T	rs368151146		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:179395587C>T	ENST00000591111.1	-	308	101056	c.100832G>A	c.(100831-100833)cGa>cAa	p.R33611Q	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R35252Q|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R26312Q|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R26187Q|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R32684Q|TTN_ENST00000342175.6_Missense_Mutation_p.R26379Q|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33611					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R26379Q(1)|p.R26187Q(1)|p.R26312Q(1)|p.R32682Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGATTTCACTCGTTTTGGAGA	0.507																																					p.E26187K												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G78559A	2						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3766		0,0,1883	132.0	129.0	130.0		79136,78935,98051,78560	4.1	1.0	2		130	1,8201		0,1,4100	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	43,43,43,43	0,1,5983	TT,TC,CC		0.0122,0.0,0.0084	benign,benign,benign,benign	26379/27119,26312/27052,32684/33424,26187/26927	179395587	1,11967	1883	4101	5984	179103833	SO:0001583	missense	7273	exon186			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100832G>A	2.37:g.179395587C>T	ENSP00000465570:p.Arg33611Gln		179103833	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	14.91	2.675311	0.47781	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62941	-0.01;0.25;0.23;0.2	4.99	4.1	0.47936	Ribonuclease H-like (1);	.	.	.	.	T	0.51770	0.1694	L	0.32530	0.975	0.34006	D	0.65094	B;B;B;B	0.23735	0.019;0.019;0.019;0.09	B;B;B;B	0.11329	0.003;0.003;0.003;0.006	T	0.61569	-0.7036	9	0.87932	D	0	.	13.701	0.62608	0.0:0.9246:0.0:0.0754	.	26187;26312;26379;33611	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	32684;26187;26379;26312;26184	ENSP00000343764:R32684Q;ENSP00000434586:R26187Q;ENSP00000340554:R26379Q;ENSP00000352154:R26312Q	ENSP00000340554:R26379Q	R	-	2	0	TTN	179103833	0.797000	0.28877	0.996000	0.52242	0.771000	0.43674	0.997000	0.29731	1.095000	0.41419	0.455000	0.32223	CGA		0.507	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179604014	179604014	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:179604014T>G	ENST00000591111.1	-	46	13219	c.12995A>C	c.(12994-12996)aAg>aCg	p.K4332T	TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K4649T|TTN_ENST00000359218.5_Missense_Mutation_p.K4411T|TTN_ENST00000460472.2_Missense_Mutation_p.K4286T|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Missense_Mutation_p.K4478T			Q8WZ42	TITIN_HUMAN	titin	12090	Ig-like 23.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K4478T(1)|p.K4411T(1)|p.K4286T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACTTGAACTTTTCATCTGA	0.378																																					p.K4286T												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A12857C	2						.						137.0	121.0	126.0					2																	179604014		1894	4118	6012	179312259	SO:0001583	missense	7273	exon45			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12995A>C	2.37:g.179604014T>G	ENSP00000465570:p.Lys4332Thr		179312259	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	13.28	2.189898	0.38707	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.45276	0.9;0.9;0.9	5.83	3.28	0.37604	.	.	.	.	.	T	0.37972	0.1023	L	0.56199	1.76	0.25039	N	0.991218	B;B;B	0.23185	0.081;0.081;0.081	B;B;B	0.25506	0.061;0.061;0.061	T	0.33189	-0.9878	9	0.87932	D	0	.	7.801	0.29174	0.1235:0.0681:0.0:0.8084	.	4286;4411;4478	D3DPF9;E7EQE6;E7ET18	.;.;.	T	4286;4478;4411;4286	ENSP00000434586:K4286T;ENSP00000340554:K4478T;ENSP00000352154:K4411T	ENSP00000340554:K4478T	K	-	2	0	TTN	179312259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.447000	0.52936	2.236000	0.73375	0.533000	0.62120	AAG		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZDBF2	57683	broad.mit.edu	37	2	207172992	207172992	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:207172992C>A	ENST00000374423.3	+	5	4126	c.3740C>A	c.(3739-3741)tCt>tAt	p.S1247Y		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1247							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S1247Y(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						ATGTATGATTCTGATGTTCTT	0.398																																					p.S1247Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3740A	2						.						43.0	45.0	45.0					2																	207172992		1861	4100	5961	206881237	SO:0001583	missense	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.3740C>A	2.37:g.207172992C>A	ENSP00000363545:p.Ser1247Tyr		206881237	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786880	0.31593	.	.	ENSG00000204186	ENST00000374423	T	0.61392	0.11	3.74	3.74	0.42951	.	.	.	.	.	T	0.72053	0.3413	M	0.69358	2.11	0.28555	N	0.911405	D	0.76494	0.999	D	0.81914	0.995	T	0.63795	-0.6556	9	0.72032	D	0.01	.	11.3549	0.49609	0.0:1.0:0.0:0.0	.	1247	Q9HCK1	ZDBF2_HUMAN	Y	1247	ENSP00000363545:S1247Y	ENSP00000363545:S1247Y	S	+	2	0	ZDBF2	206881237	0.914000	0.31030	0.642000	0.29436	0.032000	0.12392	1.633000	0.37113	2.384000	0.81235	0.650000	0.86243	TCT		0.398	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
RUFY4	285180	broad.mit.edu	37	2	218939907	218939907	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:218939907A>T	ENST00000344321.7	+	9	1210	c.692A>T	c.(691-693)cAg>cTg	p.Q231L	RUFY4_ENST00000374155.3_Missense_Mutation_p.Q251L|RUFY4_ENST00000441828.2_3'UTR|RUFY4_ENST00000463872.1_3'UTR	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	231							metal ion binding (GO:0046872)	p.Q251L(1)		endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCCAGTGGACAGCAGCTGGCA	0.532																																					p.Q231L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A692T	2						.						24.0	26.0	25.0					2																	218939907		1959	4155	6114	218648152	SO:0001583	missense	285180	exon9			AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.692A>T	2.37:g.218939907A>T	ENSP00000345900:p.Gln231Leu		218648152	NM_198483	Q6ZR96	Missense_Mutation	SNP	ENST00000344321.7	37		.	.	.	.	.	.	.	.	.	.	A	9.450	1.090250	0.20390	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.46819	1.49;0.86	4.34	-5.16	0.02857	.	1.177540	0.06248	N	0.691678	T	0.23926	0.0579	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.13953	-1.0490	10	0.26408	T	0.33	-0.0221	1.3628	0.02195	0.2194:0.2781:0.0931:0.4094	.	231	Q6ZNE9	RUFY4_HUMAN	L	231;251	ENSP00000345900:Q231L;ENSP00000363270:Q251L	ENSP00000345900:Q231L	Q	+	2	0	RUFY4	218648152	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.502000	0.22594	-0.647000	0.05444	0.378000	0.23410	CAG		0.532	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198483	
FAM134A	79137	broad.mit.edu	37	2	220047007	220047007	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:220047007delG	ENST00000430297.2	+	9	1424	c.1288delG	c.(1288-1290)gtgfs	p.V430fs		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	430						integral component of membrane (GO:0016021)		p.V430fs*4(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGAGGACCAGTGGAGACACT	0.612																																					p.V430fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1288delG	2						.						99.0	105.0	103.0					2																	220047007		2203	4300	6503	219755251	SO:0001589	frameshift_variant	79137	exon9			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.1288delG	2.37:g.220047007delG	ENSP00000395249:p.Val430fs		219755251	NM_024293	Q6P1P5|Q9H0K7	Frame_Shift_Del	DEL	ENST00000430297.2	37	CCDS2434.1																																																																																				0.612	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
OR6B3	150681	broad.mit.edu	37	2	240985219	240985219	+	Missense_Mutation	SNP	G	G	A	rs535624583		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr2:240985219G>A	ENST00000319423.4	-	1	270	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R91C(2)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		AAAGAGATGCGTTTCTGCTGG	0.557													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22478	0.0		0.0	False		,,,				2504	0.0				p.R91C												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C271T	2						.						37.0	39.0	38.0					2																	240985219		1923	4115	6038	240633892	SO:0001583	missense	150681	exon1				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.271C>T	2.37:g.240985219G>A	ENSP00000322435:p.Arg91Cys		240633892	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	G	3.917	-0.018940	0.07681	.	.	ENSG00000178586	ENST00000319423	T	0.01359	4.98	3.96	-2.58	0.06228	GPCR, rhodopsin-like superfamily (1);	1.116300	0.07024	N	0.827325	T	0.01558	0.0050	L	0.45352	1.415	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.46555	-0.9183	10	0.52906	T	0.07	.	4.3807	0.11293	0.2511:0.0:0.2314:0.5174	.	91	Q8NGW1	OR6B3_HUMAN	C	91	ENSP00000322435:R91C	ENSP00000322435:R91C	R	-	1	0	OR6B3	240633892	0.000000	0.05858	0.000000	0.03702	0.624000	0.37722	-0.700000	0.05081	-0.593000	0.05844	-0.319000	0.08680	CGC		0.557	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
COX17	10063	broad.mit.edu	37	3	119396135	119396135	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:119396135T>G	ENST00000261070.2	-	1	115	c.23A>C	c.(22-24)aAc>aCc	p.N8T	COX17_ENST00000497116.1_Missense_Mutation_p.N8T|COX17_ENST00000484810.1_Missense_Mutation_p.N8T	NM_005694.1	NP_005685.1	Q14061	COX17_HUMAN	COX17 cytochrome c oxidase copper chaperone	8	Ala/Pro-rich.				brain development (GO:0007420)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|heart development (GO:0007507)	cytoplasm (GO:0005737)|mitochondrial intermembrane space (GO:0005758)	copper chaperone activity (GO:0016531)|copper ion binding (GO:0005507)	p.N8T(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)	3				GBM - Glioblastoma multiforme(114;0.227)		CGGGGCAGGGTTTGAGTCAAC	0.627																																					p.N8T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A23C	3						.						16.0	17.0	17.0					3																	119396135		2203	4300	6503	120878825	SO:0001583	missense	10063	exon1			L77701	CCDS2993.1	3q13.33	2013-05-23	2013-05-23		ENSG00000138495	ENSG00000138495		"""Mitochondrial respiratory chain complex assembly factors"""	2264	protein-coding gene	gene with protein product		604813	"""COX17 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX17 homolog, cytochrome c oxidase assembly protein (yeast)"", ""COX17 homolog, cytochrome c oxidase assembly protein (S. cerevisiae)"", ""COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 17 (yeast)"""			9050918, 21816817	Standard	NM_005694		Approved		uc003ecz.1	Q14061	OTTHUMG00000159433	ENST00000261070.2:c.23A>C	3.37:g.119396135T>G	ENSP00000261070:p.Asn8Thr		120878825	NM_005694	B2R5D2|D3DN84|Q3MHD6	Missense_Mutation	SNP	ENST00000261070.2	37	CCDS2993.1	.	.	.	.	.	.	.	.	.	.	T	6.824	0.521103	0.13005	.	.	ENSG00000138495	ENST00000261070;ENST00000484810;ENST00000497116	.	.	.	4.98	4.09	0.47781	.	0.308918	0.36444	N	0.002586	T	0.21267	0.0512	.	.	.	0.19945	N	0.999944	B	0.02656	0.0	B	0.01281	0.0	T	0.16600	-1.0397	8	0.13470	T	0.59	-8.3168	7.217	0.25965	0.0:0.7988:0.0:0.2012	.	8	Q14061	COX17_HUMAN	T	8	.	ENSP00000261070:N8T	N	-	2	0	COX17	120878825	0.986000	0.35501	0.990000	0.47175	0.187000	0.23431	0.352000	0.20113	1.441000	0.47550	-0.475000	0.04921	AAC		0.627	COX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355297.2	NM_005694	
ALDH1L1	10840	broad.mit.edu	37	3	125826004	125826004	+	Silent	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:125826004G>A	ENST00000393434.2	-	21	2782	c.2433C>T	c.(2431-2433)atC>atT	p.I811I	ALDH1L1_ENST00000452905.2_Silent_p.I710I|ALDH1L1_ENST00000273450.3_Silent_p.I821I|ALDH1L1-AS1_ENST00000512384.1_RNA|ALDH1L1_ENST00000472186.1_Silent_p.I811I|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	811	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.I811I(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	ACCGAGAGATGATCATGACAG	0.517																																					p.I811I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2433T	3						.						174.0	151.0	159.0					3																	125826004		2203	4300	6503	127308694	SO:0001819	synonymous_variant	10840	exon21			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2433C>T	3.37:g.125826004G>A			127308694	NM_012190	B4DG36|E9PBX3|Q68CS1	Silent	SNP	ENST00000393434.2	37	CCDS3034.1																																																																																				0.517	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
RFTN1	23180	broad.mit.edu	37	3	16475491	16475491	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:16475491C>T	ENST00000334133.4	-	3	471	c.199G>A	c.(199-201)Gcc>Acc	p.A67T	RFTN1_ENST00000432519.1_Missense_Mutation_p.A31T	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	67					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.A67T(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						AGGAGCTGGGCGGGCAGGTCA	0.667																																					p.A67T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	3						.						35.0	37.0	36.0					3																	16475491		2203	4300	6503	16450495	SO:0001583	missense	23180	exon3			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.199G>A	3.37:g.16475491C>T	ENSP00000334153:p.Ala67Thr		16450495	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855114	0.32791	.	.	ENSG00000131378	ENST00000432519;ENST00000334133;ENST00000451036;ENST00000449415;ENST00000441460;ENST00000431547	T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5	5.21	-2.94	0.05581	.	0.566201	0.18737	N	0.132561	T	0.15089	0.0364	N	0.24115	0.695	0.09310	N	1	B;B	0.18013	0.025;0.025	B;B	0.14578	0.011;0.011	T	0.19451	-1.0305	10	0.23891	T	0.37	-2.0674	7.6926	0.28577	0.1017:0.5074:0.0:0.3908	.	31;67	G3XAJ6;Q14699	.;RFTN1_HUMAN	T	31;67;67;67;67;67	ENSP00000403926:A31T;ENSP00000334153:A67T;ENSP00000403997:A67T;ENSP00000409427:A67T;ENSP00000388718:A67T;ENSP00000393216:A67T	ENSP00000334153:A67T	A	-	1	0	RFTN1	16450495	0.004000	0.15560	0.335000	0.25508	0.908000	0.53690	0.013000	0.13310	-0.542000	0.06249	-0.254000	0.11334	GCC		0.667	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
P2RY14	9934	broad.mit.edu	37	3	150931418	150931418	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:150931418C>A	ENST00000309170.3	-	3	999	c.687G>T	c.(685-687)aaG>aaT	p.K229N	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|P2RY14_ENST00000424796.2_Missense_Mutation_p.K229N	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	229					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)	p.K229N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGCTAGATTTCTTTTTGACCG	0.383																																					p.K229N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G687T	3						.						84.0	87.0	86.0					3																	150931418		2203	4300	6503	152414108	SO:0001583	missense	9934	exon3			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.687G>T	3.37:g.150931418C>A	ENSP00000308361:p.Lys229Asn		152414108	NM_014879	Q8IYT7	Missense_Mutation	SNP	ENST00000309170.3	37	CCDS3156.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792525	0.50102	.	.	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.74315	-0.83;-0.83	5.9	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.622465	0.16554	N	0.209356	T	0.67373	0.2886	L	0.39020	1.185	0.34078	D	0.65929	P	0.39044	0.656	P	0.46299	0.511	T	0.69950	-0.5006	10	0.28530	T	0.3	-10.6337	5.6634	0.17682	0.0:0.6392:0.2019:0.1589	.	229	Q15391	P2Y14_HUMAN	N	229	ENSP00000308361:K229N;ENSP00000408733:K229N	ENSP00000308361:K229N	K	-	3	2	P2RY14	152414108	0.983000	0.35010	1.000000	0.80357	0.487000	0.33371	0.571000	0.23669	2.788000	0.95919	0.650000	0.86243	AAG		0.383	P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357789.1	NM_014879	
WDR49	151790	broad.mit.edu	37	3	167322172	167322172	+	Missense_Mutation	SNP	G	G	A	rs201816414		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:167322172G>A	ENST00000308378.3	-	2	325	c.20C>T	c.(19-21)tCa>tTa	p.S7L	WDR49_ENST00000479765.1_Missense_Mutation_p.S348L|WDR49_ENST00000453925.2_Missense_Mutation_p.S60L	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	7								p.S7L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						ACGCTTTTTTGATTTCTCTCT	0.348																																					p.S7L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C20T	3						.						139.0	138.0	138.0					3																	167322172		2203	4300	6503	168804866	SO:0001583	missense	151790	exon2			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.20C>T	3.37:g.167322172G>A	ENSP00000311343:p.Ser7Leu		168804866	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.324|8.324	0.824989|0.824989	0.16678|0.16678	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000479765;ENST00000453925	.|T;T;T	.|0.55588	.|0.51;1.37;0.95	5.47|5.47	5.47|5.47	0.80525|0.80525	.|WD40-repeat-containing domain (1);	.|0.671543	.|0.13438	.|N	.|0.387898	.|T	.|0.45696	.|0.1355	L|L	0.53249|0.53249	1.67|1.67	0.24382|0.24382	N|N	0.994783|0.994783	.|B;B;B	.|0.14805	.|0.011;0.001;0.006	.|B;B;B	.|0.10450	.|0.005;0.001;0.005	.|T	.|0.25467	.|-1.0131	.|10	.|0.26408	.|T	.|0.33	.|.	7.9993|7.9993	0.30286|0.30286	0.0842:0.1626:0.7533:0.0|0.0842:0.1626:0.7533:0.0	.|.	.|60;348;7	.|E7EQK3;E9PDB0;Q8IV35	.|.;.;WDR49_HUMAN	X|L	72|7;348;60	.|ENSP00000311343:S7L;ENSP00000419749:S348L;ENSP00000410863:S60L	.|ENSP00000311343:S7L	Q|S	-|-	1|2	0|0	WDR49|WDR49	168804866|168804866	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.079000|0.079000	0.17450|0.17450	2.450000|2.450000	0.44943|0.44943	2.564000|2.564000	0.86499|0.86499	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.348	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
STAC	6769	broad.mit.edu	37	3	36534691	36534691	+	Missense_Mutation	SNP	G	G	A	rs145771131		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:36534691G>A	ENST00000273183.3	+	6	1036	c.736G>A	c.(736-738)Ggg>Agg	p.G246R	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Missense_Mutation_p.G185R	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	246					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)	p.G246R(1)		endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						GCCAGGAGGCGGGTATGACCT	0.507													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17867	0.0		0.0	False		,,,				2504	0.0				p.G246R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G736A	3						.	G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	112.0	112.0	112.0		736	3.3	0.0	3	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	missense	STAC	NM_003149.1	125	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	246/403	36534691	2,13004	2203	4300	6503	36509695	SO:0001583	missense	6769	exon6			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.736G>A	3.37:g.36534691G>A	ENSP00000273183:p.Gly246Arg		36509695	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	G	8.523	0.869258	0.17322	2.27E-4	1.16E-4	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687;ENST00000434649	T;T;T	0.74947	-0.89;1.06;1.01	5.24	3.32	0.38043	.	0.346133	0.29192	N	0.012878	T	0.49490	0.1560	N	0.04508	-0.205	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.04013	0.001;0.0	T	0.27088	-1.0084	10	0.16420	T	0.52	.	12.0277	0.53380	0.0:0.0:0.617:0.383	.	185;246	E9PEA7;Q99469	.;STAC_HUMAN	R	246;185;178;174	ENSP00000273183:G246R;ENSP00000393713:G185R;ENSP00000398403:G174R	ENSP00000273183:G246R	G	+	1	0	STAC	36509695	0.004000	0.15560	0.003000	0.11579	0.986000	0.74619	1.075000	0.30716	1.324000	0.45282	0.655000	0.94253	GGG		0.507	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
SCN5A	6331	broad.mit.edu	37	3	38592077	38592077	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:38592077C>T	ENST00000333535.4	-	28	5935	c.5786G>A	c.(5785-5787)cGt>cAt	p.R1929H	SCN5A_ENST00000451551.2_Missense_Mutation_p.R1875H|SCN5A_ENST00000413689.1_Missense_Mutation_p.R1929H|SCN5A_ENST00000423572.2_Missense_Mutation_p.R1928H|SCN5A_ENST00000449557.2_Missense_Mutation_p.R1875H|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000450102.2_Missense_Mutation_p.R1875H|SCN5A_ENST00000414099.2_Missense_Mutation_p.R1911H|SCN5A_ENST00000455624.2_Missense_Mutation_p.R1896H|SCN5A_ENST00000443581.1_Missense_Mutation_p.R1928H|SCN5A_ENST00000425664.1_Missense_Mutation_p.R1911H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1929	IQ.				AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.R1929H(2)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CGCCTGCTGACGGAAGAGGAA	0.627																																					p.R1911H												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G5732A	3						.						55.0	63.0	60.0					3																	38592077		2076	4194	6270	38567081	SO:0001583	missense	6331	exon27			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5786G>A	3.37:g.38592077C>T	ENSP00000328968:p.Arg1929His		38567081	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368538	0.82463	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96232	-3.86;-3.89;-3.89;-3.92;-3.89;-3.86;-3.89;-3.95;-3.92;-3.92	4.86	4.86	0.63082	.	0.134693	0.46145	D	0.000315	D	0.97365	0.9138	L	0.54863	1.705	0.58432	D	0.999999	D;D;P;P;B;P	0.89917	0.999;1.0;0.474;0.861;0.058;0.915	P;D;B;B;B;B	0.78314	0.835;0.991;0.124;0.149;0.035;0.373	D	0.97271	0.9911	10	0.45353	T	0.12	.	18.1641	0.89719	0.0:1.0:0.0:0.0	.	1875;1896;1911;1929;1928;1929	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	H	1911;1928;1929;1875;1928;1911;1929;1896;1875;1875	ENSP00000398962:R1911H;ENSP00000398266:R1928H;ENSP00000410257:R1929H;ENSP00000388797:R1875H;ENSP00000397915:R1928H;ENSP00000416634:R1911H;ENSP00000328968:R1929H;ENSP00000399524:R1896H;ENSP00000403355:R1875H;ENSP00000413996:R1875H	ENSP00000328968:R1929H	R	-	2	0	SCN5A	38567081	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.650000	0.61440	2.525000	0.85131	0.591000	0.81541	CGT		0.627	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
CTNNB1	1499	broad.mit.edu	37	3	41277276	41277276	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:41277276G>A	ENST00000349496.5	+	11	2025	c.1745G>A	c.(1744-1746)cGg>cAg	p.R582Q	CTNNB1_ENST00000453024.1_Missense_Mutation_p.R575Q|CTNNB1_ENST00000396183.3_Missense_Mutation_p.R582Q|CTNNB1_ENST00000396185.3_Missense_Mutation_p.R582Q|CTNNB1_ENST00000405570.1_Missense_Mutation_p.R582Q	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	582					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R582Q(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ATCCTAGCTCGGGATGTTCAC	0.428		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.R582Q	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1745A	3						.						169.0	166.0	167.0					3																	41277276		2203	4300	6503	41252280	SO:0001583	missense	1499	exon11	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1745G>A	3.37:g.41277276G>A	ENSP00000344456:p.Arg582Gln		41252280	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	37	6.048495	0.97236	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84556	0.5498	M	0.92970	3.365	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.997	P;D;P	0.91635	0.75;0.999;0.75	D	0.85930	0.1451	10	0.44086	T	0.13	-10.1887	19.661	0.95871	0.0:0.0:1.0:0.0	.	510;17;582	B4DSW9;P35222-2;P35222	.;.;CTNB1_HUMAN	Q	582;582;582;575;582	ENSP00000385604:R582Q;ENSP00000379486:R582Q;ENSP00000344456:R582Q;ENSP00000411226:R575Q;ENSP00000379488:R582Q	ENSP00000344456:R582Q	R	+	2	0	CTNNB1	41252280	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.659000	0.90383	0.655000	0.94253	CGG		0.428	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CADPS	8618	broad.mit.edu	37	3	62467405	62467405	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:62467405C>T	ENST00000383710.4	-	22	3515	c.3166G>A	c.(3166-3168)Gat>Aat	p.D1056N	CADPS_ENST00000283269.9_Intron|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1056	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.D1056N(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CACTCCGCATCATATATAGCA	0.383																																					p.D1056N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3166A	3						.						166.0	154.0	158.0					3																	62467405		1891	4129	6020	62442445	SO:0001583	missense	8618	exon22			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3166G>A	3.37:g.62467405C>T	ENSP00000373215:p.Asp1056Asn		62442445	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.84|18.84	3.708808|3.708808	0.68615|0.68615	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710|ENST00000473635	T|.	0.31769|.	1.48|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Munc13 homology 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70988|0.70988	0.3287|0.3287	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	D|.	0.63880|.	0.993|.	D|.	0.70935|.	0.971|.	T|T	0.66188|0.66188	-0.5986|-0.5986	10|5	0.42905|.	T|.	0.14|.	.|.	19.8041|19.8041	0.96521|0.96521	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1056|.	Q9ULU8|.	CAPS1_HUMAN|.	N|I	1056|42	ENSP00000373215:D1056N|.	ENSP00000373214:D1056N|.	D|M	-|-	1|3	0|0	CADPS|CADPS	62442445|62442445	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.445000|7.445000	0.80570|0.80570	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GAT|ATG		0.383	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
MAGI1	9223	broad.mit.edu	37	3	65342445	65342445	+	Missense_Mutation	SNP	C	C	T	rs142375705		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:65342445C>T	ENST00000402939.2	-	23	3996	c.3997G>A	c.(3997-3999)Gcc>Acc	p.A1333T	RP11-88H12.2_ENST00000602316.1_RNA|MAGI1_ENST00000330909.8_3'UTR	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1362					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.A1333T(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GTGTTGTCGGCGCTGCGGGTG	0.716																																					p.A1333T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3997A	3						.	C	THR/ALA,	0,4406		0,0,2203	46.0	48.0	48.0		3997,	5.3	1.0	3	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3	MAGI1	NM_001033057.1,NM_015520.1	58,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,	1333/1463,	65342445	1,13005	2203	4300	6503	65317485	SO:0001583	missense	9223	exon23			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3997G>A	3.37:g.65342445C>T	ENSP00000385450:p.Ala1333Thr		65317485	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000402939.2	37	CCDS33780.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.886316	0.72410	0.0	1.16E-4	ENSG00000151276	ENST00000402939	T	0.12255	2.7	5.31	5.31	0.75309	.	0.274240	0.33401	N	0.004958	T	0.26521	0.0648	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.03157	-1.1066	10	0.15066	T	0.55	-17.7534	18.9705	0.92713	0.0:1.0:0.0:0.0	.	1333	Q96QZ7-2	.	T	1333	ENSP00000385450:A1333T	ENSP00000385450:A1333T	A	-	1	0	MAGI1	65317485	1.000000	0.71417	0.964000	0.40570	0.691000	0.40173	4.089000	0.57685	2.479000	0.83701	0.655000	0.94253	GCC		0.716	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742	
EIF4A2	1974	broad.mit.edu	37	3	186505664	186505664	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr3:186505664A>G	ENST00000323963.5	+	10	1136	c.1072A>G	c.(1072-1074)Att>Gtt	p.I358V	EIF4A2_ENST00000356531.5_Missense_Mutation_p.I263V|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.I359V|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	358	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.I358V(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TGAAAACTATATTCACAGGTG	0.348			T	BCL6	NHL																																p.I358V			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1072G	3						.						65.0	66.0	66.0					3																	186505664		2203	4299	6502	187988358	SO:0001583	missense	1974	exon10			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.1072A>G	3.37:g.186505664A>G	ENSP00000326381:p.Ile358Val		187988358	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.284357	0.59867	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.78003	-1.14;-1.14;-1.14	5.43	5.43	0.79202	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.72993	0.3530	L	0.28458	0.855	0.80722	D	1	B;B;B	0.18741	0.014;0.024;0.03	B;B;B	0.35550	0.105;0.13;0.205	T	0.72093	-0.4394	10	0.87932	D	0	-2.2975	13.7119	0.62674	1.0:0.0:0.0:0.0	.	263;359;358	Q9NZE6;Q14240-2;Q14240	.;.;IF4A2_HUMAN	V	358;359;263	ENSP00000326381:I358V;ENSP00000398370:I359V;ENSP00000348925:I263V	ENSP00000326381:I358V	I	+	1	0	EIF4A2	187988358	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.838000	0.92115	2.187000	0.69744	0.460000	0.39030	ATT		0.348	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
TRMT10A	93587	broad.mit.edu	37	4	100470295	100470295	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:100470295G>A	ENST00000273962.3	-	8	1282	c.970C>T	c.(970-972)Cag>Tag	p.Q324*	TRMT10A_ENST00000394876.2_Nonsense_Mutation_p.Q324*|TRMT10A_ENST00000394877.3_Nonsense_Mutation_p.Q324*	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	324					magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.Q324*(1)									TCCTTATCCTGCTTTTCTTCA	0.408																																					p.Q324X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C970T	4						.						228.0	203.0	211.0					4																	100470295		2203	4300	6503	100689318	SO:0001587	stop_gained	93587	exon8			BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.970C>T	4.37:g.100470295G>A	ENSP00000273962:p.Gln324*		100689318	NM_001134665	B2R8X7|Q9Y2T9	Nonsense_Mutation	SNP	ENST00000273962.3	37	CCDS3650.1	.	.	.	.	.	.	.	.	.	.	G	36	5.956966	0.97145	.	.	ENSG00000145331	ENST00000394877;ENST00000273962;ENST00000394876	.	.	.	5.77	4.02	0.46733	.	1.479880	0.03638	N	0.239086	.	.	.	.	.	.	0.47308	D	0.999384	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-7.148	7.8774	0.29601	0.0857:0.1628:0.7516:0.0	.	.	.	.	X	324	.	ENSP00000273962:Q324X	Q	-	1	0	RG9MTD2	100689318	0.005000	0.15991	0.615000	0.29064	0.635000	0.38103	1.108000	0.31123	0.866000	0.35629	0.655000	0.94253	CAG		0.408	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253668.1	NM_152292	
ANK2	287	broad.mit.edu	37	4	114208797	114208797	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:114208797G>A	ENST00000357077.4	+	19	2169	c.2116G>A	c.(2116-2118)Gat>Aat	p.D706N	ANK2_ENST00000506722.1_Missense_Mutation_p.D685N|ANK2_ENST00000394537.3_Missense_Mutation_p.D706N|ANK2_ENST00000264366.6_Missense_Mutation_p.D706N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	706					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D706N(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCCCAGGAAGATAAAGTGAA	0.408																																					p.D706N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2116A	4						.						126.0	109.0	115.0					4																	114208797		2203	4300	6503	114428246	SO:0001583	missense	287	exon19			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2116G>A	4.37:g.114208797G>A	ENSP00000349588:p.Asp706Asn		114428246	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801865	0.70682	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.02;-0.03;-0.03	5.49	5.49	0.81192	Ankyrin repeat-containing domain (3);	0.000000	0.53938	D	0.000054	T	0.63534	0.2519	N	0.04132	-0.27	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.979	D;D;D;D;D	0.97110	1.0;0.983;0.999;0.999;0.989	T	0.74222	-0.3735	10	0.66056	D	0.02	.	19.3884	0.94566	0.0:0.0:1.0:0.0	.	706;706;706;685;685	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	N	685;652;685;721;706;706;706;685	ENSP00000423799:D685N;ENSP00000421011:D652N;ENSP00000421067:D685N;ENSP00000424722:D721N;ENSP00000378044:D706N;ENSP00000349588:D706N;ENSP00000264366:D706N	ENSP00000264366:D706N	D	+	1	0	ANK2	114428246	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	9.819000	0.99357	2.550000	0.86006	0.650000	0.86243	GAT		0.408	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
PHOX2B	8929	broad.mit.edu	37	4	41749376	41749376	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:41749376G>A	ENST00000226382.2	-	2	778	c.419C>T	c.(418-420)gCg>gTg	p.A140V	RP11-227F19.2_ENST00000510602.1_lincRNA|RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	140					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.A140V(1)		autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						CTGGACTCGCGCCTCTGTGAG	0.642			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.A140V		yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C419T	4	GRCh37	CM080494	PHOX2B	M		.						37.0	42.0	40.0					4																	41749376		2203	4299	6502	41444133	SO:0001583	missense	8929	exon2	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.419C>T	4.37:g.41749376G>A	ENSP00000226382:p.Ala140Val		41444133	NM_003924	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.012017|6.012017	0.97200|0.97200	.|.	.|.	ENSG00000109132|ENSG00000109132	ENST00000226382|ENST00000510424	D|.	0.96491|.	-4.03|.	5.54|5.54	5.54|5.54	0.83059|0.83059	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76702|0.76702	0.4024|0.4024	M|M	0.73372|0.73372	2.23|2.23	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.74441|0.74441	-0.3664|-0.3664	10|5	0.54805|.	T|.	0.06|.	.|.	19.6787|19.6787	0.95950|0.95950	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	140|.	Q99453|.	PHX2B_HUMAN|.	V|C	140|80	ENSP00000226382:A140V|.	ENSP00000226382:A140V|.	A|R	-|-	2|1	0|0	PHOX2B|PHOX2B	41444133|41444133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.588000|9.588000	0.98232|0.98232	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GCG|CGC		0.642	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
TXK	7294	broad.mit.edu	37	4	48096120	48096120	+	Missense_Mutation	SNP	A	A	C	rs368453867		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:48096120A>C	ENST00000264316.4	-	8	768	c.683T>G	c.(682-684)aTc>aGc	p.I228S	TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	228	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)	p.I228S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						GTGATACCAGATTAACTCAGG	0.483																																					p.I228S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T683G	4						.						155.0	150.0	152.0					4																	48096120		2203	4300	6503	47790877	SO:0001583	missense	7294	exon8			L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.683T>G	4.37:g.48096120A>C	ENSP00000264316:p.Ile228Ser		47790877	NM_003328	Q14220	Missense_Mutation	SNP	ENST00000264316.4	37	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376696	0.82682	.	.	ENSG00000074966	ENST00000264316	D	0.95069	-3.6	5.23	5.23	0.72850	SH2 motif (5);	0.068035	0.56097	D	0.000031	D	0.98191	0.9402	H	0.97291	3.975	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	D	0.99395	1.0926	10	0.87932	D	0	.	14.0929	0.65002	1.0:0.0:0.0:0.0	.	228	P42681	TXK_HUMAN	S	228	ENSP00000264316:I228S	ENSP00000264316:I228S	I	-	2	0	TXK	47790877	1.000000	0.71417	0.972000	0.41901	0.882000	0.50991	8.924000	0.92827	2.189000	0.69895	0.528000	0.53228	ATC		0.483	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
HOPX	84525	broad.mit.edu	37	4	57514898	57514898	+	Silent	SNP	G	G	A	rs76751592	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:57514898G>A	ENST00000337881.7	-	3	866	c.210C>T	c.(208-210)tcC>tcT	p.S70S	HOPX_ENST00000503639.3_Silent_p.S70S|HOPX_ENST00000381255.3_Silent_p.S70S|HOPX_ENST00000555760.2_Silent_p.S70S|HOPX_ENST00000556376.2_Silent_p.S70S|HOPX_ENST00000554144.1_3'UTR|HOPX_ENST00000553379.2_Silent_p.S70S|HOPX_ENST00000381260.3_3'UTR|HOPX_ENST00000508121.1_Silent_p.S88S|HOPX_ENST00000556614.2_Silent_p.S70S|HOPX_ENST00000317745.7_Silent_p.S70S|HOPX_ENST00000420433.1_Silent_p.S88S	NM_139212.3	NP_631958.1	Q9BPY8	HOP_HUMAN	HOP homeobox	70					heart development (GO:0007507)|histone deacetylation (GO:0016575)|lung alveolus development (GO:0048286)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of heart contraction (GO:0008016)|regulation of protein binding (GO:0043393)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S70S(2)		large_intestine(2)|lung(5)|skin(1)	8	Glioma(25;0.08)|all_neural(26;0.101)					AGTCTGTGACGGATCTGCACT	0.493													G|||	5	0.000998403	0.0038	0.0	5008	,	,		19630	0.0		0.0	False		,,,				2504	0.0				p.S88S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C264T	4						.	G	,,,,	13,4393	20.2+/-43.8	0,13,2190	108.0	100.0	103.0		210,,264,210,210	-1.0	1.0	4	dbSNP_133	103	0,8600		0,0,4300	no	coding-synonymous,utr-3,coding-synonymous,coding-synonymous,coding-synonymous	HOPX	NM_001145459.1,NM_001145460.1,NM_032495.5,NM_139211.4,NM_139212.3	,,,,	0,13,6490	AA,AG,GG		0.0,0.2951,0.1	,,,,	70/74,,88/92,70/74,70/74	57514898	13,12993	2203	4300	6503	57209655	SO:0001819	synonymous_variant	84525	exon4				CCDS3507.1, CCDS47062.1, CCDS54767.1	4q12	2011-06-20			ENSG00000171476	ENSG00000171476		"""Homeoboxes / PRD class"""	24961	protein-coding gene	gene with protein product	"""homeobox only domain"""	607275				12297045	Standard	NM_032495		Approved	LAGY, HOP, OB1, NECC1, SMAP31	uc003hbz.2	Q9BPY8	OTTHUMG00000128768	ENST00000337881.7:c.210C>T	4.37:g.57514898G>A			57209655	NM_032495	A8K0Z2|E9PB55|G3V294|Q8N0V6|Q96CI1	Silent	SNP	ENST00000337881.7	37	CCDS3507.1																																																																																				0.493	HOPX-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250689.4		
UGT2B15	7366	broad.mit.edu	37	4	69536035	69536035	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:69536035A>G	ENST00000338206.5	-	1	311	c.302T>C	c.(301-303)gTt>gCt	p.V101A		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	101					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.V101A(1)								Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTTTTTGAAACACCATATAT	0.274																																					p.V101A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T302C	4						.						68.0	79.0	75.0					4																	69536035		2201	4298	6499	69218630	SO:0001583	missense	7366	exon1			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.302T>C	4.37:g.69536035A>G	ENSP00000341045:p.Val101Ala		69218630	NM_001076	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	a	4.949	0.176391	0.09443	.	.	ENSG00000196620	ENST00000338206	T	0.61040	0.14	2.79	0.118	0.14667	.	12.217500	0.01662	U	0.025151	T	0.34077	0.0885	N	0.03209	-0.39	0.09310	N	1	B	0.11235	0.004	B	0.23275	0.045	T	0.18429	-1.0337	10	0.33141	T	0.24	.	4.0378	0.09737	0.6605:0.2117:0.1278:0.0	.	101	P54855	UDB15_HUMAN	A	101	ENSP00000341045:V101A	ENSP00000341045:V101A	V	-	2	0	UGT2B15	69218630	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.377000	0.07456	-0.079000	0.12707	-0.781000	0.03364	GTT		0.274	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
ARHGAP24	83478	broad.mit.edu	37	4	86921741	86921741	+	Missense_Mutation	SNP	G	G	A	rs139260529		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:86921741G>A	ENST00000395184.1	+	10	2579	c.2113G>A	c.(2113-2115)Gag>Aag	p.E705K	ARHGAP24_ENST00000264343.4_Missense_Mutation_p.E612K|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.E610K|RP13-514E23.2_ENST00000610225.1_RNA	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	705					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.E705K(1)|p.E612K(1)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GCGAAATGCCGAGCGAGCAAA	0.418																																					p.E612K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1834A	4						.	G	LYS/GLU,LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	78.0	80.0	79.0		2113,1828,1834	5.6	1.0	4	dbSNP_134	79	0,8600		0,0,4300	no	missense,missense,missense	ARHGAP24	NM_001025616.2,NM_001042669.1,NM_031305.2	56,56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	705/749,610/654,612/656	86921741	1,13005	2203	4300	6503	87140765	SO:0001583	missense	83478	exon7			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.2113G>A	4.37:g.86921741G>A	ENSP00000378611:p.Glu705Lys		87140765	NM_031305	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	35	5.590282	0.96590	2.27E-4	0.0	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.74512	0.3726	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.986	T	0.76242	-0.3031	10	0.87932	D	0	.	19.8835	0.96906	0.0:0.0:1.0:0.0	.	610;612;705	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	K	705;610;620;612	ENSP00000378611:E705K;ENSP00000378610:E610K;ENSP00000425589:E620K;ENSP00000264343:E612K	ENSP00000264343:E612K	E	+	1	0	ARHGAP24	87140765	1.000000	0.71417	0.970000	0.41538	0.985000	0.73830	9.772000	0.98984	2.777000	0.95525	0.655000	0.94253	GAG		0.418	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
FBXW7	55294	broad.mit.edu	37	4	153245446	153245446	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr4:153245446G>A	ENST00000281708.4	-	11	2974	c.1745C>T	c.(1744-1746)tCg>tTg	p.S582L	FBXW7_ENST00000603548.1_Missense_Mutation_p.S582L|FBXW7_ENST00000263981.5_Missense_Mutation_p.S502L|FBXW7_ENST00000603841.1_Missense_Mutation_p.S582L|FBXW7_ENST00000393956.3_Missense_Mutation_p.S406L|FBXW7_ENST00000296555.5_Missense_Mutation_p.S464L	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	582			S -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.S582L(10)|p.S502L(2)|p.S343L(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTTGTTAACGACTGGTGCCC	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.S502L			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,colon,Substitution - Missense,0 	.	15	Substitution - Missense(14)|Unknown(1)	large_intestine(14)|haematopoietic_and_lymphoid_tissue(1)	c.C1505T	4						.						150.0	126.0	134.0					4																	153245446		2203	4300	6503	153464896	SO:0001583	missense	55294	exon10			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1745C>T	4.37:g.153245446G>A	ENSP00000281708:p.Ser582Leu		153464896	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429316	0.62844	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	M	0.81179	2.53	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.99;0.993;0.988;0.988	T	0.66480	-0.5913	10	0.39692	T	0.17	-9.1133	19.838	0.96666	0.0:0.0:1.0:0.0	.	406;582;464;502	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	L	582;464;502;406	ENSP00000281708:S582L;ENSP00000296555:S464L;ENSP00000263981:S502L;ENSP00000377528:S406L	ENSP00000263981:S502L	S	-	2	0	FBXW7	153464896	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.869000	0.99810	2.692000	0.91855	0.650000	0.86243	TCG		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
IRF1	3659	broad.mit.edu	37	5	131820150	131820150	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:131820150C>G	ENST00000245414.4	-	9	1015	c.757G>C	c.(757-759)Ggg>Cgg	p.G253R	IRF1_ENST00000405885.2_Missense_Mutation_p.G253R|IRF1_ENST00000463784.1_5'Flank	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	253					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G253R(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		TACCCCTTCCCATCCACGTTT	0.557																																					p.G253R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757C	5						.						131.0	127.0	129.0					5																	131820150		2203	4300	6503	131848049	SO:0001583	missense	3659	exon9				CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.757G>C	5.37:g.131820150C>G	ENSP00000245414:p.Gly253Arg		131848049	NM_002198	Q96GG7	Missense_Mutation	SNP	ENST00000245414.4	37	CCDS4155.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407863	0.83340	.	.	ENSG00000125347	ENST00000245414;ENST00000405885	D;D	0.84442	-1.85;-1.85	5.67	5.67	0.87782	.	0.099701	0.64402	D	0.000001	D	0.91815	0.7410	M	0.68952	2.095	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.92103	0.5690	10	0.72032	D	0.01	-27.2147	18.3462	0.90322	0.0:1.0:0.0:0.0	.	253	P10914	IRF1_HUMAN	R	253	ENSP00000245414:G253R;ENSP00000384406:G253R	ENSP00000245414:G253R	G	-	1	0	IRF1	131848049	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	4.766000	0.62279	2.677000	0.91161	0.561000	0.74099	GGG		0.557	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1	NM_002198	
PRDM9	56979	broad.mit.edu	37	5	23526580	23526580	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:23526580A>T	ENST00000296682.3	+	11	1565	c.1383A>T	c.(1381-1383)aaA>aaT	p.K461N		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	461					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.K461N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AAAGGTCCAAACTCTTGAATA	0.463										HNSCC(3;0.000094)																											p.K461N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1383T	5						.						41.0	42.0	42.0					5																	23526580		2202	4297	6499	23562337	SO:0001583	missense	56979	exon11			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1383A>T	5.37:g.23526580A>T	ENSP00000296682:p.Lys461Asn		23562337	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	A	9.669	1.146314	0.21288	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.09817	2.94	2.71	-1.48	0.08745	.	0.633782	0.13062	N	0.416830	T	0.06096	0.0158	L	0.46157	1.445	0.21105	N	0.999786	P	0.39480	0.675	B	0.34824	0.19	T	0.28332	-1.0047	10	0.19590	T	0.45	-1.3026	0.3521	0.00351	0.3955:0.1919:0.2244:0.1881	.	461	Q9NQV7	PRDM9_HUMAN	N	461;255	ENSP00000296682:K461N	ENSP00000253473:K255N	K	+	3	2	PRDM9	23562337	0.000000	0.05858	0.010000	0.14722	0.032000	0.12392	-0.295000	0.08298	-0.300000	0.08895	-0.626000	0.03995	AAA		0.463	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
DHX29	54505	broad.mit.edu	37	5	54594436	54594436	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:54594436C>T	ENST00000251636.5	-	2	392	c.244G>A	c.(244-246)Gat>Aat	p.D82N		NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	82						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.D82N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				ATAGATTTATCCAGATTTGCA	0.284																																					p.D82N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G244A	5						.						33.0	38.0	36.0					5																	54594436		2191	4283	6474	54630193	SO:0001583	missense	54505	exon2			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.244G>A	5.37:g.54594436C>T	ENSP00000251636:p.Asp82Asn		54630193	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084299	0.76642	.	.	ENSG00000067248	ENST00000251636	T	0.41065	1.01	4.75	4.75	0.60458	.	0.093245	0.64402	D	0.000001	T	0.58206	0.2106	L	0.54323	1.7	0.40846	D	0.983717	D	0.89917	1.0	D	0.75484	0.986	T	0.60939	-0.7163	10	0.56958	D	0.05	.	13.4692	0.61273	0.0:0.8425:0.1575:0.0	.	82	Q7Z478	DHX29_HUMAN	N	82	ENSP00000251636:D82N	ENSP00000251636:D82N	D	-	1	0	DHX29	54630193	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.842000	0.55858	2.327000	0.79052	0.557000	0.71058	GAT		0.284	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
MAP1B	4131	broad.mit.edu	37	5	71491802	71491802	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:71491802G>A	ENST00000296755.7	+	5	2918	c.2620G>A	c.(2620-2622)Gaa>Aaa	p.E874K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	874					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.E874K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGAGCCAGTCGAAGCCTACGT	0.502																																					p.E874K	Melanoma(17;367 822 11631 31730 47712)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2620A	5						.						123.0	122.0	122.0					5																	71491802		2203	4300	6503	71527558	SO:0001583	missense	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2620G>A	5.37:g.71491802G>A	ENSP00000296755:p.Glu874Lys		71527558	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.113953	0.37339	.	.	ENSG00000131711	ENST00000296755	T	0.04156	3.69	5.17	3.4	0.38934	.	0.630262	0.15451	N	0.261644	T	0.03053	0.0090	N	0.08118	0	0.53688	D	0.999978	B;B	0.17268	0.021;0.021	B;B	0.12156	0.007;0.007	T	0.49143	-0.8970	10	0.44086	T	0.13	-9.265	9.8438	0.41015	0.1582:0.0:0.8418:0.0	.	748;874	A2BDK6;P46821	.;MAP1B_HUMAN	K	874	ENSP00000296755:E874K	ENSP00000296755:E874K	E	+	1	0	MAP1B	71527558	1.000000	0.71417	0.482000	0.27366	0.221000	0.24807	5.677000	0.68142	0.587000	0.29643	-0.194000	0.12790	GAA		0.502	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
HMGCR	3156	broad.mit.edu	37	5	74651235	74651235	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:74651235C>T	ENST00000287936.4	+	14	1924	c.1768C>T	c.(1768-1770)Cgt>Tgt	p.R590C	HMGCR_ENST00000343975.5_Missense_Mutation_p.R537C|HMGCR_ENST00000511206.1_Missense_Mutation_p.R590C	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	590	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)	p.R590C(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TGGGATGACTCGTGGCCCAGT	0.502																																					p.R590C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1768T	5						.						201.0	189.0	193.0					5																	74651235		2203	4300	6503	74686991	SO:0001583	missense	3156	exon14				CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1768C>T	5.37:g.74651235C>T	ENSP00000287936:p.Arg590Cys		74686991	NM_000859	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369127	0.82463	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.64085	-0.08;-0.08;-0.08	6.17	6.17	0.99709	Hydroxymethylglutaryl-CoA reductase, class I/II, NAD/NADP-binding (2);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.88288	0.6396	H	0.98178	4.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.91305	0.5070	10	0.87932	D	0	-13.9437	20.8794	0.99867	0.0:1.0:0.0:0.0	.	590;537;590	B2R649;P04035-2;P04035	.;.;HMDH_HUMAN	C	590;521;590;537	ENSP00000426745:R590C;ENSP00000287936:R590C;ENSP00000340816:R537C	ENSP00000287936:R590C	R	+	1	0	HMGCR	74686991	0.889000	0.30405	0.801000	0.32222	0.995000	0.86356	1.799000	0.38824	2.941000	0.99782	0.655000	0.94253	CGT		0.502	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
VCAN	1462	broad.mit.edu	37	5	82818051	82818051	+	Missense_Mutation	SNP	C	C	T	rs149651541		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:82818051C>T	ENST00000265077.3	+	7	4491	c.3926C>T	c.(3925-3927)aCg>aTg	p.T1309M	VCAN_ENST00000342785.4_Missense_Mutation_p.T1309M|VCAN_ENST00000512590.2_Missense_Mutation_p.T1261M|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1309	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.T1309M(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCGCTTTCTACGCCACAGCCC	0.448																																					p.T1309M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3926T	5						.	C	,,MET/THR,MET/THR	4,4400		0,4,2198	58.0	60.0	59.0		,,3926,3926	5.6	0.7	5	dbSNP_134	59	1,8597		0,1,4298	yes	intron,intron,missense,missense	VCAN	NM_001126336.2,NM_001164097.1,NM_001164098.1,NM_004385.4	,,81,81	0,5,6496	TT,TC,CC		0.0116,0.0908,0.0385	,,probably-damaging,probably-damaging	,,1309/1643,1309/3397	82818051	5,12997	2202	4299	6501	82853807	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3926C>T	5.37:g.82818051C>T	ENSP00000265077:p.Thr1309Met		82853807	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	C	11.44	1.639999	0.29157	9.08E-4	1.16E-4	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.87650	-2.28;-2.23;-2.26	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000006	D	0.92851	0.7726	M	0.74258	2.255	0.40401	D	0.979647	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93616	0.6943	10	0.87932	D	0	.	14.4793	0.67570	0.1469:0.8531:0.0:0.0	.	1309;1309	P13611-3;P13611	.;CSPG2_HUMAN	M	1309;1309;1261	ENSP00000265077:T1309M;ENSP00000342768:T1309M;ENSP00000425959:T1261M	ENSP00000265077:T1309M	T	+	2	0	VCAN	82853807	0.997000	0.39634	0.719000	0.30619	0.002000	0.02628	2.492000	0.45311	2.650000	0.89964	0.655000	0.94253	ACG		0.448	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PCDHB16	57717	broad.mit.edu	37	5	140567962	140567962	+	IGR	SNP	C	C	A	rs369161237		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr5:140567962C>A	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACTCTGTTGCTGAAAACTCT	0.388																																					p.A357D												.	.	0			c.C1070A	5						.						69.0	72.0	71.0					5																	140567962		2045	4238	6283	140548146	SO:0001628	intergenic_variant	56127	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567962C>A			140548146	NM_019119	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1																																																																																				0.388	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
REV3L	5980	broad.mit.edu	37	6	111628731	111628731	+	Silent	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:111628731G>T	ENST00000358835.3	-	32	9539	c.9085C>A	c.(9085-9087)Cgg>Agg	p.R3029R	REV3L_ENST00000368802.3_Silent_p.R3029R|REV3L_ENST00000462119.1_5'UTR|REV3L_ENST00000368805.1_Silent_p.R3029R|REV3L_ENST00000435970.1_Silent_p.R2951R|RP5-1112D6.8_ENST00000607434.1_RNA			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	3029					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.R2951R(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTGCCTTTCCGCCCTTCAGGT	0.443								DNA polymerases (catalytic subunits)																													p.R3029R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9085A	6						.						134.0	119.0	124.0					6																	111628731		2203	4300	6503	111735424	SO:0001819	synonymous_variant	5980	exon31			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.9085C>A	6.37:g.111628731G>T			111735424	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																				0.443	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
SYNE1	23345	broad.mit.edu	37	6	152472789	152472789	+	Missense_Mutation	SNP	G	G	A	rs144056525	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:152472789G>A	ENST00000367255.5	-	135	24950	c.24349C>T	c.(24349-24351)Cgg>Tgg	p.R8117W	SYNE1_ENST00000539504.1_Missense_Mutation_p.R272W|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7729W|SYNE1_ENST00000354674.4_Missense_Mutation_p.R272W|SYNE1_ENST00000423061.1_Missense_Mutation_p.R8046W|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Missense_Mutation_p.R8046W|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2641W|SYNE1_ENST00000265368.4_Missense_Mutation_p.R8117W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8117					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R8117W(4)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGCTGTCCCGCGCAGTCTCA	0.398										HNSCC(10;0.0054)																											p.R2641W												.	.	4	Substitution - Missense(4)	large_intestine(2)|pancreas(2)	c.C7921T	6						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	40.0	40.0	40.0		24136,24349	6.0	1.0	6	dbSNP_134	40	14,8586	10.5+/-38.8	1,12,4287	yes	missense,missense	SYNE1	NM_033071.3,NM_182961.3	101,101	1,12,6490	AA,AG,GG		0.1628,0.0,0.1076	probably-damaging,probably-damaging	8046/8750,8117/8798	152472789	14,12992	2203	4300	6503	152514482	SO:0001583	missense	23345	exon50			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24349C>T	6.37:g.152472789G>A	ENSP00000356224:p.Arg8117Trp		152514482	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348052	0.82132	0.0	0.001628	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.97	5.97	0.96955	.	0.000000	0.53938	D	0.000046	T	0.59487	0.2197	M	0.64404	1.975	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.996;0.998;0.997	T	0.58233	-0.7672	10	0.51188	T	0.08	.	15.1877	0.73016	0.0:0.0:0.8592:0.1408	.	8117;8117;8046;8046;319	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	W	8117;272;763;8046;8117;8046;7729;2641;279;274;1039;272	ENSP00000356224:R8117W;ENSP00000441052:R272W;ENSP00000356226:R763W;ENSP00000396024:R8046W;ENSP00000265368:R8117W;ENSP00000390975:R8046W;ENSP00000341887:R7729W;ENSP00000349276:R2641W;ENSP00000356220:R1039W;ENSP00000346701:R272W	ENSP00000265368:R8117W	R	-	1	2	SYNE1	152514482	1.000000	0.71417	0.972000	0.41901	0.961000	0.63080	3.000000	0.49481	2.836000	0.97738	0.655000	0.94253	CGG		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
C6orf10	10665	broad.mit.edu	37	6	32260804	32260804	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:32260804G>A	ENST00000447241.2	-	23	1818	c.1646C>T	c.(1645-1647)gCg>gTg	p.A549V	C6orf10_ENST00000527965.1_Missense_Mutation_p.A533V|C6orf10_ENST00000375007.4_Missense_Mutation_p.A547V|C6orf10_ENST00000533191.1_Missense_Mutation_p.A547V|C6orf10_ENST00000442822.2_Intron|C6orf10_ENST00000375015.4_Missense_Mutation_p.A548V	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	549	Lys-rich.					integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.A549V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						ATTTGCCTTCGCCCTTTTCGA	0.353																																					p.E549V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1646T	6						.						124.0	135.0	131.0					6																	32260804		1511	2709	4220	32368782	SO:0001583	missense	10665	exon23			U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.1646C>T	6.37:g.32260804G>A	ENSP00000415517:p.Ala549Val		32368782	NM_006781	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Missense_Mutation	SNP	ENST00000447241.2	37	CCDS34422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.49|10.49	1.364801|1.364801	0.24684|0.24684	.|.	.|.	ENSG00000204296|ENSG00000204296	ENST00000375002|ENST00000447241;ENST00000375015;ENST00000533191;ENST00000527965;ENST00000375007;ENST00000305725	.|T;T;T;T;T	.|0.04083	.|3.72;3.72;3.72;3.72;3.71	4.24|4.24	1.26|1.26	0.21427|0.21427	.|.	.|.	.|.	.|.	.|.	.|T	.|0.01905	.|0.0060	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|D	.|0.60160	.|0.987	.|P	.|0.51170	.|0.661	.|T	.|0.40001	.|-0.9586	.|9	.|0.31617	.|T	.|0.26	.|.	2.335|2.335	0.04245|0.04245	0.0987:0.168:0.3892:0.3441|0.0987:0.168:0.3892:0.3441	.|.	.|549	.|Q5SRN2	.|CF010_HUMAN	.|V	-1|549;548;547;533;547;546	.|ENSP00000415517:A549V;ENSP00000364155:A548V;ENSP00000431199:A547V;ENSP00000435103:A533V;ENSP00000364146:A547V	.|ENSP00000303292:A546V	.|A	-|-	.|2	.|0	C6orf10|C6orf10	32368782|32368782	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.018000|0.018000	0.09664|0.09664	0.129000|0.129000	0.15830|0.15830	0.125000|0.125000	0.18397|0.18397	0.460000|0.460000	0.39030|0.39030	.|GCG		0.353	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076178.4	NM_006781	
CUL9	23113	broad.mit.edu	37	6	43156293	43156293	+	Missense_Mutation	SNP	C	C	T	rs368734594		TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:43156293C>T	ENST00000252050.4	+	8	2104	c.2020C>T	c.(2020-2022)Cgc>Tgc	p.R674C	CUL9_ENST00000372647.2_Missense_Mutation_p.R674C|CUL9_ENST00000354495.3_Missense_Mutation_p.R564C	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	674					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.R674C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TCCCGGTCCTCGCAGCTCCCT	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		18757	0.001		0.0	False		,,,				2504	0.0				p.R674C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2020T	6						.						46.0	45.0	45.0					6																	43156293		2203	4300	6503	43264271	SO:0001583	missense	23113	exon8			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2020C>T	6.37:g.43156293C>T	ENSP00000252050:p.Arg674Cys		43264271	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022353	0.75275	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74947	-0.88;-0.89;-0.78	4.81	3.87	0.44632	.	0.968679	0.08501	N	0.936481	T	0.59810	0.2221	N	0.24115	0.695	0.43994	D	0.996692	D;D	0.65815	0.995;0.995	P;P	0.50231	0.635;0.635	T	0.60429	-0.7265	10	0.72032	D	0.01	-9.4411	9.3474	0.38118	0.2292:0.7708:0.0:0.0	.	674;674	E9PEZ1;Q8IWT3	.;CUL9_HUMAN	C	674;564;674	ENSP00000252050:R674C;ENSP00000346490:R564C;ENSP00000361730:R674C	ENSP00000252050:R674C	R	+	1	0	CUL9	43264271	0.976000	0.34144	0.992000	0.48379	0.993000	0.82548	2.564000	0.45931	2.482000	0.83794	0.563000	0.77884	CGC		0.537	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
EYS	346007	broad.mit.edu	37	6	66204814	66204814	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:66204814G>A	ENST00000370621.3	-	4	1016	c.490C>T	c.(490-492)Cga>Tga	p.R164*	EYS_ENST00000370616.2_Nonsense_Mutation_p.R164*|EYS_ENST00000370618.3_Nonsense_Mutation_p.R164*|EYS_ENST00000342421.5_Nonsense_Mutation_p.R164*|EYS_ENST00000503581.1_Nonsense_Mutation_p.R164*|EYS_ENST00000393380.2_Nonsense_Mutation_p.R164*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	164					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R164*(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACATTTAGTCGAAGTCCCAGT	0.428																																					p.R164X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C490T	6						.						72.0	64.0	67.0					6																	66204814		2203	4300	6503	66261535	SO:0001587	stop_gained	346007	exon3				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.490C>T	6.37:g.66204814G>A	ENSP00000359655:p.Arg164*		66261535	NM_198283	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	39	7.865760	0.98534	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	.	.	.	4.54	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	6.7488	0.23475	0.1041:0.1754:0.7205:0.0	.	.	.	.	X	164	.	ENSP00000341818:R164X	R	-	1	2	EYS	66261535	0.509000	0.26163	0.467000	0.27180	0.992000	0.81027	0.687000	0.25407	0.386000	0.24997	0.591000	0.81541	CGA		0.428	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
IGF2R	3482	broad.mit.edu	37	6	160491078	160491078	+	Silent	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr6:160491078C>T	ENST00000356956.1	+	31	4579	c.4431C>T	c.(4429-4431)agC>agT	p.S1477S		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1477					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.S1477S(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCACCTGCAGCGAGAGCCAAG	0.532																																					p.S1477S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4431T	6						.						92.0	76.0	82.0					6																	160491078		2203	4300	6503	160411068	SO:0001819	synonymous_variant	3482	exon31			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4431C>T	6.37:g.160491078C>T			160411068	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1																																																																																				0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
WIPI2	26100	broad.mit.edu	37	7	5269346	5269346	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr7:5269346T>C	ENST00000288828.4	+	12	1461	c.1229T>C	c.(1228-1230)gTg>gCg	p.V410A	WIPI2_ENST00000484262.1_Intron|WIPI2_ENST00000401525.3_Missense_Mutation_p.V392A|WIPI2_ENST00000404704.3_Intron|WIPI2_ENST00000382384.2_Intron	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	410					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.V410A(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GGTACTTACGTGCCTTCATCC	0.567																																					p.V410A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1229C	7						.						108.0	71.0	83.0					7																	5269346		2203	4300	6503	5235872	SO:0001583	missense	26100	exon12				CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.1229T>C	7.37:g.5269346T>C	ENSP00000288828:p.Val410Ala		5235872	NM_015610	B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	ENST00000288828.4	37	CCDS5339.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.653425	0.00779	.	.	ENSG00000157954	ENST00000288828;ENST00000401525	T;T	0.34859	1.34;1.34	5.59	-5.14	0.02875	.	0.968272	0.08555	N	0.928401	T	0.13329	0.0323	N	0.11064	0.09	0.23834	N	0.996714	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.36480	-0.9746	10	0.02654	T	1	-4.7575	7.3666	0.26776	0.0:0.4057:0.2364:0.3579	.	392;410	Q9Y4P8-4;Q9Y4P8	.;WIPI2_HUMAN	A	410;392	ENSP00000288828:V410A;ENSP00000384945:V392A	ENSP00000288828:V410A	V	+	2	0	WIPI2	5235872	0.968000	0.33430	0.004000	0.12327	0.037000	0.13140	0.100000	0.15231	-1.284000	0.02390	0.533000	0.62120	GTG		0.567	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241669.2	NM_015610	
AMPH	273	broad.mit.edu	37	7	38433614	38433614	+	Silent	SNP	T	T	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr7:38433614T>C	ENST00000356264.2	-	18	1814	c.1599A>G	c.(1597-1599)acA>acG	p.T533T	AMPH_ENST00000428293.2_Silent_p.T491T|AMPH_ENST00000325590.5_Silent_p.T491T|AMPH_ENST00000471913.1_5'UTR	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	533					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.T533T(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CCTGAGGCACTGTTGCTTCGA	0.552																																					p.T491T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1473G	7						.						132.0	108.0	116.0					7																	38433614		2203	4300	6503	38400139	SO:0001819	synonymous_variant	273	exon17				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1599A>G	7.37:g.38433614T>C			38400139	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Silent	SNP	ENST00000356264.2	37	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	T	7.430	0.638488	0.14386	.	.	ENSG00000078053	ENST00000441628	.	.	.	5.93	-3.17	0.05202	.	.	.	.	.	T	0.18841	0.0452	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.29212	-1.0019	4	.	.	.	-4.0913	2.2095	0.03945	0.1347:0.1697:0.4276:0.268	.	.	.	.	G	416	.	.	S	-	1	0	AMPH	38400139	0.000000	0.05858	0.002000	0.10522	0.182000	0.23217	-1.078000	0.03413	-0.136000	0.11475	0.460000	0.39030	AGT		0.552	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ZNF479	90827	broad.mit.edu	37	7	57188190	57188190	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr7:57188190G>T	ENST00000331162.4	-	5	1202	c.932C>A	c.(931-933)aCc>aAc	p.T311N		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T311N(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GTCAGTGAGGGTTGAGGATAC	0.458																																					p.T311N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C932A	7						.						18.0	18.0	18.0					7																	57188190		1865	4050	5915	57192132	SO:0001583	missense	90827	exon5			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.932C>A	7.37:g.57188190G>T	ENSP00000333776:p.Thr311Asn		57192132	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.388144	0.00202	.	.	ENSG00000185177	ENST00000331162	T	0.07444	3.19	1.01	-2.03	0.07365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	N	0.01656	-0.775	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.43686	-0.9376	9	0.10902	T	0.67	.	4.602	0.12357	0.0:0.2295:0.5394:0.2311	.	311	Q96JC4	ZN479_HUMAN	N	311	ENSP00000333776:T311N	ENSP00000333776:T311N	T	-	2	0	ZNF479	57192132	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.906000	0.00701	-1.464000	0.01902	-1.457000	0.01029	ACC		0.458	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
ZNF479	90827	broad.mit.edu	37	7	57193740	57193740	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr7:57193740C>A	ENST00000331162.4	-	4	517	c.247G>T	c.(247-249)Gta>Tta	p.V83L		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	83	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V83L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TGTTTGGCTACCATCTCATTT	0.428																																					p.V83L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G247T	7						.						72.0	78.0	76.0					7																	57193740		2041	4089	6130	57197682	SO:0001583	missense	90827	exon4			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.247G>T	7.37:g.57193740C>A	ENSP00000333776:p.Val83Leu		57197682	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	c	3.196	-0.164790	0.06502	.	.	ENSG00000185177	ENST00000331162	T	0.05996	3.36	1.25	-1.65	0.08291	Krueppel-associated box (1);	.	.	.	.	T	0.04861	0.0131	L	0.39020	1.185	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39563	-0.9608	9	0.46703	T	0.11	.	4.222	0.10563	0.0:0.5376:0.0:0.4624	.	83	Q96JC4	ZN479_HUMAN	L	83	ENSP00000333776:V83L	ENSP00000333776:V83L	V	-	1	0	ZNF479	57197682	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.180000	0.09754	-0.414000	0.07495	-0.515000	0.04445	GTA		0.428	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
MGAM	8972	broad.mit.edu	37	7	141755397	141755397	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr7:141755397G>C	ENST00000549489.2	+	28	3449	c.3354G>C	c.(3352-3354)atG>atC	p.M1118I	MGAM_ENST00000475668.2_Missense_Mutation_p.M1118I	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1118	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.M1118I(2)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCAGTGACATGTTTATCCGCA	0.483																																					p.M1118I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3354C	7						.						159.0	145.0	149.0					7																	141755397		1929	4139	6068	141401866	SO:0001583	missense	8972	exon28			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3354G>C	7.37:g.141755397G>C	ENSP00000447378:p.Met1118Ile		141401866	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344868	0.61073	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.82619	-1.63	3.74	3.74	0.42951	Glycoside hydrolase-type carbohydrate-binding (1);	.	.	.	.	D	0.82582	0.5068	M	0.72894	2.215	0.36089	D	0.843354	P	0.38300	0.626	B	0.38842	0.283	D	0.88186	0.2874	9	0.66056	D	0.02	.	14.3696	0.66830	0.0:0.0:1.0:0.0	.	1118	O43451	MGA_HUMAN	I	1118;1118;995	ENSP00000447378:M1118I	ENSP00000316431:M995I	M	+	3	0	MGAM	141401866	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.459000	0.73513	1.626000	0.50381	0.461000	0.40582	ATG		0.483	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
C8orf74	203076	broad.mit.edu	37	8	10555487	10555487	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr8:10555487C>T	ENST00000304519.5	+	3	649	c.620C>T	c.(619-621)gCg>gTg	p.A207V	RP1L1_ENST00000329335.3_Intron	NM_001040032.1	NP_001035121	Q6P047	CH074_HUMAN	chromosome 8 open reading frame 74	207								p.A207V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13				COAD - Colon adenocarcinoma(149;0.0811)		GCCGCGCCTGCGCAGCCCGGC	0.711																																					p.A207V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C620T	8						.						4.0	5.0	5.0					8																	10555487		1910	4046	5956	10592897	SO:0001583	missense	203076	exon3			BC038534	CCDS47800.1	8p23.1	2012-04-17			ENSG00000171060	ENSG00000171060			32296	protein-coding gene	gene with protein product							Standard	NM_001040032		Approved		uc003wtd.1	Q6P047	OTTHUMG00000163807	ENST00000304519.5:c.620C>T	8.37:g.10555487C>T	ENSP00000307129:p.Ala207Val		10592897	NM_001040032	A2RUD6	Missense_Mutation	SNP	ENST00000304519.5	37	CCDS47800.1	.	.	.	.	.	.	.	.	.	.	C	5.236	0.228996	0.09916	.	.	ENSG00000171060	ENST00000304519	T	0.29397	1.57	5.24	-10.5	0.00291	.	1.782450	0.02519	N	0.092307	T	0.14874	0.0359	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.10450	0.005	T	0.09207	-1.0685	10	0.23302	T	0.38	.	3.8747	0.09051	0.1425:0.1613:0.449:0.2471	.	207	Q6P047	CH074_HUMAN	V	207	ENSP00000307129:A207V	ENSP00000307129:A207V	A	+	2	0	C8orf74	10592897	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.724000	0.00383	-3.523000	0.00147	-1.263000	0.01449	GCG		0.711	C8orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375675.1	NM_001040032	
ZFPM2	23414	broad.mit.edu	37	8	106814619	106814619	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr8:106814619G>C	ENST00000407775.2	+	8	2559	c.2309G>C	c.(2308-2310)tGt>tCt	p.C770S	RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.C501S|ZFPM2_ENST00000520492.1_Missense_Mutation_p.C638S|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.C638S|ZFPM2_ENST00000522296.1_3'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	770					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.C770S(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AATAATCCTTGTACCTCCACT	0.468																																					p.C770S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2309C	8						.						62.0	61.0	61.0					8																	106814619		1947	4151	6098	106883795	SO:0001583	missense	23414	exon8			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2309G>C	8.37:g.106814619G>C	ENSP00000384179:p.Cys770Ser		106883795	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701335	0.48307	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.21361	2.01;2.5;2.5;3.7	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	L	0.51422	1.61	0.80722	D	1	D	0.63880	0.993	P	0.52957	0.714	T	0.00975	-1.1494	10	0.19590	T	0.45	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	770	Q8WW38	FOG2_HUMAN	S	770;638;638;501	ENSP00000384179:C770S;ENSP00000430757:C638S;ENSP00000428720:C638S;ENSP00000367733:C501S	ENSP00000367733:C501S	C	+	2	0	ZFPM2	106883795	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	9.869000	0.99810	2.708000	0.92522	0.561000	0.74099	TGT		0.468	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
COL22A1	169044	broad.mit.edu	37	8	139890331	139890331	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr8:139890331C>T	ENST00000303045.6	-	3	766	c.320G>A	c.(319-321)cGt>cAt	p.R107H	COL22A1_ENST00000435777.1_Missense_Mutation_p.R107H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	107	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R107H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTAGGCGAGACGCCGGGCAGC	0.721										HNSCC(7;0.00092)																											p.R107H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G320A	8						.						16.0	18.0	17.0					8																	139890331		2183	4259	6442	139959513	SO:0001583	missense	169044	exon3			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.320G>A	8.37:g.139890331C>T	ENSP00000303153:p.Arg107His		139959513	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050290	0.36181	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	T;T	0.78816	-1.21;-1.21	5.28	-4.2	0.03823	von Willebrand factor, type A (3);	2.223100	0.02193	N	0.061529	T	0.63414	0.2509	L	0.38733	1.17	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.37384	-0.9708	9	.	.	.	.	2.6432	0.04977	0.1187:0.1849:0.118:0.5784	.	107	Q8NFW1	COMA1_HUMAN	H	107	ENSP00000303153:R107H;ENSP00000387655:R107H	.	R	-	2	0	COL22A1	139959513	0.999000	0.42202	0.000000	0.03702	0.184000	0.23303	1.571000	0.36450	-0.555000	0.06142	0.585000	0.79938	CGT		0.721	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CSMD1	64478	broad.mit.edu	37	8	2887034	2887034	+	Splice_Site	SNP	C	C	T			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr8:2887034C>T	ENST00000520002.1	-	52	8220	c.7665G>A	c.(7663-7665)ccG>ccA	p.P2555P	CSMD1_ENST00000602557.1_Splice_Site_p.P2555P|CSMD1_ENST00000537824.1_Splice_Site_p.P2554P|CSMD1_ENST00000602723.1_Splice_Site_p.P2555P|CSMD1_ENST00000400186.3_Splice_Site_p.P2555P|CSMD1_ENST00000542608.1_Splice_Site_p.P2554P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2555	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.P2554P(1)|p.P2283P(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCAAGCGACCGCTGGAAGGG	0.463																																					p.G2555S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7663A	8						.						39.0	37.0	38.0					8																	2887034		1982	4166	6148	2874441	SO:0001630	splice_region_variant	64478	exon51					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7664-1G>A	8.37:g.2887034C>T			2874441	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	2.040	-0.420216	0.04734	.	.	ENSG00000183117	ENST00000335551	.	.	.	4.58	3.7	0.42460	.	.	.	.	.	T	0.58722	0.2142	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55386	-0.8149	4	.	.	.	.	8.5542	0.33471	0.4755:0.3968:0.1278:0.0	.	.	.	.	S	1972	.	.	G	-	1	0	CSMD1	2874441	0.922000	0.31269	0.994000	0.49952	0.030000	0.12068	-0.033000	0.12246	1.278000	0.44430	0.591000	0.81541	GGT		0.463	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	Silent
C8orf31	286122	broad.mit.edu	37	8	144126110	144126110	+	Silent	SNP	C	C	T	rs185578539	byFrequency	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr8:144126110C>T	ENST00000395172.1	+	4	583	c.231C>T	c.(229-231)gaC>gaT	p.D77D	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	77								p.D77D(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTGCCAAAGACGCTCACTTTC	0.617													c|||	21	0.00419329	0.0	0.0014	5008	,	,		15315	0.0		0.0	False		,,,				2504	0.0204				p.D77D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C231T	8						.	C		0,4406		0,0,2203	78.0	68.0	72.0		231	-3.3	0.0	8		72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C8orf31	NM_173687.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		77/133	144126110	1,13005	2203	4300	6503	144197485	SO:0001819	synonymous_variant	286122	exon4				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.231C>T	8.37:g.144126110C>T			144197485	NM_173687	Q6GMU7	Silent	SNP	ENST00000395172.1	37	CCDS6395.1																																																																																				0.617	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687	
SPATA31E1	286234	broad.mit.edu	37	9	90502293	90502293	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chr9:90502293G>A	ENST00000325643.5	+	4	2957	c.2891G>A	c.(2890-2892)tGc>tAc	p.C964Y		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	964					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.C964Y(1)									CCCCCAACATGCAGCCTTGTG	0.602																																					p.C964Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2891A	9						.						41.0	42.0	42.0					9																	90502293		2203	4300	6503	89692113	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2891G>A	9.37:g.90502293G>A	ENSP00000322640:p.Cys964Tyr		89692113	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.360328	0.00214	.	.	ENSG00000177992	ENST00000325643	T	0.03152	4.03	2.16	-2.25	0.06888	.	5.743860	0.00496	N	0.000156	T	0.01765	0.0056	N	0.11064	0.09	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.33471	-0.9867	10	0.02654	T	1	.	1.257	0.01993	0.1731:0.3994:0.2613:0.1662	.	964	Q6ZUB1	CI079_HUMAN	Y	964	ENSP00000322640:C964Y	ENSP00000322640:C964Y	C	+	2	0	C9orf79	89692113	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.582000	0.05814	-0.494000	0.06669	0.557000	0.71058	TGC		0.602	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
CDKL5	6792	broad.mit.edu	37	X	18664178	18664178	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chrX:18664178G>A	ENST00000379989.3	+	20	3050	c.2765G>A	c.(2764-2766)aGa>aAa	p.R922K	RS1_ENST00000379984.3_Intron|RS1_ENST00000476595.1_Intron|CDKL5_ENST00000379996.3_Missense_Mutation_p.R922K	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	922					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.R922K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					ccccaagatagacgcttcatg	0.493																																					p.R922K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2765A	X						.						171.0	128.0	142.0					X																	18664178		2203	4300	6503	18574099	SO:0001583	missense	6792	exon19			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2765G>A	X.37:g.18664178G>A	ENSP00000369325:p.Arg922Lys		18574099	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395423	0.25205	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.70399	-0.48;-0.48	1.89	1.89	0.25635	.	0.998329	0.08104	N	0.997181	T	0.54481	0.1861	N	0.19112	0.55	0.09310	N	0.99999	B	0.09022	0.002	B	0.06405	0.002	T	0.49762	-0.8905	10	0.87932	D	0	.	6.6714	0.23070	0.0:0.0:1.0:0.0	.	922	O76039	CDKL5_HUMAN	K	922	ENSP00000369332:R922K;ENSP00000369325:R922K	ENSP00000369325:R922K	R	+	2	0	CDKL5	18574099	0.001000	0.12720	0.007000	0.13788	0.004000	0.04260	0.548000	0.23314	1.243000	0.43853	0.418000	0.28097	AGA		0.493	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
FGD1	2245	broad.mit.edu	37	X	54496518	54496518	+	Silent	SNP	G	G	A			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chrX:54496518G>A	ENST00000375135.3	-	4	1765	c.1032C>T	c.(1030-1032)gaC>gaT	p.D344D		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	344					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D344D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						cctcctcctcgtcgtcctcct	0.632																																					p.D344D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1032T	X						.						34.0	31.0	32.0					X																	54496518		2203	4300	6503	54513243	SO:0001819	synonymous_variant	2245	exon4			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1032C>T	X.37:g.54496518G>A			54513243	NM_004463	Q5H999|Q8N4D9	Silent	SNP	ENST00000375135.3	37	CCDS14359.1																																																																																				0.632	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
FUNDC2	65991	broad.mit.edu	37	X	154261807	154261807	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3831-01A-01W-0900-09	TCGA-AA-3831-10A-01W-0900-09	g.chrX:154261807T>G	ENST00000369498.3	+	2	517	c.263T>G	c.(262-264)tTc>tGc	p.F88C	FUNDC2_ENST00000484175.1_3'UTR	NM_023934.3	NP_076423.2	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	88						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.F88C(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACCCAGCTGTTCATTGGAGGT	0.463																																					p.F88C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T263G	X						.						151.0	130.0	137.0					X																	154261807		2203	4300	6503	153915001	SO:0001583	missense	65991	exon2			AF267862	CCDS14763.1	Xq28	2010-03-12			ENSG00000165775	ENSG00000165775			24925	protein-coding gene	gene with protein product						12477932	Standard	NM_023934		Approved	HCBP6, DC44	uc004fmw.3	Q9BWH2	OTTHUMG00000013504	ENST00000369498.3:c.263T>G	X.37:g.154261807T>G	ENSP00000358510:p.Phe88Cys		153915001	NM_023934	B2R7W5|D3DWY5|Q8NHX8|Q9H2I6	Missense_Mutation	SNP	ENST00000369498.3	37	CCDS14763.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306608	0.60305	.	.	ENSG00000165775	ENST00000369498	.	.	.	5.13	5.13	0.70059	.	0.239030	0.31020	N	0.008413	T	0.41650	0.1168	L	0.29908	0.895	0.24479	N	0.994351	P	0.35242	0.492	P	0.46479	0.518	T	0.38457	-0.9660	9	0.38643	T	0.18	.	12.0381	0.53438	0.0:0.0:0.0:1.0	.	88	Q9BWH2	FUND2_HUMAN	C	88	.	ENSP00000358510:F88C	F	+	2	0	FUNDC2	153915001	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.878000	0.48515	1.816000	0.52996	0.481000	0.45027	TTC		0.463	FUNDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037641.3	NM_023934	
