#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP43	80217	broad.mit.edu	37	10	105990460	105990460	+	Silent	SNP	G	G	A	rs374123628		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr10:105990460G>A	ENST00000357060.3	-	2	322	c.207C>T	c.(205-207)ggC>ggT	p.G69G	WDR96_ENST00000278064.2_5'UTR|WDR96_ENST00000369719.1_5'UTR|WDR96_ENST00000369720.1_5'UTR|WDR96_ENST00000428666.1_Silent_p.G69G	NM_025145.5	NP_079421.5												p.G69G(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TTGCCATGACGCCCACAATTC	0.408																																					p.G69G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C207T	10						.	G		0,4406		0,0,2203	144.0	132.0	136.0		207	1.3	1.0	10		136	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR96	NM_025145.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		69/1666	105990460	1,13005	2203	4300	6503	105980450	SO:0001819	synonymous_variant	80217	exon2																														ENST00000357060.3:c.207C>T	10.37:g.105990460G>A			105980450	NM_025145		Silent	SNP	ENST00000357060.3	37	CCDS31281.1																																																																																				0.408	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANKRD1	27063	broad.mit.edu	37	10	92675393	92675393	+	Silent	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr10:92675393T>G	ENST00000371697.3	-	8	1004	c.756A>C	c.(754-756)ggA>ggC	p.G252G		NM_014391.2	NP_055206.2	Q15327	ANKR1_HUMAN	ankyrin repeat domain 1 (cardiac muscle)	252					cardiac muscle tissue morphogenesis (GO:0055008)|cellular lipid metabolic process (GO:0044255)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|skeletal muscle cell differentiation (GO:0035914)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I band (GO:0031674)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|p53 binding (GO:0002039)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|titin binding (GO:0031432)|transcription corepressor activity (GO:0003714)	p.G252G(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|prostate(3)|skin(1)	27		Colorectal(252;0.0475)				ACGGGGTATCTCCTTCCTAGA	0.512																																					p.G252G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A756C	10						.						103.0	94.0	97.0					10																	92675393		2203	4300	6503	92665373	SO:0001819	synonymous_variant	27063	exon8			X83703	CCDS7412.1	10q23.33	2014-09-17			ENSG00000148677	ENSG00000148677		"""Ankyrin repeat domain containing"""	15819	protein-coding gene	gene with protein product		609599				7730328	Standard	NM_014391		Approved	C-193, ALRP, CARP, CVARP, MCARP	uc001khe.1	Q15327	OTTHUMG00000018734	ENST00000371697.3:c.756A>C	10.37:g.92675393T>G			92665373	NM_014391	Q96LE7	Silent	SNP	ENST00000371697.3	37	CCDS7412.1																																																																																				0.512	ANKRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049357.1	NM_014391	
PLCE1	51196	broad.mit.edu	37	10	95987120	95987120	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr10:95987120G>A	ENST00000371380.3	+	4	2102	c.1867G>A	c.(1867-1869)Gaa>Aaa	p.E623K	PLCE1_ENST00000371385.3_Missense_Mutation_p.E315K|PLCE1_ENST00000371375.1_Missense_Mutation_p.E315K|PLCE1_ENST00000260766.3_Missense_Mutation_p.E623K|RP11-391J2.3_ENST00000447227.1_RNA			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	623	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.E623K(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GGAGAAGCGAGAAGTCTTTTC	0.507																																					p.E315K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943A	10						.						113.0	122.0	119.0					10																	95987120		2079	4212	6291	95977110	SO:0001583	missense	51196	exon4				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1867G>A	10.37:g.95987120G>A	ENSP00000360431:p.Glu623Lys		95977110	NM_001165979	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	36	5.959092	0.97145	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.86	5.86	0.93980	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.134218	0.50627	D	0.000112	T	0.49029	0.1533	L	0.51422	1.61	0.52501	D	0.99995	D;D;P	0.58268	0.982;0.977;0.918	P;P;P	0.60286	0.872;0.725;0.761	T	0.18524	-1.0334	10	0.39692	T	0.17	.	20.1837	0.98210	0.0:0.0:1.0:0.0	.	623;315;623	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	K	623;623;315;315	ENSP00000260766:E623K;ENSP00000360431:E623K;ENSP00000360438:E315K;ENSP00000360426:E315K	ENSP00000260766:E623K	E	+	1	0	PLCE1	95977110	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.434000	0.97515	2.774000	0.95407	0.650000	0.86243	GAA		0.507	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
TCF7L2	6934	broad.mit.edu	37	10	114912149	114912149	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr10:114912149C>T	ENST00000355995.4	+	11	1726	c.1219C>T	c.(1219-1221)Cga>Tga	p.R407*	TCF7L2_ENST00000534894.1_Nonsense_Mutation_p.R407*|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000545257.1_Nonsense_Mutation_p.R407*|TCF7L2_ENST00000352065.5_Nonsense_Mutation_p.R384*|TCF7L2_ENST00000369397.4_Nonsense_Mutation_p.R384*|TCF7L2_ENST00000538897.1_Nonsense_Mutation_p.R407*|TCF7L2_ENST00000536810.1_Nonsense_Mutation_p.R407*|TCF7L2_ENST00000355717.4_Nonsense_Mutation_p.R431*|TCF7L2_ENST00000542695.1_Nonsense_Mutation_p.R123*|TCF7L2_ENST00000369389.1_Nonsense_Mutation_p.R118*|TCF7L2_ENST00000369386.1_Nonsense_Mutation_p.R50*|TCF7L2_ENST00000543371.1_Nonsense_Mutation_p.R407*			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	407					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R384*(2)|p.R407*(2)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CCGGAAGGAGCGACAGCTTCA	0.527			T	VTI1A	colorectal																																p.R380X			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.C1138T	10						.						168.0	173.0	172.0					10																	114912149		2203	4300	6503	114902139	SO:0001587	stop_gained	6934	exon10			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1219C>T	10.37:g.114912149C>T	ENSP00000348274:p.Arg407*		114902139	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Nonsense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	c	45	11.714383	0.99594	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945;ENST00000369386	.	.	.	5.66	5.66	0.87406	.	0.065778	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.2749	14.5692	0.68200	0.1461:0.8539:0.0:0.0	.	.	.	.	X	407;407;407;407;431;407;407;384;384;123;118;124;50	.	ENSP00000277945:R124X	R	+	1	2	TCF7L2	114902139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.055000	0.49916	2.669000	0.90835	0.655000	0.94253	CGA		0.527	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
ZBTB16	7704	broad.mit.edu	37	11	114118068	114118068	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:114118068G>A	ENST00000335953.4	+	6	2153	c.1773G>A	c.(1771-1773)acG>acA	p.T591T	ZBTB16_ENST00000535379.1_3'UTR|ZBTB16_ENST00000392996.2_Silent_p.T591T|RP11-64D24.2_ENST00000544925.1_RNA	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	591					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T591T(1)		central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		AGCTGGAGACGCACTATAGGG	0.582																																					p.T591T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1773A	11						.						83.0	67.0	72.0					11																	114118068		2201	4296	6497	113623278	SO:0001819	synonymous_variant	7704	exon6			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1773G>A	11.37:g.114118068G>A			113623278	NM_006006	Q8TAL4	Silent	SNP	ENST00000335953.4	37	CCDS8367.1																																																																																				0.582	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
OR51Q1	390061	broad.mit.edu	37	11	5444230	5444230	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:5444230C>A	ENST00000300778.4	+	1	890	c.800C>A	c.(799-801)gCc>gAc	p.A267D	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A267D(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATCGCTTTGCCAAGCATGCC	0.512																																					p.A267D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C800A	11						.						131.0	108.0	116.0					11																	5444230		2201	4297	6498	5400806	SO:0001583	missense	390061	exon1			AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.800C>A	11.37:g.5444230C>A	ENSP00000300778:p.Ala267Asp		5400806	NM_001004757	B2RNN1	Missense_Mutation	SNP	ENST00000300778.4	37	CCDS31381.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958078	0.53400	.	.	ENSG00000167360	ENST00000300778	T	0.36520	1.25	5.0	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.113243	0.39210	N	0.001431	T	0.59918	0.2229	M	0.86420	2.815	0.21527	N	0.999651	D	0.89917	1.0	D	0.75484	0.986	T	0.51379	-0.8713	10	0.87932	D	0	.	8.5267	0.33309	0.0:0.5982:0.3136:0.0882	.	267	Q8NH59	O51Q1_HUMAN	D	267	ENSP00000300778:A267D	ENSP00000300778:A267D	A	+	2	0	OR51Q1	5400806	0.057000	0.20700	0.999000	0.59377	0.975000	0.68041	0.461000	0.21940	1.373000	0.46208	0.380000	0.24917	GCC		0.512	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757	
OR52E6	390078	broad.mit.edu	37	11	5862381	5862381	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:5862381G>C	ENST00000329322.5	-	1	746	c.747C>G	c.(745-747)atC>atG	p.I249M	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Missense_Mutation_p.I253M	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I253M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAAGGCTAAGATAACACCAA	0.443																																					p.I249M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C747G	11						.						72.0	74.0	74.0					11																	5862381		2191	4296	6487	5818957	SO:0001583	missense	390078	exon1			AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.747C>G	11.37:g.5862381G>C	ENSP00000328878:p.Ile249Met		5818957	NM_001005167	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	CCDS53597.1	.	.	.	.	.	.	.	.	.	.	G	9.276	1.046998	0.19748	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00220	8.52;8.52	3.36	-1.06	0.10002	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	T	0.00210	0.0006	L	0.61036	1.89	0.09310	N	1	P	0.45474	0.859	P	0.49387	0.609	T	0.48328	-0.9045	10	0.40728	T	0.16	.	3.998	0.09568	0.193:0.0:0.4861:0.3209	.	249	Q96RD3	O52E6_HUMAN	M	249;253	ENSP00000328878:I249M;ENSP00000369279:I253M	ENSP00000328878:I249M	I	-	3	3	OR52E6	5818957	0.000000	0.05858	0.007000	0.13788	0.953000	0.61014	-1.448000	0.02394	-0.517000	0.06461	-0.332000	0.08345	ATC		0.443	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
TRIM3	10612	broad.mit.edu	37	11	6478040	6478040	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:6478040G>A	ENST00000525074.1	-	6	1310	c.916C>T	c.(916-918)Cgg>Tgg	p.R306W	TRIM3_ENST00000345851.3_Missense_Mutation_p.R306W|TRIM3_ENST00000536344.1_Missense_Mutation_p.R187W|TRIM3_ENST00000359518.3_Missense_Mutation_p.R306W|TRIM3_ENST00000537602.1_Missense_Mutation_p.R228W|TRIM3_ENST00000529058.1_5'UTR	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	306					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R306W(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCGATCGCCGCAGACCGTCC	0.667																																					p.R306W	Melanoma(6;5 510 1540 25169 29084)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C916T	11						.						69.0	63.0	65.0					11																	6478040		2186	4274	6460	6434616	SO:0001583	missense	10612	exon7			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.916C>T	11.37:g.6478040G>A	ENSP00000433102:p.Arg306Trp		6434616	NM_006458	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664823	0.47572	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	T;T;T;T;D	0.83506	-0.62;-0.62;-0.88;-0.62;-1.73	5.18	4.26	0.50523	.	0.107364	0.64402	D	0.000010	D	0.88858	0.6551	M	0.72894	2.215	0.46336	D	0.998992	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.70227	0.963;0.968;0.918	D	0.87923	0.2705	10	0.41790	T	0.15	-22.9911	11.958	0.52993	0.0:0.0:0.6844:0.3156	.	187;187;306	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	W	306;306;306;306;295;228;306;187	ENSP00000433102:R306W;ENSP00000340797:R306W;ENSP00000441091:R228W;ENSP00000352508:R306W;ENSP00000445460:R187W	ENSP00000337094:R295W	R	-	1	2	TRIM3	6434616	0.463000	0.25799	0.995000	0.50966	0.648000	0.38561	0.263000	0.18478	1.194000	0.43101	-0.217000	0.12591	CGG		0.667	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
TUB	7275	broad.mit.edu	37	11	8120357	8120357	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:8120357C>T	ENST00000299506.2	+	9	1200	c.1051C>T	c.(1051-1053)Cag>Tag	p.Q351*	TUB_ENST00000305253.4_Nonsense_Mutation_p.Q406*|TUB_ENST00000534099.1_Nonsense_Mutation_p.Q357*	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	351					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)	p.Q406*(1)		breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		AGTCAACCCTCAGAAGGCCTC	0.507											OREG0020732	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q351X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1051T	11						.						154.0	138.0	143.0					11																	8120357		2201	4296	6497	8076933	SO:0001587	stop_gained	7275	exon9			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1051C>T	11.37:g.8120357C>T	ENSP00000299506:p.Gln351*	646	8076933	NM_177972	D3DQU4|O00293|Q6B007	Nonsense_Mutation	SNP	ENST00000299506.2	37	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	C	35	5.488317	0.96323	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	.	.	.	5.27	3.28	0.37604	.	0.457935	0.25543	N	0.029952	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-0.2154	3.2191	0.06708	0.2603:0.5203:0.1274:0.092	.	.	.	.	X	357;406;351	.	ENSP00000299506:Q351X	Q	+	1	0	TUB	8076933	0.216000	0.23585	1.000000	0.80357	0.996000	0.88848	0.890000	0.28295	2.610000	0.88304	0.555000	0.69702	CAG		0.507	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320	
MRGPRX1	259249	broad.mit.edu	37	11	18955634	18955634	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:18955634C>G	ENST00000302797.3	-	1	922	c.698G>C	c.(697-699)gGc>gCc	p.G233A	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'Flank	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	233					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G233A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AAACTGAATGCCAAAGGGCAG	0.473																																					p.G233A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G698C	11						.						75.0	66.0	69.0					11																	18955634		2194	4286	6480	18912210	SO:0001583	missense	259249	exon1				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.698G>C	11.37:g.18955634C>G	ENSP00000305766:p.Gly233Ala		18912210	NM_147199	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	12.31	1.898687	0.33535	.	.	ENSG00000170255	ENST00000302797	T	0.37235	1.21	2.28	0.173	0.15036	GPCR, rhodopsin-like superfamily (1);	0.194885	0.36338	N	0.002650	T	0.53948	0.1828	M	0.91354	3.2	0.09310	N	1	D	0.76494	0.999	D	0.70016	0.967	T	0.46303	-0.9201	10	0.25751	T	0.34	.	1.2334	0.01948	0.2284:0.407:0.2236:0.141	.	233	Q96LB2	MRGX1_HUMAN	A	233	ENSP00000305766:G233A	ENSP00000305766:G233A	G	-	2	0	MRGPRX1	18912210	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	1.107000	0.31110	0.046000	0.15833	0.491000	0.48974	GGC		0.473	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
PRDM11	56981	broad.mit.edu	37	11	45204515	45204515	+	Silent	SNP	G	G	A	rs143277934		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:45204515G>A	ENST00000530656.1	+	4	429	c.429G>A	c.(427-429)gcG>gcA	p.A143A	PRDM11_ENST00000424263.2_Silent_p.A109A|PRDM11_ENST00000528980.1_3'UTR|PRDM11_ENST00000263765.4_Silent_p.A143A			Q9NQV5	PRD11_HUMAN	PR domain containing 11	143							methyltransferase activity (GO:0008168)	p.A143A(1)		endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						CAGACCGGGCGGCGCTCACCA	0.607																																					p.A143A	NSCLC(118;1511 1736 6472 36603 43224)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G429A	11						.	G		0,4406		0,0,2203	72.0	71.0	71.0		429	-9.0	0.3	11	dbSNP_134	71	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	PRDM11	NM_020229.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		143/512	45204515	1,13003	2203	4299	6502	45161091	SO:0001819	synonymous_variant	56981	exon5			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.429G>A	11.37:g.45204515G>A			45161091	NM_020229	Q8N9F1	Silent	SNP	ENST00000530656.1	37																																																																																					0.607	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
MYBPC3	4607	broad.mit.edu	37	11	47353764	47353764	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:47353764C>A	ENST00000545968.1	-	33	3727	c.3673G>T	c.(3673-3675)Gcc>Tcc	p.A1225S	MYBPC3_ENST00000256993.4_Missense_Mutation_p.A1224S|MYBPC3_ENST00000399249.2_Missense_Mutation_p.A1225S	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1225	Ig-like C2-type 7.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A1225S(2)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CGGAAGCGGGCGTCTTCTCCC	0.552																																					p.R1225L												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3674T	11						.						90.0	93.0	92.0					11																	47353764		1929	4134	6063	47310340	SO:0001583	missense	4607	exon31			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.3673G>T	11.37:g.47353764C>A	ENSP00000442795:p.Ala1225Ser		47310340	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932740	0.73442	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.72282	-0.64;-0.64;-0.64	5.46	5.46	0.80206	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66346	0.2780	N	0.03294	-0.36	0.58432	D	0.999993	D	0.57257	0.979	D	0.66602	0.945	T	0.75139	-0.3423	9	0.66056	D	0.02	.	14.3741	0.66862	0.0:0.8511:0.1489:0.0	.	1224	Q14896	MYPC3_HUMAN	S	1225;1225;1224	ENSP00000442795:A1225S;ENSP00000382193:A1225S;ENSP00000256993:A1224S	ENSP00000256993:A1224S	A	-	1	0	MYBPC3	47310340	0.034000	0.19679	0.956000	0.39512	0.659000	0.38960	0.329000	0.19698	2.556000	0.86216	0.561000	0.74099	GCC		0.552	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
SPI1	6688	broad.mit.edu	37	11	47381535	47381535	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:47381535C>T	ENST00000378538.3	-	3	421	c.199G>A	c.(199-201)Gag>Aag	p.E67K	SPI1_ENST00000533968.1_Missense_Mutation_p.E67K|SPI1_ENST00000227163.4_Missense_Mutation_p.E68K|SPI1_ENST00000533030.1_Intron	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	67					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E61K(1)		central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		AAGTTGTTCTCGGCGAAGCTC	0.627																																					p.E67K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	11						.						44.0	39.0	41.0					11																	47381535		2201	4297	6498	47338111	SO:0001583	missense	6688	exon3			X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.199G>A	11.37:g.47381535C>T	ENSP00000367799:p.Glu67Lys		47338111	NM_003120		Missense_Mutation	SNP	ENST00000378538.3	37	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535293	0.64972	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.30981	1.51;1.51;1.51	3.59	3.59	0.41128	.	0.112593	0.64402	D	0.000014	T	0.40595	0.1123	L	0.61218	1.895	0.51012	D	0.999906	D;P;D	0.65815	0.995;0.683;0.99	P;B;P	0.54312	0.748;0.21;0.718	T	0.32693	-0.9897	10	0.08599	T	0.76	-27.7599	15.7696	0.78157	0.0:1.0:0.0:0.0	.	67;67;68	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	K	67;68;67	ENSP00000367799:E67K;ENSP00000227163:E68K;ENSP00000438846:E67K	ENSP00000227163:E68K	E	-	1	0	SPI1	47338111	1.000000	0.71417	0.976000	0.42696	0.991000	0.79684	6.959000	0.76031	1.985000	0.57927	0.655000	0.94253	GAG		0.627	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120	
OR5R1	219479	broad.mit.edu	37	11	56184755	56184755	+	Missense_Mutation	SNP	T	T	A	rs141438285		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:56184755T>A	ENST00000312253.1	-	1	953	c.954A>T	c.(952-954)ttA>ttT	p.L318F		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L318F(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					TTCTTATTTTTAAAAATGTTA	0.294																																					p.L318F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A954T	11						.	T	PHE/LEU	0,4280		0,0,2140	25.0	26.0	26.0		954	-0.8	0.0	11	dbSNP_134	26	3,8543		0,3,4270	no	missense	OR5R1	NM_001004744.1	22	0,3,6410	AA,AT,TT		0.0351,0.0,0.0234	benign	318/325	56184755	3,12823	2140	4273	6413	55941331	SO:0001583	missense	219479	exon1			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.954A>T	11.37:g.56184755T>A	ENSP00000308595:p.Leu318Phe		55941331	NM_001004744		Missense_Mutation	SNP	ENST00000312253.1	37	CCDS31530.1	.	.	.	.	.	.	.	.	.	.	T	2.877	-0.232663	0.05983	0.0	3.51E-4	ENSG00000174942	ENST00000312253	T	0.00130	8.69	4.55	-0.836	0.10770	.	.	.	.	.	T	0.00073	0.0002	N	0.08118	0	0.09310	N	1	B	0.21381	0.055	B	0.18263	0.021	T	0.01341	-1.1380	9	0.08381	T	0.77	1.7824	5.9878	0.19444	0.2671:0.0823:0.0:0.6506	.	318	Q8NH85	OR5R1_HUMAN	F	318	ENSP00000308595:L318F	ENSP00000308595:L318F	L	-	3	2	OR5R1	55941331	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.686000	0.05161	-0.052000	0.13311	-3.280000	0.00047	TTA		0.294	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
MACROD1	28992	broad.mit.edu	37	11	63766819	63766819	+	Missense_Mutation	SNP	T	T	C	rs75347416		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:63766819T>C	ENST00000255681.6	-	8	941	c.875A>G	c.(874-876)gAg>gGg	p.E292G	OTUB1_ENST00000535715.1_Intron	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	292	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.E292G(2)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CTTGTGCTGCTCCAGCCACTC	0.711																																					p.E292G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A875G	11						.						9.0	9.0	9.0					11																	63766819		2141	4211	6352	63523395	SO:0001583	missense	28992	exon8			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.875A>G	11.37:g.63766819T>C	ENSP00000255681:p.Glu292Gly		63523395	NM_014067	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	37	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.712626	0.48517	.	.	ENSG00000133315	ENST00000255681	T	0.24151	1.87	3.92	3.92	0.45320	Appr-1-p processing (1);	0.221355	0.29544	U	0.011851	T	0.28665	0.0710	M	0.72576	2.205	0.51233	D	0.999918	B	0.13145	0.007	B	0.14023	0.01	T	0.14615	-1.0466	10	0.62326	D	0.03	-23.4342	10.5957	0.45336	0.0:0.0:0.0:1.0	.	292	Q9BQ69	MACD1_HUMAN	G	292	ENSP00000255681:E292G	ENSP00000255681:E292G	E	-	2	0	MACROD1	63523395	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.107000	0.31110	1.574000	0.49760	0.379000	0.24179	GAG		0.711	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
GRAMD1B	57476	broad.mit.edu	37	11	123484247	123484247	+	Missense_Mutation	SNP	C	C	T	rs199604534	byFrequency	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr11:123484247C>T	ENST00000529750.1	+	15	2006	c.1679C>T	c.(1678-1680)aCg>aTg	p.T560M	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.T567M|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.T560M|GRAMD1B_ENST00000450171.2_Missense_Mutation_p.T251M	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	560						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.T560M(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		AAGACTACAACGGTGCGGAGG	0.572													C|||	2	0.000399361	0.0	0.0	5008	,	,		20793	0.0		0.001	False		,,,				2504	0.001				p.T560M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1679T	11						.	C	MET/THR	0,4404		0,0,2202	58.0	64.0	62.0		1679	4.4	0.0	11		62	4,8584	3.7+/-12.6	0,4,4290	yes	missense	GRAMD1B	NM_020716.1	81	0,4,6492	TT,TC,CC		0.0466,0.0,0.0308	possibly-damaging	560/739	123484247	4,12988	2202	4294	6496	122989457	SO:0001583	missense	57476	exon15			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1679C>T	11.37:g.123484247C>T	ENSP00000436500:p.Thr560Met		122989457	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884815	0.51908	0.0	4.66E-4	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	5.28	4.37	0.52481	.	0.334048	0.31438	N	0.007649	T	0.32102	0.0818	L	0.51422	1.61	0.09310	N	0.999999	D;B;D;D	0.59767	0.982;0.163;0.986;0.963	P;B;B;P	0.48704	0.459;0.036;0.333;0.587	T	0.14699	-1.0463	10	0.62326	D	0.03	.	13.8313	0.63382	0.0:0.9263:0.0:0.0737	.	520;251;560;567	B7Z4N9;Q3KR37-3;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	M	567;567;560;560;520;251	ENSP00000402457:T567M;ENSP00000325628:T560M;ENSP00000436500:T560M;ENSP00000432987:T520M;ENSP00000388458:T251M	ENSP00000325628:T560M	T	+	2	0	GRAMD1B	122989457	0.743000	0.28239	0.003000	0.11579	0.424000	0.31475	7.085000	0.76875	1.240000	0.43803	0.561000	0.74099	ACG		0.572	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
CELA1	1990	broad.mit.edu	37	12	51736468	51736468	+	Missense_Mutation	SNP	C	C	G	rs145791288		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr12:51736468C>G	ENST00000293636.1	-	4	257	c.217G>C	c.(217-219)Gtg>Ctg	p.V73L		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	73	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V73L(1)|p.V73M(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						CCAGCCACCACGCGGAAAGTC	0.507																																					p.V73L												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G217C	12						.						112.0	86.0	95.0					12																	51736468		2203	4300	6503	50022735	SO:0001583	missense	1990	exon4				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.217G>C	12.37:g.51736468C>G	ENSP00000293636:p.Val73Leu		50022735	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	37	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646321	0.67358	.	.	ENSG00000139610	ENST00000293636	D	0.96168	-3.93	5.15	5.15	0.70609	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	L	0.49350	1.555	0.80722	D	1	D	0.67145	0.996	D	0.79784	0.993	D	0.97439	1.0020	10	0.87932	D	0	-14.5521	17.7701	0.88489	0.0:1.0:0.0:0.0	.	73	Q9UNI1	CELA1_HUMAN	L	73	ENSP00000293636:V73L	ENSP00000293636:V73L	V	-	1	0	CELA1	50022735	1.000000	0.71417	0.982000	0.44146	0.067000	0.16453	7.445000	0.80570	2.583000	0.87209	0.561000	0.74099	GTG		0.507	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
TPH2	121278	broad.mit.edu	37	12	72388269	72388269	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr12:72388269A>T	ENST00000333850.3	+	8	1133	c.992A>T	c.(991-993)aAg>aTg	p.K331M		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	331					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.K331M(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GCGGATCCTAAGTTTGCTCAG	0.398																																					p.K331M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A992T	12						.						153.0	148.0	150.0					12																	72388269		2203	4300	6503	70674536	SO:0001583	missense	121278	exon8			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.992A>T	12.37:g.72388269A>T	ENSP00000329093:p.Lys331Met		70674536	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937483	0.73557	.	.	ENSG00000139287	ENST00000333850	D	0.99527	-6.09	5.91	5.91	0.95273	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98738	0.9576	L	0.36672	1.1	0.80722	D	1	B	0.29301	0.241	B	0.43123	0.409	D	0.98832	1.0751	10	0.87932	D	0	-19.856	16.3483	0.83171	1.0:0.0:0.0:0.0	.	331	Q8IWU9	TPH2_HUMAN	M	331	ENSP00000329093:K331M	ENSP00000329093:K331M	K	+	2	0	TPH2	70674536	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	4.572000	0.60886	2.254000	0.74563	0.533000	0.62120	AAG		0.398	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
RAD52	5893	broad.mit.edu	37	12	1025937	1025937	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr12:1025937G>A	ENST00000358495.3	-	8	731	c.593C>T	c.(592-594)cCg>cTg	p.P198L	RAD52_ENST00000430095.2_Missense_Mutation_p.P198L|RAD52_ENST00000535376.1_5'Flank|RAD52_ENST00000539046.1_Missense_Mutation_p.P121L|RAD52_ENST00000536177.1_Missense_Mutation_p.P198L	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	198					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)	p.P198L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			CTCCACAGACGGTTCAAGATC	0.522								Homologous recombination																													p.P198L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C593T	12						.						135.0	137.0	136.0					12																	1025937		2046	4204	6250	896198	SO:0001583	missense	5893	exon8				CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.593C>T	12.37:g.1025937G>A	ENSP00000351284:p.Pro198Leu		896198	NM_134424	Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Missense_Mutation	SNP	ENST00000358495.3	37	CCDS8507.2	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826978	0.71143	.	.	ENSG00000002016	ENST00000358495;ENST00000430095;ENST00000539046;ENST00000536177	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	4.97	4.97	0.65823	.	0.106716	0.64402	D	0.000004	T	0.56543	0.1992	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.951;0.975	T	0.58312	-0.7658	10	0.54805	T	0.06	-18.8333	16.5571	0.84488	0.0:0.0:1.0:0.0	.	198;198	F5GX32;P43351	.;RAD52_HUMAN	L	198;198;121;198	ENSP00000351284:P198L;ENSP00000387901:P198L;ENSP00000445245:P121L;ENSP00000440486:P198L	ENSP00000351284:P198L	P	-	2	0	RAD52	896198	1.000000	0.71417	0.985000	0.45067	0.521000	0.34408	5.611000	0.67674	2.758000	0.94735	0.561000	0.74099	CCG		0.522	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	NM_134424	
KCNC2	3747	broad.mit.edu	37	12	75444552	75444552	+	Missense_Mutation	SNP	G	G	T	rs200648638		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr12:75444552G>T	ENST00000549446.1	-	3	1913	c.1233C>A	c.(1231-1233)aaC>aaA	p.N411K	KCNC2_ENST00000350228.2_Missense_Mutation_p.N411K|KCNC2_ENST00000393288.2_Missense_Mutation_p.N411K|KCNC2_ENST00000540018.1_Missense_Mutation_p.N411K|KCNC2_ENST00000548243.1_5'UTR|KCNC2_ENST00000341669.3_Missense_Mutation_p.N411K|KCNC2_ENST00000548513.1_Missense_Mutation_p.N411K|KCNC2_ENST00000550433.1_Missense_Mutation_p.N411K|KCNC2_ENST00000298972.1_Missense_Mutation_p.N411K	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	411					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.N411K(2)|p.N411N(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	CTGAAGGGTCGTTAGGTTGAG	0.453																																					p.N411K												.	.	4	Substitution - Missense(2)|Substitution - coding silent(2)	large_intestine(2)|endometrium(2)	c.C1233A	12						.						77.0	71.0	73.0					12																	75444552		2203	4300	6503	73730819	SO:0001583	missense	3747	exon3			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1233C>A	12.37:g.75444552G>T	ENSP00000449253:p.Asn411Lys		73730819	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033803	0.35893	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9;-4.9;-4.9;-4.9;-4.9	6.06	-2.88	0.05682	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	N	0.10782	0.045	0.52501	D	0.99995	B;B;B;B;P	0.48016	0.055;0.098;0.276;0.055;0.904	B;B;B;B;B	0.41466	0.073;0.104;0.171;0.073;0.358	D	0.88267	0.2927	10	0.48119	T	0.1	.	14.4951	0.67680	0.8586:0.0:0.1414:0.0	.	411;411;411;411;411	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	K	411	ENSP00000448301:N411K;ENSP00000449941:N411K;ENSP00000449253:N411K;ENSP00000340121:N411K;ENSP00000298972:N411K;ENSP00000319877:N411K;ENSP00000438423:N411K;ENSP00000376966:N411K	ENSP00000298972:N411K	N	-	3	2	KCNC2	73730819	0.969000	0.33509	0.985000	0.45067	0.981000	0.71138	0.213000	0.17521	-0.360000	0.08138	0.650000	0.86243	AAC		0.453	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
PCDH9	5101	broad.mit.edu	37	13	67477705	67477705	+	Silent	SNP	A	A	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr13:67477705A>G	ENST00000377865.2	-	2	3203	c.3069T>C	c.(3067-3069)ccT>ccC	p.P1023P	PCDH9_ENST00000328454.5_Intron|PCDH9_ENST00000544246.1_Silent_p.P1023P|PCDH9_ENST00000456367.1_Intron|PCDH9-AS2_ENST00000419371.2_RNA			Q9HC56	PCDH9_HUMAN	protocadherin 9	1023					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1023P(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAGGAGTGACAGGAATATTGT	0.408																																					p.P1023P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3069C	13						.						117.0	109.0	112.0					13																	67477705		2203	4300	6503	66375706	SO:0001819	synonymous_variant	5101	exon3			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3069T>C	13.37:g.67477705A>G			66375706	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	CCDS9444.1																																																																																				0.408	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
ABCC4	10257	broad.mit.edu	37	13	95726554	95726554	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr13:95726554G>A	ENST00000376887.4	-	23	2945	c.2831C>T	c.(2830-2832)aCg>aTg	p.T944M	ABCC4_ENST00000474158.1_5'Flank|ABCC4_ENST00000412704.1_Missense_Mutation_p.T897M	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	944	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.T944M(2)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CCAGCGGGACGTTGTCAAAAA	0.448																																					p.T944M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2831T	13						.						73.0	65.0	68.0					13																	95726554		2203	4300	6503	94524555	SO:0001583	missense	10257	exon23			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.2831C>T	13.37:g.95726554G>A	ENSP00000366084:p.Thr944Met		94524555	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	37	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552731	0.86127	.	.	ENSG00000125257	ENST00000412704;ENST00000376887	D;D	0.90444	-2.67;-2.67	5.78	5.78	0.91487	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93766	0.8007	M	0.75884	2.315	0.80722	D	1	P;D	0.59767	0.857;0.986	B;P	0.53146	0.273;0.719	D	0.93862	0.7154	10	0.66056	D	0.02	.	20.0203	0.97492	0.0:0.0:1.0:0.0	.	897;944	O15439-2;O15439	.;MRP4_HUMAN	M	897;944	ENSP00000388657:T897M;ENSP00000366084:T944M	ENSP00000366084:T944M	T	-	2	0	ABCC4	94524555	1.000000	0.71417	0.705000	0.30386	0.723000	0.41478	9.444000	0.97578	2.730000	0.93505	0.655000	0.94253	ACG		0.448	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
NIN	51199	broad.mit.edu	37	14	51237185	51237185	+	Missense_Mutation	SNP	C	C	T	rs182667346		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr14:51237185C>T	ENST00000382041.3	-	12	1545	c.1355G>A	c.(1354-1356)cGt>cAt	p.R452H	NIN_ENST00000453196.1_Missense_Mutation_p.R452H|NIN_ENST00000324330.9_Missense_Mutation_p.R452H|NIN_ENST00000245441.5_Missense_Mutation_p.R452H|NIN_ENST00000389868.3_Missense_Mutation_p.R452H|NIN_ENST00000530997.2_Missense_Mutation_p.R452H|NIN_ENST00000382043.4_Missense_Mutation_p.R452H	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	452					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.R458H(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					AAGTTCTAAACGCTGCTTGCC	0.433			T	PDGFRB	MPD																																p.R452H			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1355A	14						.						188.0	165.0	173.0					14																	51237185		2203	4300	6503	50306935	SO:0001583	missense	51199	exon12			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1355G>A	14.37:g.51237185C>T	ENSP00000371472:p.Arg452His		50306935	NM_182944	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.63	3.177550	0.57692	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96	5.85	4.78	0.61160	.	0.046949	0.85682	D	0.000000	T	0.40448	0.1117	L	0.49350	1.555	0.53005	D	0.999963	D;D;P;P;D	0.89917	0.992;0.995;0.792;0.914;1.0	P;P;B;B;D	0.83275	0.678;0.678;0.156;0.299;0.996	T	0.06935	-1.0799	10	0.54805	T	0.06	-10.3507	14.9401	0.70986	0.0:0.92:0.0:0.08	.	458;452;452;452;452	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	H	452;452;452;452;458;452;452;452	ENSP00000245441:R452H;ENSP00000374518:R452H;ENSP00000371474:R452H;ENSP00000371472:R452H;ENSP00000324210:R452H;ENSP00000412391:R452H	ENSP00000245441:R452H	R	-	2	0	NIN	50306935	1.000000	0.71417	0.966000	0.40874	0.034000	0.12701	4.646000	0.61411	2.773000	0.95371	0.650000	0.86243	CGT		0.433	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
DCAF5	8816	broad.mit.edu	37	14	69521030	69521030	+	Silent	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr14:69521030C>T	ENST00000341516.5	-	9	2520	c.2373G>A	c.(2371-2373)gaG>gaA	p.E791E	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000557386.1_Silent_p.E790E|DCAF5_ENST00000556847.1_Silent_p.E709E|DCAF5_ENST00000554215.1_Silent_p.E709E	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	791					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.E791E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GAGAAGGCGGCTCCTCAGCCC	0.587																																					p.E791E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2373A	14						.						64.0	69.0	67.0					14																	69521030		2203	4300	6503	68590783	SO:0001819	synonymous_variant	8816	exon9			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2373G>A	14.37:g.69521030C>T			68590783	NM_003861	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	ENST00000341516.5	37	CCDS32106.1																																																																																				0.587	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
FSIP1	161835	broad.mit.edu	37	15	40057828	40057828	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr15:40057828G>C	ENST00000350221.3	-	4	639	c.430C>G	c.(430-432)Cta>Gta	p.L144V		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	144								p.L144V(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		CTCATTTCTAGACCTTGCTTC	0.338																																					p.L144V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C430G	15						.						122.0	118.0	119.0					15																	40057828		2203	4299	6502	37845120	SO:0001583	missense	161835	exon4			BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.430C>G	15.37:g.40057828G>C	ENSP00000280236:p.Leu144Val		37845120	NM_152597	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978295	0.53720	.	.	ENSG00000150667	ENST00000350221	T	0.25579	1.79	5.66	3.77	0.43336	.	0.741076	0.11849	N	0.523551	T	0.26810	0.0656	M	0.73598	2.24	0.30731	N	0.747262	B	0.30281	0.275	B	0.28916	0.096	T	0.27971	-1.0058	9	.	.	.	-3.7246	4.6757	0.12710	0.0815:0.1514:0.6104:0.1567	.	144	Q8NA03	FSIP1_HUMAN	V	144	ENSP00000280236:L144V	.	L	-	1	2	FSIP1	37845120	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	0.576000	0.23744	0.734000	0.32515	-0.305000	0.09177	CTA		0.338	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	
MYO5A	4644	broad.mit.edu	37	15	52609271	52609271	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr15:52609271T>A	ENST00000399231.3	-	39	5551	c.5308A>T	c.(5308-5310)Atg>Ttg	p.M1770L	MYO5A_ENST00000553916.1_Missense_Mutation_p.M1768L|MYO5A_ENST00000399233.2_Missense_Mutation_p.M1767L|MYO5A_ENST00000356338.6_Missense_Mutation_p.M1743L|MYO5A_ENST00000358212.6_Missense_Mutation_p.M1795L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1770	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.M1770L(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GCATTGCACATAGAACAAATG	0.388																																					p.M1770L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5308T	15						.						165.0	157.0	159.0					15																	52609271		1867	4103	5970	50396563	SO:0001583	missense	4644	exon39				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.5308A>T	15.37:g.52609271T>A	ENSP00000382177:p.Met1770Leu		50396563	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.096695	0.36952	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.84873	-1.87;-1.87;-1.91;-1.91;-1.87	5.46	5.46	0.80206	Dilute (1);Dil domain (1);	0.000000	0.85682	D	0.000000	T	0.71796	0.3382	N	0.12746	0.255	0.80722	D	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.16289	0.009;0.015;0.005	T	0.67273	-0.5712	10	0.07644	T	0.81	.	15.8252	0.78698	0.0:0.0:0.0:1.0	.	500;1770;1743	B5LY56;Q9Y4I1;Q9Y4I1-2	.;MYO5A_HUMAN;.	L	1770;1277;1767;1743;1795;1373;1768	ENSP00000382177:M1770L;ENSP00000382179:M1767L;ENSP00000348693:M1743L;ENSP00000350945:M1795L;ENSP00000451109:M1768L	ENSP00000348693:M1743L	M	-	1	0	MYO5A	50396563	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.073000	0.64395	2.197000	0.70478	0.482000	0.46254	ATG		0.388	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
VPS13C	54832	broad.mit.edu	37	15	62167144	62167144	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr15:62167144C>G	ENST00000261517.5	-	77	10418	c.10345G>C	c.(10345-10347)Gtt>Ctt	p.V3449L	VPS13C_ENST00000558919.1_5'Flank|VPS13C_ENST00000395896.4_Missense_Mutation_p.V3449L|VPS13C_ENST00000249837.3_Missense_Mutation_p.V3406L|VPS13C_ENST00000395898.3_Missense_Mutation_p.V3406L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.V3449L(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GGGCCTTGAACAGCACCCTGG	0.333																																					p.V3406L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10216C	15						.						84.0	84.0	84.0					15																	62167144		2203	4300	6503	59954436	SO:0001583	missense	54832	exon75			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10345G>C	15.37:g.62167144C>G	ENSP00000261517:p.Val3449Leu		59954436	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364308	0.95877	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.50001	0.76;0.76;0.94	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	L	0.58302	1.8	0.80722	D	1	P;D;P;D	0.59357	0.918;0.985;0.918;0.964	P;P;P;P	0.61003	0.835;0.835;0.882;0.766	T	0.65368	-0.6185	10	0.72032	D	0.01	.	20.115	0.97926	0.0:1.0:0.0:0.0	.	3406;3449;3406;3449	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	L	3406;3449;3449;3449	ENSP00000249837:V3406L;ENSP00000261517:V3449L;ENSP00000379233:V3449L	ENSP00000249837:V3406L	V	-	1	0	VPS13C	59954436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.334000	0.65923	2.761000	0.94854	0.650000	0.86243	GTT		0.333	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
CEMIP	57214	broad.mit.edu	37	15	81230253	81230253	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr15:81230253T>G	ENST00000394685.3	+	25	3759	c.3340T>G	c.(3340-3342)Ttg>Gtg	p.L1114V	KIAA1199_ENST00000220244.3_Missense_Mutation_p.L1114V|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Missense_Mutation_p.L1114V			Q8WUJ3	CEMIP_HUMAN		1114					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.L1114V(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CGTGAGGACCTTGCAGATGGA	0.597																																					p.L1114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3340G	15						.						67.0	57.0	61.0					15																	81230253		2203	4300	6503	79017308	SO:0001583	missense	57214	exon24																														ENST00000394685.3:c.3340T>G	15.37:g.81230253T>G	ENSP00000378177:p.Leu1114Val		79017308	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	T	2.320	-0.355843	0.05138	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.38887	1.11;1.11;1.11	5.46	-8.97	0.00758	.	1.125910	0.06719	N	0.774504	T	0.20740	0.0499	N	0.14661	0.345	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.30327	-0.9982	10	0.17369	T	0.5	-2.0347	12.1527	0.54059	0.0918:0.5413:0.0:0.3668	.	1114	Q8WUJ3	K1199_HUMAN	V	1114	ENSP00000220244:L1114V;ENSP00000378177:L1114V;ENSP00000348583:L1114V	ENSP00000220244:L1114V	L	+	1	2	KIAA1199	79017308	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-0.755000	0.04782	-1.301000	0.02338	-0.290000	0.09829	TTG		0.597	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
ACSM5	54988	broad.mit.edu	37	16	20430599	20430599	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:20430599G>A	ENST00000331849.4	+	4	612	c.465G>A	c.(463-465)aaG>aaA	p.K155K	ACSM5_ENST00000575584.1_Silent_p.K155K	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	155					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.K155K(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						AGGACCTCAAGTACCGGCTGC	0.577																																					p.K155K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G465A	16						.						85.0	75.0	78.0					16																	20430599		2203	4300	6503	20338100	SO:0001819	synonymous_variant	54988	exon4				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.465G>A	16.37:g.20430599G>A			20338100	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	CCDS10585.1																																																																																				0.577	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
HS3ST2	9956	broad.mit.edu	37	16	22826201	22826201	+	Silent	SNP	C	C	T	rs35506706		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:22826201C>T	ENST00000261374.3	+	1	704	c.270C>T	c.(268-270)gcC>gcT	p.A90A		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	90					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)	p.A90A(1)		breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		gcgcgcccgccgccgccgtgc	0.726																																					p.A90A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C270T	16						.						3.0	4.0	4.0					16																	22826201		1853	3797	5650	22733702	SO:0001819	synonymous_variant	9956	exon1			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.270C>T	16.37:g.22826201C>T			22733702	NM_006043	Q52LZ1	Silent	SNP	ENST00000261374.3	37	CCDS10606.1																																																																																				0.726	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
USP31	57478	broad.mit.edu	37	16	23102074	23102074	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:23102074T>C	ENST00000219689.7	-	7	1285	c.1286A>G	c.(1285-1287)cAt>cGt	p.H429R		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.H429R(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		AGACAGTCTATGATAATCCAA	0.368																																					p.H429R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1286G	16						.						110.0	96.0	101.0					16																	23102074		2197	4300	6497	23009575	SO:0001583	missense	57478	exon7			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1286A>G	16.37:g.23102074T>C	ENSP00000219689:p.His429Arg		23009575	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	T	8.236	0.805665	0.16467	.	.	ENSG00000103404	ENST00000219689	T	0.07327	3.2	5.83	0.903	0.19296	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.672464	0.14339	N	0.325875	T	0.05318	0.0141	N	0.25825	0.765	0.09310	N	1	B	0.15719	0.014	B	0.18871	0.023	T	0.46261	-0.9204	10	0.16420	T	0.52	0.1463	7.0183	0.24900	0.0:0.136:0.3807:0.4833	.	429	Q70CQ4	UBP31_HUMAN	R	429	ENSP00000219689:H429R	ENSP00000219689:H429R	H	-	2	0	USP31	23009575	0.644000	0.27277	0.051000	0.19133	0.998000	0.95712	0.268000	0.18571	-0.121000	0.11787	0.528000	0.53228	CAT		0.368	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
GGA2	23062	broad.mit.edu	37	16	23497377	23497377	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:23497377G>C	ENST00000309859.4	-	8	839	c.757C>G	c.(757-759)Cgc>Ggc	p.R253G	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	253	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)	p.R253G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		CCTGGCCTGCGGTACATGCTC	0.552																																					p.R253G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C757G	16						.						128.0	97.0	107.0					16																	23497377		2197	4300	6497	23404878	SO:0001583	missense	23062	exon8			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.757C>G	16.37:g.23497377G>C	ENSP00000311962:p.Arg253Gly		23404878	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790954	0.50102	.	.	ENSG00000103365	ENST00000309859	T	0.41758	0.99	6.07	5.1	0.69264	GAT (2);	0.653207	0.16224	N	0.223933	T	0.45054	0.1323	L	0.58101	1.795	0.39504	D	0.968251	P	0.39696	0.683	P	0.45343	0.477	T	0.32745	-0.9895	10	0.25106	T	0.35	-7.9028	10.0709	0.42332	0.0:0.1495:0.6954:0.1551	.	253	Q9UJY4	GGA2_HUMAN	G	253	ENSP00000311962:R253G	ENSP00000311962:R253G	R	-	1	0	GGA2	23404878	0.961000	0.32948	0.994000	0.49952	0.918000	0.54935	1.650000	0.37292	1.529000	0.49120	0.655000	0.94253	CGC		0.552	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
PPL	5493	broad.mit.edu	37	16	4934345	4934345	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:4934345G>A	ENST00000345988.2	-	22	4400	c.4311C>T	c.(4309-4311)gcC>gcT	p.A1437A	PPL_ENST00000590782.2_Silent_p.A1435A	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1437					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A1437A(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CCTTCTCACGGGCCTCAGCTT	0.672																																					p.A1437A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4311T	16						.						69.0	70.0	70.0					16																	4934345		2191	4292	6483	4874346	SO:0001819	synonymous_variant	5493	exon22			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.4311C>T	16.37:g.4934345G>A			4874346	NM_002705	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1																																																																																				0.672	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
PLK1	5347	broad.mit.edu	37	16	23691501	23691501	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr16:23691501C>T	ENST00000300093.4	+	2	616	c.505C>T	c.(505-507)Cga>Tga	p.R169*	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R169*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GTACCTGCACCGAAACCGAGT	0.532																																					p.R169X	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C505T	16						.						129.0	110.0	116.0					16																	23691501		2197	4300	6497	23599002	SO:0001587	stop_gained	5347	exon2				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.505C>T	16.37:g.23691501C>T	ENSP00000300093:p.Arg169*		23599002	NM_005030	Q15153|Q99746	Nonsense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	C	35	5.484831	0.96323	.	.	ENSG00000166851	ENST00000300093;ENST00000425844;ENST00000330792	.	.	.	5.51	-0.439	0.12264	.	0.364346	0.32161	N	0.006485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-1.3396	9.3752	0.38278	0.4801:0.2853:0.2346:0.0	.	.	.	.	X	169;72;169	.	ENSP00000300093:R169X	R	+	1	2	PLK1	23599002	0.107000	0.21998	0.814000	0.32528	0.924000	0.55760	0.310000	0.19356	0.000000	0.14550	-0.324000	0.08512	CGA		0.532	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
TNFSF13	8741	broad.mit.edu	37	17	7462459	7462460	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:7462459_7462460insG	ENST00000338784.4	+	1	546_547	c.103_104insG	c.(103-105)tggfs	p.W35fs	SENP3_ENST00000321337.7_5'Flank|TNFSF13_ENST00000396545.4_Frame_Shift_Ins_p.W35fs|TNFSF13_ENST00000349228.4_Frame_Shift_Ins_p.W35fs|TNFSF12_ENST00000557233.1_Intron|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF13_ENST00000380535.4_Frame_Shift_Ins_p.W35fs|TNFSF13_ENST00000483039.1_Intron|TNFSF13_ENST00000396542.1_Frame_Shift_Ins_p.W18fs	NM_003808.3	NP_003799.1	O75888	TNF13_HUMAN	tumor necrosis factor (ligand) superfamily, member 13	35					gene expression (GO:0010467)|immunoglobulin production in mucosal tissue (GO:0002426)|mRNA metabolic process (GO:0016071)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	receptor binding (GO:0005102)	p.A37fs*88(2)		large_intestine(2)|lung(2)|skin(1)	5		Prostate(122;0.157)				CTGGTTGAGTTGGGGGGCAGCT	0.639																																					p.W35fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.103_104insG	17						.																																			7403184	SO:0001589	frameshift_variant	8741	exon1			AF046888	CCDS11111.1, CCDS11112.1, CCDS42256.1, CCDS56019.1, CCDS73957.1	17p13.1	2007-07-23			ENSG00000161955	ENSG00000161955		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11928	protein-coding gene	gene with protein product		604472				9743536	Standard	NM_172088		Approved	APRIL, CD256		O75888	OTTHUMG00000108145	ENST00000338784.4:c.109dupG	17.37:g.7462465_7462465dupG	ENSP00000343505:p.Trp35fs		7403183	NM_001198622	A8MYD5|B4DVT2|Q541E1|Q5U0G8|Q96HV6|Q9P1M8|Q9P1M9	Frame_Shift_Ins	INS	ENST00000338784.4	37	CCDS11111.1																																																																																				0.639	TNFSF13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226948.2	NM_003808	
ERAL1	26284	broad.mit.edu	37	17	27182094	27182094	+	Silent	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:27182094G>C	ENST00000254928.5	+	1	139	c.42G>C	c.(40-42)tcG>tcC	p.S14S	FAM222B_ENST00000583953.1_5'Flank|ERAL1_ENST00000578001.1_3'UTR	NM_005702.2	NP_005693.1	O75616	ERAL1_HUMAN	Era-like 12S mitochondrial rRNA chaperone 1	14					ribosomal small subunit assembly (GO:0000028)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)	p.S14S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			TTGTTCAATCGGTGTTAAGAG	0.622																																					p.S14S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G42C	17						.						55.0	49.0	51.0					17																	27182094		2203	4300	6503	24206220	SO:0001819	synonymous_variant	26284	exon1			AF082657	CCDS11244.1	17q11.2	2013-05-22	2013-05-22		ENSG00000132591	ENSG00000132591			3424	protein-coding gene	gene with protein product		607435	"""Era (E. coli G-protein homolog)-like 1"", ""Era G-protein-like 1 (E. coli)"""			10945472, 20604745	Standard	NM_005702		Approved	HERA-B	uc002hcy.1	O75616	OTTHUMG00000132675	ENST00000254928.5:c.42G>C	17.37:g.27182094G>C			24206220	NM_005702	B3KN21|C9JEC6|O75617|Q8WUY4|Q96LE2|Q96TC0	Silent	SNP	ENST00000254928.5	37	CCDS11244.1																																																																																				0.622	ERAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255937.2		
ANKRD13B	124930	broad.mit.edu	37	17	27935094	27935094	+	Missense_Mutation	SNP	C	C	G	rs199997513		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:27935094C>G	ENST00000394859.3	+	3	495	c.341C>G	c.(340-342)gCg>gGg	p.A114G	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	114						endosome (GO:0005768)|plasma membrane (GO:0005886)		p.A114G(1)		cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						AAGCGGCTGGCGGGCATCCCC	0.667																																					p.A114G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C341G	17						.						34.0	39.0	37.0					17																	27935094		2203	4300	6503	24959220	SO:0001583	missense	124930	exon3			AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.341C>G	17.37:g.27935094C>G	ENSP00000378328:p.Ala114Gly		24959220	NM_152345	Q8N7S9	Missense_Mutation	SNP	ENST00000394859.3	37	CCDS11251.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622070	0.66787	.	.	ENSG00000198720	ENST00000394859	T	0.56444	0.46	6.03	6.03	0.97812	.	0.046997	0.85682	D	0.000000	T	0.45054	0.1323	L	0.31578	0.945	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.21314	-1.0249	10	0.23302	T	0.38	-26.247	20.177	0.98182	0.0:1.0:0.0:0.0	.	114	Q86YJ7	AN13B_HUMAN	G	114	ENSP00000378328:A114G	ENSP00000378328:A114G	A	+	2	0	ANKRD13B	24959220	1.000000	0.71417	0.979000	0.43373	0.992000	0.81027	4.840000	0.62817	2.854000	0.98071	0.655000	0.94253	GCG		0.667	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256077.1	NM_152345	
CNTNAP1	8506	broad.mit.edu	37	17	40837075	40837075	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:40837075C>T	ENST00000264638.4	+	4	647	c.430C>T	c.(430-432)Cgc>Tgc	p.R144C	CCR10_ENST00000591765.1_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	144	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.R144C(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTTCACTGCGCGCTACATCCG	0.617																																					p.R144C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C430T	17						.						99.0	83.0	88.0					17																	40837075		2203	4300	6503	38090601	SO:0001583	missense	8506	exon4			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.430C>T	17.37:g.40837075C>T	ENSP00000264638:p.Arg144Cys		38090601	NM_003632		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921897	0.73213	.	.	ENSG00000108797	ENST00000264638	D	0.99207	-5.56	5.52	4.47	0.54385	Concanavalin A-like lectin/glucanase (1);Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000005	D	0.99486	0.9817	M	0.89968	3.075	0.45066	D	0.998087	D	0.89917	1.0	D	0.80764	0.994	D	0.98243	1.0489	10	0.87932	D	0	.	17.0403	0.86487	0.1358:0.8642:0.0:0.0	.	144	P78357	CNTP1_HUMAN	C	144	ENSP00000264638:R144C	ENSP00000264638:R144C	R	+	1	0	CNTNAP1	38090601	0.998000	0.40836	1.000000	0.80357	0.757000	0.42996	3.780000	0.55386	2.586000	0.87340	0.561000	0.74099	CGC		0.617	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
TP53	7157	broad.mit.edu	37	17	7577065	7577071	+	Frame_Shift_Del	DEL	CTTGCGG	CTTGCGG	-	rs372613518|rs55819519		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	CTTGCGG	CTTGCGG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:7577065_7577071delCTTGCGG	ENST00000269305.4	-	8	1056_1062	c.867_873delCCGCAAG	c.(865-873)ctccgcaagfs	p.LRK289fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.LRK289fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.LRK289fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.LRK289fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.LRK289fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	289	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in a sporadic cancer; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R290H(18)|p.N288fs*13(17)|p.K291fs*48(8)|p.0?(8)|p.K291*(5)|p.R290L(4)|p.K291R(3)|p.K291T(3)|p.K291N(3)|p.R290C(3)|p.R290fs*53(2)|p.K291K(2)|p.K291E(2)|p.?(2)|p.R290R(2)|p.L289L(2)|p.R290fs*12(1)|p.R290fs*50(1)|p.R290fs*57(1)|p.R290fs*55(1)|p.K291fs*12(1)|p.K291Q(1)|p.T284_G293del10(1)|p.K291M(1)|p.E285fs*13(1)|p.E294fs*51(1)|p.L265_K305del41(1)|p.R290_P295>X(1)|p.K291fs*54(1)|p.R290S(1)|p.V272_K292del21(1)|p.N288fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTCCCCTTTCTTGCGGAGATTCTCTT	0.57		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.289_291del	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	100	Substitution - Missense(39)|Deletion - Frameshift(35)|Whole gene deletion(8)|Substitution - coding silent(6)|Substitution - Nonsense(5)|Deletion - In frame(3)|Unknown(2)|Insertion - Frameshift(1)|Complex - deletion inframe(1)	upper_aerodigestive_tract(38)|urinary_tract(10)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|breast(5)|skin(5)|central_nervous_system(4)|lung(4)|bone(4)|ovary(3)|stomach(2)|soft_tissue(2)|oesophagus(2)|cervix(1)|salivary_gland(1)|vulva(1)|biliary_tract(1)|liver(1)|endometrium(1)|prostate(1)|pancreas(1)	c.867_873del	17	GRCh37	CM065493|CM993905	TP53	M	rs55819519	.																																			7517796	SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.867_873delCCGCAAG	17.37:g.7577065_7577071delCTTGCGG	ENSP00000269305:p.Leu289fs		7517790	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.570	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RPTOR	57521	broad.mit.edu	37	17	78919564	78919564	+	Silent	SNP	C	C	T	rs199631709		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr17:78919564C>T	ENST00000306801.3	+	26	3485	c.3123C>T	c.(3121-3123)gcC>gcT	p.A1041A	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Silent_p.A883A	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1041					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A1041A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TCGCCGTAGCCGACAAGGACA	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		15774	0.0		0.001	False		,,,				2504	0.0				p.A1041A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3123T	17						.						76.0	66.0	69.0					17																	78919564		2203	4300	6503	76534159	SO:0001819	synonymous_variant	57521	exon26				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3123C>T	17.37:g.78919564C>T			76534159	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	ENST00000306801.3	37	CCDS11773.1																																																																																				0.607	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
RIOK3	8780	broad.mit.edu	37	18	21044185	21044185	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr18:21044185A>T	ENST00000339486.3	+	4	958	c.341A>T	c.(340-342)gAa>gTa	p.E114V	RIOK3_ENST00000577501.1_Missense_Mutation_p.E114V|RIOK3_ENST00000581585.1_Missense_Mutation_p.E98V	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	114					chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E114V(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTTCCTTTGAAAATTATCGA	0.383																																					p.E114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A341T	18						.						81.0	80.0	80.0					18																	21044185		2203	4300	6503	19298183	SO:0001583	missense	8780	exon4			AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.341A>T	18.37:g.21044185A>T	ENSP00000341874:p.Glu114Val		19298183	NM_003831	Q8IXN9	Missense_Mutation	SNP	ENST00000339486.3	37	CCDS11877.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731967	0.69189	.	.	ENSG00000101782	ENST00000339486	T	0.08008	3.14	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.15739	0.0379	M	0.64997	1.995	0.80722	D	1	P;P;P	0.49185	0.79;0.92;0.87	B;P;B	0.45794	0.298;0.493;0.298	T	0.00419	-1.1751	10	0.49607	T	0.09	0.3193	16.4781	0.84144	1.0:0.0:0.0:0.0	.	98;114;114	B4E1Q4;O14730-2;O14730	.;.;RIOK3_HUMAN	V	114	ENSP00000341874:E114V	ENSP00000341874:E114V	E	+	2	0	RIOK3	19298183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.105000	0.94246	2.288000	0.76882	0.528000	0.53228	GAA		0.383	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1	NM_003831	
ARHGAP28	79822	broad.mit.edu	37	18	6882285	6882285	+	Silent	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr18:6882285C>A	ENST00000383472.4	+	11	1544	c.1440C>A	c.(1438-1440)atC>atA	p.I480I	ARHGAP28_ENST00000400091.2_Silent_p.I480I|ARHGAP28_ENST00000532996.1_Silent_p.I303I|ARHGAP28_ENST00000418986.1_Silent_p.I321I|ARHGAP28_ENST00000314319.3_Silent_p.I321I|ARHGAP28_ENST00000531294.1_Silent_p.I316I|ARHGAP28_ENST00000419673.2_Silent_p.I321I|ARHGAP28_ENST00000262227.3_Silent_p.I428I			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	480	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.I321I(1)|p.I480I(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CTGCCTTCATCAGTCTAATGG	0.413																																					p.I321I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C963A	18						.						141.0	130.0	134.0					18																	6882285		2203	4300	6503	6872285	SO:0001819	synonymous_variant	79822	exon10			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1440C>A	18.37:g.6882285C>A			6872285	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	ENST00000383472.4	37																																																																																					0.413	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
C18orf8	29919	broad.mit.edu	37	18	21086980	21086980	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr18:21086980A>T	ENST00000269221.3	+	3	336	c.226A>T	c.(226-228)Aat>Tat	p.N76Y	C18orf8_ENST00000590868.1_Missense_Mutation_p.N76Y	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	76						lysosomal membrane (GO:0005765)		p.N76Y(1)		endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTCCTTAGAAAATAAGATATT	0.338																																					p.N76Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A226T	18						.						164.0	177.0	173.0					18																	21086980		2203	4300	6503	19340978	SO:0001583	missense	29919	exon3			AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.226A>T	18.37:g.21086980A>T	ENSP00000269221:p.Asn76Tyr		19340978	NM_013326	Q9BU17|Q9Y5M0	Missense_Mutation	SNP	ENST00000269221.3	37	CCDS32803.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.611540	0.66558	.	.	ENSG00000141452	ENST00000269221;ENST00000540942	T	0.11930	2.73	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.040777	0.85682	D	0.000000	T	0.20170	0.0485	M	0.69823	2.125	0.80722	D	1	P;P	0.44380	0.744;0.834	B;P	0.45506	0.289;0.483	T	0.07347	-1.0777	10	0.02654	T	1	-14.1545	16.3483	0.83171	1.0:0.0:0.0:0.0	.	76;76	Q96DM3;F5H2W0	MIC1_HUMAN;.	Y	76	ENSP00000269221:N76Y	ENSP00000269221:N76Y	N	+	1	0	C18orf8	19340978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.627000	0.90974	2.254000	0.74563	0.533000	0.62120	AAT		0.338	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	NM_013326	
COLGALT1	79709	broad.mit.edu	37	19	17688013	17688013	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:17688013C>T	ENST00000252599.4	+	7	1079	c.959C>T	c.(958-960)cCg>cTg	p.P320L		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	320					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)	p.P320L(1)									GTGAAGCACCCGCCCGCAGAG	0.662																																					p.P320L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C959T	19						.						41.0	40.0	41.0					19																	17688013		2203	4300	6503	17549013	SO:0001583	missense	79709	exon7			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.959C>T	19.37:g.17688013C>T	ENSP00000252599:p.Pro320Leu		17549013	NM_024656	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	37	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330317	0.60743	.	.	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.77489	-1.1	4.47	4.47	0.54385	.	0.107001	0.64402	D	0.000004	D	0.84497	0.5485	M	0.84433	2.695	0.80722	D	1	D;D	0.64830	0.98;0.994	P;P	0.52672	0.619;0.706	D	0.87005	0.2119	10	0.59425	D	0.04	-21.9996	13.0257	0.58814	0.0:1.0:0.0:0.0	.	48;320	E9PC06;Q8NBJ5	.;GT251_HUMAN	L	48;320	ENSP00000252599:P320L	ENSP00000252599:P320L	P	+	2	0	GLT25D1	17549013	0.978000	0.34361	0.917000	0.36280	0.058000	0.15608	3.798000	0.55522	2.218000	0.71995	0.478000	0.44815	CCG		0.662	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
C19orf35	374872	broad.mit.edu	37	19	2278991	2278991	+	Silent	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:2278991C>T	ENST00000342063.3	-	3	297	c.204G>A	c.(202-204)caG>caA	p.Q68Q		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	68								p.Q68Q(1)		large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGCAGTGACTGGGTCCGGG	0.672																																					p.Q68Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G204A	19						.																																			2229991	SO:0001819	synonymous_variant	374872	exon3			AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.204G>A	19.37:g.2278991C>T			2229991	NM_198532		Silent	SNP	ENST00000342063.3	37	CCDS12087.1																																																																																				0.672	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442080.1	NM_198532	
EEF2	1938	broad.mit.edu	37	19	3984136	3984136	+	Silent	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:3984136T>A	ENST00000309311.6	-	2	304	c.216A>T	c.(214-216)tcA>tcT	p.S72S	SNORD37_ENST00000384048.1_RNA|EEF2_ENST00000600720.1_5'UTR	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	72	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)	p.S72S(1)		endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCTCACGTTGACTTGATGG	0.662																																					p.S72S	Colon(165;1804 1908 4071 6587 18799)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A216T	19						.						89.0	79.0	82.0					19																	3984136		2203	4300	6503	3935136	SO:0001819	synonymous_variant	1938	exon2			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.216A>T	19.37:g.3984136T>A			3935136	NM_001961	B2RMP5|D6W618|Q58J86	Silent	SNP	ENST00000309311.6	37	CCDS12117.1																																																																																				0.662	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	
SLC25A42	284439	broad.mit.edu	37	19	19218742	19218742	+	Silent	SNP	A	A	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:19218742A>G	ENST00000318596.7	+	7	688	c.537A>G	c.(535-537)agA>agG	p.R179R	SLC25A42_ENST00000600275.1_3'UTR	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	179					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)	p.R179R(1)		cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GCATCTCGAGAGAAGAGGGGC	0.572																																					p.R179R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A537G	19						.						122.0	110.0	114.0					19																	19218742		2203	4300	6503	19079742	SO:0001819	synonymous_variant	284439	exon7				CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.537A>G	19.37:g.19218742A>G			19079742	NM_178526	D2T2J5|O14553|O43378	Silent	SNP	ENST00000318596.7	37	CCDS32966.1																																																																																				0.572	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
ZNF30	90075	broad.mit.edu	37	19	35435739	35435739	+	Silent	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:35435739C>T	ENST00000601142.1	+	5	2106	c.1869C>T	c.(1867-1869)ccC>ccT	p.P623P	ZNF30_ENST00000426813.2_Silent_p.P542P|ZNF30_ENST00000303586.7_Silent_p.P624P|ZNF30_ENST00000439785.1_Silent_p.P624P|ZNF30_ENST00000601957.1_3'UTR			P17039	ZNF30_HUMAN	zinc finger protein 30	623					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P624P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		GTGTTATACCCTAAGAGTCTG	0.403																																					p.P624P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1872T	19						.						22.0	22.0	22.0					19																	35435739		2015	4180	6195	40127579	SO:0001819	synonymous_variant	90075	exon5			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1869C>T	19.37:g.35435739C>T			40127579	NM_001099437	A5PLP1|A8K320|B4DIC0|Q6N068	Silent	SNP	ENST00000601142.1	37	CCDS46045.1																																																																																				0.403	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
ARHGAP33	115703	broad.mit.edu	37	19	36278393	36278393	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:36278393G>T	ENST00000007510.4	+	21	3070	c.2926G>T	c.(2926-2928)Gat>Tat	p.D976Y	AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.D840Y|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.D815Y			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	976					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.D815Y(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						GCAACAAAGTGATGGGAGCCT	0.697																																					p.D815Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2443T	19						.						13.0	17.0	16.0					19																	36278393		2180	4257	6437	40970233	SO:0001583	missense	115703	exon21			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.2926G>T	19.37:g.36278393G>T	ENSP00000007510:p.Asp976Tyr		40970233	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	G	17.10	3.301762	0.60195	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.16324	2.86;2.35;2.97	5.07	5.07	0.68467	.	0.276731	0.25660	N	0.029158	T	0.29524	0.0736	N	0.24115	0.695	0.37328	D	0.909838	B;B;D	0.71674	0.158;0.395;0.998	B;B;D	0.73380	0.017;0.068;0.98	T	0.26121	-1.0112	10	0.72032	D	0.01	.	17.2053	0.86916	0.0:0.0:1.0:0.0	.	976;840;815	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	Y	976;815;840	ENSP00000007510:D976Y;ENSP00000320038:D815Y;ENSP00000368227:D840Y	ENSP00000007510:D976Y	D	+	1	0	ARHGAP33	40970233	0.972000	0.33761	1.000000	0.80357	0.911000	0.54048	2.979000	0.49313	2.357000	0.79964	0.462000	0.41574	GAT		0.697	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
WDR62	284403	broad.mit.edu	37	19	36594788	36594788	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:36594788C>T	ENST00000270301.7	+	30	4043	c.4043C>T	c.(4042-4044)tCc>tTc	p.S1348F	WDR62_ENST00000401500.2_Missense_Mutation_p.S1353F			O43379	WDR62_HUMAN	WD repeat domain 62	1348					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.S1348F(1)		cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTCCTGAGTCCCCTGGCCTT	0.687																																					p.S1353F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4058T	19						.						45.0	48.0	47.0					19																	36594788		2203	4300	6503	41286628	SO:0001583	missense	284403	exon30			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.4043C>T	19.37:g.36594788C>T	ENSP00000270301:p.Ser1348Phe		41286628	NM_001083961	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928563	0.34002	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.47177	0.94;0.85	4.96	3.92	0.45320	.	0.612875	0.15577	N	0.255111	T	0.42944	0.1225	N	0.14661	0.345	0.21527	N	0.999655	P;P	0.49358	0.923;0.874	P;P	0.53593	0.73;0.541	T	0.25950	-1.0117	10	0.52906	T	0.07	-2.4912	11.2112	0.48799	0.0:0.8151:0.1849:0.0	.	1353;1348	O43379-4;O43379	.;WDR62_HUMAN	F	1353;1348	ENSP00000384792:S1353F;ENSP00000270301:S1348F	ENSP00000270301:S1348F	S	+	2	0	WDR62	41286628	0.005000	0.15991	0.033000	0.17914	0.014000	0.08584	1.531000	0.36018	1.312000	0.45043	0.555000	0.69702	TCC		0.687	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671	
ZNF568	374900	broad.mit.edu	37	19	37441788	37441788	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:37441788G>T	ENST00000333987.7	+	7	2239	c.1733G>T	c.(1732-1734)aGa>aTa	p.R578I	ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.R514I|ZNF568_ENST00000455427.2_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R578I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTCATGTGAGAAGTCACACA	0.383																																					p.R578I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1733T	19						.						73.0	84.0	80.0					19																	37441788		2193	4294	6487	42133628	SO:0001583	missense	374900	exon7			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1733G>T	19.37:g.37441788G>T	ENSP00000334685:p.Arg578Ile		42133628	NM_198539	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.345522	0.41498	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.24908	1.83;4.29	3.74	2.69	0.31865	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.193084	0.25801	N	0.028218	T	0.41050	0.1142	M	0.70787	2.145	0.80722	D	1	D	0.54772	0.968	P	0.58660	0.843	T	0.28170	-1.0052	10	0.59425	D	0.04	.	9.0582	0.36419	0.1125:0.0:0.8875:0.0	.	578	Q3ZCX4	ZN568_HUMAN	I	578;514	ENSP00000334685:R578I;ENSP00000394514:R514I	ENSP00000334685:R578I	R	+	2	0	ZNF568	42133628	0.000000	0.05858	0.807000	0.32361	0.997000	0.91878	0.312000	0.19397	0.908000	0.36671	0.591000	0.81541	AGA		0.383	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
POU2F2	5452	broad.mit.edu	37	19	42598041	42598041	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:42598041G>A	ENST00000526816.2	-	12	1153	c.1138C>T	c.(1138-1140)Ccc>Tcc	p.P380S	POU2F2_ENST00000533720.1_Missense_Mutation_p.P364S|POU2F2_ENST00000560558.1_Missense_Mutation_p.P325S|POU2F2_ENST00000389341.5_Missense_Mutation_p.P364S|POU2F2_ENST00000560398.1_Missense_Mutation_p.P386S|POU2F2_ENST00000342301.4_Missense_Mutation_p.P380S|POU2F2_ENST00000529952.1_Missense_Mutation_p.P380S|POU2F2_ENST00000529067.1_Missense_Mutation_p.P364S			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	380					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P364S(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	CCCCCTTGGGGTGTGACCTGA	0.622																																					p.P364S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1090T	19						.						107.0	95.0	99.0					19																	42598041		2203	4300	6503	47289881	SO:0001583	missense	5452	exon12				CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1138C>T	19.37:g.42598041G>A	ENSP00000431603:p.Pro380Ser		47289881	NM_002698	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428889	0.25726	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	T;D;D;T;T	0.82526	-1.43;-1.62;-1.58;-1.33;-1.49	3.98	3.98	0.46160	.	2.632160	0.01305	N	0.010433	T	0.66963	0.2843	N	0.03608	-0.345	0.30154	N	0.802816	B;B;B	0.21452	0.002;0.056;0.007	B;B;B	0.19666	0.001;0.026;0.007	T	0.59445	-0.7453	10	0.13108	T	0.6	.	9.2172	0.37355	0.1028:0.0:0.8972:0.0	.	364;380;364	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	S	364;380;380;364;379;364;380	ENSP00000373992:P364S;ENSP00000339369:P380S;ENSP00000437221:P364S;ENSP00000437224:P364S;ENSP00000436988:P380S	ENSP00000292077:P380S	P	-	1	0	POU2F2	47289881	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.681000	0.46926	2.236000	0.73375	0.561000	0.74099	CCC		0.622	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
MUC16	94025	broad.mit.edu	37	19	9082940	9082940	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:9082940T>A	ENST00000397910.4	-	1	9078	c.8875A>T	c.(8875-8877)Act>Tct	p.T2959S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2960	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T2959S(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGGTTTCAGTAAAACCTGTT	0.498																																					p.T2959S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A8875T	19						.						114.0	111.0	112.0					19																	9082940		1989	4194	6183	8943940	SO:0001583	missense	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8875A>T	19.37:g.9082940T>A	ENSP00000381008:p.Thr2959Ser		8943940	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.067	0.380608	0.11466	.	.	ENSG00000181143	ENST00000397910	T	0.02369	4.32	0.723	0.723	0.18231	.	.	.	.	.	T	0.03564	0.0102	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.45818	-0.9235	7	0.87932	D	0	.	.	.	.	.	2959	B5ME49	.	S	2959	ENSP00000381008:T2959S	ENSP00000381008:T2959S	T	-	1	0	MUC16	8943940	0.007000	0.16637	0.008000	0.14137	0.381000	0.30169	1.118000	0.31246	0.560000	0.29169	0.248000	0.18094	ACT		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LILRA5	353514	broad.mit.edu	37	19	54823313	54823313	+	Missense_Mutation	SNP	C	C	T	rs146444616	byFrequency	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr19:54823313C>T	ENST00000301219.3	-	4	349	c.230G>A	c.(229-231)cGt>cAt	p.R77H	LILRA5_ENST00000446712.3_Missense_Mutation_p.R65H|AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000346508.3_Missense_Mutation_p.R65H|LILRA5_ENST00000432233.3_Missense_Mutation_p.R77H	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	77	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R77H(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTTAACCAGACGGTATTCCTG	0.592																																					p.R77H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G230A	19						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	227.0	203.0	211.0		230,230,194,194	-5.9	0.0	19	dbSNP_134	211	0,8600		0,0,4300	no	missense,missense,missense,missense	LILRA5	NM_021250.2,NM_181879.2,NM_181985.2,NM_181986.2	29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	77/300,77/266,65/288,65/254	54823313	1,13005	2203	4300	6503	59515125	SO:0001583	missense	353514	exon4			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.230G>A	19.37:g.54823313C>T	ENSP00000301219:p.Arg77His		59515125	NM_021250	A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	37	CCDS12888.1	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.392275	0.01185	2.27E-4	0.0	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	2.93	-5.87	0.02297	Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	2.394330	0.02227	N	0.064579	T	0.05823	0.0152	N	0.11756	0.17	0.09310	N	1	B;B;B;B	0.20261	0.008;0.043;0.007;0.029	B;B;B;B	0.15870	0.003;0.009;0.005;0.014	T	0.31024	-0.9958	10	0.08179	T	0.78	.	4.3174	0.11000	0.2806:0.197:0.0:0.5223	.	65;77;65;77	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	H	77;65;65;77	ENSP00000301219:R77H;ENSP00000302948:R65H;ENSP00000389499:R65H;ENSP00000404236:R77H	ENSP00000301219:R77H	R	-	2	0	LILRA5	59515125	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-6.193000	0.00076	-2.329000	0.00634	-1.472000	0.01007	CGT		0.592	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
ADORA3	140	broad.mit.edu	37	1	112031487	112031487	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:112031487G>A	ENST00000369716.4	-	3	750	c.617C>T	c.(616-618)aCc>aTc	p.T206I	ADORA3_ENST00000369717.4_Missense_Mutation_p.T125I|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.T206I(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	CACATGATTGGTGCTGTTAGG	0.537																																					p.T125I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C374T	1						.						185.0	159.0	168.0					1																	112031487		2203	4300	6503	111833010	SO:0001583	missense	140	exon3			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.617C>T	1.37:g.112031487G>A	ENSP00000358730:p.Thr206Ile		111833010	NM_001081976	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	37	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.74|12.74	2.028442|2.028442	0.35797|0.35797	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000414219;ENST00000442484|ENST00000369717;ENST00000369716;ENST00000355437;ENST00000443498	.|T;T;T	.|0.04317	.|3.65;3.65;3.65	5.15|5.15	4.23|4.23	0.50019|0.50019	.|.	.|0.122893	.|0.37136	.|N	.|0.002226	T|T	0.09335|0.09335	0.0230|0.0230	L|L	0.58669|0.58669	1.825|1.825	0.80722|0.80722	D|D	1|1	.|D;D	.|0.67145	.|0.996;0.989	.|D;P	.|0.71184	.|0.972;0.884	T|T	0.01409|0.01409	-1.1362|-1.1362	5|10	.|0.87932	.|D	.|0	-21.5174|-21.5174	11.8905|11.8905	0.52626|0.52626	0.0:0.1752:0.8248:0.0|0.0:0.1752:0.8248:0.0	.|.	.|125;206	.|Q5QNY7;P33765-2	.|.;.	S|I	66;19|125;206;37;31	.|ENSP00000358731:T125I;ENSP00000358730:T206I;ENSP00000398770:T31I	.|ENSP00000347612:T37I	P|T	-|-	1|2	0|0	ADORA3|ADORA3	111833010|111833010	0.966000|0.966000	0.33281|0.33281	0.788000|0.788000	0.31933|0.31933	0.117000|0.117000	0.20001|0.20001	1.714000|1.714000	0.37961|0.37961	1.131000|1.131000	0.42111|0.42111	0.462000|0.462000	0.41574|0.41574	CCA|ACC		0.537	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
SLC22A15	55356	broad.mit.edu	37	1	116574064	116574064	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:116574064C>G	ENST00000369503.4	+	6	936	c.806C>G	c.(805-807)gCc>gGc	p.A269G	SLC22A15_ENST00000369502.1_3'UTR	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	269					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.A269G(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TACCTCATTGCCAAGAGGAAC	0.507																																					p.A269G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C806G	1						.						107.0	108.0	108.0					1																	116574064		2002	4168	6170	116375587	SO:0001583	missense	55356	exon6			AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.806C>G	1.37:g.116574064C>G	ENSP00000358515:p.Ala269Gly		116375587	NM_018420	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	37	CCDS44198.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418317	0.83449	.	.	ENSG00000163393	ENST00000369503	T	0.74002	-0.8	4.91	4.91	0.64330	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.051917	0.85682	D	0.000000	T	0.74275	0.3695	L	0.51853	1.615	0.80722	D	1	P	0.42735	0.788	P	0.51324	0.666	T	0.76558	-0.2915	10	0.56958	D	0.05	.	18.2938	0.90138	0.0:1.0:0.0:0.0	.	269	Q8IZD6	S22AF_HUMAN	G	269	ENSP00000358515:A269G	ENSP00000358515:A269G	A	+	2	0	SLC22A15	116375587	1.000000	0.71417	0.995000	0.50966	0.836000	0.47400	3.293000	0.51779	2.556000	0.86216	0.655000	0.94253	GCC		0.507	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420	
SPAG17	200162	broad.mit.edu	37	1	118598446	118598446	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:118598446T>C	ENST00000336338.5	-	19	2697	c.2632A>G	c.(2632-2634)Atc>Gtc	p.I878V		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	878						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.I878V(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTGGTCCTGATGATTTTCTCA	0.313																																					p.I878V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2632G	1						.						126.0	129.0	128.0					1																	118598446		2203	4297	6500	118399969	SO:0001583	missense	200162	exon19				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2632A>G	1.37:g.118598446T>C	ENSP00000337804:p.Ile878Val		118399969	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	T	7.675	0.687870	0.14973	.	.	ENSG00000155761	ENST00000336338	T	0.16457	2.34	5.35	0.635	0.17723	.	2.443350	0.01277	N	0.009640	T	0.04227	0.0117	N	0.22421	0.69	0.09310	N	1	B	0.13145	0.007	B	0.14023	0.01	T	0.36187	-0.9758	10	0.28530	T	0.3	.	9.916	0.41434	0.0:0.7253:0.0:0.2747	.	878	Q6Q759	SPG17_HUMAN	V	878	ENSP00000337804:I878V	ENSP00000337804:I878V	I	-	1	0	SPAG17	118399969	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.494000	0.06451	-0.068000	0.12953	0.477000	0.44152	ATC		0.313	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
GJA5	2702	broad.mit.edu	37	1	147230820	147230820	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:147230820C>G	ENST00000271348.2	-	2	688	c.527G>C	c.(526-528)gGa>gCa	p.G176A	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Missense_Mutation_p.G176A	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	176					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)	p.G176A(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CAGGAAGATTCCGTAGATGAA	0.562																																					p.G176A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G527C	1						.						95.0	88.0	90.0					1																	147230820		2203	4300	6503	145697444	SO:0001583	missense	2702	exon2				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.527G>C	1.37:g.147230820C>G	ENSP00000271348:p.Gly176Ala		145697444	NM_181703	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	37	CCDS929.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916327	0.92249	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.97598	-4.45;-4.45;-4.45	5.68	5.68	0.88126	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.98745	0.9578	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99552	1.0966	10	0.87932	D	0	.	19.798	0.96494	0.0:1.0:0.0:0.0	.	176	P36382	CXA5_HUMAN	A	176	ENSP00000271348:G176A;ENSP00000358240:G176A;ENSP00000407645:G176A	ENSP00000271348:G176A	G	-	2	0	GJA5	145697444	1.000000	0.71417	0.971000	0.41717	0.932000	0.56968	7.811000	0.86092	2.677000	0.91161	0.563000	0.77884	GGA		0.562	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703	
CFAP74	85452	broad.mit.edu	37	1	1897852	1897852	+	IGR	SNP	G	G	A	rs376236547		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:1897852G>A								TMEM52 (47140 upstream) : C1orf222 (21710 downstream)														p.P453P(1)									CAGAGATCTCGGGCTCAGCTA	0.617																																					p.P453P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1359T	1						.			7,3869		0,7,1931	49.0	56.0	54.0		1359	-6.0	0.4	1		54	0,8242		0,0,4121	no	coding-synonymous	KIAA1751	NM_001080484.1		0,7,6052	AA,AG,GG		0.0,0.1806,0.0578		453/763	1897852	7,12111	1938	4121	6059	1887712	SO:0001628	intergenic_variant	85452	exon12																															1.37:g.1897852G>A			1887712	NM_001080484		Silent	SNP		37																																																																																				0	0.617								
F5	2153	broad.mit.edu	37	1	169525985	169525985	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:169525985G>C	ENST00000367797.3	-	6	1052	c.851C>G	c.(850-852)tCa>tGa	p.S284*	F5_ENST00000546081.1_Nonsense_Mutation_p.S147*|F5_ENST00000367796.3_Nonsense_Mutation_p.S284*	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	284	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.S284*(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGTGATGGCTGAGACCTTATG	0.502																																					p.S284X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C851G	1						.						173.0	139.0	150.0					1																	169525985		2203	4300	6503	167792609	SO:0001587	stop_gained	2153	exon6			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.851C>G	1.37:g.169525985G>C	ENSP00000356771:p.Ser284*		167792609	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Nonsense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	40	8.113110	0.98659	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	.	.	.	6.07	6.07	0.98685	.	0.114783	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.1671	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	284;284;147	.	ENSP00000356770:S284X	S	-	2	0	F5	167792609	1.000000	0.71417	0.229000	0.23960	0.977000	0.68977	9.434000	0.97515	2.890000	0.99128	0.650000	0.86243	TCA		0.502	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
RNF19B	127544	broad.mit.edu	37	1	33407919	33407919	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:33407919A>C	ENST00000373456.7	-	7	1546	c.1547T>G	c.(1546-1548)tTt>tGt	p.F516C	RNF19B_ENST00000235150.4_Missense_Mutation_p.F515C|RNF19B_ENST00000356990.5_Missense_Mutation_p.F515C	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	516					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.F325C(1)|p.F515C(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GAGGGCTGCAAAGCTGGCCGT	0.483																																					p.F516C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1547G	1						.						116.0	109.0	111.0					1																	33407919		2203	4300	6503	33180506	SO:0001583	missense	127544	exon7			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1547T>G	1.37:g.33407919A>C	ENSP00000362555:p.Phe516Cys		33180506	NM_153341	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	ENST00000373456.7	37	CCDS372.2	.	.	.	.	.	.	.	.	.	.	A	15.07	2.725347	0.48833	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.32988	1.43;1.49;1.43	5.11	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.44265	0.1285	L	0.44542	1.39	0.41333	D	0.987252	D;D;D	0.76494	0.999;0.993;0.988	D;P;P	0.71414	0.973;0.72;0.758	T	0.30765	-0.9967	10	0.52906	T	0.07	.	11.2625	0.49091	0.9272:0.0:0.0728:0.0	.	515;516;515	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	C	516;515;515;414	ENSP00000362555:F516C;ENSP00000349482:F515C;ENSP00000235150:F515C	ENSP00000235150:F515C	F	-	2	0	RNF19B	33180506	0.991000	0.36638	0.998000	0.56505	0.390000	0.30446	2.447000	0.44917	0.865000	0.35603	0.533000	0.62120	TTT		0.483	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341	
CSMD2	114784	broad.mit.edu	37	1	34401392	34401392	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:34401392G>A	ENST00000373381.4	-	4	857	c.681C>T	c.(679-681)gcC>gcT	p.A227A		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	187	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A187A(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGTCCCACGTGGCGCTGTTCT	0.632																																					p.A187A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561T	1						.						67.0	61.0	63.0					1																	34401392		2203	4300	6503	34173979	SO:0001819	synonymous_variant	114784	exon4			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.681C>T	1.37:g.34401392G>A			34173979	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																					0.632	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
PTGER3	5733	broad.mit.edu	37	1	71477903	71477903	+	Intron	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:71477903C>A	ENST00000306666.5	-	2	1288				PTGER3_ENST00000370932.2_Intron|PTGER3_ENST00000351052.5_Missense_Mutation_p.A388S|PTGER3_ENST00000370931.3_Intron|PTGER3_ENST00000414819.1_Intron|PTGER3_ENST00000370924.4_Missense_Mutation_p.A388S|PTGER3_ENST00000460330.1_Intron|PTGER3_ENST00000354608.5_Intron|PTGER3_ENST00000356595.4_Intron	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)						cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)	p.A388S(1)		endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TTCTTTCATGCTTCTGTCTGT	0.398																																					p.A388S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1162T	1						.						100.0	94.0	96.0					1																	71477903		2203	4300	6503	71250491	SO:0001627	intron_variant	5733	exon2			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.1077+84G>T	1.37:g.71477903C>A			71250491	NM_198715	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	37	CCDS657.1	.	.	.	.	.	.	.	.	.	.	C	6.999	0.554564	0.13374	.	.	ENSG00000050628	ENST00000351052;ENST00000370934;ENST00000370924	T;T	0.16743	2.48;2.32	5.7	2.78	0.32641	.	0.571438	0.16658	N	0.204897	T	0.03220	0.0094	N	0.24115	0.695	0.80722	D	1	B	0.27068	0.167	B	0.28011	0.085	T	0.29212	-1.0019	10	0.08837	T	0.75	.	8.7243	0.34460	0.0:0.7311:0.1289:0.14	.	388	F5H821	.	S	388	ENSP00000280208:A388S;ENSP00000359962:A388S	ENSP00000280208:A388S	A	-	1	0	PTGER3	71250491	0.912000	0.30974	0.728000	0.30774	0.382000	0.30200	1.265000	0.33027	0.327000	0.23409	-0.339000	0.08088	GCA		0.398	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
CCBL2	56267	broad.mit.edu	37	1	89414888	89414888	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:89414888G>C	ENST00000260508.4	-	11	1364	c.1027C>G	c.(1027-1029)Cca>Gca	p.P343A	CCBL2_ENST00000370491.3_Missense_Mutation_p.P309A|CCBL2_ENST00000446900.2_5'UTR|CCBL2_ENST00000370485.2_3'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	343					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)	p.P309A(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		AACTCTTTTGGCAAAGAATTA	0.388																																					p.P309A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C925G	1						.						97.0	89.0	92.0					1																	89414888		2203	4300	6503	89187476	SO:0001583	missense	56267	exon10			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.1027C>G	1.37:g.89414888G>C	ENSP00000260508:p.Pro343Ala		89187476	NM_001008662	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	ENST00000260508.4	37	CCDS30766.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173629	0.38413	.	.	ENSG00000137944	ENST00000370491;ENST00000260508	D;D	0.89415	-2.51;-2.51	5.34	5.34	0.76211	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.103096	0.64402	D	0.000002	T	0.73321	0.3572	N	0.20304	0.555	0.80722	D	1	P	0.36183	0.542	B	0.34824	0.19	T	0.76160	-0.3061	10	0.33141	T	0.24	-42.91	14.2883	0.66260	0.0738:0.0:0.9262:0.0	.	343	Q6YP21	KAT3_HUMAN	A	309;343	ENSP00000359522:P309A;ENSP00000260508:P343A	ENSP00000260508:P343A	P	-	1	0	CCBL2	89187476	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.189000	0.42621	2.515000	0.84797	0.467000	0.42956	CCA		0.388	CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
NSL1	25936	broad.mit.edu	37	1	212912877	212912877	+	Splice_Site	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr1:212912877T>G	ENST00000366977.3	-	5	584	c.566A>C	c.(565-567)aAg>aCg	p.K189T	NSL1_ENST00000366976.1_Intron|NSL1_ENST00000366975.6_Intron|NSL1_ENST00000422588.2_3'UTR|NSL1_ENST00000366978.1_Intron	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	189					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.K189T(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AGCTTTTACCTTCATGGCTTC	0.353																																					p.K189T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A566C	1						.						139.0	127.0	131.0					1																	212912877		2203	4299	6502	210979500	SO:0001630	splice_region_variant	25936	exon5			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.567+1A>C	1.37:g.212912877T>G			210979500	NM_015471	E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	ENST00000366977.3	37	CCDS1509.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.611761	0.66558	.	.	ENSG00000117697	ENST00000366977	T	0.52754	0.65	5.65	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.65386	0.2686	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.67142	-0.5745	10	0.87932	D	0	-13.3216	9.3865	0.38347	0.0:0.082:0.0:0.918	.	189	Q96IY1	NSL1_HUMAN	T	189	ENSP00000355944:K189T	ENSP00000355944:K189T	K	-	2	0	NSL1	210979500	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	4.477000	0.60223	0.957000	0.37930	0.455000	0.32223	AAG		0.353	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089398.2	NM_015471	Missense_Mutation
TTI1	9675	broad.mit.edu	37	20	36627600	36627600	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr20:36627600C>G	ENST00000373448.2	-	6	3021	c.2783G>C	c.(2782-2784)aGa>aCa	p.R928T	TTI1_ENST00000373447.3_Missense_Mutation_p.R928T|TTI1_ENST00000449821.1_Missense_Mutation_p.R928T	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	928					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.R928T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CTTGAAGGCTCTAAGCACTGC	0.577																																					p.R928T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2783C	20						.						68.0	66.0	67.0					20																	36627600		2203	4300	6503	36061014	SO:0001583	missense	9675	exon6			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.2783G>C	20.37:g.36627600C>G	ENSP00000362547:p.Arg928Thr		36061014	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278914	0.80692	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.59638	0.25;0.25;0.25	4.59	4.59	0.56863	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70378	0.3217	M	0.73598	2.24	0.80722	D	1	D	0.62365	0.991	P	0.58820	0.846	T	0.67821	-0.5571	10	0.19590	T	0.45	-5.5164	16.5633	0.84572	0.0:1.0:0.0:0.0	.	928	O43156	TTI1_HUMAN	T	928	ENSP00000362547:R928T;ENSP00000362546:R928T;ENSP00000407270:R928T	ENSP00000362546:R928T	R	-	2	0	TTI1	36061014	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.092000	0.76930	2.379000	0.81126	0.563000	0.77884	AGA		0.577	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
ACOT8	10005	broad.mit.edu	37	20	44483834	44483835	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	GG	GG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr20:44483834_44483835GG>AA	ENST00000217455.4	-	2	315_316	c.225_226CC>TT	c.(223-228)gtCCac>gtTTac	p.H76Y	ZSWIM3_ENST00000454862.2_5'Flank|ZSWIM3_ENST00000255152.2_5'Flank	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	76					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.V75>?(1)		kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				GAGTGCACGTGGACGTCTTCAC	0.609																																					.												.	.	1	Complex(1)	large_intestine(1)	c.225_226TT	20						.																																			43917242	SO:0001583	missense	10005	exon2			AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.225_226delinsAA	20.37:g.44483834_44483835delinsAA	ENSP00000217455:p.His76Tyr		43917241	NM_005469	O15261|Q17RX4	Missense_Mutation	DNP	ENST00000217455.4	37	CCDS13378.1																																																																																				0.609	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080338.2	NM_183386	
CLIC6	54102	broad.mit.edu	37	21	36088774	36088774	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr21:36088774G>T	ENST00000360731.3	+	7	2109	c.2109G>T	c.(2107-2109)atG>atT	p.M703I	CLIC6_ENST00000349499.2_Missense_Mutation_p.M685I			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	703	GST C-terminal.					chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)	p.M685I(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CAAAAAGAATGAAATGAAGCT	0.373																																					p.M685I												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.G2055T	21						.						98.0	98.0	98.0					21																	36088774		2203	4300	6503	35010644	SO:0001583	missense	54102	exon6			AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.2109G>T	21.37:g.36088774G>T	ENSP00000353959:p.Met703Ile		35010644	NM_053277	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		.	.	.	.	.	.	.	.	.	.	G	14.61	2.587596	0.46110	.	.	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.25912	1.77;1.87	5.66	3.75	0.43078	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.061282	0.64402	D	0.000001	T	0.10895	0.0266	N	0.03000	-0.44	0.37450	D	0.914794	B;B	0.29136	0.15;0.234	B;B	0.32090	0.066;0.14	T	0.10474	-1.0628	10	0.72032	D	0.01	-15.1257	6.0991	0.20037	0.0716:0.1338:0.6562:0.1385	.	703;685	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	I	703;685	ENSP00000353959:M703I;ENSP00000290332:M685I	ENSP00000290332:M685I	M	+	3	0	CLIC6	35010644	1.000000	0.71417	0.999000	0.59377	0.860000	0.49131	4.275000	0.58927	1.396000	0.46663	0.563000	0.77884	ATG		0.373	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
ROCK2	9475	broad.mit.edu	37	2	11341146	11341146	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:11341146C>A	ENST00000315872.6	-	23	3295	c.2847G>T	c.(2845-2847)gaG>gaT	p.E949D	ROCK2_ENST00000401753.1_Missense_Mutation_p.E706D	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	949					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)	p.E949D(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TCTCTTTGATCTCCAGCTCTT	0.378																																					p.E949D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2847T	2						.						232.0	212.0	218.0					2																	11341146		1860	4096	5956	11258597	SO:0001583	missense	9475	exon23			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.2847G>T	2.37:g.11341146C>A	ENSP00000317985:p.Glu949Asp		11258597	NM_004850	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308643	0.81247	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.70282	-0.47;0.65	5.61	2.34	0.29019	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	M	0.79123	2.44	0.54753	D	0.999983	D	0.61697	0.99	P	0.55965	0.788	T	0.78640	-0.2125	10	0.44086	T	0.13	.	12.2342	0.54505	0.0:0.7795:0.0:0.2205	.	949	O75116	ROCK2_HUMAN	D	949;706;307	ENSP00000317985:E949D;ENSP00000385509:E706D	ENSP00000317985:E949D	E	-	3	2	ROCK2	11258597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.977000	0.40589	0.708000	0.31955	0.467000	0.42956	GAG		0.378	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		
IL18R1	8809	broad.mit.edu	37	2	102992397	102992397	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:102992397A>G	ENST00000409599.1	+	6	855	c.499A>G	c.(499-501)Aaa>Gaa	p.K167E	IL18R1_ENST00000233957.1_Missense_Mutation_p.K167E			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	167	Ig-like C2-type 2.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)	p.K167E(1)		breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GGAGAACAATAAAAACCCAAC	0.313																																					p.K167E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A499G	2						.						51.0	51.0	51.0					2																	102992397		2203	4300	6503	102358829	SO:0001583	missense	8809	exon4			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.499A>G	2.37:g.102992397A>G	ENSP00000387211:p.Lys167Glu		102358829	NM_003855	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	.	.	.	.	.	.	.	.	.	.	A	3.891	-0.024056	0.07634	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.10763	2.84;2.84;2.84	3.8	-7.6	0.01303	.	2.465900	0.01805	N	0.033156	T	0.05914	0.0154	L	0.29908	0.895	0.09310	N	1	B;B	0.20164	0.042;0.042	B;B	0.23018	0.043;0.043	T	0.35798	-0.9774	10	0.09338	T	0.73	.	2.4369	0.04485	0.3143:0.1452:0.4081:0.1324	.	167;167	B7ZKV7;Q13478	.;IL18R_HUMAN	E	167	ENSP00000386663:K167E;ENSP00000387211:K167E;ENSP00000233957:K167E	ENSP00000233957:K167E	K	+	1	0	IL18R1	102358829	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.690000	0.01922	-2.149000	0.00797	-0.624000	0.04008	AAA		0.313	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
TTC32	130502	broad.mit.edu	37	2	20101566	20101566	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:20101566G>A	ENST00000333610.3	-	1	181	c.50C>T	c.(49-51)gCt>gTt	p.A17V	TTC32_ENST00000402414.1_Missense_Mutation_p.A17V|RP11-79O8.1_ENST00000607190.1_lincRNA	NM_001008237.1	NP_001008238.1	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	17								p.A17V(1)		kidney(2)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTGAAATGAGCCTGGGCGAG	0.612																																					p.A17V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C50T	2						.						167.0	151.0	156.0					2																	20101566		2203	4300	6503	19965047	SO:0001583	missense	130502	exon1			BC057850	CCDS33151.1	2p24.1	2013-01-10			ENSG00000183891	ENSG00000183891		"""Tetratricopeptide (TTC) repeat domain containing"""	32954	protein-coding gene	gene with protein product							Standard	NM_001008237		Approved		uc002rdg.3	Q5I0X7	OTTHUMG00000151776	ENST00000333610.3:c.50C>T	2.37:g.20101566G>A	ENSP00000333018:p.Ala17Val		19965047	NM_001008237		Missense_Mutation	SNP	ENST00000333610.3	37	CCDS33151.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395599	0.42512	.	.	ENSG00000183891	ENST00000402414;ENST00000333610	T;T	0.74632	-0.09;-0.86	5.19	4.32	0.51571	Tetratricopeptide-like helical (1);	0.265174	0.36519	N	0.002558	T	0.77391	0.4123	L	0.54323	1.7	0.40742	D	0.982843	P	0.47677	0.899	P	0.54060	0.741	T	0.77696	-0.2491	10	0.44086	T	0.13	-41.5305	11.181	0.48627	0.0:0.0:0.8167:0.1833	.	17	Q5I0X7	TTC32_HUMAN	V	17	ENSP00000385708:A17V;ENSP00000333018:A17V	ENSP00000333018:A17V	A	-	2	0	TTC32	19965047	0.975000	0.34042	0.797000	0.32132	0.084000	0.17831	1.877000	0.39598	1.427000	0.47276	-0.127000	0.14921	GCT		0.612	TTC32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323868.1	NM_001008237	
DPP10	57628	broad.mit.edu	37	2	116548880	116548880	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:116548880T>C	ENST00000410059.1	+	19	2128	c.1648T>C	c.(1648-1650)Tcc>Ccc	p.S550P	DPP10_ENST00000310323.8_Missense_Mutation_p.S543P|DPP10_ENST00000393147.2_Missense_Mutation_p.S554P|DPP10_ENST00000409163.1_Missense_Mutation_p.S500P	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	550						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.S543P(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTTACAGTTGTCCCTTCCCAA	0.294																																					p.S500P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1498C	2						.						91.0	96.0	94.0					2																	116548880		2203	4299	6502	116265350	SO:0001583	missense	57628	exon20			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1648T>C	2.37:g.116548880T>C	ENSP00000386565:p.Ser550Pro		116265350	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483232	0.63962	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.54	5.54	0.83059	.	0.122583	0.56097	D	0.000021	T	0.60830	0.2299	M	0.69823	2.125	0.58432	D	0.999996	D;D;D;D	0.76494	0.997;0.999;0.994;0.994	D;D;P;P	0.66196	0.921;0.942;0.837;0.837	T	0.61332	-0.7084	10	0.44086	T	0.13	-11.1085	13.5512	0.61734	0.0:0.0:0.0:1.0	.	543;554;546;550	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	P	550;500;554;543;500	ENSP00000386565:S550P;ENSP00000387038:S500P;ENSP00000376855:S554P;ENSP00000309066:S543P	ENSP00000309066:S543P	S	+	1	0	DPP10	116265350	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.707000	0.47143	2.323000	0.78572	0.528000	0.53228	TCC		0.294	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
THADA	63892	broad.mit.edu	37	2	43779372	43779372	+	Silent	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:43779372T>G	ENST00000405006.4	-	18	3132	c.2781A>C	c.(2779-2781)atA>atC	p.I927I	THADA_ENST00000415080.2_Silent_p.I637I|THADA_ENST00000330266.7_Silent_p.I637I|THADA_ENST00000405975.2_Silent_p.I927I|THADA_ENST00000402360.2_Silent_p.I927I	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	927								p.I927I(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AAGCTCCTGTTATACAGTGGA	0.428																																					p.I927I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2781C	2						.						58.0	58.0	58.0					2																	43779372		1941	4131	6072	43632876	SO:0001819	synonymous_variant	63892	exon18			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2781A>C	2.37:g.43779372T>G			43632876	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.252751	0.22965	.	.	ENSG00000115970	ENST00000407351	.	.	.	5.56	-4.9	0.03094	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.2423	0.04023	0.1087:0.257:0.3357:0.2986	.	.	.	.	S	241	.	.	X	-	2	2	THADA	43632876	0.969000	0.33509	0.336000	0.25522	0.970000	0.65996	-0.091000	0.11146	-0.777000	0.04572	0.482000	0.46254	TAA		0.428	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
NRXN1	9378	broad.mit.edu	37	2	50699499	50699499	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:50699499G>A	ENST00000406316.2	-	16	4657	c.3181C>T	c.(3181-3183)Cgg>Tgg	p.R1061W	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401710.1_Missense_Mutation_p.R70W|NRXN1_ENST00000402717.3_Missense_Mutation_p.R1053W|NRXN1_ENST00000405472.3_Missense_Mutation_p.R1053W|NRXN1_ENST00000404971.1_Missense_Mutation_p.R1101W|NRXN1_ENST00000401669.2_Missense_Mutation_p.R1061W|NRXN1_ENST00000406859.3_Missense_Mutation_p.R1061W	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1061	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.R1102W(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCCGGAAGCCGTCCATTTAAA	0.413																																					p.R1101W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3301T	2						.						95.0	90.0	92.0					2																	50699499		1865	4108	5973	50553003	SO:0001583	missense	9378	exon17			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3181C>T	2.37:g.50699499G>A	ENSP00000384311:p.Arg1061Trp		50553003	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414128	0.83449	.	.	ENSG00000179915	ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.42	2.26	0.28386	.	0.000000	0.85682	D	0.000000	D	0.88746	0.6520	M	0.88704	2.975	0.41092	D	0.985604	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.999	D	0.90458	0.4444	10	0.72032	D	0.01	.	13.8918	0.63744	0.0:0.0:0.5508:0.4492	.	1101;1061;1053	Q9ULB1-3;F8WB18;A7E294	.;.;.	W	70;1101;1061;1053;1061;1102;1053;1061	ENSP00000385580:R70W;ENSP00000385142:R1101W;ENSP00000384311:R1061W;ENSP00000434015:R1053W;ENSP00000385017:R1061W;ENSP00000385434:R1053W;ENSP00000385681:R1061W	ENSP00000385017:R1061W	R	-	1	2	NRXN1	50553003	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	4.680000	0.61656	0.665000	0.31066	0.655000	0.94253	CGG		0.413	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
USP34	9736	broad.mit.edu	37	2	61473562	61473562	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:61473562C>T	ENST00000398571.2	-	50	6521	c.6445G>A	c.(6445-6447)Gac>Aac	p.D2149N		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2149	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D2149N(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCTATCAAGTCATATTCATAG	0.343																																					p.D2149N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6445A	2						.						57.0	52.0	54.0					2																	61473562		1830	4077	5907	61327066	SO:0001583	missense	9736	exon50			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6445G>A	2.37:g.61473562C>T	ENSP00000381577:p.Asp2149Asn		61327066	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698718	0.68501	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.30714	1.52;1.52	5.84	4.96	0.65561	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.046003	0.85682	D	0.000000	T	0.41419	0.1158	L	0.35341	1.055	0.58432	D	0.999998	B	0.25486	0.127	P	0.47015	0.534	T	0.42716	-0.9435	10	0.48119	T	0.1	.	16.315	0.82915	0.1334:0.8666:0.0:0.0	.	2149	Q70CQ2	UBP34_HUMAN	N	1997;1997;2149;427	ENSP00000381577:D2149N;ENSP00000410559:D427N	ENSP00000263989:D1997N	D	-	1	0	USP34	61327066	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	1.447000	0.47661	0.561000	0.74099	GAC		0.343	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CDK15	65061	broad.mit.edu	37	2	202672329	202672329	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr2:202672329G>A	ENST00000374598.4	+	2	236	c.236G>A	c.(235-237)tGt>tAt	p.C79Y	CDK15_ENST00000260967.2_Missense_Mutation_p.C28Y|CDK15_ENST00000488419.1_3'UTR|CDK15_ENST00000434439.1_Missense_Mutation_p.C79Y|Y_RNA_ENST00000365267.1_RNA|CDK15_ENST00000410091.3_Missense_Mutation_p.C28Y|CDK15_ENST00000450471.2_Missense_Mutation_p.C79Y			Q96Q40	CDK15_HUMAN	cyclin-dependent kinase 15	79							ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.C28Y(1)		breast(3)|endometrium(2)|kidney(5)|large_intestine(1)|lung(14)|ovary(1)	26					Adenosine triphosphate(DB00171)	AACAGTGATTGTTTTCAGGAA	0.488																																					p.C28Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G83A	2						.						116.0	120.0	119.0					2																	202672329		2203	4300	6503	202380574	SO:0001583	missense	65061	exon2			AB053308	CCDS2350.1, CCDS58746.1, CCDS58747.1	2q33.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000138395	ENSG00000138395		"""Cyclin-dependent kinases"""	14434	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7"", ""PFTAIRE protein kinase 2"""	ALS2CR7, PFTK2		11586298, 16236519, 19884882	Standard	NM_139158		Approved	PFTAIRE2	uc002uyt.3	Q96Q40	OTTHUMG00000132838	ENST00000374598.4:c.236G>A	2.37:g.202672329G>A	ENSP00000363726:p.Cys79Tyr		202380574	NM_139158	A8K8R9|B8ZZX0|C9J1N8|C9K003|F8W6H8|Q4ZG86|Q53TV1|Q6ZMR9|Q8IUP1	Missense_Mutation	SNP	ENST00000374598.4	37		.	.	.	.	.	.	.	.	.	.	C	17.93	3.508524	0.64410	.	.	ENSG00000138395	ENST00000410091;ENST00000260967;ENST00000450471;ENST00000434439;ENST00000374598	T;T;T;T;T	0.69435	-0.39;-0.39;-0.4;-0.38;-0.4	5.65	4.77	0.60923	.	0.212960	0.40728	N	0.001022	T	0.46580	0.1400	N	0.08118	0	0.18873	N	0.999984	B;B	0.12013	0.001;0.005	B;B	0.17722	0.0;0.019	T	0.41142	-0.9525	10	0.54805	T	0.06	-6.0257	11.0609	0.47946	0.1351:0.6038:0.261:0.0	.	79;79	Q96Q40-2;F8W6H8	.;.	Y	28;28;79;79;79	ENSP00000386901:C28Y;ENSP00000260967:C28Y;ENSP00000406472:C79Y;ENSP00000412775:C79Y;ENSP00000363726:C79Y	ENSP00000260967:C28Y	C	+	2	0	CDK15	202380574	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.282000	0.51693	0.761000	0.33130	-0.829000	0.03081	TGT		0.488	CDK15-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000336053.2		
NKTR	4820	broad.mit.edu	37	3	42679711	42679712	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr3:42679711_42679712insA	ENST00000232978.8	+	13	2703_2704	c.2515_2516insA	c.(2515-2517)gaafs	p.E839fs	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	839					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.N841fs*21(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TAATAAACAAGAAAAAAACAGA	0.396																																					p.E839fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2515_2516insA	3						.																																			42654716	SO:0001589	frameshift_variant	4820	exon13				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2522dupA	3.37:g.42679718_42679718dupA	ENSP00000232978:p.Glu839fs		42654715	NM_005385		Frame_Shift_Ins	INS	ENST00000232978.8	37	CCDS2702.1																																																																																				0.396	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
COL6A5	256076	broad.mit.edu	37	3	130159097	130159097	+	Missense_Mutation	SNP	G	G	A	rs200739552		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr3:130159097G>A	ENST00000432398.2	+	35	6409	c.5915G>A	c.(5914-5916)cGg>cAg	p.R1972Q	COL6A5_ENST00000265379.6_Missense_Mutation_p.R1972Q	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1972	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R11Q(1)|p.R1972Q(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GACAATTCTCGGAATATAGCA	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		21439	0.0		0.001	False		,,,				2504	0.0				p.R1972Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5915A	3						.	G	GLN/ARG	0,3754		0,0,1877	80.0	74.0	76.0		5915	-6.7	0.0	3		76	2,8204		0,2,4101	yes	missense	COL6A5	NM_153264.5	43	0,2,5978	AA,AG,GG		0.0244,0.0,0.0167	benign	1972/2527	130159097	2,11958	1877	4103	5980	131641787	SO:0001583	missense	256076	exon35			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.5915G>A	3.37:g.130159097G>A	ENSP00000390895:p.Arg1972Gln		131641787	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	G	4.757	0.140856	0.09083	0.0	2.44E-4	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82803	-1.65;-1.65	5.63	-6.66	0.01789	von Willebrand factor, type A (3);	1.217900	0.06277	N	0.696773	T	0.69495	0.3117	N	0.17082	0.46	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.002	T	0.53746	-0.8395	10	0.20519	T	0.43	.	16.7988	0.85609	0.7769:0.0:0.2231:0.0	.	1972;1972	A8TX70;A8TX70-2	CO6A5_HUMAN;.	Q	1972	ENSP00000390895:R1972Q;ENSP00000265379:R1972Q	ENSP00000265379:R1972Q	R	+	2	0	COL6A5	131641787	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-1.601000	0.02081	-1.577000	0.01650	-0.951000	0.02657	CGG		0.398	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
PLCL2	23228	broad.mit.edu	37	3	17052321	17052321	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr3:17052321G>C	ENST00000418129.2	+	2	1570	c.1105G>C	c.(1105-1107)Gtt>Ctt	p.V369L	PLCL2_ENST00000432376.1_Missense_Mutation_p.V369L|PLCL2_ENST00000460467.1_Intron|PLCL2_ENST00000396755.2_Missense_Mutation_p.V369L	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	495					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.V369L(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CTCTCAGATAGTTTTCCGCAG	0.398																																					p.X488Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1464C	3						.						113.0	102.0	106.0					3																	17052321		2203	4300	6503	17027325	SO:0001583	missense	23228	exon3			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1105G>C	3.37:g.17052321G>C	ENSP00000409637:p.Val369Leu		17027325	NM_001144382	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	37	CCDS33713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.246|9.246	1.039503|1.039503	0.19669|0.19669	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376|ENST00000419842	T;T;T|.	0.61859|.	0.07;0.07;0.07|.	5.96|5.96	5.09|5.09	0.68999|0.68999	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);|.	0.176654|.	0.49305|.	D|.	0.000141|.	T|.	0.70868|.	0.3273|.	.|.	.|.	.|.	0.44523|0.44523	D|D	0.997479|0.997479	B|.	0.09022|.	0.002|.	B|.	0.11329|.	0.006|.	T|.	0.70263|.	-0.4920|.	9|.	0.02654|.	T|.	1|.	.|.	15.0274|15.0274	0.71680|0.71680	0.0679:0.0:0.9321:0.0|0.0679:0.0:0.9321:0.0	.|.	495|.	Q9UPR0|.	PLCL2_HUMAN|.	L|Y	369;496;369;369|112	ENSP00000409637:V369L;ENSP00000379979:V369L;ENSP00000412836:V369L|.	ENSP00000285094:V496L|.	V|X	+|+	1|3	0|2	PLCL2|PLCL2	17027325|17027325	1.000000|1.000000	0.71417|0.71417	0.914000|0.914000	0.36105|0.36105	0.967000|0.967000	0.64934|0.64934	6.714000|6.714000	0.74692|0.74692	1.533000|1.533000	0.49186|0.49186	0.655000|0.655000	0.94253|0.94253	GTT|TAG		0.398	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
OTOL1	131149	broad.mit.edu	37	3	161214627	161214627	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr3:161214627T>G	ENST00000327928.4	+	1	32	c.32T>G	c.(31-33)tTa>tGa	p.L11*		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	11						collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.L11*(1)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						TGTGCTATTTTAATTATTTTG	0.338																																					p.L11X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T32G	3						.						37.0	35.0	35.0					3																	161214627		1818	4078	5896	162697321	SO:0001587	stop_gained	131149	exon1				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.32T>G	3.37:g.161214627T>G	ENSP00000330808:p.Leu11*		162697321	NM_001080440		Nonsense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	T	35	5.451733	0.96205	.	.	ENSG00000182447	ENST00000327928	.	.	.	5.66	5.66	0.87406	.	0.871164	0.10009	N	0.727479	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8563	0.63529	0.0:0.0:0.0:1.0	.	.	.	.	X	11	.	ENSP00000330808:L11X	L	+	2	0	OTOL1	162697321	1.000000	0.71417	0.983000	0.44433	0.936000	0.57629	5.397000	0.66302	2.160000	0.67779	0.528000	0.53228	TTA		0.338	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
GLRB	2743	broad.mit.edu	37	4	157999272	157999273	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr4:157999272_157999273insA	ENST00000264428.4	+	2	366_367	c.96_97insA	c.(97-99)aaafs	p.K33fs	GLRB_ENST00000512619.1_Frame_Shift_Ins_p.K33fs|GLRB_ENST00000509282.1_Frame_Shift_Ins_p.K33fs|GLRB_ENST00000541722.1_Frame_Shift_Ins_p.K33fs	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	33					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.K35fs*23(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	AAGGGAAGGGGAAAAAGAAGCA	0.332																																					p.G32fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.96_97insA	4						.																																			158218723	SO:0001589	frameshift_variant	2743	exon2			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.101dupA	4.37:g.157999277_157999277dupA	ENSP00000264428:p.Lys33fs		158218722	NM_001166060	A8K3K2|D3DP23|F5GWE1	Frame_Shift_Ins	INS	ENST00000264428.4	37	CCDS3796.1																																																																																				0.332	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
BOD1L1	259282	broad.mit.edu	37	4	13615842	13615842	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr4:13615842T>A	ENST00000040738.5	-	4	1287	c.1152A>T	c.(1150-1152)aaA>aaT	p.K384N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	384	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K384N(1)									CTTCAACAGTTTTAGCTTTAT	0.318																																					p.K384N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1152T	4						.						43.0	39.0	40.0					4																	13615842		2108	4077	6185	13224940	SO:0001583	missense	259282	exon4			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1152A>T	4.37:g.13615842T>A	ENSP00000040738:p.Lys384Asn		13224940	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	10.94	1.491493	0.26774	.	.	ENSG00000038219	ENST00000040738	T	0.10477	2.87	5.45	0.301	0.15781	.	0.286026	0.25148	N	0.032773	T	0.08714	0.0216	M	0.63843	1.955	0.09310	N	1	P	0.43287	0.802	B	0.34489	0.184	T	0.21724	-1.0237	10	0.54805	T	0.06	-14.3537	5.3576	0.16069	0.0:0.2862:0.1395:0.5744	.	384	Q8NFC6	BOD1L_HUMAN	N	384	ENSP00000040738:K384N	ENSP00000040738:K384N	K	-	3	2	BOD1L	13224940	0.001000	0.12720	0.002000	0.10522	0.098000	0.18820	-0.412000	0.07132	0.112000	0.17975	-0.326000	0.08463	AAA		0.318	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
KLHL5	51088	broad.mit.edu	37	4	39098386	39098386	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr4:39098386G>T	ENST00000504108.1	+	6	1609	c.1326G>T	c.(1324-1326)atG>atT	p.M442I	KLHL5_ENST00000261426.5_Missense_Mutation_p.M381I|KLHL5_ENST00000508137.2_Missense_Mutation_p.M255I|KLHL5_ENST00000359687.2_Missense_Mutation_p.M442I|KLHL5_ENST00000381930.3_Missense_Mutation_p.M442I|KLHL5_ENST00000261425.3_Missense_Mutation_p.M396I	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	442						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.M442I(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						TGGAAGCAATGAAGTACCATT	0.383																																					p.M442I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1326T	4						.						99.0	92.0	94.0					4																	39098386		2203	4300	6503	38774781	SO:0001583	missense	51088	exon6			AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.1326G>T	4.37:g.39098386G>T	ENSP00000423897:p.Met442Ile		38774781	NM_015990	A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	ENST00000504108.1	37	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082958	0.94050	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426;ENST00000546147	T;T;T;T;T;T	0.70282	-0.42;-0.47;-0.43;-0.34;-0.37;-0.47	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.82204	0.4986	M	0.78456	2.415	0.80722	D	1	P;B;D	0.55172	0.732;0.25;0.97	P;B;P	0.56700	0.561;0.157;0.804	T	0.82829	-0.0264	10	0.49607	T	0.09	.	19.4686	0.94952	0.0:0.0:1.0:0.0	.	381;442;442	F8WAE7;Q96PQ7;Q96PQ7-2	.;KLHL5_HUMAN;.	I	476;396;255;442;442;442;381;36	ENSP00000261425:M396I;ENSP00000423080:M255I;ENSP00000423897:M442I;ENSP00000352716:M442I;ENSP00000371355:M442I;ENSP00000261426:M381I	ENSP00000261425:M396I	M	+	3	0	KLHL5	38774781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.824000	0.99380	2.668000	0.90789	0.650000	0.86243	ATG		0.383	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1		
PTPN13	5783	broad.mit.edu	37	4	87622579	87622579	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr4:87622579C>A	ENST00000411767.2	+	7	883	c.820C>A	c.(820-822)Cct>Act	p.P274T	PTPN13_ENST00000427191.2_Missense_Mutation_p.P274T|PTPN13_ENST00000436978.1_Missense_Mutation_p.P274T|PTPN13_ENST00000511467.1_Missense_Mutation_p.P274T|PTPN13_ENST00000316707.6_Missense_Mutation_p.P274T			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	274					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.P274T(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TACATTCTCCCCTTACCAGTT	0.388																																					p.P274T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C820A	4						.						49.0	47.0	48.0					4																	87622579		1823	4078	5901	87841603	SO:0001583	missense	5783	exon7				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.820C>A	4.37:g.87622579C>A	ENSP00000407249:p.Pro274Thr		87841603	NM_080684	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	8.552	0.875860	0.17395	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.89	5.05	0.67936	.	0.136513	0.33515	N	0.004838	T	0.31702	0.0805	L	0.60455	1.87	0.40650	D	0.982021	B;B;B;B	0.29862	0.011;0.253;0.259;0.253	B;B;B;B	0.32980	0.019;0.156;0.075;0.075	T	0.09885	-1.0654	10	0.28530	T	0.3	.	12.0214	0.53346	0.0:0.8619:0.0:0.1381	.	274;274;274;274	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	T	274;274;274;274;274;242	ENSP00000408368:P274T;ENSP00000394794:P274T;ENSP00000322675:P274T;ENSP00000407249:P274T;ENSP00000426626:P274T	ENSP00000322675:P274T	P	+	1	0	PTPN13	87841603	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.588000	0.36633	1.501000	0.48654	0.557000	0.71058	CCT		0.388	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
DNAH5	1767	broad.mit.edu	37	5	13862766	13862766	+	Missense_Mutation	SNP	C	C	T	rs147567352		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:13862766C>T	ENST00000265104.4	-	29	4791	c.4687G>A	c.(4687-4689)Ggc>Agc	p.G1563S	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1563	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1563S(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTAAAGCTGCCGAAGGTGAAT	0.453									Kartagener syndrome																												p.G1563S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4687A	5						.	C	SER/GLY	4,4402	8.1+/-20.4	0,4,2199	202.0	184.0	190.0		4687	1.0	0.3	5	dbSNP_134	190	1,8599	1.2+/-3.3	0,1,4299	yes	missense	DNAH5	NM_001369.2	56	0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384	benign	1563/4625	13862766	5,13001	2203	4300	6503	13915766	SO:0001583	missense	1767	exon29	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4687G>A	5.37:g.13862766C>T	ENSP00000265104:p.Gly1563Ser		13915766	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	5.028	0.190906	0.09547	9.08E-4	1.16E-4	ENSG00000039139	ENST00000265104	T	0.59772	0.24	5.22	0.966	0.19667	Dynein heavy chain, domain-2 (1);	0.283508	0.38381	N	0.001716	T	0.23532	0.0569	N	0.02111	-0.68	0.30229	N	0.796114	B	0.02656	0.0	B	0.06405	0.002	T	0.27020	-1.0086	10	0.08837	T	0.75	.	8.8219	0.35032	0.0:0.6529:0.0:0.3471	.	1563	Q8TE73	DYH5_HUMAN	S	1563	ENSP00000265104:G1563S	ENSP00000265104:G1563S	G	-	1	0	DNAH5	13915766	0.915000	0.31059	0.281000	0.24762	0.297000	0.27493	1.716000	0.37981	-0.116000	0.11893	-0.128000	0.14901	GGC		0.453	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
JAKMIP2	9832	broad.mit.edu	37	5	147027950	147027950	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:147027950G>A	ENST00000265272.5	-	5	1392	c.925C>T	c.(925-927)Cga>Tga	p.R309*	JAKMIP2_ENST00000507386.1_Nonsense_Mutation_p.R309*|JAKMIP2_ENST00000333010.6_Nonsense_Mutation_p.R267*	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	309						Golgi apparatus (GO:0005794)		p.R309*(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTCATTTCGTTCATCTCCA	0.303																																					p.R309X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C925T	5						.						171.0	167.0	168.0					5																	147027950		2203	4296	6499	147008143	SO:0001587	stop_gained	9832	exon5			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.925C>T	5.37:g.147027950G>A	ENSP00000265272:p.Arg309*		147008143	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Nonsense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	39	7.762048	0.98474	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	.	.	.	5.3	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1718	0.65514	0.0:0.0:0.7567:0.2433	.	.	.	.	X	309;309;267;309	.	ENSP00000265272:R309X	R	-	1	2	JAKMIP2	147008143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.237000	0.58681	2.634000	0.89283	0.591000	0.81541	CGA		0.303	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
ADAMTS16	170690	broad.mit.edu	37	5	5239385	5239385	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:5239385A>T	ENST00000274181.7	+	15	2414	c.2276A>T	c.(2275-2277)aAc>aTc	p.N759I		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	759	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N759I(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CACCACACCAACCGTGAGTAC	0.512																																					p.N759I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2276T	5						.						138.0	137.0	138.0					5																	5239385		2047	4199	6246	5292385	SO:0001583	missense	170690	exon15			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2276A>T	5.37:g.5239385A>T	ENSP00000274181:p.Asn759Ile		5292385	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.980674	0.74474	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.52057	0.68	5.85	4.69	0.59074	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.59569	0.2203	L	0.53617	1.68	0.48571	D	0.999679	D;D	0.62365	0.989;0.991	P;D	0.67103	0.892;0.949	T	0.56378	-0.7989	10	0.35671	T	0.21	.	11.0522	0.47896	0.9262:0.0:0.0738:0.0	.	759;759	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	I	759	ENSP00000274181:N759I	ENSP00000274181:N759I	N	+	2	0	ADAMTS16	5292385	1.000000	0.71417	0.990000	0.47175	0.882000	0.50991	4.735000	0.62051	1.034000	0.39945	0.533000	0.62120	AAC		0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
PRLR	5618	broad.mit.edu	37	5	35070339	35070339	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:35070339A>C	ENST00000382002.5	-	7	998	c.572T>G	c.(571-573)tTt>tGt	p.F191C	PRLR_ENST00000397391.3_Missense_Mutation_p.F120C|PRLR_ENST00000231423.3_Missense_Mutation_p.F191C|PRLR_ENST00000542609.1_Missense_Mutation_p.F191C|PRLR_ENST00000511486.1_Missense_Mutation_p.F90C|PRLR_ENST00000348262.3_Missense_Mutation_p.F191C|PRLR_ENST00000310101.5_Missense_Mutation_p.F191C|PRLR_ENST00000513753.1_Missense_Mutation_p.F191C|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000342362.5_Missense_Mutation_p.F90C	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	191	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.F191C(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	GAGAATCTTAAACTCTGTTTG	0.423																																					p.F191C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T572G	5						.						99.0	86.0	90.0					5																	35070339		2203	4300	6503	35106096	SO:0001583	missense	5618	exon7				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.572T>G	5.37:g.35070339A>C	ENSP00000371432:p.Phe191Cys		35106096	NM_000949	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.362262	0.41902	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000397391;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.35	5.35	0.76521	Fibronectin, type III (3);Long hematopoietin receptor, single chain, conserved site (1);Immunoglobulin-like fold (1);	0.317141	0.39544	N	0.001328	T	0.58949	0.2158	L	0.52905	1.665	0.39027	D	0.959862	B;D;D;B;B;B;B	0.89917	0.01;1.0;1.0;0.403;0.054;0.191;0.364	B;D;D;B;B;B;B	0.71870	0.024;0.948;0.975;0.252;0.025;0.122;0.122	T	0.63019	-0.6730	10	0.52906	T	0.07	-13.8832	7.8388	0.29387	0.7219:0.1498:0.0:0.1282	.	191;191;90;120;191;191;191	P16471-3;P16471;P16471-2;Q8TD76;P16471-7;P16471-6;P16471-4	.;PRLR_HUMAN;.;.;.;.;.	C	191;191;191;120;191;90;191;90;191	ENSP00000231423:F191C;ENSP00000424841:F191C;ENSP00000311613:F191C;ENSP00000380546:F120C;ENSP00000441813:F191C;ENSP00000339213:F90C;ENSP00000371432:F191C;ENSP00000422556:F90C;ENSP00000309008:F191C	ENSP00000231423:F191C	F	-	2	0	PRLR	35106096	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.821000	0.48065	2.248000	0.74166	0.533000	0.62120	TTT		0.423	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2		
OXCT1	5019	broad.mit.edu	37	5	41762297	41762297	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:41762297C>G	ENST00000196371.5	-	14	1414	c.1254G>C	c.(1252-1254)aaG>aaC	p.K418N	OXCT1_ENST00000510634.1_Missense_Mutation_p.K21N|OXCT1_ENST00000512084.1_Missense_Mutation_p.K21N|OXCT1_ENST00000509987.1_Missense_Mutation_p.K232N|OXCT1_ENST00000513081.1_5'UTR	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	418					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.K418N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	CTTTCACCATCTTCCCCTGCA	0.383																																					p.K418N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1254C	5						.						243.0	228.0	233.0					5																	41762297		2203	4300	6503	41798054	SO:0001583	missense	5019	exon14			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1254G>C	5.37:g.41762297C>G	ENSP00000196371:p.Lys418Asn		41798054	NM_000436	B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	CCDS3937.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571854	0.65765	.	.	ENSG00000083720	ENST00000196371;ENST00000512084;ENST00000510634;ENST00000509987	D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59	4.97	4.09	0.47781	3-oxoacid CoA-transferase, subunit B (1);	0.000000	0.85682	D	0.000000	D	0.94870	0.8342	H	0.95004	3.61	0.58432	D	0.999996	D	0.65815	0.995	D	0.65874	0.939	D	0.94511	0.7718	10	0.87932	D	0	-9.4004	8.3211	0.32130	0.0:0.813:0.0:0.187	.	418	P55809	SCOT1_HUMAN	N	418;21;21;232	ENSP00000196371:K418N;ENSP00000421143:K21N;ENSP00000423144:K21N;ENSP00000425348:K232N	ENSP00000196371:K418N	K	-	3	2	OXCT1	41798054	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.283000	0.33237	1.173000	0.42796	0.655000	0.94253	AAG		0.383	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
PTCD2	79810	broad.mit.edu	37	5	71622532	71622532	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:71622532G>A	ENST00000380639.5	+	3	330	c.314G>A	c.(313-315)cGg>cAg	p.R105Q	PTCD2_ENST00000536805.1_5'UTR|PTCD2_ENST00000503868.1_Intron|PTCD2_ENST00000543322.1_Missense_Mutation_p.R105Q	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	105					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.R105Q(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TGTGAGTCTCGGGACCATGTG	0.413																																					p.R105Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314A	5						.						184.0	169.0	174.0					5																	71622532		1929	4127	6056	71658288	SO:0001583	missense	79810	exon3			BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.314G>A	5.37:g.71622532G>A	ENSP00000370013:p.Arg105Gln		71658288	NM_024754	B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	ENST00000380639.5	37	CCDS4014.2	.	.	.	.	.	.	.	.	.	.	G	1.695	-0.503122	0.04261	.	.	ENSG00000049883	ENST00000380639;ENST00000543322	T;T	0.46451	0.87;0.87	6.15	-0.734	0.11140	.	1.073890	0.07116	N	0.843055	T	0.26195	0.0639	L	0.39898	1.24	0.09310	N	0.999995	B	0.18741	0.03	B	0.09377	0.004	T	0.21280	-1.0250	10	0.13108	T	0.6	.	1.6703	0.02810	0.4631:0.1348:0.2674:0.1347	.	105	Q8WV60	PTCD2_HUMAN	Q	105	ENSP00000370013:R105Q;ENSP00000438810:R105Q	ENSP00000308948:R105Q	R	+	2	0	PTCD2	71658288	0.024000	0.19004	0.010000	0.14722	0.186000	0.23388	-0.162000	0.10012	-0.312000	0.08741	0.643000	0.83706	CGG		0.413	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218562.6	NM_024754	
GPR98	84059	broad.mit.edu	37	5	90073778	90073778	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:90073778C>T	ENST00000405460.2	+	62	12680	c.12584C>T	c.(12583-12585)cCt>cTt	p.P4195L		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4195	Calx-beta 28. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.P4195L(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGATATTCCCTCCTTCCGTG	0.433																																					p.P4195L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C12584T	5						.						68.0	70.0	69.0					5																	90073778		1901	4117	6018	90109534	SO:0001583	missense	84059	exon62			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12584C>T	5.37:g.90073778C>T	ENSP00000384582:p.Pro4195Leu		90109534	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826896	0.90955	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.28895	1.59	5.24	5.24	0.73138	.	0.048522	0.85682	D	0.000000	T	0.52403	0.1732	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	P	0.61874	0.895	T	0.55192	-0.8179	10	0.72032	D	0.01	.	18.816	0.92077	0.0:1.0:0.0:0.0	.	4195	Q8WXG9	GPR98_HUMAN	L	4195	ENSP00000384582:P4195L	ENSP00000296619:P4195L	P	+	2	0	GPR98	90109534	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.691000	0.74573	2.418000	0.82041	0.448000	0.29417	CCT		0.433	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
TLX3	30012	broad.mit.edu	37	5	170737296	170737296	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr5:170737296G>C	ENST00000296921.5	+	2	646	c.564G>C	c.(562-564)caG>caC	p.Q188H		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	188					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.Q188H(1)		central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCATCGCCAGAAGTACCTGG	0.632			T	BCL11B	T-ALL																																p.Q188H	Esophageal Squamous(33;43 807 3116 3348 30094)		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G564C	5						.						27.0	27.0	27.0					5																	170737296		2198	4296	6494	170669901	SO:0001583	missense	30012	exon2			AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.564G>C	5.37:g.170737296G>C	ENSP00000296921:p.Gln188His		170669901	NM_021025	Q96AD3	Missense_Mutation	SNP	ENST00000296921.5	37	CCDS34288.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345326	0.61073	.	.	ENSG00000164438	ENST00000296921	D	0.95690	-3.78	4.21	2.29	0.28610	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.054376	0.85682	D	0.000000	D	0.92280	0.7551	L	0.31578	0.945	0.44261	D	0.997116	P	0.52316	0.952	P	0.48952	0.596	D	0.89494	0.3759	10	0.66056	D	0.02	.	8.3989	0.32574	0.2109:0.0:0.7891:0.0	.	188	O43711	TLX3_HUMAN	H	188	ENSP00000296921:Q188H	ENSP00000296921:Q188H	Q	+	3	2	TLX3	170669901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.417000	0.52714	0.210000	0.20664	0.500000	0.49745	CAG		0.632	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
PREP	5550	broad.mit.edu	37	6	105726122	105726122	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:105726122T>A	ENST00000369110.3	-	15	2222	c.2030A>T	c.(2029-2031)aAg>aTg	p.K677M	RP3-355L5.4_ENST00000452363.1_RNA	NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	677					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.K677M(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	GTGGCCCGCCTTGGTGTCCAC	0.592																																					p.K677M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2030T	6						.						92.0	81.0	85.0					6																	105726122		2203	4300	6503	105832815	SO:0001583	missense	5550	exon15				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.2030A>T	6.37:g.105726122T>A	ENSP00000358106:p.Lys677Met		105832815	NM_002726	Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	37	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485245	0.84854	.	.	ENSG00000085377	ENST00000369110	T	0.33216	1.42	5.91	4.76	0.60689	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.040549	0.85682	D	0.000000	T	0.60025	0.2237	H	0.97440	4.005	0.80722	D	1	D	0.71674	0.998	D	0.71870	0.975	T	0.74456	-0.3659	10	0.87932	D	0	-17.9177	11.789	0.52059	0.0:0.0682:0.0:0.9318	.	677	P48147	PPCE_HUMAN	M	677	ENSP00000358106:K677M	ENSP00000358106:K677M	K	-	2	0	PREP	105832815	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.980000	0.70516	1.082000	0.41137	0.528000	0.53228	AAG		0.592	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		
MAN1A1	4121	broad.mit.edu	37	6	119623194	119623194	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:119623194C>G	ENST00000368468.3	-	4	1216	c.775G>C	c.(775-777)Gaa>Caa	p.E259Q	MAN1A1_ENST00000368466.2_Missense_Mutation_p.E282Q	NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	259					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.E282Q(1)|p.E259Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GATTTTGCTTCTTCAAATTCA	0.279																																					p.E259Q	Ovarian(136;8 1825 12608 33541 47587)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G775C	6						.						50.0	53.0	52.0					6																	119623194		2202	4281	6483	119664893	SO:0001583	missense	4121	exon4			AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.775G>C	6.37:g.119623194C>G	ENSP00000357453:p.Glu259Gln		119664893	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	37	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745716	0.69418	.	.	ENSG00000111885	ENST00000368468;ENST00000368466	T;T	0.72835	-0.69;-0.69	6.14	6.14	0.99180	.	0.251680	0.45867	D	0.000326	T	0.67239	0.2872	M	0.65975	2.015	0.48830	D	0.999712	B;P	0.39352	0.099;0.669	B;B	0.42163	0.155;0.378	T	0.65899	-0.6056	9	.	.	.	-28.9627	19.6312	0.95704	0.0:1.0:0.0:0.0	.	282;259	Q6P052;P33908	.;MA1A1_HUMAN	Q	259;282	ENSP00000357453:E259Q;ENSP00000357451:E282Q	.	E	-	1	0	MAN1A1	119664893	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	6.763000	0.74955	2.937000	0.99478	0.650000	0.86243	GAA		0.279	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
UST	10090	broad.mit.edu	37	6	149262503	149262503	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:149262503A>G	ENST00000367463.4	+	3	483	c.380A>G	c.(379-381)gAg>gGg	p.E127G		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	127					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.E127G(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		ATCTTGTCGGAGAAGCACGGA	0.423																																					p.E127G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A380G	6						.						196.0	181.0	186.0					6																	149262503		2203	4300	6503	149304196	SO:0001583	missense	10090	exon3			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.380A>G	6.37:g.149262503A>G	ENSP00000356433:p.Glu127Gly		149304196	NM_005715	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	A	15.90	2.968057	0.53507	.	.	ENSG00000111962	ENST00000367463	T	0.39787	1.06	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.20414	0.0491	L	0.31120	0.905	0.80722	D	1	B	0.18310	0.027	B	0.24701	0.055	T	0.05835	-1.0861	10	0.27082	T	0.32	-25.3759	16.2285	0.82315	1.0:0.0:0.0:0.0	.	127	Q9Y2C2	UST_HUMAN	G	127	ENSP00000356433:E127G	ENSP00000356433:E127G	E	+	2	0	UST	149304196	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.276000	0.78559	2.235000	0.73313	0.460000	0.39030	GAG		0.423	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
PRPF4B	8899	broad.mit.edu	37	6	4041038	4041038	+	Missense_Mutation	SNP	G	G	T	rs560019716		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:4041038G>T	ENST00000337659.6	+	4	1545	c.1445G>T	c.(1444-1446)cGa>cTa	p.R482L	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R468L	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	482	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R482L(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TCACGCTTGCGAAGGCGGTCT	0.433																																					p.R482L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1445T	6						.						58.0	63.0	61.0					6																	4041038		2203	4300	6503	3986037	SO:0001583	missense	8899	exon4			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1445G>T	6.37:g.4041038G>T	ENSP00000337194:p.Arg482Leu		3986037	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248161	0.59103	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.70631	-0.5;-0.5	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.73737	0.3625	L	0.57536	1.79	0.80722	D	1	D	0.60160	0.987	D	0.65010	0.931	T	0.67507	-0.5653	10	0.11182	T	0.66	.	19.5223	0.95190	0.0:0.0:1.0:0.0	.	482	Q13523	PRP4B_HUMAN	L	482;468	ENSP00000337194:R482L;ENSP00000439331:R468L	ENSP00000337194:R482L	R	+	2	0	PRPF4B	3986037	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	6.800000	0.75165	2.688000	0.91661	0.591000	0.81541	CGA		0.433	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
EFHC1	114327	broad.mit.edu	37	6	52303222	52303222	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:52303222C>T	ENST00000371068.5	+	3	509	c.406C>T	c.(406-408)Cct>Tct	p.P136S	EFHC1_ENST00000433625.2_Missense_Mutation_p.P45S|EFHC1_ENST00000538167.1_Missense_Mutation_p.P117S|EFHC1_ENST00000491749.1_3'UTR	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	136	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.P136S(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					TGTCATAGAGCCTGTTGTAGA	0.418																																					p.P136S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C406T	6						.						62.0	63.0	63.0					6																	52303222		2203	4300	6503	52411181	SO:0001583	missense	114327	exon3			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.406C>T	6.37:g.52303222C>T	ENSP00000360107:p.Pro136Ser		52411181	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	37	CCDS4942.1	.	.	.	.	.	.	.	.	.	.	C	35	5.538488	0.96474	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.50277	0.75;0.75;0.75	5.56	5.56	0.83823	Uncharacterised domain DM10 (2);	0.000000	0.85682	D	0.000000	T	0.69860	0.3158	M	0.88181	2.935	0.80722	D	1	D;D;P	0.58620	0.978;0.983;0.862	P;D;P	0.66351	0.839;0.943;0.742	T	0.74878	-0.3514	10	0.62326	D	0.03	.	19.5359	0.95254	0.0:1.0:0.0:0.0	.	117;45;136	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	S	136;45;117	ENSP00000360107:P136S;ENSP00000416492:P45S;ENSP00000444521:P117S	ENSP00000360107:P136S	P	+	1	0	EFHC1	52411181	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.772000	0.85439	2.617000	0.88574	0.655000	0.94253	CCT		0.418	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
DOPEY1	23033	broad.mit.edu	37	6	83855344	83855344	+	Silent	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:83855344T>G	ENST00000349129.2	+	25	5903	c.5643T>G	c.(5641-5643)gtT>gtG	p.V1881V	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000237163.5_Silent_p.V1862V|DOPEY1_ENST00000369739.3_Silent_p.V1872V	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1881					protein transport (GO:0015031)			p.V1881V(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TAAAAGAAGTTTTAAAGCAGC	0.378																																					p.V1881V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5643G	6						.						74.0	68.0	70.0					6																	83855344		2203	4300	6503	83912063	SO:0001819	synonymous_variant	23033	exon25			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.5643T>G	6.37:g.83855344T>G			83912063	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1																																																																																				0.378	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
CEP162	22832	broad.mit.edu	37	6	84922722	84922722	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:84922722A>C	ENST00000403245.3	-	6	638	c.524T>G	c.(523-525)cTa>cGa	p.L175R	KIAA1009_ENST00000257766.4_Missense_Mutation_p.L99R	NM_014895.2	NP_055710.2												p.L175R(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		GTCATCAGTTAGTTCTGCGTT	0.279																																					p.L175R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T524G	6						.						54.0	50.0	51.0					6																	84922722		2186	4281	6467	84979441	SO:0001583	missense	22832	exon6																														ENST00000403245.3:c.524T>G	6.37:g.84922722A>C	ENSP00000385215:p.Leu175Arg		84979441	NM_014895		Missense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	A	0.182	-1.061599	0.01950	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.18502	2.21;2.21	5.78	2.14	0.27477	.	0.547535	0.15457	N	0.261350	T	0.02649	0.0080	L	0.31294	0.92	0.21933	N	0.999469	B;B	0.24368	0.005;0.102	B;B	0.25759	0.007;0.063	T	0.45498	-0.9257	10	0.12766	T	0.61	-0.2739	3.0427	0.06143	0.5098:0.2274:0.2628:0.0	.	175;175	Q5TB80;C9JFM9	QN1_HUMAN;.	R	99;175	ENSP00000257766:L99R;ENSP00000385215:L175R	ENSP00000257766:L99R	L	-	2	0	KIAA1009	84979441	0.598000	0.26882	0.967000	0.41034	0.175000	0.22909	1.193000	0.32162	0.463000	0.27118	0.533000	0.62120	CTA		0.279	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
ZNF292	23036	broad.mit.edu	37	6	87943114	87943114	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:87943114C>T	ENST00000369577.3	+	5	653	c.610C>T	c.(610-612)Cag>Tag	p.Q204*	ZNF292_ENST00000339907.4_Nonsense_Mutation_p.Q199*	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	204						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q204*(1)|p.Q59*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CAAAACAAATCAGTTAAGTCA	0.333																																					p.Q204X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C610T	6						.						108.0	104.0	105.0					6																	87943114		1841	4091	5932	87999833	SO:0001587	stop_gained	23036	exon5			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.610C>T	6.37:g.87943114C>T	ENSP00000358590:p.Gln204*		87999833	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Nonsense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	C	35	5.476437	0.96291	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	.	.	.	5.36	4.49	0.54785	.	0.208574	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	15.7086	0.77606	0.1381:0.8619:0.0:0.0	.	.	.	.	X	204;199	.	ENSP00000342847:Q199X	Q	+	1	0	ZNF292	87999833	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	2.230000	0.42999	1.379000	0.46325	-0.309000	0.09137	CAG		0.333	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
NDUFAF4	29078	broad.mit.edu	37	6	97339261	97339261	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:97339261C>G	ENST00000316149.7	-	3	326	c.247G>C	c.(247-249)Gct>Cct	p.A83P	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	83					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)		p.A83P(1)		large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						GTTTCAGCAGCTTTTACCTAG	0.328																																					p.A83P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G247C	6						.						60.0	64.0	63.0					6																	97339261		2202	4299	6501	97445982	SO:0001583	missense	29078	exon3			AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.247G>C	6.37:g.97339261C>G	ENSP00000358272:p.Ala83Pro		97445982	NM_014165	B2R4J5	Missense_Mutation	SNP	ENST00000316149.7	37	CCDS5037.1	.	.	.	.	.	.	.	.	.	.	C	9.942	1.217824	0.22373	.	.	ENSG00000123545	ENST00000316149	D	0.84223	-1.82	4.74	1.96	0.26148	.	0.858425	0.10535	N	0.663387	T	0.66684	0.2814	L	0.51422	1.61	0.27779	N	0.943217	P	0.39157	0.662	B	0.35859	0.212	T	0.52495	-0.8568	10	0.31617	T	0.26	-7.0347	10.0457	0.42186	0.0:0.7776:0.0:0.2224	.	83	Q9P032	NDUF4_HUMAN	P	83	ENSP00000358272:A83P	ENSP00000358272:A83P	A	-	1	0	NDUFAF4	97445982	0.006000	0.16342	0.265000	0.24526	0.518000	0.34316	0.299000	0.19138	0.625000	0.30304	-0.140000	0.14226	GCT		0.328	NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
FNDC1	84624	broad.mit.edu	37	6	159652933	159652933	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr6:159652933G>T	ENST00000297267.9	+	11	1589	c.1389G>T	c.(1387-1389)gaG>gaT	p.E463D	FNDC1_ENST00000340366.6_Missense_Mutation_p.E400D	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	463			E -> Q (in dbSNP:rs420137). {ECO:0000269|PubMed:11347906, ECO:0000269|PubMed:15489334}.		cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E463D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGGATGTTGAGCAGAACACGG	0.493																																					p.E463D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1389T	6						.						38.0	40.0	39.0					6																	159652933		1922	4134	6056	159572923	SO:0001583	missense	84624	exon11			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1389G>T	6.37:g.159652933G>T	ENSP00000297267:p.Glu463Asp		159572923	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.49|10.49	1.364182|1.364182	0.24684|0.24684	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|T;T	.|0.07327	.|3.2;3.99	5.47|5.47	1.25|1.25	0.21368|0.21368	.|.	.|0.954556	.|0.08652	.|N	.|0.913867	T|T	0.00998|0.00998	0.0033|0.0033	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.48592|0.48592	-0.9022|-0.9022	5|10	.|0.13108	.|T	.|0.6	0.2874|0.2874	5.4952|5.4952	0.16799|0.16799	0.2504:0.0:0.5518:0.1978|0.2504:0.0:0.5518:0.1978	.|.	.|400;463	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	S|D	359|463;400	.|ENSP00000297267:E463D;ENSP00000342460:E400D	.|ENSP00000297267:E463D	A|E	+|+	1|3	0|2	FNDC1|FNDC1	159572923|159572923	0.000000|0.000000	0.05858|0.05858	0.010000|0.010000	0.14722|0.14722	0.028000|0.028000	0.11728|0.11728	-0.353000|-0.353000	0.07691|0.07691	0.296000|0.296000	0.22592|0.22592	0.655000|0.655000	0.94253|0.94253	GCA|GAG		0.493	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
ETV1	2115	broad.mit.edu	37	7	13971233	13971233	+	Silent	SNP	G	G	A	rs577222571		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:13971233G>A	ENST00000430479.1	-	9	1363	c.696C>T	c.(694-696)caC>caT	p.H232H	ETV1_ENST00000403685.1_Silent_p.H214H|ETV1_ENST00000405192.2_Silent_p.H232H|ETV1_ENST00000343495.5_Silent_p.H214H|ETV1_ENST00000405358.4_Silent_p.H246H|ETV1_ENST00000399357.3_Silent_p.H129H|ETV1_ENST00000420159.2_Silent_p.H174H|ETV1_ENST00000242066.5_Silent_p.H214H|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000405218.2_Silent_p.H232H|ETV1_ENST00000403527.1_Silent_p.H192H	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	232					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H232H(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						ACACTGGGTCGTGGTACTCCT	0.522			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.H232H			Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	7						.						132.0	129.0	130.0					7																	13971233		2016	4180	6196	13937758	SO:0001819	synonymous_variant	2115	exon8				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.696C>T	7.37:g.13971233G>A			13937758	NM_001163147	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	37	CCDS55088.1																																																																																				0.522	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956	
OR2F1	26211	broad.mit.edu	37	7	143657084	143657084	+	Silent	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:143657084T>G	ENST00000392899.1	+	1	58	c.21T>G	c.(19-21)acT>acG	p.T7T	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	7					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T7T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					ATAACCAGACTTGGGTGAGTG	0.423																																					p.T7T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T21G	7						.						130.0	131.0	131.0					7																	143657084		2203	4300	6503	143288017	SO:0001819	synonymous_variant	26211	exon1			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.21T>G	7.37:g.143657084T>G			143288017	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Silent	SNP	ENST00000392899.1	37	CCDS5887.1																																																																																				0.423	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
ARHGEF5	7984	broad.mit.edu	37	7	144059784	144059784	+	Missense_Mutation	SNP	C	C	T	rs531993064		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:144059784C>T	ENST00000056217.5	+	2	196	c.22C>T	c.(22-24)Cgt>Tgt	p.R8C		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	8					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R8C(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGAGGCCCAGCGTGGAGCCTC	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		35523	0.0		0.0	False		,,,				2504	0.001				p.R8C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C22T	7						.						79.0	93.0	88.0					7																	144059784		1501	3160	4661	143690717	SO:0001583	missense	7984	exon2			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.22C>T	7.37:g.144059784C>T	ENSP00000056217:p.Arg8Cys		143690717	NM_005435	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.283162	0.23392	.	.	ENSG00000050327	ENST00000498580;ENST00000056217	T	0.74315	-0.83	4.16	1.06	0.20224	.	2.094490	0.03015	U	0.149993	T	0.54481	0.1861	N	0.08118	0	0.09310	N	1	B	0.19935	0.04	B	0.06405	0.002	T	0.48055	-0.9068	10	0.87932	D	0	0.0126	3.1889	0.06610	0.2024:0.5485:0.0:0.2491	.	8	Q12774	ARHG5_HUMAN	C	8	ENSP00000056217:R8C	ENSP00000056217:R8C	R	+	1	0	ARHGEF5	143690717	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.160000	0.10041	0.010000	0.14839	0.650000	0.86243	CGT		0.517	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
PTPN12	5782	broad.mit.edu	37	7	77212878	77212878	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:77212878T>C	ENST00000248594.6	+	4	564	c.292T>C	c.(292-294)Tat>Cat	p.Y98H	PTPN12_ENST00000435495.2_Intron|PTPN12_ENST00000415482.2_5'UTR	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	98	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.Y98H(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TTAGGGCGTCTATGGGCCAAA	0.294																																					p.Y98H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T292C	7						.						106.0	104.0	105.0					7																	77212878		2203	4299	6502	77050814	SO:0001583	missense	5782	exon4				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.292T>C	7.37:g.77212878T>C	ENSP00000248594:p.Tyr98His		77050814	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	T	6.636	0.485810	0.12641	.	.	ENSG00000127947	ENST00000248594	D	0.83163	-1.69	5.65	4.51	0.55191	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.120339	0.56097	D	0.000037	T	0.66479	0.2793	N	0.17674	0.51	0.80722	D	1	B	0.13145	0.007	B	0.17433	0.018	T	0.59413	-0.7459	10	0.20046	T	0.44	.	4.9232	0.13880	0.0:0.2646:0.0:0.7354	.	98	Q05209	PTN12_HUMAN	H	98	ENSP00000248594:Y98H	ENSP00000248594:Y98H	Y	+	1	0	PTPN12	77050814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.641000	0.46587	2.140000	0.66376	0.482000	0.46254	TAT		0.294	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
PCLO	27445	broad.mit.edu	37	7	82451802	82451802	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:82451802G>A	ENST00000423517.2	-	20	15137	c.14800C>T	c.(14800-14802)Cgc>Tgc	p.R4934C	PCLO_ENST00000333891.9_Intron|PCLO_ENST00000426442.2_5'UTR	NM_014510.2	NP_055325.2			piccolo presynaptic cytomatrix protein									p.?(4)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATTTATTTGCGTCTTTTACTT	0.488																																					p.R4934C												.	.	4	Unknown(4)	lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)	c.C14800T	7						.						122.0	127.0	126.0					7																	82451802		2029	4197	6226	82289738	SO:0001583	missense	27445	exon20			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000423517.2:c.14800C>T	7.37:g.82451802G>A	ENSP00000388393:p.Arg4934Cys		82289738	NM_014510		Missense_Mutation	SNP	ENST00000423517.2	37	CCDS47631.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199426	0.79015	.	.	ENSG00000186472	ENST00000423517;ENST00000380195	T	0.18960	2.18	5.56	5.56	0.83823	.	.	.	.	.	T	0.29684	0.0741	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.995	D;P;P	0.72982	0.979;0.707;0.513	T	0.42085	-0.9472	9	0.87932	D	0	.	19.5157	0.95162	0.0:0.0:1.0:0.0	.	4934;355;422	Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.	C	4934;421	ENSP00000388393:R4934C	ENSP00000369542:R421C	R	-	1	0	PCLO	82289738	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.427000	0.80284	2.610000	0.88304	0.655000	0.94253	CGC		0.488	PCLO-011	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377249.1	NM_014510	
ANKIB1	54467	broad.mit.edu	37	7	92020616	92020616	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:92020616G>C	ENST00000265742.3	+	16	2565	c.2189G>C	c.(2188-2190)cGg>cCg	p.R730P		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	730							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTGTGGCTCGGGGAGTAGCT	0.517																																					p.R730P												.	.	0			c.G2189C	7						.						48.0	50.0	49.0					7																	92020616		1941	4140	6081	91858552	SO:0001583	missense	54467	exon16			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2189G>C	7.37:g.92020616G>C	ENSP00000265742:p.Arg730Pro		91858552	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	G	32	5.161691	0.94727	.	.	ENSG00000001629	ENST00000265742	T	0.12984	2.63	5.34	5.34	0.76211	.	0.115517	0.64402	D	0.000020	T	0.32675	0.0837	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.01428	-1.1357	10	0.72032	D	0.01	.	19.4102	0.94670	0.0:0.0:1.0:0.0	.	730	Q9P2G1	AKIB1_HUMAN	P	730	ENSP00000265742:R730P	ENSP00000265742:R730P	R	+	2	0	ANKIB1	91858552	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	9.813000	0.99286	2.654000	0.90174	0.563000	0.77884	CGG		0.517	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
SLC25A13	10165	broad.mit.edu	37	7	95818688	95818688	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:95818688C>T	ENST00000265631.5	-	9	987	c.851G>A	c.(850-852)cGt>cAt	p.R284H	SLC25A13_ENST00000416240.2_Missense_Mutation_p.R284H|SLC25A13_ENST00000542654.1_Missense_Mutation_p.R176H			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	284					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)	p.R284H(1)		breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	TAAGGTCATACGTCTGTAGGG	0.388																																					p.R284H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G851A	7						.						88.0	86.0	87.0					7																	95818688		2203	4300	6503	95656624	SO:0001583	missense	10165	exon9			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.851G>A	7.37:g.95818688C>T	ENSP00000265631:p.Arg284His		95656624	NM_014251	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	ENST00000265631.5	37	CCDS5645.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635827	0.67130	.	.	ENSG00000004864	ENST00000265631;ENST00000416240;ENST00000542654	T;T;T	0.80994	-1.44;-1.43;-1.44	4.69	4.69	0.59074	EF-hand-like domain (1);	0.058798	0.64402	D	0.000002	T	0.82144	0.4973	M	0.82923	2.615	0.80722	D	1	B;B;B	0.31485	0.325;0.218;0.218	B;B;B	0.26202	0.067;0.03;0.03	T	0.83214	-0.0072	10	0.54805	T	0.06	-8.9509	18.9332	0.92574	0.0:1.0:0.0:0.0	.	176;284;284	F5GX33;Q546F9;Q9UJS0	.;.;CMC2_HUMAN	H	284;284;176	ENSP00000265631:R284H;ENSP00000400101:R284H;ENSP00000440484:R176H	ENSP00000265631:R284H	R	-	2	0	SLC25A13	95656624	1.000000	0.71417	0.945000	0.38365	0.068000	0.16541	7.609000	0.82925	2.885000	0.99019	0.655000	0.94253	CGT		0.388	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
ABCB8	11194	broad.mit.edu	37	7	150731450	150731450	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr7:150731450G>A	ENST00000297504.6	+	4	616	c.550G>A	c.(550-552)Gta>Ata	p.V184I	ABCB8_ENST00000477719.1_Missense_Mutation_p.V167I|ABCB8_ENST00000477092.1_Missense_Mutation_p.V167I|ABCB8_ENST00000542328.1_Missense_Mutation_p.V79I|ABCB8_ENST00000356058.4_Missense_Mutation_p.V204I|ABCB8_ENST00000493338.1_3'UTR|ABCB8_ENST00000498578.1_Missense_Mutation_p.V167I|ABCB8_ENST00000358849.4_Missense_Mutation_p.V167I			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	184	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.V167I(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	AAGGGACCACGTAGGGAGTTT	0.607																																					p.V167I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G499A	7						.						92.0	82.0	86.0					7																	150731450		2203	4300	6503	150362383	SO:0001583	missense	11194	exon3			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.550G>A	7.37:g.150731450G>A	ENSP00000297504:p.Val184Ile		150362383	NM_007188	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		.	.	.	.	.	.	.	.	.	.	G	13.35	2.212396	0.39102	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-1.77;-1.76;-1.76	5.3	-0.175	0.13315	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.635933	0.15892	N	0.239502	D	0.86053	0.5841	L	0.31926	0.97	0.09310	N	1	B;P;P;P;B;P	0.42039	0.434;0.566;0.566;0.51;0.359;0.769	B;B;B;B;B;B	0.36534	0.103;0.108;0.164;0.102;0.166;0.227	T	0.78186	-0.2302	10	0.33940	T	0.23	-0.5232	2.4438	0.04501	0.1625:0.117:0.461:0.2595	.	79;167;184;167;167;204	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;.;ABCB8_HUMAN;.;.;.	I	167;150;184;79;167;204;167;167	ENSP00000351717:V167I;ENSP00000297504:V184I;ENSP00000438776:V79I;ENSP00000418271:V167I;ENSP00000348353:V204I;ENSP00000419891:V167I;ENSP00000419558:V167I	ENSP00000297504:V184I	V	+	1	0	ABCB8	150362383	0.000000	0.05858	0.007000	0.13788	0.793000	0.44817	-0.228000	0.09114	0.212000	0.20703	0.655000	0.94253	GTA		0.607	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
ZFAT	57623	broad.mit.edu	37	8	135614512	135614512	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:135614512C>A	ENST00000377838.3	-	6	1624	c.1450G>T	c.(1450-1452)Gcc>Tcc	p.A484S	ZFAT_ENST00000523399.1_Missense_Mutation_p.A422S|ZFAT_ENST00000520214.1_Missense_Mutation_p.A472S|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520356.1_Missense_Mutation_p.A472S|ZFAT_ENST00000520727.1_Missense_Mutation_p.A472S|ZFAT_ENST00000429442.2_Missense_Mutation_p.A472S	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	484					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A472S(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GCCTCCTGGGCAGCCCCGTGC	0.597																																					p.A422S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1264T	8						.						34.0	36.0	35.0					8																	135614512		2039	4190	6229	135683694	SO:0001583	missense	57623	exon5			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1450G>T	8.37:g.135614512C>A	ENSP00000367069:p.Ala484Ser		135683694	NM_001174157	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	C	0.564	-0.843952	0.02671	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16;3.16	6.04	4.08	0.47627	Zinc finger, C2H2 (1);	0.497614	0.19771	N	0.106423	T	0.05273	0.0140	L	0.27053	0.805	0.09310	N	1	P;B;B;P	0.47106	0.839;0.001;0.002;0.89	B;B;B;B	0.37833	0.218;0.002;0.005;0.259	T	0.27739	-1.0065	10	0.08837	T	0.75	-28.6593	11.9592	0.52999	0.2313:0.6536:0.115:0.0	.	422;472;472;484	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	S	472;472;472;484;472;422;472	ENSP00000427879:A472S;ENSP00000427831:A472S;ENSP00000394501:A472S;ENSP00000367069:A484S;ENSP00000428483:A472S;ENSP00000429091:A422S	ENSP00000367069:A484S	A	-	1	0	ZFAT	135683694	0.000000	0.05858	0.780000	0.31762	0.269000	0.26545	0.127000	0.15790	1.565000	0.49641	-0.261000	0.10672	GCC		0.597	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
LZTS1	11178	broad.mit.edu	37	8	20112432	20112432	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:20112432G>A	ENST00000381569.1	-	2	618	c.261C>T	c.(259-261)agC>agT	p.S87S	LZTS1_ENST00000522290.1_Silent_p.S87S|LZTS1_ENST00000265801.6_Silent_p.S87S			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	87					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S87S(2)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CTAAATCCCCGCTGGACAGTG	0.582																																					p.S87S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C261T	8						.						57.0	55.0	56.0					8																	20112432		2203	4300	6503	20156712	SO:0001819	synonymous_variant	11178	exon1			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.261C>T	8.37:g.20112432G>A			20156712	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	37	CCDS6015.1																																																																																				0.582	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
NPM2	10361	broad.mit.edu	37	8	21882972	21882972	+	Silent	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:21882972G>T	ENST00000397940.1	+	3	1099	c.84G>T	c.(82-84)cgG>cgT	p.R28R	NPM2_ENST00000521157.1_Silent_p.R28R|NPM2_ENST00000381530.5_Silent_p.R28R|NPM2_ENST00000518119.1_Silent_p.R28R|NPM2_ENST00000520180.1_3'UTR|NPM2_ENST00000289820.6_Silent_p.R28R			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2	28					chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)	p.R28R(2)		large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		AGGAGAGGCGGACTTGGACCT	0.622																																					p.R28R												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G84T	8						.						71.0	71.0	71.0					8																	21882972		2203	4300	6503	21938918	SO:0001819	synonymous_variant	10361	exon3			AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.84G>T	8.37:g.21882972G>T			21938918	NM_182795	B3KSU0|D3DSQ8|Q6NVH6	Silent	SNP	ENST00000397940.1	37	CCDS6018.1																																																																																				0.622	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253810.2	NM_182795	
POLR3D	661	broad.mit.edu	37	8	22105752	22105752	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:22105752A>T	ENST00000397802.4	+	4	662	c.447A>T	c.(445-447)gaA>gaT	p.E149D	POLR3D_ENST00000306433.4_Missense_Mutation_p.E149D			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	149					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.E149D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		AGACAGACGAAGAAACTAAAC	0.498																																					p.E149D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A447T	8						.						103.0	106.0	105.0					8																	22105752		2203	4300	6503	22161697	SO:0001583	missense	661	exon5			M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.447A>T	8.37:g.22105752A>T	ENSP00000380904:p.Glu149Asp		22161697	NM_001722	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Missense_Mutation	SNP	ENST00000397802.4	37	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545078	0.45280	.	.	ENSG00000168495	ENST00000306433;ENST00000519237;ENST00000397802	.	.	.	5.74	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.38241	0.1033	L	0.52364	1.645	0.52099	D	0.99994	P	0.37636	0.603	B	0.30646	0.118	T	0.13442	-1.0509	9	0.24483	T	0.36	-25.7309	7.9753	0.30151	0.721:0.0:0.279:0.0	.	149	P05423	RPC4_HUMAN	D	149	.	ENSP00000303088:E149D	E	+	3	2	POLR3D	22161697	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	2.017000	0.40981	0.983000	0.38602	0.533000	0.62120	GAA		0.498	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722	
PDLIM2	64236	broad.mit.edu	37	8	22438969	22438969	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:22438969G>A	ENST00000397760.4	+	3	571	c.171G>A	c.(169-171)gcG>gcA	p.A57A	PDLIM2_ENST00000397761.2_Silent_p.A57A|PDLIM2_ENST00000339162.7_Silent_p.A57A|PDLIM2_ENST00000308354.7_Silent_p.A307A|PDLIM2_ENST00000409417.1_Silent_p.A57A|PDLIM2_ENST00000409141.1_Silent_p.A57A|PDLIM2_ENST00000265810.4_Silent_p.A57A			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	57	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A57A(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		GGGAAAGCGCGGAGGGCATGC	0.672																																					p.A307A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G921A	8						.						86.0	75.0	78.0					8																	22438969		2203	4300	6503	22494914	SO:0001819	synonymous_variant	64236	exon3			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.171G>A	8.37:g.22438969G>A			22494914	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Silent	SNP	ENST00000397760.4	37																																																																																					0.672	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
TM2D2	83877	broad.mit.edu	37	8	38851152	38851152	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:38851152C>G	ENST00000456397.2	-	3	436	c.343G>C	c.(343-345)Gaa>Caa	p.E115Q	TM2D2_ENST00000397070.2_Missense_Mutation_p.E72Q|TM2D2_ENST00000522434.1_5'UTR|TM2D2_ENST00000412303.1_Missense_Mutation_p.E72Q|TM2D2_ENST00000456845.2_Missense_Mutation_p.E72Q	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2	115						integral component of membrane (GO:0016021)		p.E115Q(1)|p.E72Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			GAAGTGTGTTCCACGTCGCTG	0.438																																					p.E72Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G214C	8						.						81.0	71.0	74.0					8																	38851152		2203	4300	6503	38970309	SO:0001583	missense	83877	exon3			AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.343G>C	8.37:g.38851152C>G	ENSP00000416050:p.Glu115Gln		38970309	NM_001024380	B2RBK4|D3DSX8|Q8N0X9	Missense_Mutation	SNP	ENST00000456397.2	37	CCDS6111.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.719892	0.48728	.	.	ENSG00000169490	ENST00000456845;ENST00000456397;ENST00000412303;ENST00000397070;ENST00000522142	.	.	.	5.69	4.81	0.61882	.	0.181563	0.64402	N	0.000015	T	0.56062	0.1960	L	0.60957	1.885	0.43503	D	0.995754	B;B	0.21071	0.051;0.0	B;B	0.17433	0.018;0.002	T	0.52540	-0.8562	9	0.28530	T	0.3	-14.4457	11.2163	0.48827	0.0:0.8007:0.1293:0.07	.	72;115	Q9BX73-2;Q9BX73	.;TM2D2_HUMAN	Q	72;115;72;72;72	.	ENSP00000380260:E72Q	E	-	1	0	TM2D2	38970309	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.620000	0.46410	1.514000	0.48869	0.655000	0.94253	GAA		0.438	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377280.1	NM_031940	
TRPA1	8989	broad.mit.edu	37	8	72958764	72958764	+	Missense_Mutation	SNP	G	G	A	rs201119954		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:72958764G>A	ENST00000262209.4	-	17	2252	c.2045C>T	c.(2044-2046)cCg>cTg	p.P682L	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	682					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.P682L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GGCTGTAAGCGGTTCATATAT	0.274																																					p.P682L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2045T	8						.						171.0	183.0	179.0					8																	72958764		2203	4299	6502	73121318	SO:0001583	missense	8989	exon17			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2045C>T	8.37:g.72958764G>A	ENSP00000262209:p.Pro682Leu		73121318	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016523	0.75161	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.76839	-1.05;-1.05	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.88621	0.6486	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90260	0.4300	10	0.66056	D	0.02	-19.0615	17.872	0.88813	0.0:0.0:1.0:0.0	.	682	O75762	TRPA1_HUMAN	L	534;682	ENSP00000428151:P534L;ENSP00000262209:P682L	ENSP00000262209:P682L	P	-	2	0	TRPA1	73121318	1.000000	0.71417	0.998000	0.56505	0.034000	0.12701	7.635000	0.83286	2.285000	0.76669	0.555000	0.69702	CCG		0.274	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
COL22A1	169044	broad.mit.edu	37	8	139890398	139890398	+	Missense_Mutation	SNP	G	G	A	rs139591204		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr8:139890398G>A	ENST00000303045.6	-	3	699	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W	COL22A1_ENST00000435777.1_Missense_Mutation_p.R85W	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	85	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R85W(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTGGTGGGCCGGTCGCTGTAG	0.687										HNSCC(7;0.00092)																											p.R85W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C253T	8						.	G	TRP/ARG	1,4393		0,1,2196	15.0	18.0	17.0		253	3.4	0.3	8	dbSNP_134	17	0,8584		0,0,4292	no	missense	COL22A1	NM_152888.1	101	0,1,6488	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	85/1627	139890398	1,12977	2197	4292	6489	139959580	SO:0001583	missense	169044	exon3			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.253C>T	8.37:g.139890398G>A	ENSP00000303153:p.Arg85Trp		139959580	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914985	0.52546	2.28E-4	0.0	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.83914	-1.78;-1.78	5.28	3.4	0.38934	von Willebrand factor, type A (3);	0.156039	0.29225	U	0.012765	D	0.84392	0.5462	M	0.64997	1.995	0.42711	D	0.993649	D	0.65815	0.995	P	0.54210	0.745	T	0.82037	-0.0656	9	.	.	.	.	9.1478	0.36944	0.0:0.1437:0.5593:0.2971	.	85	Q8NFW1	COMA1_HUMAN	W	85	ENSP00000303153:R85W;ENSP00000387655:R85W	.	R	-	1	2	COL22A1	139959580	0.757000	0.28394	0.309000	0.25155	0.396000	0.30629	0.918000	0.28678	0.529000	0.28599	0.585000	0.79938	CGG		0.687	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CDK20	23552	broad.mit.edu	37	9	90582462	90582463	+	Frame_Shift_Ins	INS	-	-	G	rs151084868	byFrequency	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr9:90582462_90582463insG	ENST00000325303.8	-	8	1260_1261	c.955_956insC	c.(955-957)cacfs	p.H319fs	CDK20_ENST00000375871.4_3'UTR|CDK20_ENST00000336654.5_Frame_Shift_Ins_p.H311fs|CDK20_ENST00000605159.1_3'UTR|CDK20_ENST00000375883.3_Frame_Shift_Ins_p.H298fs	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20	319					cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.H319fs*4(1)		skin(1)	1						GTCATGGATGTGGGGGGGCCCT	0.619																																					p.H319fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.956_957insC	9						.																																			89772283	SO:0001589	frameshift_variant	23552	exon8			AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.956dupC	9.37:g.90582469_90582469dupG	ENSP00000322343:p.His319fs		89772282	NM_001039803	A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	Frame_Shift_Ins	INS	ENST00000325303.8	37	CCDS35060.1																																																																																				0.619	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214996.1	NM_012119	
NUP188	23511	broad.mit.edu	37	9	131745592	131745592	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr9:131745592C>A	ENST00000372577.2	+	18	1838	c.1817C>A	c.(1816-1818)cCa>cAa	p.P606Q		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	606					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.P606Q(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GTGATCTCCCCACCTGTGGAT	0.433																																					p.P606Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1817A	9						.						216.0	202.0	207.0					9																	131745592		2203	4300	6503	130785413	SO:0001583	missense	23511	exon18			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1817C>A	9.37:g.131745592C>A	ENSP00000361658:p.Pro606Gln		130785413	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109467	0.77096	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.66280	-0.2	5.43	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	L	0.34521	1.04	0.80722	D	1	B	0.33299	0.407	P	0.44518	0.452	T	0.66720	-0.5852	10	0.87932	D	0	-20.3113	15.7539	0.78009	0.0:0.8634:0.1366:0.0	.	606	Q5SRE5	NU188_HUMAN	Q	495;606	ENSP00000361658:P606Q	ENSP00000349125:P495Q	P	+	2	0	NUP188	130785413	1.000000	0.71417	0.146000	0.22360	0.893000	0.52053	5.560000	0.67332	1.424000	0.47217	0.563000	0.77884	CCA		0.433	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
PHF2	5253	broad.mit.edu	37	9	96439004	96439004	+	Silent	SNP	C	C	A	rs75653373|rs149736720|rs368818072	byFrequency	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr9:96439004C>A	ENST00000359246.4	+	21	3328	c.2961C>A	c.(2959-2961)acC>acA	p.T987T	PHF2_ENST00000375376.4_Silent_p.T218T	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	987	Ser/Thr-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.T987_P988insPASTT(1)|p.T987T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		cctctaccaccccggcctcca	0.692																																					p.T987T												.	.	2	Insertion - In frame(1)|Substitution - coding silent(1)	large_intestine(1)|central_nervous_system(1)	c.C2961A	9						.						82.0	60.0	68.0					9																	96439004		2155	4247	6402	95478825	SO:0001819	synonymous_variant	5253	exon21			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2961C>A	9.37:g.96439004C>A			95478825	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	CCDS35069.1																																																																																				0.692	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
TMEM141	85014	broad.mit.edu	37	9	139686459	139686459	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chr9:139686459A>G	ENST00000290079.8	+	3	198	c.182A>G	c.(181-183)cAg>cGg	p.Q61R	RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.Q36R|TMEM141_ENST00000465017.1_3'UTR	NM_032928.3	NP_116317.1	Q96I45	TM141_HUMAN	transmembrane protein 141	61						integral component of membrane (GO:0016021)		p.Q61R(1)		large_intestine(1)|lung(2)|prostate(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.67e-06)|Epithelial(140;0.000112)		TACCCTTTGCAGTGGAGCCTC	0.607											OREG0019622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q61R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A182G	9						.						81.0	84.0	83.0					9																	139686459		2203	4300	6503	138806280	SO:0001583	missense	85014	exon3			BC007834	CCDS7007.1	9q34.3	2009-11-13			ENSG00000244187	ENSG00000244187			28211	protein-coding gene	gene with protein product							Standard	NM_032928		Approved	MGC14141	uc004cje.4	Q96I45	OTTHUMG00000020945	ENST00000290079.8:c.182A>G	9.37:g.139686459A>G	ENSP00000290079:p.Gln61Arg	1650	138806280	NM_032928	A6NIZ7|Q5T5R5	Missense_Mutation	SNP	ENST00000290079.8	37	CCDS7007.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884452	0.33255	.	.	ENSG00000244187	ENST00000290079	.	.	.	4.31	3.14	0.36123	.	.	.	.	.	T	0.59500	0.2198	M	0.78049	2.395	0.37007	D	0.895547	B	0.11235	0.004	B	0.10450	0.005	T	0.60762	-0.7199	8	0.56958	D	0.05	.	6.5569	0.22466	0.888:0.0:0.112:0.0	.	61	Q96I45	TM141_HUMAN	R	61	.	ENSP00000290079:Q61R	Q	+	2	0	TMEM141	138806280	0.996000	0.38824	0.992000	0.48379	0.679000	0.39708	1.892000	0.39748	0.679000	0.31345	0.260000	0.18958	CAG		0.607	TMEM141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055119.1	NM_032928	
F9	2158	broad.mit.edu	37	X	138633258	138633258	+	Silent	SNP	T	T	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:138633258T>A	ENST00000218099.2	+	6	565	c.558T>A	c.(556-558)acT>acA	p.T186T	F9_ENST00000394090.2_Silent_p.T148T	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	186					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.T186T(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	TTTCACAAACTTCTAAGCTCA	0.363																																					p.T186T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T558A	X						.						105.0	92.0	96.0					X																	138633258		2203	4300	6503	138460924	SO:0001819	synonymous_variant	2158	exon6			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.558T>A	X.37:g.138633258T>A			138460924	NM_000133	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Silent	SNP	ENST00000218099.2	37	CCDS14666.1																																																																																				0.363	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1		
STS	412	broad.mit.edu	37	X	7175299	7175299	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:7175299C>T	ENST00000217961.4	+	3	389	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	57					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)	p.R57W(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CAATATCGACCGGTTGGCCAG	0.488									Ichthyosis																												p.R57W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C169T	X						.						59.0	45.0	50.0					X																	7175299		2203	4299	6502	7185299	SO:0001583	missense	412	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.169C>T	X.37:g.7175299C>T	ENSP00000217961:p.Arg57Trp		7185299	NM_000351	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.716599	0.30413	.	.	ENSG00000101846	ENST00000217961	D	0.95205	-3.64	3.86	0.119	0.14685	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.169390	0.48767	D	0.000162	D	0.97424	0.9157	H	0.96777	3.88	0.38471	D	0.947464	D	0.89917	1.0	D	0.81914	0.995	D	0.95332	0.8430	10	0.87932	D	0	.	6.1292	0.20195	0.6195:0.247:0.1335:0.0	.	57	P08842	STS_HUMAN	W	57	ENSP00000217961:R57W	ENSP00000217961:R57W	R	+	1	2	STS	7185299	0.008000	0.16893	0.015000	0.15790	0.220000	0.24768	0.069000	0.14552	0.029000	0.15352	0.600000	0.82982	CGG		0.488	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
DMD	1756	broad.mit.edu	37	X	32486647	32486647	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:32486647C>G	ENST00000357033.4	-	23	3336	c.3130G>C	c.(3130-3132)Gag>Cag	p.E1044Q	DMD_ENST00000378677.2_Missense_Mutation_p.E1040Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1044					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E1039Q(2)|p.E1040Q(1)|p.E1044Q(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATTTGCTCCTCTAGCTTTTGA	0.378																																					p.E1044Q												.	.	4	Substitution - Missense(4)	endometrium(3)|large_intestine(1)	c.G3130C	X						.						59.0	51.0	54.0					X																	32486647		2202	4300	6502	32396568	SO:0001583	missense	1756	exon23			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3130G>C	X.37:g.32486647C>G	ENSP00000354923:p.Glu1044Gln		32396568	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300891	0.23650	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.38240	1.15;1.15	5.12	5.12	0.69794	.	0.223951	0.20973	U	0.082354	T	0.27629	0.0679	N	0.16656	0.425	0.80722	D	1	B;B;B	0.25850	0.003;0.136;0.004	B;B;B	0.26094	0.019;0.066;0.033	T	0.05989	-1.0852	10	0.39692	T	0.17	.	17.8472	0.88733	0.0:1.0:0.0:0.0	.	1036;1044;1040	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	Q	1036;1040;1044;1044;921	ENSP00000367948:E1040Q;ENSP00000354923:E1044Q	ENSP00000354923:E1044Q	E	-	1	0	DMD	32396568	0.998000	0.40836	0.917000	0.36280	0.379000	0.30106	4.239000	0.58694	2.234000	0.73211	0.538000	0.68166	GAG		0.378	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
FAM47B	170062	broad.mit.edu	37	X	34962223	34962223	+	Silent	SNP	G	G	A			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:34962223G>A	ENST00000329357.5	+	1	1311	c.1275G>A	c.(1273-1275)ccG>ccA	p.P425P		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	425								p.P425P(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GTCTCTGCCCGGAGCCTACCA	0.547																																					p.P425P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1275A	X						.						68.0	63.0	65.0					X																	34962223		2202	4300	6502	34872144	SO:0001819	synonymous_variant	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1275G>A	X.37:g.34962223G>A			34872144	NM_152631	Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	CCDS14236.1																																																																																				0.547	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
MAGT1	84061	broad.mit.edu	37	X	77086304	77086304	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:77086304G>T	ENST00000358075.6	-	9	1172	c.1086C>A	c.(1084-1086)taC>taA	p.Y362*		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	330					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.Y330*(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						AATCATACCTGTATGGGTAGC	0.323																																					p.Y362X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1086A	X						.						64.0	59.0	61.0					X																	77086304		2203	4293	6496	76972960	SO:0001587	stop_gained	84061	exon9				CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.1086C>A	X.37:g.77086304G>T	ENSP00000354649:p.Tyr362*		76972960	NM_032121	B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Nonsense_Mutation	SNP	ENST00000358075.6	37	CCDS14436.2	.	.	.	.	.	.	.	.	.	.	G	30	5.052037	0.93793	.	.	ENSG00000102158	ENST00000358075;ENST00000453109	.	.	.	5.28	1.15	0.20763	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9447	13.8335	0.63395	0.1226:0.0:0.8774:0.0	.	.	.	.	X	362;213	.	ENSP00000354649:Y362X	Y	-	3	2	MAGT1	76972960	1.000000	0.71417	0.999000	0.59377	0.852000	0.48524	4.184000	0.58323	0.003000	0.14656	0.462000	0.41574	TAC		0.323	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121	
GPR174	84636	broad.mit.edu	37	X	78427061	78427079	+	Frame_Shift_Del	DEL	TGACCATTGGCGAGTTGAT	TGACCATTGGCGAGTTGAT	-	rs141253543		TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	TGACCATTGGCGAGTTGAT	TGACCATTGGCGAGTTGAT	TGACCATTGGCGAGTTGAT	-	TGACCATTGGCGAGTTGAT	TGACCATTGGCGAGTTGAT	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:78427061_78427079delTGACCATTGGCGAGTTGAT	ENST00000276077.1	+	1	593_611	c.557_575delTGACCATTGGCGAGTTGAT	c.(556-576)atgaccattggcgagttgattfs	p.MTIGELI186fs		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T187fs*3(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						GTTGTTATGATGACCATTGGCGAGTTGATTGGGTTTGTA	0.457										HNSCC(63;0.18)																											p.186_192del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.557_575del	X						.																																			78313735	SO:0001589	frameshift_variant	84636	exon1			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.557_575delTGACCATTGGCGAGTTGAT	X.37:g.78427061_78427079delTGACCATTGGCGAGTTGAT	ENSP00000276077:p.Met186fs		78313717	NM_032553	Q2M3F7	Frame_Shift_Del	DEL	ENST00000276077.1	37	CCDS14443.1																																																																																				0.457	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
MAGEC1	9947	broad.mit.edu	37	X	140994881	140994881	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3955-01A-02W-0995-10	TCGA-AA-3955-10A-01W-0995-10	g.chrX:140994881T>G	ENST00000285879.4	+	4	1977	c.1691T>G	c.(1690-1692)tTt>tGt	p.F564C	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	564								p.F564C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCACTACTTTCCTCAGAGC	0.572										HNSCC(15;0.026)																											p.F564C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1691G	X						.						231.0	249.0	243.0					X																	140994881		2203	4300	6503	140822547	SO:0001583	missense	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1691T>G	X.37:g.140994881T>G	ENSP00000285879:p.Phe564Cys		140822547	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	9.208	1.030253	0.19512	.	.	ENSG00000155495	ENST00000285879	T	0.02197	4.4	0.118	0.118	0.14667	.	.	.	.	.	T	0.01592	0.0051	N	0.08118	0	0.41107	D	0.985713	P	0.50156	0.932	P	0.47528	0.549	T	0.65257	-0.6212	9	0.87932	D	0	.	2.1911	0.03899	0.4903:1.0E-4:2.0E-4:0.5094	.	564	O60732	MAGC1_HUMAN	C	564	ENSP00000285879:F564C	ENSP00000285879:F564C	F	+	2	0	MAGEC1	140822547	0.000000	0.05858	0.105000	0.21289	0.105000	0.19272	-1.375000	0.02563	0.153000	0.19213	0.151000	0.16131	TTT		0.572	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
