#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZMYND11	10771	broad.mit.edu	37	10	267147	267147	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr10:267147G>C	ENST00000397962.3	+	4	717	c.289G>C	c.(289-291)Gaa>Caa	p.E97Q	ZMYND11_ENST00000402736.1_Missense_Mutation_p.E97Q|ZMYND11_ENST00000381607.4_Intron|ZMYND11_ENST00000403354.1_Intron|ZMYND11_ENST00000558098.2_Missense_Mutation_p.E97Q|ZMYND11_ENST00000381591.1_Missense_Mutation_p.E97Q|ZMYND11_ENST00000381602.4_Missense_Mutation_p.E57Q|ZMYND11_ENST00000535374.1_Intron|ZMYND11_ENST00000397959.3_Intron|ZMYND11_ENST00000509513.2_Missense_Mutation_p.E97Q|ZMYND11_ENST00000381584.1_Missense_Mutation_p.E80Q|ZMYND11_ENST00000602682.1_Intron|ZMYND11_ENST00000545619.1_Intron|ZMYND11_ENST00000309776.4_Missense_Mutation_p.E57Q|ZMYND11_ENST00000381604.4_Missense_Mutation_p.E57Q			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	97					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E57Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CTGGGAAACAGAAAATCATGA	0.348																																					p.E97Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G289C	10						.						255.0	238.0	244.0					10																	267147		2203	4300	6503	257147	SO:0001583	missense	10771	exon4			X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.289G>C	10.37:g.267147G>C	ENSP00000381053:p.Glu97Gln		257147	NM_212479	B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	37	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268799	0.80469	.	.	ENSG00000015171	ENST00000397962;ENST00000309776;ENST00000381602;ENST00000509513;ENST00000381591;ENST00000402736;ENST00000381604;ENST00000397955;ENST00000381584	D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.89536	0.6743	L	0.28740	0.885	0.38580	D	0.950162	D;D;D;D	0.71674	0.998;0.981;0.993;0.993	D;D;D;D	0.70227	0.942;0.932;0.968;0.968	D	0.86348	0.1709	9	0.22109	T	0.4	-25.4194	20.0371	0.97565	0.0:0.0:1.0:0.0	.	97;97;57;97	Q2LD45;Q2LD48;B0QZE3;E7ENI9	.;.;.;.	Q	97;57;57;97;97;97;57;112;80	ENSP00000381053:E97Q;ENSP00000309992:E57Q;ENSP00000371015:E57Q;ENSP00000424205:E97Q;ENSP00000371003:E97Q;ENSP00000386010:E97Q;ENSP00000371017:E57Q;ENSP00000381046:E112Q;ENSP00000370996:E80Q	ENSP00000309992:E57Q	E	+	1	0	ZMYND11	257147	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.734000	0.93682	0.655000	0.94253	GAA		0.348	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4	NM_006624	
PTPLA	9200	broad.mit.edu	37	10	17636322	17636322	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr10:17636322G>A	ENST00000361271.3	-	6	703	c.666C>T	c.(664-666)taC>taT	p.Y222Y		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	222					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)	p.Y222Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						GCAAGGCAGCGTATATTGTAA	0.313																																					p.Y222Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C666T	10						.						65.0	65.0	65.0					10																	17636322		2203	4297	6500	17676328	SO:0001819	synonymous_variant	9200	exon6			AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.666C>T	10.37:g.17636322G>A			17676328	NM_014241	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Silent	SNP	ENST00000361271.3	37	CCDS7121.1																																																																																				0.313	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
MYPN	84665	broad.mit.edu	37	10	69925510	69925510	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr10:69925510G>A	ENST00000358913.5	+	9	2023	c.1535G>A	c.(1534-1536)tGc>tAc	p.C512Y	MYPN_ENST00000540630.1_Missense_Mutation_p.C512Y|MYPN_ENST00000354393.2_Missense_Mutation_p.C237Y	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	512	Ig-like 2.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.C512Y(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GATTCTGGGTGCTTCACATGT	0.433																																					p.C512Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1535A	10						.						153.0	125.0	135.0					10																	69925510		2203	4300	6503	69595516	SO:0001583	missense	84665	exon9			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1535G>A	10.37:g.69925510G>A	ENSP00000351790:p.Cys512Tyr		69595516	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	6.480	0.456716	0.12283	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.66460	-0.21;-0.21;-0.21	5.23	2.94	0.34122	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.269404	0.42294	D	0.000739	T	0.36303	0.0962	N	0.01242	-0.935	0.30698	N	0.750572	P;P;P	0.52577	0.944;0.671;0.954	P;B;P	0.45377	0.461;0.245;0.478	T	0.36962	-0.9726	9	.	.	.	.	8.457	0.32906	0.0807:0.0:0.6502:0.2691	.	512;237;512	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	Y	237;237;512;512	ENSP00000346369:C237Y;ENSP00000351790:C512Y;ENSP00000441668:C512Y	.	C	+	2	0	MYPN	69595516	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.575000	0.46025	1.138000	0.42230	0.561000	0.74099	TGC		0.433	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
HNRNPH3	3189	broad.mit.edu	37	10	70097012	70097012	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr10:70097012G>A	ENST00000265866.7	+	2	199	c.34G>A	c.(34-36)Gac>Aac	p.D12N	HNRNPH3_ENST00000441000.2_Missense_Mutation_p.D12N|HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000354695.5_Missense_Mutation_p.D12N	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	12					epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D12N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						TGGTCCAAATGACGCTAGTGA	0.363																																					p.D12N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G34A	10						.						204.0	184.0	191.0					10																	70097012		2203	4300	6503	69767018	SO:0001583	missense	3189	exon2				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.34G>A	10.37:g.70097012G>A	ENSP00000265866:p.Asp12Asn		69767018	NM_012207	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Missense_Mutation	SNP	ENST00000265866.7	37	CCDS7278.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473959	0.63737	.	.	ENSG00000096746	ENST00000265866;ENST00000441000;ENST00000354695	T;T;T	0.29917	2.89;1.55;2.73	5.88	5.88	0.94601	.	0.190901	0.53938	D	0.000050	T	0.34978	0.0916	N	0.12182	0.205	0.45777	D	0.998662	D;D;D	0.61697	0.99;0.982;0.97	P;P;P	0.57425	0.813;0.82;0.665	T	0.12091	-1.0561	10	0.34782	T	0.22	.	20.2165	0.98299	0.0:0.0:1.0:0.0	.	12;12;12	B4DHY1;P31942-2;P31942	.;.;HNRH3_HUMAN	N	12	ENSP00000265866:D12N;ENSP00000409869:D12N;ENSP00000346726:D12N	ENSP00000265866:D12N	D	+	1	0	HNRNPH3	69767018	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.787000	0.95880	0.585000	0.79938	GAC		0.363	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1		
GRIA4	2893	broad.mit.edu	37	11	105795379	105795379	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:105795379G>A	ENST00000530497.1	+	11	1731	c.1731G>A	c.(1729-1731)gaG>gaA	p.E577E	GRIA4_ENST00000525187.1_Silent_p.E577E|GRIA4_ENST00000393127.2_Silent_p.E577E|GRIA4_ENST00000282499.5_Silent_p.E577E			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	577					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E577E(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACACAGAAGAGCCAGAGGACG	0.478																																					p.E577E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1731A	11						.						146.0	123.0	131.0					11																	105795379		2202	4299	6501	105300589	SO:0001819	synonymous_variant	2893	exon12			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1731G>A	11.37:g.105795379G>A			105300589	NM_001077243	Q86XE8	Silent	SNP	ENST00000530497.1	37	CCDS8333.1																																																																																				0.478	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
SIDT2	51092	broad.mit.edu	37	11	117060070	117060070	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:117060070G>C	ENST00000324225.4	+	15	1903	c.1372G>C	c.(1372-1374)Gtc>Ctc	p.V458L	SIDT2_ENST00000431081.2_Missense_Mutation_p.V455L	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	458					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.V458L(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CACCATTGCTGTCTTCTATGC	0.617																																					p.V458L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372C	11						.						117.0	91.0	100.0					11																	117060070		2201	4296	6497	116565280	SO:0001583	missense	51092	exon15			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1372G>C	11.37:g.117060070G>C	ENSP00000314023:p.Val458Leu		116565280	NM_001040455	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450342	0.84101	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.25912	1.77;1.77;1.77	4.77	4.77	0.60923	.	0.068351	0.64402	D	0.000015	T	0.47377	0.1442	L	0.58583	1.82	0.80722	D	1	D;P;P;D	0.65815	0.994;0.835;0.859;0.995	D;P;P;D	0.70227	0.946;0.513;0.609;0.968	T	0.35351	-0.9792	10	0.42905	T	0.14	-39.0588	17.593	0.88003	0.0:0.0:1.0:0.0	.	479;455;458;479	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	L	458;479;455	ENSP00000314023:V458L;ENSP00000278951:V479L;ENSP00000399635:V455L	ENSP00000278951:V479L	V	+	1	0	SIDT2	116565280	1.000000	0.71417	0.904000	0.35570	0.730000	0.41778	9.576000	0.98192	2.502000	0.84385	0.462000	0.41574	GTC		0.617	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
OR52B4	143496	broad.mit.edu	37	11	4389312	4389312	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:4389312C>T	ENST00000408920.2	-	1	304	c.214G>A	c.(214-216)Gac>Aac	p.D72N		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	72					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D72N(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGACAATGTCTGCTCCAGCC	0.542																																					p.D72N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	11						.						81.0	87.0	85.0					11																	4389312		2167	4270	6437	4345888	SO:0001583	missense	143496	exon1			AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.214G>A	11.37:g.4389312C>T	ENSP00000386160:p.Asp72Asn		4345888	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	37	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744400	0.49151	.	.	ENSG00000221996	ENST00000408920	T	0.66280	-0.2	5.28	3.39	0.38822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.82181	0.4981	M	0.93462	3.42	0.33277	D	0.561773	D	0.89917	1.0	D	0.97110	1.0	D	0.88437	0.3039	10	0.87932	D	0	.	10.9872	0.47528	0.0:0.8436:0.0:0.1564	.	72	Q8NGK2	O52B4_HUMAN	N	72	ENSP00000386160:D72N	ENSP00000386160:D72N	D	-	1	0	OR52B4	4345888	0.990000	0.36364	0.237000	0.24090	0.130000	0.20726	2.980000	0.49321	1.472000	0.48140	-0.142000	0.14014	GAC		0.542	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
OR51F2	119694	broad.mit.edu	37	11	4842793	4842793	+	Silent	SNP	C	C	T	rs111849521	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:4842793C>T	ENST00000322110.5	+	1	243	c.178C>T	c.(178-180)Ctg>Ttg	p.L60L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L60L(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAGCATGATCCTGTTTGTGGT	0.493													C|||	14	0.00279553	0.0091	0.0014	5008	,	,		20816	0.0		0.001	False		,,,				2504	0.0				p.L60L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C178T	11						.	C		79,4323	69.8+/-107.6	0,79,2122	265.0	259.0	261.0		178	2.7	1.0	11	dbSNP_132	261	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous	OR51F2	NM_001004753.1		0,81,6418	TT,TC,CC		0.0233,1.7946,0.6232		60/343	4842793	81,12917	2201	4298	6499	4799369	SO:0001819	synonymous_variant	119694	exon1			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.178C>T	11.37:g.4842793C>T			4799369	NM_001004753	Q6IFI1	Silent	SNP	ENST00000322110.5	37	CCDS31361.1																																																																																				0.493	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753	
UBQLNL	143630	broad.mit.edu	37	11	5537077	5537077	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:5537077G>C	ENST00000380184.1	-	1	858	c.595C>G	c.(595-597)Cta>Gta	p.L199V	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	199								p.L199V(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		TGCGTGTCTAGATGTTCTGAA	0.493																																					p.L199V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C595G	11						.						131.0	129.0	130.0					11																	5537077		2201	4297	6498	5493653	SO:0001583	missense	143630	exon1			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.595C>G	11.37:g.5537077G>C	ENSP00000369531:p.Leu199Val		5493653	NM_145053	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	ENST00000380184.1	37	CCDS31385.1	.	.	.	.	.	.	.	.	.	.	G	1.918	-0.449098	0.04572	.	.	ENSG00000175518	ENST00000380184	T	0.47869	0.83	4.87	2.93	0.34026	.	0.971044	0.08404	N	0.951017	T	0.29749	0.0743	N	0.08118	0	0.09310	N	0.999999	B	0.22276	0.067	B	0.19946	0.027	T	0.29088	-1.0023	10	0.66056	D	0.02	.	9.0365	0.36291	0.0883:0.1488:0.7629:0.0	.	199	Q8IYU4	UBQLN_HUMAN	V	199	ENSP00000369531:L199V	ENSP00000369531:L199V	L	-	1	2	UBQLNL	5493653	1.000000	0.71417	0.002000	0.10522	0.011000	0.07611	3.226000	0.51254	0.233000	0.21120	-0.797000	0.03246	CTA		0.493	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143386.1	NM_145053	
OR5D18	219438	broad.mit.edu	37	11	55587541	55587541	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:55587541G>C	ENST00000333976.4	+	1	456	c.436G>C	c.(436-438)Gtt>Ctt	p.V146L		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V146L(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CGTGCTGCTGGTTGTGGGATC	0.458																																					p.V146L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G436C	11						.						189.0	178.0	182.0					11																	55587541		2200	4296	6496	55344117	SO:0001583	missense	219438	exon1			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.436G>C	11.37:g.55587541G>C	ENSP00000335025:p.Val146Leu		55344117	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	10.44	1.350270	0.24512	.	.	ENSG00000186119	ENST00000333976	T	0.36878	1.23	4.66	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35739	N	0.003013	T	0.37404	0.1002	L	0.54323	1.7	0.09310	N	1	B	0.29590	0.25	B	0.43575	0.424	T	0.37888	-0.9686	10	0.56958	D	0.05	-26.039	4.2039	0.10480	0.0844:0.2944:0.4699:0.1513	.	146	Q8NGL1	OR5DI_HUMAN	L	146	ENSP00000335025:V146L	ENSP00000335025:V146L	V	+	1	0	OR5D18	55344117	0.013000	0.17824	0.004000	0.12327	0.020000	0.10135	1.190000	0.32126	0.481000	0.27557	0.567000	0.79289	GTT		0.458	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
PATL1	219988	broad.mit.edu	37	11	59410433	59410433	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:59410433G>A	ENST00000300146.9	-	16	2053	c.1969C>T	c.(1969-1971)Cga>Tga	p.R657*		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	657	Involved in nuclear spleckles localization.|Region C.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.R657*(3)		central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						ATTAGCTGTCGCAAAAGGCTG	0.453																																					p.R657X												.	.	3	Substitution - Nonsense(3)	endometrium(2)|large_intestine(1)	c.C1969T	11						.						156.0	151.0	153.0					11																	59410433		2003	4157	6160	59167009	SO:0001587	stop_gained	219988	exon16			AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.1969C>T	11.37:g.59410433G>A	ENSP00000300146:p.Arg657*		59167009	NM_152716	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Nonsense_Mutation	SNP	ENST00000300146.9	37	CCDS44613.1	.	.	.	.	.	.	.	.	.	.	G	38	7.147257	0.98096	.	.	ENSG00000166889	ENST00000300146;ENST00000428532	.	.	.	5.85	5.85	0.93711	.	0.054132	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-8.7461	17.9657	0.89099	0.0:0.0:1.0:0.0	.	.	.	.	X	657;627	.	ENSP00000300146:R657X	R	-	1	2	PATL1	59167009	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.349000	0.73013	2.771000	0.95319	0.561000	0.74099	CGA		0.453	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394559.1	NM_152716	
MS4A5	64232	broad.mit.edu	37	11	60197265	60197265	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:60197265C>A	ENST00000300190.2	+	1	204	c.118C>A	c.(118-120)Caa>Aaa	p.Q40K	MS4A5_ENST00000534071.1_3'UTR	NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	40						integral component of membrane (GO:0016021)		p.Q40K(1)		large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						AAGCCCCTTGCAAAAATTATT	0.408																																					p.Q40K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C118A	11						.						76.0	82.0	80.0					11																	60197265		2203	4300	6503	59953841	SO:0001583	missense	64232	exon1			AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.118C>A	11.37:g.60197265C>A	ENSP00000300190:p.Gln40Lys		59953841	NM_023945	Q9BZH1	Missense_Mutation	SNP	ENST00000300190.2	37	CCDS7987.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.297|6.297	0.422984|0.422984	0.11928|0.11928	.|.	.|.	ENSG00000166930|ENSG00000166930	ENST00000528905;ENST00000528093|ENST00000300190	.|T	.|0.10005	.|2.92	4.66|4.66	-1.56|-1.56	0.08532|0.08532	.|.	.|1.787320	.|0.02292	.|N	.|0.070383	T|T	0.06280|0.06280	0.0162|0.0162	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.11235	.|0.004	.|B	.|0.06405	.|0.002	T|T	0.29150|0.29150	-1.0021|-1.0021	5|10	.|0.15066	.|T	.|0.55	0.1413|0.1413	1.2499|1.2499	0.01980|0.01980	0.1558:0.2665:0.352:0.2256|0.1558:0.2665:0.352:0.2256	.|.	.|40	.|Q9H3V2	.|MS4A5_HUMAN	E|K	13;6|40	.|ENSP00000300190:Q40K	.|ENSP00000300190:Q40K	A|Q	+|+	2|1	0|0	MS4A5|MS4A5	59953841|59953841	0.046000|0.046000	0.20272|0.20272	0.020000|0.020000	0.16555|0.16555	0.524000|0.524000	0.34500|0.34500	0.045000|0.045000	0.14013|0.14013	-0.045000|-0.045000	0.13468|0.13468	0.467000|0.467000	0.42956|0.42956	GCA|CAA		0.408	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1		
NXF1	10482	broad.mit.edu	37	11	62561813	62561813	+	Silent	SNP	C	C	T	rs143444714	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:62561813C>T	ENST00000532297.1	-	20	2306	c.1677G>A	c.(1675-1677)ccG>ccA	p.P559P	TMEM223_ENST00000307366.7_5'Flank|TMEM223_ENST00000527073.1_5'Flank|TMEM223_ENST00000525631.1_5'Flank|NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000294172.2_Silent_p.P559P|NXF1_ENST00000533048.1_5'UTR			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	559	Pro-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P559P(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGGTGGGCACCGGGCTGGAGG	0.542													C|||	3	0.000599042	0.0	0.0	5008	,	,		17938	0.0		0.0	False		,,,				2504	0.0031				p.P559P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1677A	11						.						101.0	94.0	97.0					11																	62561813		2201	4299	6500	62318389	SO:0001819	synonymous_variant	10482	exon19			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1677G>A	11.37:g.62561813C>T			62318389	NM_006362	B4E269|Q99799|Q9UQL2	Silent	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457325	0.26161	.	.	ENSG00000162231	ENST00000527902	.	.	.	5.38	-9.87	0.00470	.	.	.	.	.	T	0.34279	0.0892	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43065	-0.9414	4	.	.	.	-12.2741	2.7462	0.05268	0.1738:0.1409:0.422:0.2633	.	.	.	.	Q	64	.	.	R	-	2	0	NXF1	62318389	0.016000	0.18221	0.851000	0.33527	0.986000	0.74619	-1.252000	0.02880	-1.466000	0.01897	-0.605000	0.04089	CGG		0.542	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
MRPL21	219927	broad.mit.edu	37	11	68660895	68660895	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:68660895G>A	ENST00000362034.2	-	5	434	c.425C>T	c.(424-426)aCg>aTg	p.T142M	MRPL21_ENST00000450904.2_Missense_Mutation_p.T57M|MRPL21_ENST00000567045.1_Missense_Mutation_p.T57M	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	142					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.T142M(1)		large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCCAAGCAGCGTGAAGTTGTC	0.507																																					p.T142M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C425T	11						.						78.0	72.0	74.0					11																	68660895		2200	4294	6494	68417471	SO:0001583	missense	219927	exon5			AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.425C>T	11.37:g.68660895G>A	ENSP00000354580:p.Thr142Met		68417471	NM_181514	A6NKU0|C9JPR2	Missense_Mutation	SNP	ENST00000362034.2	37	CCDS8186.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084575	0.76642	.	.	ENSG00000197345	ENST00000450904;ENST00000362034;ENST00000447977	.	.	.	4.25	4.25	0.50352	.	0.046978	0.85682	D	0.000000	D	0.83031	0.5166	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86589	0.1859	9	0.87932	D	0	-22.5276	15.6122	0.76733	0.0:0.0:1.0:0.0	.	142;142	B4DXI4;Q7Z2W9	.;RM21_HUMAN	M	57;142;142	.	ENSP00000354580:T142M	T	-	2	0	MRPL21	68417471	1.000000	0.71417	0.950000	0.38849	0.811000	0.45836	8.335000	0.90031	2.209000	0.71365	0.561000	0.74099	ACG		0.507	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512	
MYO7A	4647	broad.mit.edu	37	11	76915212	76915212	+	Silent	SNP	C	C	T	rs368749248		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:76915212C>T	ENST00000409709.3	+	39	5690	c.5418C>T	c.(5416-5418)gcC>gcT	p.A1806A	MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000458637.2_Silent_p.A1768A|MYO7A_ENST00000409619.2_Silent_p.A1757A	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1806	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.A1806A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CCCTGAAAGCCGAGCCCCTGA	0.602																																					p.A1806A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5418T	11						.	C	,	0,4174		0,0,2087	50.0	54.0	52.0		5418,5304	-9.4	0.4	11		52	1,8407		0,1,4203	no	coding-synonymous,coding-synonymous	MYO7A	NM_000260.3,NM_001127180.1	,	0,1,6290	TT,TC,CC		0.0119,0.0,0.0079	,	1806/2216,1768/2176	76915212	1,12581	2087	4204	6291	76592860	SO:0001819	synonymous_variant	4647	exon39			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5418C>T	11.37:g.76915212C>T			76592860	NM_000260	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																				0.602	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
KIRREL3	84623	broad.mit.edu	37	11	126343313	126343313	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr11:126343313C>T	ENST00000525144.2	-	5	731	c.482G>A	c.(481-483)cGt>cAt	p.R161H	KIRREL3_ENST00000529097.2_Missense_Mutation_p.R161H|KIRREL3_ENST00000525704.2_Missense_Mutation_p.R161H	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	161	Ig-like C2-type 2.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R120H(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		GTCCCCCGCACGCAGGCTGAT	0.652																																					p.R161H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G482A	11						.						39.0	44.0	42.0					11																	126343313		2068	4193	6261	125848523	SO:0001583	missense	84623	exon5			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.482G>A	11.37:g.126343313C>T	ENSP00000435466:p.Arg161His		125848523	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	c	24.9	4.580138	0.86645	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	D;D;D	0.86497	-2.13;-2.13;-2.13	4.86	4.86	0.63082	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93635	0.7967	M	0.84219	2.685	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.85130	0.799;0.997;0.97	D	0.93608	0.6936	10	0.44086	T	0.13	.	17.0522	0.86523	0.0:1.0:0.0:0.0	.	161;161;161	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	H	161	ENSP00000435466:R161H;ENSP00000434081:R161H;ENSP00000435094:R161H	ENSP00000435466:R161H	R	-	2	0	KIRREL3	125848523	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.276000	0.78559	2.260000	0.74910	0.632000	0.83419	CGT		0.652	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
CLEC9A	283420	broad.mit.edu	37	12	10218213	10218213	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:10218213G>A	ENST00000355819.1	+	9	1321	c.708G>A	c.(706-708)gcG>gcA	p.A236A		NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	236					positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A236A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						AGAAGTATGCGTTGAGATCCT	0.438																																					p.A236A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G708A	12						.						187.0	166.0	173.0					12																	10218213		2203	4300	6503	10109480	SO:0001819	synonymous_variant	283420	exon9				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.708G>A	12.37:g.10218213G>A			10109480	NM_207345	B0ZBM2	Silent	SNP	ENST00000355819.1	37	CCDS8611.1																																																																																				0.438	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000399564.1	NM_207345	
CLSTN3	9746	broad.mit.edu	37	12	7289474	7289474	+	Silent	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:7289474C>T	ENST00000266546.6	+	7	1428	c.978C>T	c.(976-978)gcC>gcT	p.A326A	CLSTN3_ENST00000537408.1_Silent_p.A338A	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	326					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.A326A(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GCCCCAATGCCAACTGGACAG	0.627																																					p.A326A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C978T	12						.						166.0	166.0	166.0					12																	7289474		2203	4300	6503	7180741	SO:0001819	synonymous_variant	9746	exon7			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.978C>T	12.37:g.7289474C>T			7180741	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																				0.627	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
C2CD5	9847	broad.mit.edu	37	12	22623824	22623824	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:22623824T>A	ENST00000333957.4	-	21	2635	c.2380A>T	c.(2380-2382)Atc>Ttc	p.I794F	C2CD5_ENST00000542676.1_Missense_Mutation_p.I794F|C2CD5_ENST00000545552.1_Missense_Mutation_p.I807F|C2CD5_ENST00000396028.2_Missense_Mutation_p.I785F|C2CD5_ENST00000446597.1_Missense_Mutation_p.I794F|C2CD5_ENST00000536386.1_Missense_Mutation_p.I796F|C2CD5_ENST00000544930.1_Missense_Mutation_p.I609F	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	794					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.I794F(1)									TCAAAAGTGATTGCGACTGCC	0.333																																					p.I794F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2380T	12						.						142.0	133.0	136.0					12																	22623824		2203	4299	6502	22515091	SO:0001583	missense	9847	exon21			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2380A>T	12.37:g.22623824T>A	ENSP00000334229:p.Ile794Phe		22515091	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	CCDS31758.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.86|17.86	3.491514|3.491514	0.64074|0.64074	.|.	.|.	ENSG00000111731|ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930|ENST00000539615	T;T;T;T;T;T|.	0.67171|.	-0.2;-0.25;-0.24;-0.24;-0.25;-0.22|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.049986|.	0.85682|.	D|.	0.000000|.	T|T	0.53286|0.53286	0.1787|0.1787	L|L	0.29908|0.29908	0.895|0.895	0.54753|0.54753	D|D	0.999984|0.999984	B;B;B;B;B|.	0.31383|.	0.21;0.034;0.026;0.321;0.309|.	B;B;B;B;B|.	0.38225|.	0.268;0.022;0.012;0.148;0.025|.	T|T	0.50233|0.50233	-0.8852|-0.8852	10|5	0.72032|.	D|.	0.01|.	-24.9388|-24.9388	13.3832|13.3832	0.60780|0.60780	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	796;794;609;785;794|.	F5H2A1;B4DRN7;F5H3N1;Q86YS7-2;Q86YS7|.	.;.;.;.;K0528_HUMAN|.	F|H	794;794;796;785;794;807;609|77	ENSP00000334229:I794F;ENSP00000388756:I794F;ENSP00000439392:I796F;ENSP00000379345:I785F;ENSP00000441951:I794F;ENSP00000443204:I807F|.	ENSP00000334229:I794F|.	I|Q	-|-	1|3	0|2	KIAA0528|KIAA0528	22515091|22515091	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	6.471000|6.471000	0.73562|0.73562	2.096000|2.096000	0.63516|0.63516	0.472000|0.472000	0.43445|0.43445	ATC|CAA		0.333	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
PDZRN4	29951	broad.mit.edu	37	12	41967227	41967227	+	Silent	SNP	T	T	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:41967227T>C	ENST00000402685.2	+	10	2654	c.2646T>C	c.(2644-2646)tgT>tgC	p.C882C	PDZRN4_ENST00000298919.7_Silent_p.C622C|PDZRN4_ENST00000539469.2_Silent_p.C624C	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	882							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C624C(1)|p.C882C(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CTCAGAAGTGTTCAGAGCCCA	0.483																																					p.C882C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2646C	12						.						114.0	106.0	109.0					12																	41967227		2203	4300	6503	40253494	SO:0001819	synonymous_variant	29951	exon10			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2646T>C	12.37:g.41967227T>C			40253494	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	ENST00000402685.2	37	CCDS53777.1																																																																																				0.483	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
NELL2	4753	broad.mit.edu	37	12	45173462	45173462	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:45173462G>A	ENST00000429094.2	-	5	1094	c.590C>T	c.(589-591)gCg>gTg	p.A197V	NELL2_ENST00000437801.2_Missense_Mutation_p.A247V|NELL2_ENST00000333837.4_Missense_Mutation_p.A220V|NELL2_ENST00000549027.1_Missense_Mutation_p.A196V|NELL2_ENST00000452445.2_Missense_Mutation_p.A197V|NELL2_ENST00000551601.1_Missense_Mutation_p.A196V|NELL2_ENST00000395487.2_Missense_Mutation_p.A196V|NELL2_ENST00000547172.1_5'Flank	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	197	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.A247V(1)|p.A197V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ATATCCATGCGCATTATTTCT	0.343																																					p.A197V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C590T	12						.						79.0	75.0	76.0					12																	45173462		2203	4299	6502	43459729	SO:0001583	missense	4753	exon5			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.590C>T	12.37:g.45173462G>A	ENSP00000390680:p.Ala197Val		43459729	NM_001145108	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266175	0.59540	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684;ENST00000552993	T;T;T;T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51;4.51;4.51;4.51	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.050696	0.85682	D	0.000000	T	0.02610	0.0079	L	0.43701	1.375	0.58432	D	0.999998	B;B;P;B;P;B	0.36183	0.132;0.208;0.487;0.095;0.542;0.124	B;B;B;B;B;B	0.29524	0.02;0.077;0.062;0.05;0.103;0.053	T	0.57201	-0.7852	10	0.45353	T	0.12	-13.6032	12.6736	0.56880	0.0755:0.0:0.9245:0.0	.	220;247;196;197;197;196	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.;.;.;.;NELL2_HUMAN;.	V	196;197;196;197;196;220;247;196;197	ENSP00000378866:A196V;ENSP00000390680:A197V;ENSP00000449332:A196V;ENSP00000394612:A197V;ENSP00000447927:A196V;ENSP00000327988:A220V;ENSP00000416341:A247V;ENSP00000447085:A197V	ENSP00000327988:A220V	A	-	2	0	NELL2	43459729	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.690000	0.84178	2.566000	0.86566	0.650000	0.86243	GCG		0.343	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
MMP19	4327	broad.mit.edu	37	12	56231653	56231653	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:56231653C>T	ENST00000322569.4	-	7	1125	c.1034G>A	c.(1033-1035)cGa>cAa	p.R345Q	MMP19_ENST00000394182.1_Missense_Mutation_p.R59Q|MMP19_ENST00000409200.3_Silent_p.S298S|MMP19_ENST00000548629.1_Missense_Mutation_p.R322Q|TMEM198B_ENST00000478241.1_RNA	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	345					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R345Q(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CCATTGTGTTCGAGGCGAGTA	0.507																																					p.R345Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1034A	12						.						105.0	107.0	107.0					12																	56231653		2203	4300	6503	54517920	SO:0001583	missense	4327	exon7			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1034G>A	12.37:g.56231653C>T	ENSP00000313437:p.Arg345Gln		54517920	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136693	0.77662	.	.	ENSG00000123342	ENST00000394182;ENST00000322569;ENST00000548629	T;T;T	0.02395	4.31;4.31;4.31	5.94	5.94	0.96194	Hemopexin/matrixin (2);	0.357272	0.26460	N	0.024255	T	0.09468	0.0233	L	0.41079	1.255	0.53688	D	0.99997	D;D	0.89917	0.994;1.0	P;D	0.68039	0.854;0.955	T	0.43925	-0.9361	10	0.22706	T	0.39	.	17.8571	0.88767	0.0:1.0:0.0:0.0	.	345;59	Q99542;Q99542-3	MMP19_HUMAN;.	Q	59;345;322	ENSP00000377736:R59Q;ENSP00000313437:R345Q;ENSP00000446979:R322Q	ENSP00000313437:R345Q	R	-	2	0	MMP19	54517920	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.143000	0.64826	2.826000	0.97356	0.561000	0.74099	CGA		0.507	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
WSCD2	9671	broad.mit.edu	37	12	108603929	108603929	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr12:108603929G>A	ENST00000332082.4	+	5	1347	c.529G>A	c.(529-531)Gcc>Acc	p.A177T	WSCD2_ENST00000261400.3_Missense_Mutation_p.A177T|WSCD2_ENST00000547525.1_Missense_Mutation_p.A177T|WSCD2_ENST00000549903.1_Missense_Mutation_p.A177T			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	177	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.A177T(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GGAGTTCGGCGCCGAGTGCTA	0.662																																					p.A177T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G529A	12						.						28.0	33.0	31.0					12																	108603929		2189	4275	6464	107128059	SO:0001583	missense	9671	exon4				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.529G>A	12.37:g.108603929G>A	ENSP00000331933:p.Ala177Thr		107128059	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	31	5.101328	0.94245	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.22	5.22	0.72569	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	N	0.20807	0.61	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.58578	-0.7612	10	0.48119	T	0.1	-27.0548	17.3431	0.87303	0.0:0.0:1.0:0.0	.	177	Q2TBF2	WSCD2_HUMAN	T	177;177;24;177;177	ENSP00000448047:A177T;ENSP00000261400:A177T;ENSP00000446744:A24T;ENSP00000331933:A177T;ENSP00000447272:A177T	ENSP00000261400:A177T	A	+	1	0	WSCD2	107128059	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.024000	0.93689	2.436000	0.82500	0.555000	0.69702	GCC		0.662	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
PABPC3	5042	broad.mit.edu	37	13	25670864	25670864	+	Silent	SNP	T	T	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:25670864T>C	ENST00000281589.3	+	1	565	c.528T>C	c.(526-528)cgT>cgC	p.R176R		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	176					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.R176R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTAAGTCTCGTAAAGAACGAG	0.403																																					p.R176R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T528C	13						.						104.0	98.0	100.0					13																	25670864		2203	4300	6503	24568864	SO:0001819	synonymous_variant	5042	exon1			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.528T>C	13.37:g.25670864T>C			24568864	NM_030979	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																				0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
POSTN	10631	broad.mit.edu	37	13	38154705	38154705	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:38154705G>A	ENST00000379747.4	-	11	1639	c.1522C>T	c.(1522-1524)Cgc>Tgc	p.R508C	POSTN_ENST00000541481.1_Missense_Mutation_p.R508C|POSTN_ENST00000541179.1_Missense_Mutation_p.R508C|POSTN_ENST00000379742.4_Missense_Mutation_p.R508C|POSTN_ENST00000379743.4_Missense_Mutation_p.R508C|POSTN_ENST00000379749.4_Missense_Mutation_p.R508C	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	508	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.R508C(3)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TACCTAAAGCGCTTATCTTGT	0.438																																					p.R508C												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C1522T	13						.						279.0	267.0	271.0					13																	38154705		2203	4300	6503	37052705	SO:0001583	missense	10631	exon11			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1522C>T	13.37:g.38154705G>A	ENSP00000369071:p.Arg508Cys		37052705	NM_001135934	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047403	0.75846	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95	5.02	5.02	0.67125	FAS1 domain (4);	0.290945	0.39475	N	0.001349	D	0.95758	0.8620	M	0.70275	2.135	0.54753	D	0.999982	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.993;0.999;0.996;0.975;0.993	D	0.95922	0.8931	10	0.62326	D	0.03	-9.2511	18.6988	0.91613	0.0:0.0:1.0:0.0	.	508;508;508;508;508;508;508	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	C	508	ENSP00000437959:R508C;ENSP00000369073:R508C;ENSP00000369071:R508C;ENSP00000369067:R508C;ENSP00000369066:R508C;ENSP00000437953:R508C	ENSP00000369066:R508C	R	-	1	0	POSTN	37052705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.653000	0.61462	2.472000	0.83506	0.557000	0.71058	CGC		0.438	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
ZC3H13	23091	broad.mit.edu	37	13	46559498	46559498	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:46559498G>A	ENST00000242848.4	-	10	2002	c.1654C>T	c.(1654-1656)Cga>Tga	p.R552*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R552*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	552	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R552*(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ATTTCACTTCGAGACTCATTT	0.428																																					p.R552X	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1654T	13						.						98.0	99.0	99.0					13																	46559498		2203	4300	6503	45457499	SO:0001587	stop_gained	23091	exon10			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1654C>T	13.37:g.46559498G>A	ENSP00000242848:p.Arg552*		45457499	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	G	41	9.106610	0.99068	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	.	.	.	5.73	5.73	0.89815	.	0.000000	0.49916	D	0.000136	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1522	0.65392	0.0:0.0:0.7528:0.2472	.	.	.	.	X	552;552;368	.	ENSP00000242848:R552X	R	-	1	2	ZC3H13	45457499	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.487000	0.53222	2.861000	0.98227	0.655000	0.94253	CGA		0.428	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
PCDH20	64881	broad.mit.edu	37	13	61987587	61987587	+	Silent	SNP	C	C	T	rs201107730		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:61987587C>T	ENST00000409186.1	-	5	2750	c.645G>A	c.(643-645)tcG>tcA	p.S215S	PCDH20_ENST00000409204.4_Silent_p.S215S			Q8N6Y1	PCD20_HUMAN	protocadherin 20	215	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.S188S(1)|p.S215S(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GGACCCACACCGAGATCTGGG	0.527																																					p.S215S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G645A	13						.						110.0	99.0	102.0					13																	61987587		2203	4300	6503	60885588	SO:0001819	synonymous_variant	64881	exon2			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.645G>A	13.37:g.61987587C>T			60885588	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	CCDS9442.2																																																																																				0.527	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
PCDH9	5101	broad.mit.edu	37	13	67801516	67801516	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:67801516C>T	ENST00000377865.2	-	1	1191	c.1057G>A	c.(1057-1059)Gat>Aat	p.D353N	PCDH9_ENST00000377861.3_Missense_Mutation_p.D353N|PCDH9_ENST00000544246.1_Missense_Mutation_p.D353N|PCDH9_ENST00000456367.1_Missense_Mutation_p.D353N|PCDH9_ENST00000328454.5_Missense_Mutation_p.D353N			Q9HC56	PCDH9_HUMAN	protocadherin 9	353	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D353N(2)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GGAGGGTTATCATTTACATCG	0.448																																					p.D353N												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1057A	13						.						151.0	148.0	149.0					13																	67801516		2203	4300	6503	66699517	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1057G>A	13.37:g.67801516C>T	ENSP00000367096:p.Asp353Asn		66699517	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965616	0.74131	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	6.17	6.17	0.99709	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79125	0.4393	M	0.93462	3.42	0.80722	D	1	D;D;D;D	0.89917	0.991;1.0;1.0;1.0	P;D;D;D	0.91635	0.874;0.999;0.999;0.999	T	0.82744	-0.0306	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	353;353;353;353	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	353	ENSP00000442186:D353N;ENSP00000367096:D353N;ENSP00000401699:D353N;ENSP00000332060:D353N;ENSP00000367092:D353N	ENSP00000332060:D353N	D	-	1	0	PCDH9	66699517	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAT		0.448	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
ITGBL1	9358	broad.mit.edu	37	13	102106446	102106446	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr13:102106446G>A	ENST00000376180.3	+	2	530	c.311G>A	c.(310-312)tGt>tAt	p.C104Y	ITGBL1_ENST00000545560.2_Intron	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	104	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)		p.C104Y(1)		breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGGAGCACCTGTGCAGGTAAG	0.627																																					p.C104Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G311A	13						.						28.0	29.0	29.0					13																	102106446		2200	4298	6498	100904447	SO:0001583	missense	9358	exon2			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.311G>A	13.37:g.102106446G>A	ENSP00000365351:p.Cys104Tyr		100904447	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	CCDS9499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.935048|4.935048	0.92458|0.92458	.|.	.|.	ENSG00000198542|ENSG00000198542	ENST00000376180|ENST00000537118	D|.	0.99724|.	-6.54|.	5.8|5.8	5.8|5.8	0.92144|0.92144	EGF, extracellular (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90225|0.90225	0.6944|0.6944	H|H	0.97291|0.97291	3.975|3.975	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	D|D	0.90724|0.90724	0.4637|0.4637	10|6	0.87932|0.33940	D|T	0|0.23	.|.	20.1338|20.1338	0.98010|0.98010	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	104|.	O95965|.	ITGBL_HUMAN|.	Y|M	104|13	ENSP00000365351:C104Y|.	ENSP00000365351:C104Y|ENSP00000444152:V13M	C|V	+|+	2|1	0|0	ITGBL1|ITGBL1	100904447|100904447	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.994000|0.994000	0.84299|0.84299	9.078000|9.078000	0.94023|0.94023	2.754000|2.754000	0.94517|0.94517	0.650000|0.650000	0.86243|0.86243	TGT|GTG		0.627	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
DLGAP5	9787	broad.mit.edu	37	14	55637436	55637436	+	Silent	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr14:55637436C>T	ENST00000247191.2	-	11	1587	c.1371G>A	c.(1369-1371)ttG>ttA	p.L457L	DLGAP5_ENST00000395425.2_Silent_p.L457L	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	457					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)	p.L457L(1)		biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CTGGAATGTCCAATTCAAGTT	0.333																																					p.L457L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1371A	14						.						172.0	144.0	153.0					14																	55637436		2203	4300	6503	54707189	SO:0001819	synonymous_variant	9787	exon11			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1371G>A	14.37:g.55637436C>T			54707189	NM_001146015	A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	ENST00000247191.2	37	CCDS9723.1																																																																																				0.333	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
KCNH5	27133	broad.mit.edu	37	14	63453879	63453879	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr14:63453879G>A	ENST00000322893.7	-	5	728	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	KCNH5_ENST00000420622.2_Missense_Mutation_p.R154W|KCNH5_ENST00000394968.1_Missense_Mutation_p.R96W|KCNH5_ENST00000394964.2_Missense_Mutation_p.R96W	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	154					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R154W(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GTCAAAGCCCGTGTCAATCGG	0.383																																					p.R96W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286T	14						.						110.0	104.0	106.0					14																	63453879		2203	4299	6502	62523632	SO:0001583	missense	27133	exon5			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.460C>T	14.37:g.63453879G>A	ENSP00000321427:p.Arg154Trp		62523632	NM_172376	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608974	0.66558	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.99089	-5.41;-5.21;-5.2;-5.2	5.71	2.84	0.33178	.	0.000000	0.85682	D	0.000000	D	0.99064	0.9679	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;0.998;1.0	P;P;P;D	0.71184	0.832;0.873;0.873;0.972	D	0.99157	1.0860	10	0.87932	D	0	.	15.0379	0.71764	0.0:0.0:0.6289:0.3711	.	96;96;154;154	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	W	154;154;96;96	ENSP00000321427:R154W;ENSP00000395439:R154W;ENSP00000378419:R96W;ENSP00000378415:R96W	ENSP00000321427:R154W	R	-	1	2	KCNH5	62523632	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	4.763000	0.62257	0.325000	0.23359	-1.364000	0.01208	CGG		0.383	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
CHGA	1113	broad.mit.edu	37	14	93397954	93397954	+	Missense_Mutation	SNP	G	G	C	rs144251489	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr14:93397954G>C	ENST00000216492.5	+	6	995	c.715G>C	c.(715-717)Gct>Cct	p.A239P	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Intron	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	239					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)		p.A239P(1)		cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		ggaggCTGAGGCTGGAGAGGA	0.617																																					p.A239P	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G715C	14						.						42.0	49.0	46.0					14																	93397954		2203	4300	6503	92467707	SO:0001583	missense	1113	exon6				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.715G>C	14.37:g.93397954G>C	ENSP00000216492:p.Ala239Pro		92467707	NM_001275	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077938	0.36662	.	.	ENSG00000100604	ENST00000216492	T	0.01647	4.71	4.61	3.72	0.42706	.	0.553966	0.18995	N	0.125501	T	0.04815	0.0130	L	0.39633	1.23	0.46749	D	0.999182	D	0.69078	0.997	P	0.62740	0.906	T	0.52764	-0.8532	10	0.44086	T	0.13	-4.1162	10.1727	0.42920	0.096:0.0:0.904:0.0	.	239	P10645	CMGA_HUMAN	P	239	ENSP00000216492:A239P	ENSP00000216492:A239P	A	+	1	0	CHGA	92467707	0.033000	0.19621	0.718000	0.30602	0.075000	0.17131	1.775000	0.38584	1.067000	0.40740	0.455000	0.32223	GCT		0.617	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412411.1	NM_001275	
EXD1	161829	broad.mit.edu	37	15	41476460	41476460	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr15:41476460T>A	ENST00000314992.5	-	10	1404	c.1214A>T	c.(1213-1215)gAg>gTg	p.E405V	EXD1_ENST00000458580.2_Missense_Mutation_p.E463V	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	405							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.E405V(1)		large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						ACTGGAATCCTCACTGGTTTC	0.413																																					p.E405V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1214T	15						.						163.0	165.0	164.0					15																	41476460		2203	4300	6503	39263752	SO:0001583	missense	161829	exon10			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1214A>T	15.37:g.41476460T>A	ENSP00000321029:p.Glu405Val		39263752	NM_152596	A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	ENST00000314992.5	37	CCDS10072.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742013	0.49151	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.51325	0.71;0.73	5.26	4.1	0.47936	.	0.675914	0.14684	N	0.304600	T	0.51363	0.1670	M	0.63428	1.95	0.09310	N	1	P;P;D	0.53151	0.838;0.838;0.958	B;B;P	0.51229	0.296;0.216;0.663	T	0.48151	-0.9060	10	0.72032	D	0.01	-10.4533	5.4593	0.16607	0.0:0.0878:0.1777:0.7346	.	463;405;203	B7Z839;Q8NHP7;Q8NHP7-2	.;EXD1_HUMAN;.	V	405;463	ENSP00000321029:E405V;ENSP00000415056:E463V	ENSP00000321029:E405V	E	-	2	0	EXD1	39263752	0.009000	0.17119	0.002000	0.10522	0.404000	0.30871	1.445000	0.35079	1.081000	0.41110	0.533000	0.62120	GAG		0.413	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596	
RPL4	6124	broad.mit.edu	37	15	66795082	66795082	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr15:66795082G>A	ENST00000307961.6	-	4	381	c.289C>T	c.(289-291)Cgt>Tgt	p.R97C	ZWILCH_ENST00000446801.2_5'Flank|ZWILCH_ENST00000307897.5_5'Flank|ZWILCH_ENST00000565627.1_5'Flank|RPL4_ENST00000564517.1_5'Flank|RPL4_ENST00000568588.1_Missense_Mutation_p.R3C|ZWILCH_ENST00000535141.2_5'Flank|SNORD16_ENST00000362803.1_RNA|SNORD18A_ENST00000363753.1_RNA|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	97					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R97C(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						CGGCCTCCACGACACATCTAT	0.433																																					p.R97C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C289T	15						.						104.0	97.0	100.0					15																	66795082		2201	4299	6500	64582136	SO:0001583	missense	6124	exon4			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.289C>T	15.37:g.66795082G>A	ENSP00000311430:p.Arg97Cys		64582136	NM_000968	A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	ENST00000307961.6	37	CCDS10218.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203041	0.79127	.	.	ENSG00000174444	ENST00000307961;ENST00000449253;ENST00000432669	.	.	.	4.39	3.46	0.39613	Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	D	0.82582	0.5068	H	0.98218	4.175	0.80722	D	1	B;P	0.40083	0.384;0.702	B;P	0.45946	0.294;0.498	D	0.88014	0.2764	9	0.87932	D	0	-3.1136	13.9716	0.64245	0.0:0.0:0.8472:0.1528	.	97;97	B4DFI6;P36578	.;RL4_HUMAN	C	97	.	ENSP00000311430:R97C	R	-	1	0	RPL4	64582136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.222000	0.72249	1.174000	0.42811	0.655000	0.94253	CGT		0.433	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968	
PEX11A	8800	broad.mit.edu	37	15	90227069	90227069	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr15:90227069T>A	ENST00000300056.3	-	3	432	c.283A>T	c.(283-285)Att>Ttt	p.I95F	PEX11A_ENST00000561257.1_Missense_Mutation_p.I64F|PEX11A_ENST00000559170.1_3'UTR|PEX11A_ENST00000557982.1_Intron|PEX11A_ENST00000561224.1_Intron	NM_001271573.1	NP_001258502.1	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha	95					brown fat cell differentiation (GO:0050873)|cellular lipid metabolic process (GO:0044255)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)	p.I95F(1)		endometrium(2)|large_intestine(2)|lung(3)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ATGAAATAAATCACACGGTTC	0.493																																					p.I95F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A283T	15						.						105.0	103.0	103.0					15																	90227069		2200	4299	6499	88028073	SO:0001583	missense	8800	exon3			AF093668	CCDS10354.1, CCDS61751.1	15q	2008-08-26	2008-08-26		ENSG00000166821	ENSG00000166821			8852	protein-coding gene	gene with protein product		603866	"""peroxisomal biogenesis factor 11A"""			9792670	Standard	NM_003847		Approved	PEX11-ALPHA, MGC119947, MGC138534	uc002boi.4	O75192	OTTHUMG00000149809	ENST00000300056.3:c.283A>T	15.37:g.90227069T>A	ENSP00000300056:p.Ile95Phe		88028073	NM_003847	B4DV88	Missense_Mutation	SNP	ENST00000300056.3	37	CCDS10354.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690435	0.48097	.	.	ENSG00000166821	ENST00000300056	T	0.42900	0.96	5.75	-1.41	0.08941	.	0.448355	0.25099	N	0.033142	T	0.30166	0.0756	L	0.48362	1.52	0.80722	D	1	B	0.13145	0.007	B	0.12837	0.008	T	0.03945	-1.0990	10	0.37606	T	0.19	-0.0148	8.0549	0.30600	0.0:0.4394:0.3516:0.209	.	95	O75192	PX11A_HUMAN	F	95	ENSP00000300056:I95F	ENSP00000300056:I95F	I	-	1	0	PEX11A	88028073	0.680000	0.27605	0.988000	0.46212	0.842000	0.47809	-0.228000	0.09114	-0.484000	0.06763	0.533000	0.62120	ATT		0.493	PEX11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313420.1	NM_003847	
RAB40C	57799	broad.mit.edu	37	16	677579	677580	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr16:677579_677580insC	ENST00000248139.3	+	6	1006_1007	c.803_804insC	c.(802-807)agccccfs	p.SP268fs	RAB40C_ENST00000539661.1_Frame_Shift_Ins_p.SP268fs|RAB40C_ENST00000538492.1_Frame_Shift_Ins_p.SP268fs|RAB40C_ENST00000535977.1_Frame_Shift_Ins_p.SP268fs	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	268					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)	p.Q271fs*7(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				CCACCCCAGAGCCCCCCCCAGA	0.678																																					p.S268fs	Melanoma(123;1631 1690 28262 44104 44957)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.803_804insC	16						.																																			617581	SO:0001589	frameshift_variant	57799	exon7			Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.811dupC	16.37:g.677587_677587dupC	ENSP00000248139:p.Ser268fs		617580	NM_001172664	A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Frame_Shift_Ins	INS	ENST00000248139.3	37	CCDS10413.1																																																																																				0.678	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109079.4	NM_021168	
COX6A2	1339	broad.mit.edu	37	16	31439130	31439130	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr16:31439130C>T	ENST00000287490.4	-	3	361	c.259G>A	c.(259-261)Gtg>Atg	p.V87M		NM_005205.3	NP_005196.1	Q02221	CX6A2_HUMAN	cytochrome c oxidase subunit VIa polypeptide 2	87					generation of precursor metabolites and energy (GO:0006091)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)	p.V87M(2)		endometrium(2)|large_intestine(2)|lung(1)	5						AGAGGGTTCACGTGGCTATTG	0.667																																					p.V87M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G259A	16						.						51.0	51.0	51.0					16																	31439130		2197	4300	6497	31346631	SO:0001583	missense	1339	exon3			U66875, M83308	CCDS10712.1	16p11.12	2011-07-04			ENSG00000156885	ENSG00000156885	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2279	protein-coding gene	gene with protein product		602009				1327966, 9177785	Standard	NM_005205		Approved		uc002ebx.2	Q02221	OTTHUMG00000132463	ENST00000287490.4:c.259G>A	16.37:g.31439130C>T	ENSP00000287490:p.Val87Met		31346631	NM_005205	O00761|Q6GTW6	Missense_Mutation	SNP	ENST00000287490.4	37	CCDS10712.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289861	0.40494	.	.	ENSG00000156885	ENST00000287490	.	.	.	4.63	0.025	0.14143	.	0.584025	0.17389	N	0.175983	T	0.28599	0.0708	.	.	.	0.28551	N	0.911639	B	0.24092	0.097	B	0.22601	0.04	T	0.17107	-1.0380	8	0.54805	T	0.06	-19.5655	6.8975	0.24265	0.4673:0.4471:0.0:0.0856	.	87	Q02221	CX6A2_HUMAN	M	87	.	ENSP00000287490:V87M	V	-	1	0	COX6A2	31346631	0.054000	0.20591	0.045000	0.18777	0.081000	0.17604	0.383000	0.20651	-0.041000	0.13558	0.313000	0.20887	GTG		0.667	COX6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255626.2	NM_005205	
SALL1	6299	broad.mit.edu	37	16	51175457	51175457	+	Missense_Mutation	SNP	C	C	T	rs149603480		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr16:51175457C>T	ENST00000251020.4	-	2	709	c.676G>A	c.(676-678)Gtc>Atc	p.V226I	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.V129I	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	226					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V226I(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGGGCTGGGACGGCCAGCTTG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		15826	0.001		0.0	False		,,,				2504	0.0				p.V226I	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G676A	16						.	C	ILE/VAL,ILE/VAL	0,4396		0,0,2198	70.0	75.0	73.0		385,676	0.6	0.7	16	dbSNP_134	73	5,8595	4.3+/-15.6	0,5,4295	no	missense,missense	SALL1	NM_001127892.1,NM_002968.2	29,29	0,5,6493	TT,TC,CC		0.0581,0.0,0.0385	benign,benign	129/1228,226/1325	51175457	5,12991	2198	4300	6498	49732958	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.676G>A	16.37:g.51175457C>T	ENSP00000251020:p.Val226Ile		49732958	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	0.183	-1.060377	0.01950	0.0	5.81E-4	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.03689	3.84;3.96	5.37	0.636	0.17729	.	0.164918	0.53938	N	0.000059	T	0.01387	0.0045	N	0.02916	-0.46	0.43137	D	0.994888	B	0.13594	0.008	B	0.04013	0.001	T	0.50083	-0.8869	10	0.02654	T	1	.	10.7066	0.45958	0.0:0.6902:0.0:0.3098	.	226	Q9NSC2	SALL1_HUMAN	I	226;129;190	ENSP00000251020:V226I;ENSP00000407914:V129I	ENSP00000251020:V226I	V	-	1	0	SALL1	49732958	0.994000	0.37717	0.692000	0.30179	0.505000	0.33919	2.525000	0.45598	0.235000	0.21160	0.561000	0.74099	GTC		0.592	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
TLDC1	57707	broad.mit.edu	37	16	84531659	84531659	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr16:84531659A>G	ENST00000343629.6	-	2	216	c.34T>C	c.(34-36)Ttt>Ctt	p.F12L	TLDC1_ENST00000561807.1_5'UTR|RP11-517C16.4_ENST00000568771.1_RNA|TLDC1_ENST00000535580.1_5'UTR	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	12						lysosomal membrane (GO:0005765)		p.F12L(1)									TGTGAACAAAAGCTCCGCCCC	0.423																																					p.F12L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T34C	16						.						165.0	169.0	168.0					16																	84531659		2199	4300	6499	83089160	SO:0001583	missense	57707	exon2			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.34T>C	16.37:g.84531659A>G	ENSP00000343635:p.Phe12Leu		83089160	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	A	7.949	0.744509	0.15710	.	.	ENSG00000140950	ENST00000343629	T	0.06933	3.24	5.13	-9.24	0.00669	.	1.678800	0.02833	N	0.126972	T	0.04048	0.0113	N	0.22421	0.69	0.19300	N	0.99998	B	0.02656	0.0	B	0.01281	0.0	T	0.35822	-0.9773	10	0.13108	T	0.6	0.9707	3.8969	0.09143	0.2113:0.4111:0.2794:0.0982	.	12	Q6P9B6	K1609_HUMAN	L	12	ENSP00000343635:F12L	ENSP00000343635:F12L	F	-	1	0	KIAA1609	83089160	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.491000	0.06474	-1.467000	0.01895	-0.361000	0.07541	TTT		0.423	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
GALNS	2588	broad.mit.edu	37	16	88901661	88901661	+	Silent	SNP	C	C	T	rs140299014		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr16:88901661C>T	ENST00000268695.5	-	8	946	c.858G>A	c.(856-858)acG>acA	p.T286T	GALNS_ENST00000542788.1_Silent_p.T211T	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	286	Catalytic domain.		Missing (in MPS4A; mild form).		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)	p.T286T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		CGTTGTCCGACGTGAAGAAGA	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17234	0.0		0.001	False		,,,				2504	0.0				p.T286T	GBM(129;1929 2344 25209 33204)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G858A	16						.	C		2,4392	6.2+/-15.9	0,2,2195	132.0	95.0	108.0		858	-10.3	0.0	16	dbSNP_134	108	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous	GALNS	NM_000512.4		0,12,6485	TT,TC,CC		0.1163,0.0455,0.0924		286/523	88901661	12,12982	2197	4300	6497	87429162	SO:0001819	synonymous_variant	2588	exon8			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.858G>A	16.37:g.88901661C>T			87429162	NM_000512	Q86VK3	Silent	SNP	ENST00000268695.5	37	CCDS10970.1																																																																																				0.592	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
SLC52A1	55065	broad.mit.edu	37	17	4936629	4936630	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:4936629_4936630insC	ENST00000424747.1	-	4	1772_1773	c.1060_1061insG	c.(1060-1062)gccfs	p.A354fs	SLC52A1_ENST00000254853.5_Frame_Shift_Ins_p.A354fs|SLC52A1_ENST00000512825.2_Intron	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	354					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)	p.A354fs*>96(1)									CATCAGGTAGGCCCCAAAGAGC	0.629																																					p.A354fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1061_1062insG	17						.																																			4877354	SO:0001589	frameshift_variant	55065	exon4			AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.1061dupG	17.37:g.4936633_4936633dupC	ENSP00000399979:p.Ala354fs		4877353	NM_001104577	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Frame_Shift_Ins	INS	ENST00000424747.1	37	CCDS11066.1																																																																																				0.629	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
BAIAP2	10458	broad.mit.edu	37	17	79089622	79089623	+	Intron	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:79089622_79089623insC	ENST00000321300.6	+	14	1676				BAIAP2_ENST00000392411.3_Frame_Shift_Ins_p.A452fs|BAIAP2_ENST00000435091.3_3'UTR|BAIAP2_ENST00000428708.2_Frame_Shift_Ins_p.A530fs|BAIAP2_ENST00000575245.1_3'UTR	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2						actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CGACAGGTCTGCCCCCCTCCTC	0.559																																					p.A530fs												.	.	0			c.1588_1589insC	17						.																																			76704218	SO:0001627	intron_variant	10458	exon14			AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1583+5->C	17.37:g.79089628_79089628dupC			76704217	NM_001144888	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Frame_Shift_Ins	INS	ENST00000321300.6	37	CCDS11775.1																																																																																				0.559	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		
NF1	4763	broad.mit.edu	37	17	29562747	29562747	+	Missense_Mutation	SNP	G	G	A	rs137854556		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:29562747G>A	ENST00000358273.4	+	28	4210	c.3827G>A	c.(3826-3828)cGa>cAa	p.R1276Q	NF1_ENST00000356175.3_Missense_Mutation_p.R1276Q	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1276	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		R -> G (in NF1; dbSNP:rs199474742). {ECO:0000269|PubMed:15060124}.|R -> P (in NF1; complete loss of GAP activity; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:9668168}.|R -> Q (in NF1 and mismatch repair deficient cancer cells; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:12522551, ECO:0000269|PubMed:15060124}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.R1276Q(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACTCTCTTCCGAGGCAACAGC	0.398			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.R1276Q		yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	NF1,large_intestine,colon,Substitution - Missense,0 	.	14	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(2)	soft_tissue(7)|large_intestine(2)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.G3827A	17	GRCh37	CM000802|CM983421	NF1	M	rs137854556	.						165.0	161.0	163.0					17																	29562747		2203	4300	6503	26586873	SO:0001583	missense	4763	exon28	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3827G>A	17.37:g.29562747G>A	ENSP00000351015:p.Arg1276Gln		26586873	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	36	5.774352	0.96922	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.93133	-3.17;-3.17;-3.17	6.16	6.16	0.99307	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.98321	0.9443	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.997;1.0	D;D;D;D	0.97110	1.0;1.0;0.964;1.0	D	0.98581	1.0650	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1276;326;1276;1276	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	Q	1276;1276;942	ENSP00000351015:R1276Q;ENSP00000348498:R1276Q;ENSP00000389907:R942Q	ENSP00000348498:R1276Q	R	+	2	0	NF1	26586873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.212000	0.95126	2.937000	0.99478	0.650000	0.86243	CGA		0.398	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ITGAE	3682	broad.mit.edu	37	17	3654968	3654968	+	Silent	SNP	G	G	A	rs577050526		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:3654968G>A	ENST00000263087.4	-	15	1967	c.1869C>T	c.(1867-1869)gaC>gaT	p.D623D		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	623					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.D623D(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CGGAGAGGCCGTCCCAGTGTC	0.597																																					p.D623D	NSCLC(182;635 2928 8995 38788)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1869T	17						.						63.0	70.0	67.0					17																	3654968		2203	4300	6503	3601717	SO:0001819	synonymous_variant	3682	exon15			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1869C>T	17.37:g.3654968G>A			3601717	NM_002208	Q17RS6|Q9NZU9	Silent	SNP	ENST00000263087.4	37	CCDS32531.1																																																																																				0.597	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
SLFN13	146857	broad.mit.edu	37	17	33768306	33768306	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:33768306C>T	ENST00000285013.6	-	6	2277	c.2002G>A	c.(2002-2004)Gac>Aac	p.D668N	SLFN13_ENST00000534689.1_Missense_Mutation_p.D350N|SLFN13_ENST00000526861.1_Missense_Mutation_p.D668N|SLFN13_ENST00000533791.1_Missense_Mutation_p.D668N|SLFN13_ENST00000542635.1_Missense_Mutation_p.D668N|SLFN13_ENST00000360502.2_Missense_Mutation_p.D350N	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	668						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.D668N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGAGCTTCGTCAATGACGATG	0.403																																					p.D668N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2002A	17						.						108.0	117.0	114.0					17																	33768306		2203	4300	6503	30792419	SO:0001583	missense	146857	exon6			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2002G>A	17.37:g.33768306C>T	ENSP00000285013:p.Asp668Asn		30792419	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	c	14.45	2.539623	0.45176	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	3.29	3.29	0.37713	Domain of unknown function DUF2075 (1);	0.000000	0.50627	D	0.000115	D	0.88912	0.6566	M	0.85859	2.78	0.22771	N	0.998752	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.994	T	0.79928	-0.1596	10	0.87932	D	0	.	10.189	0.43015	0.0:1.0:0.0:0.0	.	350;668	Q68D06-2;Q68D06	.;SLN13_HUMAN	N	668;350;668;668;350	ENSP00000285013:D668N;ENSP00000353692:D350N;ENSP00000434439:D668N;ENSP00000444016:D668N;ENSP00000435442:D350N	ENSP00000285013:D668N	D	-	1	0	SLFN13	30792419	0.999000	0.42202	0.290000	0.24890	0.135000	0.20990	4.761000	0.62243	1.828000	0.53243	0.205000	0.17691	GAC		0.403	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
KRT27	342574	broad.mit.edu	37	17	38936090	38936090	+	Silent	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:38936090C>T	ENST00000301656.3	-	4	748	c.708G>A	c.(706-708)gcG>gcA	p.A236A	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27									p.A236A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TGCCTCCAGCCGCGCACTGAA	0.488																																					p.A236A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G708A	17						.						48.0	51.0	50.0					17																	38936090		2203	4300	6503	36189616	SO:0001819	synonymous_variant	342574	exon4			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.708G>A	17.37:g.38936090C>T			36189616	NM_181537		Silent	SNP	ENST00000301656.3	37	CCDS11375.1																																																																																				0.488	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
SOST	50964	broad.mit.edu	37	17	41835989	41835989	+	Missense_Mutation	SNP	C	C	T	rs574411567		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:41835989C>T	ENST00000301691.2	-	1	167	c.121G>A	c.(121-123)Gga>Aga	p.G41R		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	41					cellular response to parathyroid hormone stimulus (GO:0071374)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|response to mechanical stimulus (GO:0009612)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|transcription factor binding (GO:0008134)	p.G41R(1)		large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		GGGTACTCTCCGAGCTCGGGG	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16226	0.0		0.0	False		,,,				2504	0.0				p.G41R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121A	17						.						75.0	70.0	72.0					17																	41835989		2203	4300	6503	39191515	SO:0001583	missense	50964	exon1			AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941			13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""			11179006, 11181578	Standard	NM_025237		Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.121G>A	17.37:g.41835989C>T	ENSP00000301691:p.Gly41Arg		39191515	NM_025237	Q495N9	Missense_Mutation	SNP	ENST00000301691.2	37	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	C	7.042	0.562659	0.13498	.	.	ENSG00000167941	ENST00000301691	T	0.77750	-1.12	4.36	-0.418	0.12344	.	1.052620	0.07469	N	0.901862	T	0.49081	0.1536	N	0.02802	-0.49	0.19300	N	0.999978	B	0.18741	0.03	B	0.14023	0.01	T	0.37957	-0.9683	10	0.48119	T	0.1	-22.2395	0.5686	0.00691	0.1756:0.2858:0.1725:0.3661	.	41	Q9BQB4	SOST_HUMAN	R	41	ENSP00000301691:G41R	ENSP00000301691:G41R	G	-	1	0	SOST	39191515	0.002000	0.14202	0.319000	0.25293	0.922000	0.55478	0.050000	0.14120	0.098000	0.17522	0.555000	0.69702	GGA		0.622	SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1	NM_025237	
RNF43	54894	broad.mit.edu	37	17	56436150	56436150	+	Silent	SNP	A	A	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:56436150A>T	ENST00000584437.1	-	8	2942	c.987T>A	c.(985-987)tcT>tcA	p.S329S	RNF43_ENST00000581868.1_Silent_p.S202S|RNF43_ENST00000407977.2_Silent_p.S329S|RNF43_ENST00000500597.2_Silent_p.S288S|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577625.1_Silent_p.S202S|RNF43_ENST00000583753.1_Silent_p.S288S|RNF43_ENST00000577716.1_Silent_p.S329S			Q68DV7	RNF43_HUMAN	ring finger protein 43	329					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S329S(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGTAAGATCGAGAGGGTCCCA	0.522																																					p.S329S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T987A	17						.						18.0	18.0	18.0					17																	56436150		2200	4294	6494	53791149	SO:0001819	synonymous_variant	54894	exon9				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.987T>A	17.37:g.56436150A>T			53791149	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Silent	SNP	ENST00000584437.1	37	CCDS11607.1																																																																																				0.522	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
TP53	7157	broad.mit.edu	37	17	7578413	7578413	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:7578413C>T	ENST00000269305.4	-	5	706	c.517G>A	c.(517-519)Gtg>Atg	p.V173M	TP53_ENST00000455263.2_Missense_Mutation_p.V173M|TP53_ENST00000420246.2_Missense_Mutation_p.V173M|TP53_ENST00000445888.2_Missense_Mutation_p.V173M|TP53_ENST00000413465.2_Missense_Mutation_p.V173M|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.V173M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173L(68)|p.V173M(46)|p.0?(8)|p.V80L(6)|p.V41L(6)|p.V173fs*1(4)|p.V80M(3)|p.V41M(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.E171fs*1(1)|p.V173W(1)|p.V173fs*8(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCCTCACAACCTCCGTC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V173M	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,autonomic_ganglia,NS,Substitution - Missense,0 	.	159	Substitution - Missense(133)|Deletion - Frameshift(12)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(1)	upper_aerodigestive_tract(29)|large_intestine(25)|lung(17)|stomach(16)|ovary(14)|breast(11)|oesophagus(9)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|skin(6)|bone(5)|liver(4)|vulva(3)|soft_tissue(2)|kidney(1)|biliary_tract(1)|urinary_tract(1)|pancreas(1)|autonomic_ganglia(1)	c.G517A	17	GRCh37	CM070299	TP53	M		.						51.0	51.0	51.0					17																	7578413		2203	4300	6503	7519138	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.517G>A	17.37:g.7578413C>T	ENSP00000269305:p.Val173Met		7519138	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408040	0.83340	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99860	-7.25;-7.25;-7.25;-7.25;-7.25;-7.25;-7.25;-7.25	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99891	0.9948	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.997;0.999;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.988;0.999;1.0;0.978;0.99;1.0	D	0.96586	0.9434	10	0.87932	D	0	-25.5548	17.4784	0.87667	0.0:1.0:0.0:0.0	.	134;173;173;80;173;173;173	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	173;173;173;173;173;173;162;80;41;80;41	ENSP00000410739:V173M;ENSP00000352610:V173M;ENSP00000269305:V173M;ENSP00000398846:V173M;ENSP00000391127:V173M;ENSP00000391478:V173M;ENSP00000425104:V41M;ENSP00000423862:V80M	ENSP00000269305:V173M	V	-	1	0	TP53	7519138	1.000000	0.71417	0.150000	0.22450	0.458000	0.32498	7.775000	0.85489	2.804000	0.96469	0.655000	0.94253	GTG		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ARSG	22901	broad.mit.edu	37	17	66339917	66339917	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:66339917G>A	ENST00000448504.2	+	3	1187	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	131					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V131I(2)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGCGGGTTACGTCACTGGGAT	0.557																																					p.V131I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G391A	17						.						63.0	44.0	51.0					17																	66339917		2203	4300	6503	63851512	SO:0001583	missense	22901	exon3			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.391G>A	17.37:g.66339917G>A	ENSP00000407193:p.Val131Ile		63851512	NM_014960	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	G	2.144	-0.396218	0.04899	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.56	1.45	0.22620	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase, conserved site (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.712404	0.13869	N	0.357148	T	0.23572	0.0570	N	0.20445	0.575	0.18873	N	0.999982	B	0.02656	0.0	B	0.06405	0.002	T	0.16364	-1.0405	9	0.31617	T	0.26	.	5.4646	0.16635	0.3594:0.1396:0.5009:0.0	.	131	Q96EG1	ARSG_HUMAN	I	131	.	ENSP00000413953:V131I	V	+	1	0	ARSG	63851512	0.182000	0.23173	0.540000	0.28089	0.324000	0.28378	0.170000	0.16663	0.263000	0.21812	-0.813000	0.03139	GTC		0.557	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
RAB40B	10966	broad.mit.edu	37	17	80615938	80615938	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr17:80615938G>A	ENST00000571995.1	-	6	769	c.638C>T	c.(637-639)cCg>cTg	p.P213L	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Missense_Mutation_p.P34L|RAB40B_ENST00000538809.2_3'UTR	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	213	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.P213L(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			AATGGGGAGCGGGAGCTTGTC	0.592																																					p.P213L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C638T	17						.						142.0	125.0	131.0					17																	80615938		2203	4300	6503	78209227	SO:0001583	missense	10966	exon6			U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.638C>T	17.37:g.80615938G>A	ENSP00000461785:p.Pro213Leu		78209227	NM_006822	Q8WVG3	Missense_Mutation	SNP	ENST00000571995.1	37	CCDS11816.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506548	0.64410	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	4.79	4.79	0.61399	SOCS protein, C-terminal (4);	0.000000	0.64402	D	0.000001	T	0.79997	0.4543	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.63793	0.918	D	0.83567	0.0110	9	0.87932	D	0	.	18.3187	0.90230	0.0:0.0:1.0:0.0	.	213	Q12829	RB40B_HUMAN	L	213;247	.	ENSP00000269347:P213L	P	-	2	0	RAB40B	78209227	1.000000	0.71417	0.191000	0.23289	0.019000	0.09904	6.488000	0.73637	2.590000	0.87494	0.563000	0.77884	CCG		0.592	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
LAMA3	3909	broad.mit.edu	37	18	21399891	21399891	+	Missense_Mutation	SNP	G	G	A	rs200367371		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr18:21399891G>A	ENST00000313654.9	+	19	2475	c.2234G>A	c.(2233-2235)cGa>cAa	p.R745Q	LAMA3_ENST00000399516.3_Missense_Mutation_p.R745Q	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	745					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.R745Q(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AGAGACCTTCGATTTGGATTT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		19049	0.0		0.001	False		,,,				2504	0.0				p.R745Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2234A	18						.						139.0	131.0	133.0					18																	21399891		1906	4127	6033	19653889	SO:0001583	missense	3909	exon19			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2234G>A	18.37:g.21399891G>A	ENSP00000324532:p.Arg745Gln		19653889	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	29.8	5.038708	0.93630	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.22743	1.95;1.94	5.47	5.47	0.80525	.	.	.	.	.	T	0.55816	0.1944	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.62737	-0.6791	9	0.59425	D	0.04	.	19.3278	0.94270	0.0:0.0:1.0:0.0	.	745;745	Q6VU67;Q16787	.;LAMA3_HUMAN	Q	745;745;743	ENSP00000324532:R745Q;ENSP00000382432:R745Q	ENSP00000324532:R745Q	R	+	2	0	LAMA3	19653889	1.000000	0.71417	0.972000	0.41901	0.618000	0.37518	9.399000	0.97285	2.579000	0.87056	0.555000	0.69702	CGA		0.443	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
MEX3C	51320	broad.mit.edu	37	18	48703076	48703076	+	5'Flank	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr18:48703076G>A	ENST00000591040.1	-	0	799							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P347L(1)		endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		AGACAGACGAGGAGTAGATGG	0.502																																					p.P542L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1625T	18						.						82.0	80.0	80.0					18																	48703076		2203	4300	6503	46957074	SO:0001631	upstream_gene_variant	51320	exon2			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693		18.37:g.48703076G>A	Exception_encountered		46957074	NM_016626	A1L022|Q9NZE3	Missense_Mutation	SNP	ENST00000591040.1	37		.	.	.	.	.	.	.	.	.	.	G	23.4	4.416741	0.83449	.	.	ENSG00000176624	ENST00000406189	T	0.39997	1.05	5.97	5.97	0.96955	.	0.056271	0.64402	D	0.000001	T	0.58935	0.2157	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57957	-0.7721	10	0.72032	D	0.01	-9.3092	17.3555	0.87334	0.0:0.0:1.0:0.0	.	542	Q5U5Q3	MEX3C_HUMAN	L	542	ENSP00000385610:P542L	ENSP00000385610:P542L	P	-	2	0	MEX3C	46957074	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.823000	0.62694	2.836000	0.97738	0.655000	0.94253	CCT		0.502	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
CRTC1	23373	broad.mit.edu	37	19	18887992	18887993	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-	-	C	-	C	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:18887992_18887993insC	ENST00000321949.8	+	14	1731_1732	c.1705_1706insC	c.(1705-1707)tccfs	p.S569fs	CRTC1_ENST00000594658.1_Frame_Shift_Ins_p.S528fs|CRTC1_ENST00000338797.6_Frame_Shift_Ins_p.S585fs|CRTC1_ENST00000601916.1_Frame_Shift_Ins_p.S327fs	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.S572fs*6(2)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						GACAGGAGAGTCCCCCCCCAGC	0.639																																					p.S569fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.1705_1706insC	19						.																																			18748993	SO:0001589	frameshift_variant	23373	exon14			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1713dupC	19.37:g.18888000_18888000dupC	ENSP00000323332:p.Ser569fs		18748992	NM_015321		Frame_Shift_Ins	INS	ENST00000321949.8	37	CCDS32963.1																																																																																				0.639	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
NDUFA13	51079	broad.mit.edu	37	19	19627085	19627086	+	Frame_Shift_Ins	INS	-	-	G	rs145228508		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:19627085_19627086insG	ENST00000507754.4	+	1	522_523	c.38_39insG	c.(37-42)ccggggfs	p.PG13fs	CTC-260F20.3_ENST00000555938.1_Frame_Shift_Ins_p.PG13fs|TSSK6_ENST00000585580.3_5'Flank|NDUFA13_ENST00000503283.1_Frame_Shift_Ins_p.PG13fs|YJEFN3_ENST00000608404.1_Frame_Shift_Ins_p.PG13fs|TSSK6_ENST00000360913.3_5'Flank|CTC-260F20.3_ENST00000586674.1_3'UTR|NDUFA13_ENST00000428459.2_Frame_Shift_Ins_p.PG13fs|NDUFA13_ENST00000512771.3_Frame_Shift_Ins_p.PG13fs|NDUFA13_ENST00000252576.5_Frame_Shift_Ins_p.PG96fs			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	13					apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)	p.Y99fs*41(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						ATGCCTCCGCCGGGGGGCTATG	0.629																																					p.P13fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.38_39insG	19						.																																			19488086	SO:0001589	frameshift_variant	51079	exon1			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.44dupG	19.37:g.19627091_19627091dupG	ENSP00000423673:p.Pro13fs		19488085	NM_015965	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Frame_Shift_Ins	INS	ENST00000507754.4	37	CCDS12404.2																																																																																				0.629	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965	
DMWD	1762	broad.mit.edu	37	19	46295646	46295647	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:46295646_46295647insC	ENST00000270223.6	-	1	413_414	c.368_369insG	c.(367-369)ggafs	p.G123fs	DMWD_ENST00000601370.1_5'UTR|DMWD_ENST00000377735.3_Frame_Shift_Ins_p.G123fs	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	123								p.D124fs*10(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		AGACGCGGTCTCCCCCCGAGCC	0.752																																					p.G123fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.369_370insG	19						.																																			50987487	SO:0001589	frameshift_variant	1762	exon1			L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.369dupG	19.37:g.46295652_46295652dupC	ENSP00000270223:p.Gly123fs		50987486	NM_004943		Frame_Shift_Ins	INS	ENST00000270223.6	37	CCDS33054.1																																																																																				0.752	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
DNMT1	1786	broad.mit.edu	37	19	10265386	10265386	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:10265386C>T	ENST00000340748.4	-	20	1895	c.1660G>A	c.(1660-1662)Gcg>Acg	p.A554T	DNMT1_ENST00000540357.1_Missense_Mutation_p.A554T|DNMT1_ENST00000359526.4_Missense_Mutation_p.A570T			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	554	Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.		A -> V (in ADCADN). {ECO:0000269|PubMed:22328086}.		cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A554P(1)|p.A554T(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	ACAAACTGCGCGTGTCGCAGG	0.557																																					p.A570T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1708A	19						.						52.0	46.0	48.0					19																	10265386		2203	4300	6503	10126386	SO:0001583	missense	1786	exon21			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.1660G>A	19.37:g.10265386C>T	ENSP00000345739:p.Ala554Thr		10126386	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494238	0.85069	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.35605	1.3;1.3;1.31	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.63908	0.2551	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.66204	-0.5982	10	0.87932	D	0	.	18.77	0.91888	0.0:1.0:0.0:0.0	.	554;570;554	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	T	570;554;554;422	ENSP00000352516:A570T;ENSP00000440457:A554T;ENSP00000345739:A554T	ENSP00000345739:A554T	A	-	1	0	DNMT1	10126386	1.000000	0.71417	0.922000	0.36590	0.143000	0.21401	7.617000	0.83032	2.813000	0.96785	0.655000	0.94253	GCG		0.557	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
ZNF569	148266	broad.mit.edu	37	19	37903614	37903614	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:37903614A>C	ENST00000316950.6	-	6	2503	c.1946T>G	c.(1945-1947)cTt>cGt	p.L649R	ZNF569_ENST00000392150.2_Missense_Mutation_p.L490R|ZNF569_ENST00000392149.2_Missense_Mutation_p.L649R	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L649R(1)		breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGAAGGGTAAGAGATGAGAT	0.433																																					p.L649R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1946G	19						.						125.0	126.0	126.0					19																	37903614		2203	4300	6503	42595454	SO:0001583	missense	148266	exon6			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1946T>G	19.37:g.37903614A>C	ENSP00000325018:p.Leu649Arg		42595454	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390379	0.62066	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.53640	0.61;0.61	3.97	3.97	0.46021	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.30437	N	0.009640	T	0.74450	0.3718	M	0.94021	3.485	0.35933	D	0.832689	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85158	0.0990	10	0.87932	D	0	.	12.2421	0.54549	1.0:0.0:0.0:0.0	.	490;649	Q17RR6;Q5MCW4	.;ZN569_HUMAN	R	649;305;490	ENSP00000325018:L649R;ENSP00000375993:L490R	ENSP00000325018:L649R	L	-	2	0	ZNF569	42595454	1.000000	0.71417	0.969000	0.41365	0.982000	0.71751	7.346000	0.79347	1.777000	0.52277	0.460000	0.39030	CTT		0.433	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
FBL	2091	broad.mit.edu	37	19	40331344	40331344	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:40331344C>T	ENST00000221801.3	-	2	207	c.94G>A	c.(94-96)Ggg>Agg	p.G32R	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	32	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G32R(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CCTCGGCCCCCGCCAAAGCCC	0.667																																					p.G32R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94A	19						.						16.0	20.0	19.0					19																	40331344		2179	4263	6442	45023184	SO:0001583	missense	2091	exon2			AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.94G>A	19.37:g.40331344C>T	ENSP00000221801:p.Gly32Arg		45023184	NM_001436	B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	ENST00000221801.3	37	CCDS12545.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825347	0.32237	.	.	ENSG00000105202	ENST00000221801	.	.	.	4.47	4.47	0.54385	.	0.177680	0.48286	N	0.000197	T	0.49779	0.1577	N	0.08118	0	0.52501	D	0.999956	D;D	0.89917	1.0;0.997	D;P	0.64506	0.926;0.47	T	0.59423	-0.7457	9	0.87932	D	0	-7.0653	12.48	0.55836	0.0:1.0:0.0:0.0	.	32;32	B4DLD4;P22087	.;FBRL_HUMAN	R	32	.	ENSP00000221801:G32R	G	-	1	0	FBL	45023184	0.997000	0.39634	0.931000	0.37212	0.695000	0.40330	5.487000	0.66863	2.297000	0.77311	0.561000	0.74099	GGG		0.667	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
SHANK1	50944	broad.mit.edu	37	19	51190051	51190051	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:51190051G>A	ENST00000293441.1	-	19	2426	c.2408C>T	c.(2407-2409)gCg>gTg	p.A803V	SHANK1_ENST00000391813.1_Missense_Mutation_p.A190V|SHANK1_ENST00000391814.1_Missense_Mutation_p.A811V|SHANK1_ENST00000359082.3_Missense_Mutation_p.A794V	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	803					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.A803V(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GGGCACCGGCGCCGGCTGCTG	0.706																																					p.A803V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2408T	19						.						39.0	39.0	39.0					19																	51190051		2203	4300	6503	55881863	SO:0001583	missense	50944	exon19			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2408C>T	19.37:g.51190051G>A	ENSP00000293441:p.Ala803Val		55881863	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274992	0.40194	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	3.43	3.43	0.39272	.	0.804227	0.10460	U	0.672112	T	0.29914	0.0748	N	0.17082	0.46	0.09310	N	1	D;P	0.63880	0.993;0.876	P;B	0.44647	0.456;0.124	T	0.04565	-1.0942	10	0.18276	T	0.48	-2.3594	12.7307	0.57197	0.0:0.0:1.0:0.0	.	803;190	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	V	803;190;794;811	ENSP00000293441:A803V;ENSP00000375689:A190V;ENSP00000351984:A794V;ENSP00000375690:A811V	ENSP00000293441:A803V	A	-	2	0	SHANK1	55881863	0.711000	0.27906	0.063000	0.19743	0.797000	0.45037	6.032000	0.70918	1.919000	0.55581	0.478000	0.44815	GCG		0.706	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
CACNG7	59284	broad.mit.edu	37	19	54416095	54416095	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:54416095T>A	ENST00000391767.1	+	2	222	c.10T>A	c.(10-12)Tgc>Agc	p.C4S	CACNG7_ENST00000222212.2_Missense_Mutation_p.C4S|CACNG7_ENST00000468076.1_Intron|CACNG7_ENST00000391766.1_Missense_Mutation_p.C4S			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	4					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.C4S(1)		NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		GATGAGTCACTGCAGCAGCCG	0.642											OREG0003671	type=REGULATORY REGION|Gene=CACNG7|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.C4S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T10A	19						.						44.0	40.0	41.0					19																	54416095		2203	4300	6503	59107907	SO:0001583	missense	59284	exon1			AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.10T>A	19.37:g.54416095T>A	ENSP00000375647:p.Cys4Ser	1000	59107907	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	37	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.808749	0.90707	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	T;T;D	0.84730	-1.01;-1.01;-1.89	4.3	4.3	0.51218	.	0.099696	0.64402	D	0.000001	D	0.83308	0.5226	L	0.34521	1.04	0.51767	D	0.999934	D	0.53462	0.96	P	0.51945	0.685	D	0.85229	0.1031	10	0.87932	D	0	-36.4574	11.717	0.51659	0.0:0.0:0.0:1.0	.	4	P62955	CCG7_HUMAN	S	4	ENSP00000375647:C4S;ENSP00000222212:C4S;ENSP00000375646:C4S	ENSP00000222212:C4S	C	+	1	0	CACNG7	59107907	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.374000	0.79633	1.952000	0.56665	0.459000	0.35465	TGC		0.642	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
ZNF470	388566	broad.mit.edu	37	19	57089694	57089694	+	Missense_Mutation	SNP	C	C	T	rs143160710		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:57089694C>T	ENST00000330619.8	+	6	2583	c.1897C>T	c.(1897-1899)Cgt>Tgt	p.R633C	ZNF470_ENST00000391709.3_Missense_Mutation_p.R633C|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	633					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R633C(1)		endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		CTTTAGCCATCGTAAATCCCT	0.433																																					p.R633C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1897T	19						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	82.0	80.0	81.0		1897	2.0	1.0	19	dbSNP_134	81	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF470	NM_001001668.3	180	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	633/718	57089694	2,13004	2203	4300	6503	61781506	SO:0001583	missense	388566	exon6			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1897C>T	19.37:g.57089694C>T	ENSP00000333223:p.Arg633Cys		61781506	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	37	CCDS33122.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982169	0.34942	2.27E-4	1.16E-4	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.07800	3.16;3.16	4.24	1.97	0.26223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05090	0.0136	N	0.20483	0.58	0.09310	N	1	B	0.17852	0.024	B	0.06405	0.002	T	0.36915	-0.9728	9	0.37606	T	0.19	.	4.7944	0.13265	0.1714:0.6414:0.0:0.1872	.	633	Q6ECI4	ZN470_HUMAN	C	633	ENSP00000375590:R633C;ENSP00000333223:R633C	ENSP00000333223:R633C	R	+	1	0	ZNF470	61781506	0.000000	0.05858	0.952000	0.39060	0.961000	0.63080	-1.010000	0.03656	1.015000	0.39444	0.561000	0.74099	CGT		0.433	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
COL5A3	50509	broad.mit.edu	37	19	10088092	10088092	+	Silent	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:10088092C>T	ENST00000264828.3	-	43	3268	c.3183G>A	c.(3181-3183)ggG>ggA	p.G1061G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1061	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G1061G(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GTCCCAGAGGCCCCAGGGGCC	0.652																																					p.G1061G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3183A	19						.						62.0	77.0	72.0					19																	10088092		2202	4292	6494	9949092	SO:0001819	synonymous_variant	50509	exon43			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3183G>A	19.37:g.10088092C>T			9949092	NM_015719	Q9NZQ6	Silent	SNP	ENST00000264828.3	37	CCDS12222.1																																																																																				0.652	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
AURKC	6795	broad.mit.edu	37	19	57744038	57744038	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr19:57744038G>A	ENST00000302804.7	+	4	611	c.425G>A	c.(424-426)cGc>cAc	p.R142H	AURKC_ENST00000598785.1_Missense_Mutation_p.R108H|AURKC_ENST00000599062.1_Missense_Mutation_p.R139H|AURKC_ENST00000415300.2_Missense_Mutation_p.R123H|AURKC_ENST00000448930.1_Missense_Mutation_p.R108H	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.R142H(1)|p.R108H(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		GATGAACAGCGCACAGCCACG	0.552																																					p.R108H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G323A	19						.						66.0	64.0	65.0					19																	57744038		2203	4300	6503	62435850	SO:0001583	missense	6795	exon4				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.425G>A	19.37:g.57744038G>A	ENSP00000302898:p.Arg142His		62435850	NM_003160	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	G	8.372	0.835437	0.16820	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.65178	-0.14;-0.14;-0.14	3.81	-0.993	0.10228	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.184695	0.47093	N	0.000253	T	0.35189	0.0923	N	0.16862	0.45	0.35232	D	0.77703	B;B;B	0.32693	0.38;0.38;0.329	B;B;B	0.25291	0.059;0.049;0.023	T	0.19031	-1.0318	10	0.72032	D	0.01	-1.1314	4.8159	0.13367	0.3083:0.1585:0.5333:0.0	.	139;142;123	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	H	123;108;142	ENSP00000407162:R123H;ENSP00000406798:R108H;ENSP00000302898:R142H	ENSP00000302898:R142H	R	+	2	0	AURKC	62435850	0.998000	0.40836	0.134000	0.22075	0.004000	0.04260	2.854000	0.48325	-0.063000	0.13065	-0.291000	0.09656	CGC		0.552	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160	
UBE4B	10277	broad.mit.edu	37	1	10132092	10132092	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:10132092C>T	ENST00000253251.8	+	2	870	c.31C>T	c.(31-33)Cgg>Tgg	p.R11W	UBE4B_ENST00000343090.6_Missense_Mutation_p.R11W|UBE4B_ENST00000377157.3_5'UTR|UBE4B_ENST00000377153.1_Missense_Mutation_p.R11W					ubiquitination factor E4B									p.R11W(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTAGATTCGACGGAGGCGCCT	0.522																																					p.R11W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C31T	1						.						70.0	66.0	67.0					1																	10132092		2203	4300	6503	10054679	SO:0001583	missense	10277	exon2			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.31C>T	1.37:g.10132092C>T	ENSP00000253251:p.Arg11Trp		10054679	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606881	0.66558	.	.	ENSG00000130939	ENST00000253251;ENST00000377153;ENST00000343090	T;T	0.60920	0.41;0.15	4.99	4.06	0.47325	.	0.056651	0.64402	D	0.000001	T	0.66127	0.2758	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.988	T	0.69953	-0.5005	10	0.72032	D	0.01	-21.0913	14.9051	0.70711	0.1447:0.8553:0.0:0.0	.	11;11	O95155;O95155-2	UBE4B_HUMAN;.	W	11	ENSP00000253251:R11W;ENSP00000343001:R11W	ENSP00000253251:R11W	R	+	1	2	UBE4B	10054679	0.991000	0.36638	0.992000	0.48379	0.830000	0.47004	2.888000	0.48594	1.203000	0.43233	0.462000	0.41574	CGG		0.522	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
MTOR	2475	broad.mit.edu	37	1	11291410	11291410	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:11291410C>T	ENST00000361445.4	-	17	2672	c.2596G>A	c.(2596-2598)Gag>Aag	p.E866K		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	866					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E866K(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGTAGCACCTCAAGCAAAGTA	0.517																																					p.E866K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2596A	1						.						187.0	177.0	180.0					1																	11291410		2203	4300	6503	11213997	SO:0001583	missense	2475	exon17			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2596G>A	1.37:g.11291410C>T	ENSP00000354558:p.Glu866Lys		11213997	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924886	0.92319	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.65549	-0.16	5.84	5.84	0.93424	Domain of unknown function DUF3385,  target of rapamycin protein (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.053133	0.85682	D	0.000000	T	0.64371	0.2592	M	0.65975	2.015	0.80722	D	1	B	0.26708	0.157	B	0.25614	0.062	T	0.60244	-0.7301	10	0.39692	T	0.17	-25.1178	20.1346	0.98019	0.0:1.0:0.0:0.0	.	866	P42345	MTOR_HUMAN	K	866	ENSP00000354558:E866K	ENSP00000354558:E866K	E	-	1	0	MTOR	11213997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.381000	0.79718	2.765000	0.95021	0.655000	0.94253	GAG		0.517	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
VCAM1	7412	broad.mit.edu	37	1	101188749	101188749	+	Missense_Mutation	SNP	T	T	C	rs201899191		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:101188749T>C	ENST00000294728.2	+	3	615	c.514T>C	c.(514-516)Tcc>Ccc	p.S172P	VCAM1_ENST00000370119.4_Missense_Mutation_p.S110P|VCAM1_ENST00000347652.2_Missense_Mutation_p.S172P|VCAM1_ENST00000370115.1_Missense_Mutation_p.S172P	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	172	Ig-like C2-type 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.S172P(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGACAGGAAGTCCCTGGAAAC	0.413																																					p.S110P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T328C	1						.						108.0	102.0	104.0					1																	101188749		2203	4299	6502	100961337	SO:0001583	missense	7412	exon3			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.514T>C	1.37:g.101188749T>C	ENSP00000294728:p.Ser172Pro		100961337	NM_001199834	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.997534	0.54147	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.63	1.73	0.24493	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.824756	0.11429	N	0.564984	T	0.19765	0.0475	M	0.77103	2.36	0.32043	N	0.597968	D;D;P	0.56287	0.965;0.975;0.887	P;P;P	0.49683	0.619;0.469;0.548	T	0.07809	-1.0753	10	0.30078	T	0.28	-6.8217	7.4852	0.27427	0.1309:0.0:0.2718:0.5974	.	110;172;172	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	P	110;172;172;172	ENSP00000359137:S110P;ENSP00000304611:S172P;ENSP00000294728:S172P;ENSP00000359133:S172P	ENSP00000294728:S172P	S	+	1	0	VCAM1	100961337	0.211000	0.23529	1.000000	0.80357	0.877000	0.50540	0.374000	0.20501	0.474000	0.27392	0.482000	0.46254	TCC		0.413	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
IGSF3	3321	broad.mit.edu	37	1	117159024	117159024	+	Silent	SNP	C	C	T	rs201692914		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:117159024C>T	ENST00000369486.3	-	3	864	c.99G>A	c.(97-99)acG>acA	p.T33T	IGSF3_ENST00000318837.6_Silent_p.T33T|IGSF3_ENST00000369483.1_Silent_p.T33T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	33	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T33T(6)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGGAGCCCTCCGTGCGGTACA	0.547																																					p.T33T												.	.	6	Substitution - coding silent(6)	large_intestine(6)	c.G99A	1						.						18.0	19.0	18.0					1																	117159024		1976	3928	5904	116960547	SO:0001819	synonymous_variant	3321	exon3			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.99G>A	1.37:g.117159024C>T			116960547	NM_001542	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	CCDS30813.1																																																																																				0.547	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
SV2A	9900	broad.mit.edu	37	1	149882420	149882420	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:149882420C>T	ENST00000369146.3	-	4	1403	c.913G>A	c.(913-915)Gtg>Atg	p.V305M	SV2A_ENST00000369145.1_Missense_Mutation_p.V305M	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	305					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.V305M(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GCTGCGTACACGCCACCAATC	0.562																																					p.V305M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	1						.						62.0	59.0	60.0					1																	149882420		2203	4300	6503	148149044	SO:0001583	missense	9900	exon4			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.913G>A	1.37:g.149882420C>T	ENSP00000358142:p.Val305Met		148149044	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	CCDS940.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218380	0.79464	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.74526	-0.85;-0.85	4.99	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.065759	0.64402	D	0.000008	T	0.70919	0.3279	L	0.48935	1.535	0.45634	D	0.998569	D	0.54772	0.968	P	0.58130	0.833	T	0.74475	-0.3653	10	0.59425	D	0.04	-22.4528	9.2356	0.37464	0.0:0.9041:0.0:0.0959	.	305	Q7L0J3	SV2A_HUMAN	M	305	ENSP00000358142:V305M;ENSP00000358141:V305M	ENSP00000358141:V305M	V	-	1	0	SV2A	148149044	1.000000	0.71417	0.808000	0.32385	0.939000	0.58152	4.810000	0.62598	2.591000	0.87537	0.585000	0.79938	GTG		0.562	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
SPEN	23013	broad.mit.edu	37	1	16245478	16245478	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:16245478G>A	ENST00000375759.3	+	7	1657	c.1453G>A	c.(1453-1455)Gat>Aat	p.D485N		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	485	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.D485N(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCAATACTGTGATATTGCTAG	0.338																																					p.D485N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1453A	1						.						117.0	116.0	116.0					1																	16245478		2203	4300	6503	16118065	SO:0001583	missense	23013	exon7				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1453G>A	1.37:g.16245478G>A	ENSP00000364912:p.Asp485Asn		16118065	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	36	5.816948	0.96982	.	.	ENSG00000065526	ENST00000375759	T	0.06608	3.28	5.85	5.85	0.93711	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.19846	0.0477	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02860	-1.1101	9	0.17369	T	0.5	-6.037	20.243	0.98386	0.0:0.0:1.0:0.0	.	485	Q96T58	MINT_HUMAN	N	485	ENSP00000364912:D485N	ENSP00000364912:D485N	D	+	1	0	SPEN	16118065	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.781000	0.99029	2.777000	0.95525	0.552000	0.68991	GAT		0.338	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
PEA15	8682	broad.mit.edu	37	1	160181347	160181347	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:160181347G>A	ENST00000360472.4	+	2	201	c.13G>A	c.(13-15)Ggg>Agg	p.G5R	PEA15_ENST00000368076.1_Missense_Mutation_p.G26R|RP11-536C5.7_ENST00000418602.1_RNA|PEA15_ENST00000368077.1_Missense_Mutation_p.G5R|PEA15_ENST00000488858.1_3'UTR	NM_003768.3	NP_003759.1	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15	5	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|DNA damage checkpoint (GO:0000077)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of glucose import (GO:0046325)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|response to morphine (GO:0043278)|transport (GO:0006810)	cytoplasm (GO:0005737)|microtubule associated complex (GO:0005875)		p.G5R(1)		large_intestine(1)|lung(4)	5	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCTGAGTACGGGACCCTCCT	0.537																																					p.G5R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13A	1						.						111.0	93.0	99.0					1																	160181347		2203	4300	6503	158447971	SO:0001583	missense	8682	exon2			Y13736	CCDS1199.1, CCDS72954.1	1q21.1	2008-07-18			ENSG00000162734	ENSG00000162734			8822	protein-coding gene	gene with protein product	"""Phosphoprotein enriched in astrocytes, 15kD"", ""homolog of mouse MAT-1 oncogene"""	603434				9205133	Standard	XM_005245564		Approved	HMAT1, MAT1, PED, PEA-15, MAT1H, HUMMAT1H	uc001fvk.3	Q15121	OTTHUMG00000031605	ENST00000360472.4:c.13G>A	1.37:g.160181347G>A	ENSP00000353660:p.Gly5Arg		158447971	NM_003768	B1AKZ3|O00511	Missense_Mutation	SNP	ENST00000360472.4	37	CCDS1199.1	.	.	.	.	.	.	.	.	.	.	G	8.379	0.837102	0.16891	.	.	ENSG00000162734	ENST00000360472;ENST00000368077;ENST00000368076	T;T;T	0.81078	-1.45;-1.45;-1.45	4.77	4.77	0.60923	DEATH-like (2);Death effector (3);	0.252848	0.38217	N	0.001767	T	0.47488	0.1448	N	0.03608	-0.345	0.33596	D	0.601668	B;D;P	0.65815	0.244;0.995;0.723	B;P;B	0.46825	0.027;0.528;0.082	T	0.51679	-0.8675	10	0.15499	T	0.54	-1.4606	10.959	0.47374	0.0905:0.0:0.9095:0.0	.	5;26;5	B1AKZ5;B1AKZ3;Q15121	.;.;PEA15_HUMAN	R	5;5;26	ENSP00000353660:G5R;ENSP00000357056:G5R;ENSP00000357055:G26R	ENSP00000353660:G5R	G	+	1	0	PEA15	158447971	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.937000	0.56575	2.493000	0.84123	0.555000	0.69702	GGG		0.537	PEA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077407.1	NM_003768	
HMCN1	83872	broad.mit.edu	37	1	186083185	186083185	+	Missense_Mutation	SNP	G	G	A	rs138190200	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:186083185G>A	ENST00000271588.4	+	73	11435	c.11206G>A	c.(11206-11208)Gct>Act	p.A3736T	HMCN1_ENST00000367492.2_Missense_Mutation_p.A3736T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3736	Ig-like C2-type 36.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A3736T(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGAATGCATCGCTGAAGGTGT	0.408													G|||	5	0.000998403	0.003	0.0014	5008	,	,		15692	0.0		0.0	False		,,,				2504	0.0				p.A3736T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11206A	1						.	G	THR/ALA	11,4395	17.9+/-39.9	0,11,2192	111.0	121.0	117.0		11206	2.2	0.3	1	dbSNP_134	117	0,8600		0,0,4300	yes	missense	HMCN1	NM_031935.2	58	0,11,6492	AA,AG,GG		0.0,0.2497,0.0846	benign	3736/5636	186083185	11,12995	2203	4300	6503	184349808	SO:0001583	missense	83872	exon73			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11206G>A	1.37:g.186083185G>A	ENSP00000271588:p.Ala3736Thr		184349808	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	8.783	0.928807	0.18131	0.002497	0.0	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68331	-0.32;-0.32	5.08	2.21	0.28008	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.308230	0.36482	N	0.002564	T	0.60051	0.2239	M	0.86178	2.8	0.20196	N	0.999929	P	0.38711	0.643	B	0.29353	0.101	T	0.51236	-0.8731	10	0.22109	T	0.4	.	8.2261	0.31570	0.3036:0.0:0.6964:0.0	.	3736	Q96RW7	HMCN1_HUMAN	T	3736	ENSP00000271588:A3736T;ENSP00000356462:A3736T	ENSP00000271588:A3736T	A	+	1	0	HMCN1	184349808	1.000000	0.71417	0.295000	0.24960	0.174000	0.22865	5.210000	0.65214	0.271000	0.22005	-0.136000	0.14681	GCT		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PRG4	10216	broad.mit.edu	37	1	186276169	186276169	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:186276169C>A	ENST00000445192.2	+	7	1363	c.1318C>A	c.(1318-1320)Ccc>Acc	p.P440T	PRG4_ENST00000367485.4_Missense_Mutation_p.P347T|PRG4_ENST00000367483.4_Missense_Mutation_p.P399T|PRG4_ENST00000367486.3_Missense_Mutation_p.P397T|PRG4_ENST00000367484.3_Intron	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	440	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P440T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						ACCCACCACCCCCAAGAAGCC	0.652																																					p.P347T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1039A	1						.						76.0	84.0	81.0					1																	186276169		2203	4298	6501	184542792	SO:0001583	missense	10216	exon5			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1318C>A	1.37:g.186276169C>A	ENSP00000399679:p.Pro440Thr		184542792	NM_001127709	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	-	3.055	-0.194511	0.06259	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05649	3.44;3.51;3.41;3.54	3.56	-3.32	0.04973	.	2.159030	0.03971	U	0.291606	T	0.06826	0.0174	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.13145	0.007;0.007;0.004;0.007	B;B;B;B	0.10450	0.005;0.005;0.002;0.005	T	0.44283	-0.9338	9	.	.	.	.	11.4615	0.50213	0.1053:0.4341:0.4606:0.0	.	306;347;440;399	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	T	397;306;399;347;440	ENSP00000356456:P397T;ENSP00000356453:P399T;ENSP00000356455:P347T;ENSP00000399679:P440T	.	P	+	1	0	PRG4	184542792	.	.	0.000000	0.03702	0.012000	0.07955	.	.	-0.227000	0.09884	-1.583000	0.00853	CCC		0.652	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PTPRC	5788	broad.mit.edu	37	1	198721443	198721443	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:198721443A>C	ENST00000367376.2	+	30	3438	c.3267A>C	c.(3265-3267)aaA>aaC	p.K1089N	PTPRC_ENST00000442510.2_Missense_Mutation_p.K1091N|PTPRC_ENST00000352140.3_Missense_Mutation_p.K1041N|PTPRC_ENST00000348564.6_Missense_Mutation_p.K930N|PTPRC_ENST00000594404.1_Missense_Mutation_p.K928N	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1089	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.K1089N(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TTGACCTGAAAGACACAGACA	0.363																																					p.K928N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2784C	1						.						129.0	123.0	125.0					1																	198721443		2203	4300	6503	196988066	SO:0001583	missense	5788	exon27			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3267A>C	1.37:g.198721443A>C	ENSP00000356346:p.Lys1089Asn		196988066	NM_080921	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	A	14.86	2.661068	0.47572	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	D	0.84660	-1.88	5.92	3.52	0.40303	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.131242	0.34879	N	0.003607	D	0.87822	0.6274	L	0.57536	1.79	0.45097	D	0.998114	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.72075	0.968;0.976;0.976	D	0.83595	0.0125	10	0.32370	T	0.25	.	5.9515	0.19248	0.7141:0.1365:0.1494:0.0	.	930;1041;1089	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	N	1091;1041;1089;928	ENSP00000193532:K1041N	ENSP00000306782:K928N	K	+	3	2	PTPRC	196988066	0.995000	0.38212	0.982000	0.44146	0.412000	0.31113	0.783000	0.26802	0.455000	0.26910	0.528000	0.53228	AAA		0.363	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
REN	5972	broad.mit.edu	37	1	204124235	204124235	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:204124235G>T	ENST00000272190.8	-	10	1158	c.1130C>A	c.(1129-1131)cCc>cAc	p.P377H	ETNK2_ENST00000367199.2_5'Flank|REN_ENST00000367195.2_Missense_Mutation_p.P374H	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	377					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)	p.P377H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GGCCCAGGTGGGTCCAGTGGG	0.582																																					p.P377H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1130A	1						.						87.0	79.0	82.0					1																	204124235		2203	4300	6503	202390858	SO:0001583	missense	5972	exon10			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.1130C>A	1.37:g.204124235G>T	ENSP00000272190:p.Pro377His		202390858	NM_000537	Q6FI38|Q6T5C2	Missense_Mutation	SNP	ENST00000272190.8	37	CCDS30981.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454889	0.84209	.	.	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.59502	0.26;0.26	5.33	4.42	0.53409	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.160235	0.56097	D	0.000025	T	0.76442	0.3988	M	0.84846	2.72	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.80781	-0.1229	10	0.87932	D	0	.	13.3874	0.60803	0.0768:0.0:0.9232:0.0	.	377	P00797	RENI_HUMAN	H	374;296;377	ENSP00000356163:P374H;ENSP00000272190:P377H	ENSP00000272190:P377H	P	-	2	0	REN	202390858	1.000000	0.71417	0.038000	0.18304	0.368000	0.29767	9.258000	0.95555	1.243000	0.43853	0.591000	0.81541	CCC		0.582	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087891.1	NM_000537	
EPHB2	2048	broad.mit.edu	37	1	23235584	23235584	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:23235584G>A	ENST00000400191.3	+	13	2440	c.2422G>A	c.(2422-2424)Gat>Aat	p.D808N	EPHB2_ENST00000374632.3_Missense_Mutation_p.D809N|EPHB2_ENST00000374627.1_Missense_Mutation_p.D803N|EPHB2_ENST00000374630.3_Missense_Mutation_p.D808N	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	808	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.D808N(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CTCGGCCAGTGATGTGTGGAG	0.582																																					p.D808N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2422A	1						.						131.0	117.0	121.0					1																	23235584		2203	4300	6503	23108171	SO:0001583	missense	2048	exon13			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2422G>A	1.37:g.23235584G>A	ENSP00000383053:p.Asp808Asn		23108171	NM_017449	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	27.6	4.844172	0.91197	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	4.96	4.03	0.46877	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96163	0.8749	H	0.96633	3.855	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.97089	0.9789	10	0.87932	D	0	.	13.4385	0.61099	0.0:0.0:0.8417:0.1583	.	750;808;826;809	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	N	750;808;808;809;803	ENSP00000363761:D808N;ENSP00000383053:D808N;ENSP00000363763:D809N;ENSP00000363758:D803N	ENSP00000363755:D750N	D	+	1	0	EPHB2	23108171	1.000000	0.71417	0.365000	0.25901	0.975000	0.68041	9.656000	0.98514	1.294000	0.44707	0.644000	0.83932	GAT		0.582	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
HHAT	55733	broad.mit.edu	37	1	210637854	210637854	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:210637854C>G	ENST00000367010.1	+	8	1089	c.862C>G	c.(862-864)Ctg>Gtg	p.L288V	HHAT_ENST00000261458.3_Missense_Mutation_p.L288V|HHAT_ENST00000367009.1_5'UTR|HHAT_ENST00000537898.1_Missense_Mutation_p.L223V|HHAT_ENST00000541565.1_Missense_Mutation_p.L151V|HHAT_ENST00000545154.1_Missense_Mutation_p.L289V|HHAT_ENST00000391905.3_Missense_Mutation_p.L288V|HHAT_ENST00000308852.6_Missense_Mutation_p.L243V|HHAT_ENST00000545781.1_Missense_Mutation_p.L225V|HHAT_ENST00000413764.2_Missense_Mutation_p.L288V	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	288					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.L288V(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TTCAGGAGGACTGGCGTTAGC	0.567																																					p.L288V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C862G	1						.						229.0	227.0	228.0					1																	210637854		2203	4300	6503	208704477	SO:0001583	missense	55733	exon8			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.862C>G	1.37:g.210637854C>G	ENSP00000355977:p.Leu288Val		208704477	NM_018194	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625742	0.46840	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968	T;T;T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	5.42	3.53	0.40419	.	0.076862	0.53938	D	0.000056	T	0.72053	0.3413	L	0.54323	1.7	0.48341	D	0.999631	P;P;P;P;P	0.48640	0.827;0.886;0.91;0.791;0.913	B;P;P;B;P	0.46917	0.443;0.462;0.531;0.41;0.529	T	0.71974	-0.4430	10	0.42905	T	0.14	-12.6962	11.0444	0.47850	0.0:0.8442:0.0:0.1558	.	243;289;151;223;288	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	V	288;151;289;223;288;225;288;243;288;160	ENSP00000416845:L288V;ENSP00000444995:L151V;ENSP00000438468:L289V;ENSP00000442625:L223V;ENSP00000375773:L288V;ENSP00000439229:L225V;ENSP00000261458:L288V;ENSP00000308628:L243V;ENSP00000355977:L288V;ENSP00000413399:L160V	ENSP00000261458:L288V	L	+	1	2	HHAT	208704477	0.998000	0.40836	0.998000	0.56505	0.694000	0.40290	2.812000	0.47994	1.283000	0.44513	0.555000	0.69702	CTG		0.567	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194	
FMN2	56776	broad.mit.edu	37	1	240492640	240492640	+	Splice_Site	SNP	T	T	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:240492640T>C	ENST00000319653.9	+	10	4539	c.4309T>C	c.(4309-4311)Ttc>Ctc	p.F1437L	FMN2_ENST00000545751.1_Splice_Site_p.F33L	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1437	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.F1580L(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTTCCTTAGGTTCCTTTATGA	0.378																																					p.F1437L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4309C	1						.						145.0	136.0	139.0					1																	240492640		2203	4300	6503	238559263	SO:0001630	splice_region_variant	56776	exon10			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4308-1T>C	1.37:g.240492640T>C			238559263	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	T	34	5.375787	0.95923	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000545751;ENST00000537355	T;T;T	0.41065	1.01;1.01;1.01	5.7	5.7	0.88788	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000004	T	0.69015	0.3064	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.992;0.999;0.976;1.0	T	0.74907	-0.3504	10	0.87932	D	0	.	15.9704	0.80013	0.0:0.0:0.0:1.0	.	33;83;66;1437	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	L	1437;83;33;64	ENSP00000318884:F1437L;ENSP00000388922:F83L;ENSP00000437918:F33L	ENSP00000318884:F1437L	F	+	1	0	FMN2	238559263	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.165000	0.68154	0.460000	0.39030	TTC		0.378	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	Missense_Mutation
ARHGEF16	27237	broad.mit.edu	37	1	3388287	3388287	+	Intron	DEL	C	C	-			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:3388287delC	ENST00000378378.4	+	7	1427				ARHGEF16_ENST00000378373.1_Intron|ARHGEF16_ENST00000378371.2_Intron|ARHGEF16_ENST00000413250.2_Frame_Shift_Del_p.L22fs	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16						activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q24fs*12(1)		lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CCGGCCTCCTCCCCCAGCTGG	0.637																																					.												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	.	1						.																																			3378147	SO:0001627	intron_variant	27237	.			D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1023-1355C>-	1.37:g.3388287delC			3378147	.	Q86TF0|Q99434	Frame_Shift_Del	DEL	ENST00000378378.4	37	CCDS46.2																																																																																				0.637	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001515.1	NM_014448	
CHD5	26038	broad.mit.edu	37	1	6188196	6188196	+	Silent	SNP	G	G	A	rs201484104		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:6188196G>A	ENST00000262450.3	-	25	3912	c.3813C>T	c.(3811-3813)gaC>gaT	p.D1271D	CHD5_ENST00000378021.1_Silent_p.D128D	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.D1271D(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CATCTGTAGCGTCCTGGTTCC	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15021	0.0		0.0	False		,,,				2504	0.0				p.D1271D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3813T	1						.						194.0	132.0	153.0					1																	6188196		2203	4300	6503	6110783	SO:0001819	synonymous_variant	26038	exon25			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3813C>T	1.37:g.6188196G>A			6110783	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	37	CCDS57.1																																																																																				0.587	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
CAMTA1	23261	broad.mit.edu	37	1	7797385	7797385	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:7797385C>T	ENST00000303635.7	+	15	3620	c.3413C>T	c.(3412-3414)tCg>tTg	p.S1138L	CAMTA1_ENST00000439411.2_Missense_Mutation_p.S1138L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1138L(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CGGGCCATCTCGATTCCCGAC	0.572			T	WWTR1	epitheliod hemangioendothelioma																																p.S1138L			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3413T	1						.						98.0	99.0	99.0					1																	7797385		2203	4300	6503	7719972	SO:0001583	missense	23261	exon15			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3413C>T	1.37:g.7797385C>T	ENSP00000306522:p.Ser1138Leu		7719972	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.05|17.05	3.290580|3.290580	0.59976|0.59976	.|.	.|.	ENSG00000171735|ENSG00000171735	ENST00000495233|ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	.|T;T	.|0.34667	.|1.35;1.35	5.91|5.91	5.91|5.91	0.95273|0.95273	.|Ankyrin repeat-containing domain (3);	.|0.054615	.|0.85682	.|D	.|0.000000	.|T	.|0.32255	.|0.0823	N|N	0.20445|0.20445	0.575|0.575	0.53005|0.53005	D|D	0.999961|0.999961	.|D;D;D;D	.|0.64830	.|0.974;0.985;0.994;0.966	.|B;B;P;B	.|0.46659	.|0.325;0.265;0.523;0.222	.|T	.|0.02144	.|-1.1206	.|10	.|0.21014	.|T	.|0.42	-16.0717|-16.0717	20.2985|20.2985	0.98592|0.98592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1138;225;94;1138	.|Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.|.;.;.;CMTA1_HUMAN	X|L	95|1138;1138;225;94	.|ENSP00000306522:S1138L;ENSP00000402561:S1138L	.|ENSP00000306522:S1138L	R|S	+|+	1|2	2|0	CAMTA1|CAMTA1	7719972|7719972	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.543000|0.543000	0.35085|0.35085	7.770000|7.770000	0.85390|0.85390	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.572	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
CSMD2	114784	broad.mit.edu	37	1	34209061	34209061	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:34209061C>T	ENST00000373381.4	-	14	2169	c.1993G>A	c.(1993-1995)Gtg>Atg	p.V665M		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	625	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V625M(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGAGGCTCCACGTCAATGTCG	0.602																																					p.V625M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1873A	1						.						84.0	84.0	84.0					1																	34209061		2203	4300	6503	33981648	SO:0001583	missense	114784	exon14			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1993G>A	1.37:g.34209061C>T	ENSP00000362479:p.Val665Met		33981648	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	17.08	3.296486	0.60086	.	.	ENSG00000121904	ENST00000373381	T	0.21031	2.03	5.58	5.58	0.84498	CUB (5);	0.055186	0.64402	D	0.000001	T	0.22360	0.0539	L	0.38531	1.155	0.80722	D	1	P;B	0.37864	0.61;0.403	B;B	0.38264	0.269;0.21	T	0.01169	-1.1430	10	0.48119	T	0.1	.	18.9334	0.92576	0.0:1.0:0.0:0.0	.	625;665	Q7Z408;E7EUA6	CSMD2_HUMAN;.	M	665	ENSP00000362479:V665M	ENSP00000241312:V625M	V	-	1	0	CSMD2	33981648	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	4.839000	0.62810	2.782000	0.95742	0.655000	0.94253	GTG		0.602	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
LRRC42	115353	broad.mit.edu	37	1	54423900	54423900	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:54423900G>A	ENST00000371370.3	+	4	1073	c.552G>A	c.(550-552)aaG>aaA	p.K184K	LRRC42_ENST00000319223.4_Silent_p.K184K	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	184								p.K184K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						CCTGTTGCAAGCTTGGAGATG	0.458																																					p.K184K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552A	1						.						153.0	134.0	140.0					1																	54423900		2203	4300	6503	54196488	SO:0001819	synonymous_variant	115353	exon3			AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.552G>A	1.37:g.54423900G>A			54196488	NM_052940	D3DQ46|Q8N2Q8	Silent	SNP	ENST00000371370.3	37	CCDS585.1																																																																																				0.458	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940	
DOCK7	85440	broad.mit.edu	37	1	63090943	63090943	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:63090943T>A	ENST00000340370.5	-	12	1429	c.1412A>T	c.(1411-1413)aAt>aTt	p.N471I	DOCK7_ENST00000404627.2_Missense_Mutation_p.N471I|DOCK7_ENST00000251157.5_Missense_Mutation_p.N471I	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	471					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.N471I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CTTAAAAAAATTTGTCACTGT	0.363																																					p.N471I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1412T	1						.						124.0	127.0	126.0					1																	63090943		2203	4300	6503	62863531	SO:0001583	missense	85440	exon12				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1412A>T	1.37:g.63090943T>A	ENSP00000340742:p.Asn471Ile		62863531	NM_033407	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039505	0.75617	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.38401	1.14;1.14;1.14	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	L	0.59436	1.845	0.80722	D	1	D;D;D;D;B	0.76494	0.992;0.997;0.99;0.999;0.314	P;D;D;D;B	0.79108	0.897;0.964;0.942;0.992;0.118	T	0.49634	-0.8919	10	0.59425	D	0.04	.	14.1992	0.65690	0.0:0.0:0.0:1.0	.	471;471;471;471;471	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	I	471	ENSP00000251157:N471I;ENSP00000340742:N471I;ENSP00000384446:N471I	ENSP00000251157:N471I	N	-	2	0	DOCK7	62863531	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	7.386000	0.79775	1.932000	0.55993	0.383000	0.25322	AAT		0.363	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
AHCTF1	25909	broad.mit.edu	37	1	247065838	247065838	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr1:247065838C>T	ENST00000391829.2	-	8	1229	c.1106G>A	c.(1105-1107)gGc>gAc	p.G369D	AHCTF1_ENST00000366508.1_Missense_Mutation_p.G404D|AHCTF1_ENST00000326225.3_Missense_Mutation_p.G378D			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	369	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G369D(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTCATTCACGCCTTCCTCCCT	0.408																																					p.G378D	Colon(145;197 1800 4745 15099 26333)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1133A	1						.						154.0	150.0	151.0					1																	247065838		2203	4300	6503	245132461	SO:0001583	missense	25909	exon8				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.1106G>A	1.37:g.247065838C>T	ENSP00000375705:p.Gly369Asp		245132461	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	C	17.15	3.315188	0.60524	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.21543	2.0;2.0;2.0	4.96	4.03	0.46877	.	0.446141	0.27397	N	0.019542	T	0.15998	0.0385	N	0.19112	0.55	0.31413	N	0.675254	D;P	0.53312	0.959;0.732	P;B	0.48030	0.564;0.241	T	0.02391	-1.1166	10	0.05525	T	0.97	-0.394	15.1593	0.72771	0.0:0.8457:0.1543:0.0	.	404;369	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	D	404;378;369	ENSP00000355464:G404D;ENSP00000355465:G378D;ENSP00000375705:G369D	ENSP00000355465:G378D	G	-	2	0	AHCTF1	245132461	1.000000	0.71417	0.659000	0.29680	0.978000	0.69477	3.614000	0.54160	1.194000	0.43101	0.563000	0.77884	GGC		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
CHD6	84181	broad.mit.edu	37	20	40049982	40049982	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr20:40049982C>G	ENST00000373233.3	-	31	5470	c.5293G>C	c.(5293-5295)Gaa>Caa	p.E1765Q		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1765					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.E1765Q(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCTCCTGCTTCTAAGCTACCC	0.448																																					p.E1765Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5293C	20						.						101.0	108.0	106.0					20																	40049982		2203	4300	6503	39483396	SO:0001583	missense	84181	exon31			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5293G>C	20.37:g.40049982C>G	ENSP00000362330:p.Glu1765Gln		39483396	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595437	0.28445	.	.	ENSG00000124177	ENST00000373233	D	0.86297	-2.1	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000007	T	0.81123	0.4757	L	0.32530	0.975	0.80722	D	1	B	0.23540	0.087	B	0.20577	0.03	T	0.75196	-0.3403	10	0.32370	T	0.25	-21.8098	14.278	0.66194	0.0:0.8096:0.1904:0.0	.	1765	Q8TD26	CHD6_HUMAN	Q	1765	ENSP00000362330:E1765Q	ENSP00000362330:E1765Q	E	-	1	0	CHD6	39483396	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	3.359000	0.52292	2.861000	0.98227	0.655000	0.94253	GAA		0.448	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
NCOA3	8202	broad.mit.edu	37	20	46279873	46279873	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr20:46279873C>G	ENST00000371998.3	+	20	3990	c.3799C>G	c.(3799-3801)Cag>Gag	p.Q1267E	NCOA3_ENST00000371997.3_Missense_Mutation_p.Q1258E|NCOA3_ENST00000372004.3_Missense_Mutation_p.Q1263E|NCOA3_ENST00000341724.6_Missense_Mutation_p.Q1193E			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1267	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q1267E(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						gcaacagcaacagcaacagca	0.572																																					p.Q1266E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3796G	20						.						75.0	77.0	76.0					20																	46279873		2203	4300	6503	45713280	SO:0001583	missense	8202	exon20			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3799C>G	20.37:g.46279873C>G	ENSP00000361066:p.Gln1267Glu		45713280	NM_001174087	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	c	6.681	0.494201	0.12702	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.03301	3.98;4.18;4.09;4.01	1.13	1.13	0.20643	.	0.212182	0.23754	N	0.044888	T	0.06645	0.0170	N	0.22421	0.69	0.21020	N	0.999804	P;P;P;D;D;P	0.67145	0.956;0.811;0.458;0.994;0.996;0.458	P;P;B;D;D;B	0.76071	0.899;0.764;0.217;0.97;0.987;0.217	T	0.22277	-1.0221	10	0.52906	T	0.07	.	6.0322	0.19686	0.0:1.0:0.0:0.0	.	1267;1258;1270;1262;1263;1267	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	E	1263;1193;1263;1267;1258	ENSP00000342123:Q1193E;ENSP00000361073:Q1263E;ENSP00000361066:Q1267E;ENSP00000361065:Q1258E	ENSP00000345671:Q1263E	Q	+	1	0	NCOA3	45713280	0.999000	0.42202	0.191000	0.23289	0.012000	0.07955	0.993000	0.29680	0.473000	0.27368	0.205000	0.17691	CAG		0.572	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
UMODL1	89766	broad.mit.edu	37	21	43547183	43547183	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr21:43547183G>A	ENST00000408910.2	+	19	3361	c.3361G>A	c.(3361-3363)Gga>Aga	p.G1121R	UMODL1_ENST00000400427.1_Missense_Mutation_p.G1177R|UMODL1_ENST00000400424.2_Missense_Mutation_p.G1049R|UMODL1_ENST00000408989.2_Missense_Mutation_p.G1249R|UMODL1_ENST00000400423.2_3'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1121	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.G1049R(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GTTGTTTATCGGAGACTCTCC	0.512																																					p.G1177R	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3529A	21						.						110.0	109.0	109.0					21																	43547183		1995	4172	6167	42420252	SO:0001583	missense	89766	exon18				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3361G>A	21.37:g.43547183G>A	ENSP00000386147:p.Gly1121Arg		42420252	NM_001199527	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341583	0.41498	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000434156	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	3.25	3.25	0.37280	Zona pellucida sperm-binding protein (3);	0.000000	0.43110	D	0.000612	D	0.90273	0.6958	M	0.81239	2.535	0.43740	D	0.996239	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90858	0.4736	9	.	.	.	-21.243	13.9103	0.63862	0.0:0.0:1.0:0.0	.	1249;1121	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	R	1177;1049;1249;1121;6	ENSP00000383279:G1177R;ENSP00000383276:G1049R;ENSP00000386126:G1249R;ENSP00000386147:G1121R	.	G	+	1	0	UMODL1	42420252	0.999000	0.42202	0.087000	0.20705	0.164000	0.22412	3.895000	0.56258	2.115000	0.64714	0.462000	0.41574	GGA		0.512	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
UBASH3A	53347	broad.mit.edu	37	21	43863452	43863452	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr21:43863452G>A	ENST00000319294.6	+	13	1693	c.1662G>A	c.(1660-1662)ccG>ccA	p.P554P	UBASH3A_ENST00000398367.1_Intron|UBASH3A_ENST00000291535.6_Silent_p.P516P	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	554	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.P554P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						CCCTCATGCCGGCCGAGAGCT	0.587																																					p.P516P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1548A	21						.						71.0	54.0	59.0					21																	43863452		2203	4300	6503	42736521	SO:0001819	synonymous_variant	53347	exon12			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1662G>A	21.37:g.43863452G>A			42736521	NM_001001895	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	ENST00000319294.6	37	CCDS13687.1																																																																																				0.587	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895	
PARVG	64098	broad.mit.edu	37	22	44579284	44579284	+	Silent	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr22:44579284A>G	ENST00000444313.3	+	3	559	c.75A>G	c.(73-75)tcA>tcG	p.S25S	PARVG_ENST00000453888.3_3'UTR|PARVG_ENST00000415224.1_Silent_p.S25S|PARVG_ENST00000422871.1_Silent_p.S25S|PARVG_ENST00000466375.2_Silent_p.S25S	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	25					actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.S25S(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				AGGAGCTCTCAAAAGGTGTGT	0.637																																					p.S25S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A75G	22						.						48.0	44.0	45.0					22																	44579284		2203	4300	6503	42910617	SO:0001819	synonymous_variant	64098	exon3			AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.75A>G	22.37:g.44579284A>G			42910617	NM_001137606	B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Silent	SNP	ENST00000444313.3	37	CCDS14057.1																																																																																				0.637	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318238.4	NM_022141	
MOV10L1	54456	broad.mit.edu	37	22	50591566	50591566	+	Silent	SNP	G	G	A	rs202017003	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr22:50591566G>A	ENST00000262794.5	+	22	3068	c.2985G>A	c.(2983-2985)gcG>gcA	p.A995A	MOV10L1_ENST00000395858.3_Silent_p.A995A|MOV10L1_ENST00000395843.1_Silent_p.A38A|MOV10L1_ENST00000395852.1_Silent_p.A122A|MOV10L1_ENST00000540615.1_Silent_p.A975A|MOV10L1_ENST00000354853.2_Silent_p.A38A|MOV10L1_ENST00000545383.1_Silent_p.A995A	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	995					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.A995A(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		AGGTCTGTGCGGACCCCACAG	0.582													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18572	0.0		0.0	False		,,,				2504	0.0				p.A995A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2985A	22						.						209.0	195.0	200.0					22																	50591566		2203	4300	6503	48933693	SO:0001819	synonymous_variant	54456	exon22			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2985G>A	22.37:g.50591566G>A			48933693	NM_001164104	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	CCDS14084.1																																																																																				0.582	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
FER1L5	90342	broad.mit.edu	37	2	97357204	97357205	+	RNA	INS	-	-	GGG	rs78906699	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:97357204_97357205insGGG	ENST00000457909.1	+	0	1389_1390							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G971_W972insG(1)		NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GGCGAGGAGGAGGGCTGGGAGT	0.708																																					p.E970delinsEG												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.2909_2910insGGG	2						.																																			96720932			90342	exon28			BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97357205_97357207dupGGG			96720931	NM_001113382	Q17RH2|Q6ZU24	In_Frame_Ins	INS	ENST00000457909.1	37																																																																																					0.708	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
IL1R1	3554	broad.mit.edu	37	2	102789154	102789154	+	Missense_Mutation	SNP	A	A	G	rs200335414		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:102789154A>G	ENST00000410023.1	+	9	1165	c.847A>G	c.(847-849)Aat>Gat	p.N283D	IL1R1_ENST00000409288.1_Missense_Mutation_p.N283D|AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000409589.1_Intron|IL1R1_ENST00000409929.1_Missense_Mutation_p.N283D|IL1R1_ENST00000233946.3_Missense_Mutation_p.N283D|IL1R1_ENST00000409329.1_Missense_Mutation_p.N283D|IL1R1_ENST00000424272.1_Missense_Mutation_p.N283D			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	283	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)	p.N283D(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	TAGTGTGGAAAATCCTGCAAA	0.338																																					p.N283D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A847G	2						.						99.0	91.0	94.0					2																	102789154		2203	4300	6503	102155586	SO:0001583	missense	3554	exon8			M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.847A>G	2.37:g.102789154A>G	ENSP00000386380:p.Asn283Asp		102155586	NM_000877	Q587I7	Missense_Mutation	SNP	ENST00000410023.1	37	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	A	5.234	0.228618	0.09916	.	.	ENSG00000115594	ENST00000409929;ENST00000424272;ENST00000409329;ENST00000428279;ENST00000409288;ENST00000410023;ENST00000233946	T;T;T;T;T;T;T	0.03212	4.01;4.01;4.01;4.01;4.01;4.01;4.01	4.87	2.38	0.29361	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.128350	0.06250	N	0.691847	T	0.05868	0.0153	L	0.60455	1.87	0.09310	N	1	B;B;B	0.17852	0.002;0.004;0.024	B;B;B	0.21360	0.006;0.017;0.034	T	0.50268	-0.8848	10	0.18276	T	0.48	.	9.0121	0.36148	0.6311:0.3689:0.0:0.0	.	283;283;283	B8ZZW4;P14778;B8ZZ73	.;IL1R1_HUMAN;.	D	283;283;283;139;283;283;283	ENSP00000386776:N283D;ENSP00000415366:N283D;ENSP00000387131:N283D;ENSP00000410461:N139D;ENSP00000386478:N283D;ENSP00000386380:N283D;ENSP00000233946:N283D	ENSP00000233946:N283D	N	+	1	0	IL1R1	102155586	0.001000	0.12720	0.015000	0.15790	0.184000	0.23303	0.233000	0.17911	0.397000	0.25310	0.482000	0.46254	AAT		0.338	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		
KCNJ3	3760	broad.mit.edu	37	2	155711393	155711394	+	Nonsense_Mutation	DNP	GA	GA	AT			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	GA	GA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:155711393_155711394GA>AT	ENST00000295101.2	+	3	1551_1552	c.1074_1075GA>AT	c.(1072-1077)gtGAaa>gtATaa	p.K359*	KCNJ3_ENST00000493505.1_3'UTR|KCNJ3_ENST00000544049.1_3'UTR	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	359					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.V358>?(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CTTACAGTGTGAAAGAGCAGGA	0.411																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1074_1075AT	2						.																																			155419640	SO:0001587	stop_gained	3760	exon3			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	Exception_encountered	2.37:g.155711393_155711394delinsAT	ENSP00000295101:p.Lys359*		155419639	NM_002239	B4DEW7|Q8TBI0	Nonsense_Mutation	DNP	ENST00000295101.2	37	CCDS2200.1																																																																																				0.411	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
TTN	7273	broad.mit.edu	37	2	179571275	179571275	+	Missense_Mutation	SNP	C	C	T	rs143477225		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:179571275C>T	ENST00000591111.1	-	100	28599	c.28375G>A	c.(28375-28377)Gaa>Aaa	p.E9459K	TTN_ENST00000342992.6_Missense_Mutation_p.E8532K|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E9776K|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	13552	Ig-like 77.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E8532K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACCATGTTCGTTAAATGCC	0.398													T|||	1	0.000199681	0.0008	0.0	5008	,	,		18748	0.0		0.0	False		,,,				2504	0.0				p.E8532K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G25594A	2						.						176.0	160.0	165.0					2																	179571275		1905	4128	6033	179279520	SO:0001583	missense	7273	exon99			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.28375G>A	2.37:g.179571275C>T	ENSP00000465570:p.Glu9459Lys		179279520	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	T	12.80	2.047710	0.36085	.	.	ENSG00000155657	ENST00000342992	T	0.68025	-0.3	5.92	4.7	0.59300	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38983	0.1061	N	0.12443	0.215	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36915	-0.9728	9	0.87932	D	0	.	8.8556	0.35225	0.0:0.0692:0.2:0.7308	.	9459	Q8WZ42	TITIN_HUMAN	K	8532	ENSP00000343764:E8532K	ENSP00000343764:E8532K	E	-	1	0	TTN	179279520	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	2.847000	0.48270	1.063000	0.40649	-0.269000	0.10298	GAA		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SPHKAP	80309	broad.mit.edu	37	2	228884376	228884376	+	Silent	SNP	G	G	A	rs201850154		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:228884376G>A	ENST00000392056.3	-	7	1240	c.1194C>T	c.(1192-1194)tcC>tcT	p.S398S	SPHKAP_ENST00000344657.5_Silent_p.S398S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	398						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S398S(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCTGCAGCACGGATTCTGCTA	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		22016	0.0		0.001	False		,,,				2504	0.0				p.S398S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1194T	2						.						166.0	147.0	154.0					2																	228884376		2203	4300	6503	228592620	SO:0001819	synonymous_variant	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1194C>T	2.37:g.228884376G>A			228592620	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1																																																																																				0.453	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
COLEC11	78989	broad.mit.edu	37	2	3660953	3660953	+	Silent	SNP	C	C	T	rs369069794		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:3660953C>T	ENST00000349077.4	+	3	286	c.183C>T	c.(181-183)gtC>gtT	p.V61V	COLEC11_ENST00000487365.1_Intron|COLEC11_ENST00000236693.7_Missense_Mutation_p.S32L|COLEC11_ENST00000402794.1_Intron|COLEC11_ENST00000382062.2_Silent_p.V61V|COLEC11_ENST00000418971.2_Silent_p.V75V|COLEC11_ENST00000403096.3_Silent_p.V35V|COLEC11_ENST00000404205.1_Intron|COLEC11_ENST00000402922.1_Silent_p.V35V	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	61					developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)	p.V75V(1)|p.S32L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CTGGAAGAGTCGGCCCCACGG	0.657																																					p.S32L												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C95T	2						.	C	,LEU/SER	0,4382		0,0,2191	23.0	26.0	25.0		183,95	-1.5	1.0	2		25	1,8591		0,1,4295	no	coding-synonymous,missense	COLEC11	NM_024027.3,NM_199235.1	,145	0,1,6486	TT,TC,CC		0.0116,0.0,0.0077	,	61/272,32/269	3660953	1,12973	2191	4296	6487	3638828	SO:0001819	synonymous_variant	78989	exon3			BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.183C>T	2.37:g.3660953C>T			3638828	NM_199235	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Missense_Mutation	SNP	ENST00000349077.4	37	CCDS1649.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048287	0.36181	0.0	1.16E-4	ENSG00000118004	ENST00000236693	T	0.05258	3.47	4.62	-1.52	0.08637	.	.	.	.	.	T	0.02888	0.0086	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47548	-0.9109	8	0.19590	T	0.45	-19.4127	1.0213	0.01518	0.161:0.273:0.3221:0.244	.	32	Q9BWP8-9	.	L	32	ENSP00000236693:S32L	ENSP00000236693:S32L	S	+	2	0	COLEC11	3638828	0.973000	0.33851	0.996000	0.52242	0.966000	0.64601	-0.087000	0.11215	-0.236000	0.09753	0.561000	0.74099	TCG		0.657	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027	
DYNC2LI1	51626	broad.mit.edu	37	2	44036860	44036860	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:44036860A>C	ENST00000260605.8	+	13	1110	c.1010A>C	c.(1009-1011)aAa>aCa	p.K337T	DYNC2LI1_ENST00000605786.1_Missense_Mutation_p.K338T|DYNC2LI1_ENST00000443170.3_Missense_Mutation_p.K211T	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	337					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)	p.K337T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GAACAGTACAAAAGAAGTTCT	0.284																																					p.K338T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1013C	2						.						68.0	68.0	68.0					2																	44036860		2202	4295	6497	43890364	SO:0001583	missense	51626	exon13				CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.1010A>C	2.37:g.44036860A>C	ENSP00000260605:p.Lys337Thr		43890364	NM_001193464	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Missense_Mutation	SNP	ENST00000260605.8	37	CCDS1813.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868538	0.72065	.	.	ENSG00000138036	ENST00000260605;ENST00000443170	T;T	0.52295	0.67;0.67	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.58552	0.2130	M	0.62723	1.935	0.51767	D	0.999931	D;D	0.58268	0.982;0.969	P;P	0.56163	0.793;0.626	T	0.61392	-0.7072	10	0.54805	T	0.06	-18.6431	12.5258	0.56085	1.0:0.0:0.0:0.0	.	338;337	Q8TCX1-2;Q8TCX1	.;DC2L1_HUMAN	T	337;211	ENSP00000260605:K337T;ENSP00000388941:K211T	ENSP00000260605:K337T	K	+	2	0	DYNC2LI1	43890364	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.453000	0.73488	2.135000	0.66039	0.519000	0.50382	AAA		0.284	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008	
SPHKAP	80309	broad.mit.edu	37	2	228884650	228884650	+	Missense_Mutation	SNP	T	T	C	rs139197816	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr2:228884650T>C	ENST00000392056.3	-	7	966	c.920A>G	c.(919-921)cAg>cGg	p.Q307R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.Q307R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	307						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.Q307R(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCTTTTCCACTGTGATGGCTT	0.408																																					p.Q307R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A920G	2						.						210.0	215.0	213.0					2																	228884650		2203	4300	6503	228592894	SO:0001583	missense	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.920A>G	2.37:g.228884650T>C	ENSP00000375909:p.Gln307Arg		228592894	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	0.037	-1.302186	0.01353	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11277	2.79;2.79	5.6	-6.66	0.01789	.	1.959970	0.01623	N	0.023138	T	0.04182	0.0116	N	0.11427	0.14	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.32719	-0.9896	10	0.16896	T	0.51	.	1.2131	0.01908	0.2204:0.3346:0.2064:0.2385	.	307;307	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	307	ENSP00000375909:Q307R;ENSP00000339886:Q307R	ENSP00000339886:Q307R	Q	-	2	0	SPHKAP	228592894	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.524000	0.06222	-0.939000	0.03709	0.528000	0.53228	CAG		0.408	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
PDCD6IP	10015	broad.mit.edu	37	3	33840274	33840275	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr3:33840274_33840275insA	ENST00000307296.3	+	1	431_432	c.54_55insA	c.(55-57)aagfs	p.K19fs	RP11-10C24.3_ENST00000604982.1_lincRNA|RP11-10C24.1_ENST00000605513.1_lincRNA|PDCD6IP_ENST00000457054.2_Frame_Shift_Ins_p.K19fs			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	19	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)	p.P20fs*54(1)		central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						TGGACCTGGCCAAGCCGCTGGT	0.649																																					p.A18fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.54_55insA	3						.		,	42,4192		1,40,2076					,	2.6	1.0			19	89,8073		1,87,3993	no	frameshift,frameshift	PDCD6IP	NM_013374.4,NM_001162429.1	,	2,127,6069	A1A1,A1R,RR		1.0904,0.992,1.0568	,	,		131,12265				33815279	SO:0001589	frameshift_variant	10015	exon1			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.56dupA	3.37:g.33840276_33840276dupA	ENSP00000307387:p.Lys19fs		33815278	NM_013374	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Frame_Shift_Ins	INS	ENST00000307296.3	37	CCDS2660.1																																																																																				0.649	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
EPHB1	2047	broad.mit.edu	37	3	134911428	134911428	+	Silent	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr3:134911428A>G	ENST00000398015.3	+	11	2263	c.1893A>G	c.(1891-1893)ggA>ggG	p.G631G	EPHB1_ENST00000493838.1_Silent_p.G192G	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	631	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.G631G(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GGGAGTTTGGAGAAGTGTACA	0.512																																					p.G631G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1893G	3						.						60.0	62.0	61.0					3																	134911428		2066	4263	6329	136394118	SO:0001819	synonymous_variant	2047	exon11			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1893A>G	3.37:g.134911428A>G			136394118	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	ENST00000398015.3	37	CCDS46921.1																																																																																				0.512	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
ZBBX	79740	broad.mit.edu	37	3	166960426	166960426	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr3:166960426A>T	ENST00000392766.2	-	20	2483	c.2143T>A	c.(2143-2145)Tca>Aca	p.S715T	ZBBX_ENST00000455345.2_Missense_Mutation_p.S754T|ZBBX_ENST00000307529.5_Missense_Mutation_p.S754T|ZBBX_ENST00000392764.1_Missense_Mutation_p.S686T|ZBBX_ENST00000392767.2_Missense_Mutation_p.S715T	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	715						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S715T(1)|p.S754T(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AGCTTTTCTGAAGTATCTGAA	0.343																																					p.S715T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2143A	3						.						70.0	68.0	68.0					3																	166960426		1805	4077	5882	168443120	SO:0001583	missense	79740	exon20			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2143T>A	3.37:g.166960426A>T	ENSP00000376519:p.Ser715Thr		168443120	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	11.47	1.649405	0.29336	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	5.62	-0.796	0.10912	.	1.029870	0.07734	N	0.945799	T	0.38692	0.1050	L	0.44542	1.39	0.24268	N	0.995252	P;B	0.41673	0.759;0.386	B;B	0.37692	0.256;0.131	T	0.28396	-1.0045	10	0.38643	T	0.18	-0.0683	4.0831	0.09935	0.5199:0.0:0.3261:0.1539	.	754;715	A8MT70-2;A8MT70	.;ZBBX_HUMAN	T	715;715;754;754;686	ENSP00000376519:S715T;ENSP00000376520:S715T;ENSP00000390232:S754T;ENSP00000305065:S754T;ENSP00000376517:S686T	ENSP00000305065:S754T	S	-	1	0	ZBBX	168443120	1.000000	0.71417	0.998000	0.56505	0.032000	0.12392	0.861000	0.27885	0.070000	0.16634	-0.353000	0.07706	TCA		0.343	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
PLXNB1	5364	broad.mit.edu	37	3	48461440	48461440	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr3:48461440C>G	ENST00000358536.4	-	11	2524	c.2255G>C	c.(2254-2256)gGg>gCg	p.G752A	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Intron|PLXNB1_ENST00000456774.1_Intron|PLXNB1_ENST00000296440.6_Missense_Mutation_p.G752A	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	752	Pro-rich.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.G752A(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGAGGCGACCCTGTGGAGCC	0.647																																					p.G752A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2255C	3						.						20.0	24.0	23.0					3																	48461440		2203	4293	6496	48436444	SO:0001583	missense	5364	exon11			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2255G>C	3.37:g.48461440C>G	ENSP00000351338:p.Gly752Ala		48436444	NM_002673	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	c	2.449	-0.326816	0.05350	.	.	ENSG00000164050	ENST00000296440;ENST00000358536	T;T	0.02890	4.12;4.12	4.35	0.481	0.16809	.	1.348330	0.04682	N	0.412467	T	0.01592	0.0051	N	0.08118	0	0.09310	N	0.999999	B	0.12013	0.005	B	0.12837	0.008	T	0.43294	-0.9400	10	0.06365	T	0.9	.	4.7366	0.12991	0.0:0.2667:0.1527:0.5806	.	752	O43157	PLXB1_HUMAN	A	752	ENSP00000296440:G752A;ENSP00000351338:G752A	ENSP00000296440:G752A	G	-	2	0	PLXNB1	48436444	0.000000	0.05858	0.016000	0.15963	0.125000	0.20455	0.272000	0.18644	-0.175000	0.10725	-0.598000	0.04106	GGG		0.647	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
PIK3CA	5290	broad.mit.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	A	C	rs121913274		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr3:178936092A>C	ENST00000263967.3	+	10	1791	c.1634A>C	c.(1633-1635)gAg>gCg	p.E545A		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545A(96)|p.E545G(78)|p.E545V(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAATCACTGAGCAGGAGAAA	0.353	E545A(AGS_STOMACH)|E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545A	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,+1 	.	178	Substitution - Missense(178)	breast(40)|large_intestine(39)|ovary(30)|endometrium(17)|skin(9)|urinary_tract(8)|upper_aerodigestive_tract(4)|central_nervous_system(4)|oesophagus(4)|stomach(4)|liver(4)|thyroid(3)|soft_tissue(3)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|NS(1)|eye(1)|pancreas(1)|prostate(1)|pituitary(1)	c.A1634C	3						.						61.0	61.0	61.0					3																	178936092		1813	4072	5885	180418786	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1634A>C	3.37:g.178936092A>C	ENSP00000263967:p.Glu545Ala		180418786	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555316	0.86231	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71074	0.3297	L	0.43757	1.38	0.80722	D	1	D	0.67145	0.996	D	0.65140	0.932	T	0.69109	-0.5232	10	0.34782	T	0.22	-25.7963	16.1026	0.81194	1.0:0.0:0.0:0.0	.	545	P42336	PK3CA_HUMAN	A	545	ENSP00000263967:E545A	ENSP00000263967:E545A	E	+	2	0	PIK3CA	180418786	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
CPEB2	132864	broad.mit.edu	37	4	15067994	15067994	+	Missense_Mutation	SNP	G	G	A	rs533201180		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr4:15067994G>A	ENST00000507071.1	+	11	1847	c.1760G>A	c.(1759-1761)cGc>cAc	p.R587H	CPEB2_ENST00000382395.3_Missense_Mutation_p.R565H|CPEB2_ENST00000538197.1_Missense_Mutation_p.R1032H|CPEB2_ENST00000541112.1_Missense_Mutation_p.R1024H|CPEB2_ENST00000345451.3_Missense_Mutation_p.R557H|CPEB2_ENST00000259997.5_Missense_Mutation_p.R595H|RP11-665G4.1_ENST00000513384.1_RNA|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000442003.2_Missense_Mutation_p.R1005H|CPEB2_ENST00000382401.3_Missense_Mutation_p.R560H			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	587					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)	p.R587H(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						ATCCACTTCCGCTGGAACTAA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		18690	0.0		0.0	False		,,,				2504	0.001				p.R1002H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3005A	4						.						50.0	46.0	47.0					4																	15067994		2203	4300	6503	14677092	SO:0001583	missense	132864	exon11			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1760G>A	4.37:g.15067994G>A	ENSP00000424084:p.Arg587His		14677092	NM_001177383	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	ENST00000507071.1	37		.	.	.	.	.	.	.	.	.	.	G	19.69	3.874285	0.72180	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003;ENST00000507071;ENST00000345451;ENST00000382395;ENST00000382401;ENST00000259997;ENST00000382391	T;T;T;T;T;T;T;T	0.60040	0.22;0.23;0.37;0.42;0.45;0.48;0.44;0.4	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.73313	0.3571	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D;D	0.89917	0.992;1.0;0.99;0.984;1.0;1.0	P;D;P;P;D;D	0.87578	0.557;0.998;0.691;0.761;0.997;0.992	T	0.72286	-0.4338	10	0.72032	D	0.01	-2.8417	20.8598	0.99761	0.0:0.0:1.0:0.0	.	560;565;1005;1032;557;587	Q7Z5Q1-4;Q7Z5Q1-6;E7EPM3;F5H160;Q7Z5Q1-5;Q7Z5Q1	.;.;.;.;.;CPEB2_HUMAN	H	1032;1024;1005;587;557;565;560;595;574	ENSP00000443985:R1032H;ENSP00000437884:R1024H;ENSP00000414270:R1005H;ENSP00000424084:R587H;ENSP00000334058:R557H;ENSP00000371832:R565H;ENSP00000371838:R560H;ENSP00000259997:R595H	ENSP00000259997:R595H	R	+	2	0	CPEB2	14677092	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CGC		0.458	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000207349.2	XM_059607	
SLIT2	9353	broad.mit.edu	37	4	20512750	20512750	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr4:20512750C>G	ENST00000504154.1	+	11	1300	c.1048C>G	c.(1048-1050)Ctg>Gtg	p.L350V	SLIT2_ENST00000503837.1_Missense_Mutation_p.L354V|SLIT2_ENST00000503823.1_Missense_Mutation_p.L350V|SLIT2_ENST00000273739.5_Missense_Mutation_p.L354V	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	350					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.L350V(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACTACGCTCTCTGAATTCACT	0.383																																					p.L350V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1048G	4						.						86.0	84.0	85.0					4																	20512750		2203	4300	6503	20121848	SO:0001583	missense	9353	exon11			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1048C>G	4.37:g.20512750C>G	ENSP00000422591:p.Leu350Val		20121848	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198480	0.79015	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.80276	0.4593	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.81914	0.893;0.995	T	0.83263	-0.0047	10	0.87932	D	0	.	18.411	0.90550	0.0:1.0:0.0:0.0	.	350;350	O94813-3;O94813	.;SLIT2_HUMAN	V	350;350;354;354;354	ENSP00000427548:L350V;ENSP00000422591:L350V;ENSP00000273739:L354V;ENSP00000422261:L354V	ENSP00000273739:L354V	L	+	1	2	SLIT2	20121848	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	3.987000	0.56944	2.331000	0.79229	0.585000	0.79938	CTG		0.383	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
ARAP2	116984	broad.mit.edu	37	4	36189087	36189087	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr4:36189087C>A	ENST00000303965.4	-	8	2153	c.1664G>T	c.(1663-1665)aGa>aTa	p.R555I		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	555	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.R555I(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTTTTCTACTCTAAAAACAAA	0.289																																					p.R555I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1664T	4						.						50.0	49.0	50.0					4																	36189087		2200	4293	6493	35865482	SO:0001583	missense	116984	exon8			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1664G>T	4.37:g.36189087C>A	ENSP00000302895:p.Arg555Ile		35865482	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182789	0.78677	.	.	ENSG00000047365	ENST00000303965	T	0.12879	2.64	5.91	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.37705	0.1013	M	0.65498	2.005	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.87578	0.997;0.998	T	0.24440	-1.0160	10	0.87932	D	0	.	16.9801	0.86325	0.0:0.8723:0.1277:0.0	.	485;555	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	I	555	ENSP00000302895:R555I	ENSP00000302895:R555I	R	-	2	0	ARAP2	35865482	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.261000	0.58841	1.509000	0.48786	-0.133000	0.14855	AGA		0.289	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
NAA11	84779	broad.mit.edu	37	4	80246488	80246488	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr4:80246488C>T	ENST00000286794.4	-	1	716	c.544G>A	c.(544-546)Ggc>Agc	p.G182S	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	182					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.G182S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						AGTGTGCTGCCCTGGGTCTCC	0.557																																					p.G182S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G544A	4						.						53.0	54.0	54.0					4																	80246488		1953	4148	6101	80465512	SO:0001583	missense	84779	exon1				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.544G>A	4.37:g.80246488C>T	ENSP00000286794:p.Gly182Ser		80465512	NM_032693	Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	37	CCDS47084.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924880	0.34002	.	.	ENSG00000156269	ENST00000286794	T	0.55052	0.54	4.97	2.31	0.28768	.	0.505914	0.19557	U	0.111437	T	0.30103	0.0754	N	0.14661	0.345	0.09310	N	1	B	0.19706	0.038	B	0.12156	0.007	T	0.12811	-1.0533	10	0.38643	T	0.18	-6.7378	5.9621	0.19305	0.0:0.6178:0.0:0.3822	.	182	Q9BSU3	NAA11_HUMAN	S	182	ENSP00000286794:G182S	ENSP00000286794:G182S	G	-	1	0	NAA11	80465512	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.043000	0.13971	0.809000	0.34255	0.655000	0.94253	GGC		0.557	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1		
ATP6AP1L	92270	broad.mit.edu	37	5	81600752	81600753	+	Splice_Site	INS	-	-	A	rs201645066		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:81600752_81600753insA	ENST00000380167.4	+	7	857_858		c.e7-1		ATP6AP1L_ENST00000439350.1_5'Flank			Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like						ATP hydrolysis coupled proton transport (GO:0015991)	integral component of membrane (GO:0016021)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12						TGTCATTTCAGAAAAAAAAAGT	0.371																																					.												.	.	0			.	5						.																																			81636509	SO:0001630	splice_region_variant	92270	.			AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464			28091	protein-coding gene	gene with protein product							Standard	XR_112744		Approved		uc003khw.3	Q52LC2		ENST00000380167.4:c.-468-1->A	5.37:g.81600761_81600761dupA			81636508	.		Splice_Site	INS	ENST00000380167.4	37	CCDS34196.1																																																																																				0.371	ATP6AP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369562.3	NM_001017971	Intron
IL3	3562	broad.mit.edu	37	5	131398068	131398068	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:131398068G>A	ENST00000296870.2	+	3	446	c.268G>A	c.(268-270)Gca>Aca	p.A90T		NM_000588.3	NP_000579.2	P08700	IL3_HUMAN	interleukin 3	90					cell-cell signaling (GO:0007267)|embryonic hemopoiesis (GO:0035162)|immune response (GO:0006955)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-3 receptor binding (GO:0005135)	p.A90T(2)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)	10		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	TTTACAGAACGCATCAGCAAT	0.512																																					p.A90T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G268A	5						.						179.0	183.0	182.0					5																	131398068		2203	4300	6503	131425967	SO:0001583	missense	3562	exon3			M14743	CCDS4149.1	5q23-q31	2014-04-04	2014-04-04		ENSG00000164399	ENSG00000164399		"""Interleukins and interleukin receptors"""	6011	protein-coding gene	gene with protein product	"""multilineage-colony-stimulating factor"", ""hematopoietic growth factor"", ""P-cell stimulating factor"", ""mast-cell growth factor"", ""colony-stimulating factor, multiple"""	147740	"""interleukin 3 (colony-stimulating factor, multiple)"""			3489530	Standard	NM_000588		Approved	IL-3, MULTI-CSF, MCGF, MGC79398, MGC79399	uc003kwe.1	P08700	OTTHUMG00000059640	ENST00000296870.2:c.268G>A	5.37:g.131398068G>A	ENSP00000296870:p.Ala90Thr		131425967	NM_000588	Q6GS87	Missense_Mutation	SNP	ENST00000296870.2	37	CCDS4149.1	.	.	.	.	.	.	.	.	.	.	G	9.745	1.166026	0.21538	.	.	ENSG00000164399	ENST00000296870	T	0.34072	1.38	4.33	0.0657	0.14358	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	3.482320	0.00424	N	0.000063	T	0.24160	0.0585	L	0.34521	1.04	0.09310	N	1	B	0.33940	0.433	B	0.22880	0.042	T	0.10613	-1.0622	10	0.17832	T	0.49	8.436	6.8112	0.23805	0.7087:0.0:0.2913:0.0	.	90	P08700	IL3_HUMAN	T	90	ENSP00000296870:A90T	ENSP00000296870:A90T	A	+	1	0	IL3	131425967	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.425000	0.21346	-0.008000	0.14320	-0.140000	0.14226	GCA		0.512	IL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132639.1	NM_000588	
PLEKHG4B	153478	broad.mit.edu	37	5	144997	144997	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:144997G>A	ENST00000283426.6	+	4	849	c.799G>A	c.(799-801)Gct>Act	p.A267T	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	267							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A267T(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CAGGAGTCCAGCTGCCCCTGC	0.597																																					p.A267T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	5						.						57.0	55.0	55.0					5																	144997		2203	4299	6502	197997	SO:0001583	missense	153478	exon4			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.799G>A	5.37:g.144997G>A	ENSP00000283426:p.Ala267Thr		197997	NM_052909		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	13.36	2.214459	0.39102	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.59772	0.24;0.24	3.17	2.24	0.28232	.	.	.	.	.	T	0.38957	0.1060	L	0.28274	0.84	0.09310	N	1	P	0.52842	0.956	B	0.41764	0.366	T	0.11275	-1.0594	9	0.14252	T	0.57	.	8.1735	0.31268	0.0:0.5214:0.4786:0.0	.	267	Q96PX9	PKH4B_HUMAN	T	267;181	ENSP00000283426:A267T;ENSP00000422493:A181T	ENSP00000283426:A267T	A	+	1	0	PLEKHG4B	197997	0.044000	0.20184	0.001000	0.08648	0.014000	0.08584	1.879000	0.39618	1.317000	0.45149	0.313000	0.20887	GCT		0.597	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
CDH9	1007	broad.mit.edu	37	5	26916012	26916012	+	Silent	SNP	T	T	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:26916012T>C	ENST00000231021.4	-	3	421	c.249A>G	c.(247-249)aaA>aaG	p.K83K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	83	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K83K(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TTCCATCTCCTTTATCTTGGT	0.333																																					p.K83K	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A249G	5						.						71.0	73.0	72.0					5																	26916012		2203	4298	6501	26951769	SO:0001819	synonymous_variant	1007	exon3			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.249A>G	5.37:g.26916012T>C			26951769	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																				0.333	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CRHBP	1393	broad.mit.edu	37	5	76249497	76249497	+	Missense_Mutation	SNP	G	G	C	rs141268164|rs200529625		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:76249497G>C	ENST00000274368.4	+	2	575	c.153G>C	c.(151-153)gaG>gaC	p.E51D	CRHBP_ENST00000506501.1_Missense_Mutation_p.E51D	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	51					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.E51D(2)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TGGCTGGGGAGCAGCCGTACC	0.687																																					p.E51D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G153C	5						.						10.0	11.0	11.0					5																	76249497		2192	4280	6472	76285253	SO:0001583	missense	1393	exon2			X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.153G>C	5.37:g.76249497G>C	ENSP00000274368:p.Glu51Asp		76285253	NM_001882	Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	37	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080373	0.55753	.	.	ENSG00000145708	ENST00000274368;ENST00000506501	.	.	.	4.54	3.66	0.41972	CUB (1);	0.293159	0.37437	N	0.002095	T	0.50701	0.1631	L	0.46614	1.455	0.36296	D	0.856711	B;B	0.26708	0.157;0.157	B;B	0.34301	0.179;0.179	T	0.56438	-0.7979	9	0.33940	T	0.23	-24.1019	10.3303	0.43818	0.1548:0.0:0.8452:0.0	.	51;51	D6RHH7;P24387	.;CRHBP_HUMAN	D	51	.	ENSP00000274368:E51D	E	+	3	2	CRHBP	76285253	1.000000	0.71417	0.879000	0.34478	0.944000	0.59088	1.276000	0.33156	2.508000	0.84585	0.462000	0.41574	GAG		0.687	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882	
APC	324	broad.mit.edu	37	5	112175615	112175615	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:112175615delC	ENST00000457016.1	+	16	4704	c.4324delC	c.(4324-4326)cctfs	p.P1443fs	APC_ENST00000508376.2_Frame_Shift_Del_p.P1443fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.P1443fs			P25054	APC_HUMAN	adenomatous polyposis coli	1443	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.P1441fs*28(1)|p.S1436fs*22(1)|p.P1441fs*27(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACCTCCACCACCTCCTCAAAC	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.P1424fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - coding silent,-2 	.	6	Deletion - Frameshift(5)|Unknown(1)	large_intestine(4)|soft_tissue(1)|skin(1)	c.4270delC	5						.						113.0	99.0	104.0					5																	112175615		2202	4300	6502	112203514	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4324delC	5.37:g.112175615delC	ENSP00000413133:p.Pro1443fs		112203514	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.473	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGA6	56109	broad.mit.edu	37	5	140753849	140753849	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr5:140753849G>A	ENST00000517434.1	+	1	199	c.199G>A	c.(199-201)Gtc>Atc	p.V67I	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V67I(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCCGCATCGTCTCCAGAGG	0.597																																					p.V67I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	5						.						53.0	60.0	57.0					5																	140753849		2200	4300	6500	140734033	SO:0001583	missense	56109	exon1			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.199G>A	5.37:g.140753849G>A	ENSP00000429601:p.Val67Ile		140734033	NM_032086	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	7.131	0.579984	0.13686	.	.	ENSG00000253731	ENST00000517434	T	0.30714	1.52	5.19	0.306	0.15806	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.422327	0.13664	N	0.371407	T	0.22589	0.0545	L	0.53671	1.685	0.09310	N	1	P;B	0.35107	0.484;0.297	B;B	0.30251	0.069;0.113	T	0.11179	-1.0598	10	0.32370	T	0.25	.	6.4028	0.21648	0.3188:0.0:0.5707:0.1105	.	67;67	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	I	67	ENSP00000429601:V67I	ENSP00000429601:V67I	V	+	1	0	PCDHGA6	140734033	0.000000	0.05858	0.214000	0.23707	0.419000	0.31324	-1.003000	0.03682	-0.056000	0.13221	0.650000	0.86243	GTC		0.597	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
ASCC3	10973	broad.mit.edu	37	6	101077019	101077019	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:101077019T>A	ENST00000369162.2	-	27	4591	c.4247A>T	c.(4246-4248)aAa>aTa	p.K1416I		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1416	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.K1416I(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGCAATGGATTTCATATCAGG	0.428																																					p.K1416I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4247T	6						.						99.0	84.0	89.0					6																	101077019		2203	4300	6503	101183740	SO:0001583	missense	10973	exon27			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4247A>T	6.37:g.101077019T>A	ENSP00000358159:p.Lys1416Ile		101183740	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203522	0.79127	.	.	ENSG00000112249	ENST00000369162	T	0.37411	1.2	5.78	5.78	0.91487	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.054132	0.85682	D	0.000000	T	0.27629	0.0679	M	0.83852	2.665	0.80722	D	1	B	0.19073	0.033	B	0.26310	0.068	T	0.43458	-0.9390	10	0.62326	D	0.03	.	6.4228	0.21754	0.0:0.1883:0.0:0.8117	.	1416	Q8N3C0	HELC1_HUMAN	I	1416	ENSP00000358159:K1416I	ENSP00000358159:K1416I	K	-	2	0	ASCC3	101183740	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.922000	0.63404	2.333000	0.79357	0.482000	0.46254	AAA		0.428	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
TAAR2	9287	broad.mit.edu	37	6	132938832	132938832	+	Silent	SNP	A	A	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:132938832A>T	ENST00000367931.1	-	2	512	c.513T>A	c.(511-513)ccT>ccA	p.P171P	TAAR2_ENST00000275191.2_Silent_p.P126P|TAAR2_ENST00000537809.1_Silent_p.P126P			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	171					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.P171P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CAAATGCTCCAGGGACCGACC	0.428																																					p.P171P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T513A	6						.						60.0	59.0	59.0					6																	132938832		2203	4300	6503	132980525	SO:0001819	synonymous_variant	9287	exon2			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.513T>A	6.37:g.132938832A>T			132980525	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Silent	SNP	ENST00000367931.1	37	CCDS34541.1																																																																																				0.428	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
SYNE1	23345	broad.mit.edu	37	6	152453311	152453311	+	Silent	SNP	G	G	T	rs376254773		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:152453311G>T	ENST00000367255.5	-	144	26641	c.26040C>A	c.(26038-26040)acC>acA	p.T8680T	SYNE1_ENST00000356820.4_Silent_p.T3204T|SYNE1_ENST00000539504.1_Silent_p.T835T|SYNE1_ENST00000341594.5_Silent_p.T8292T|SYNE1_ENST00000265368.4_Silent_p.T8680T|SYNE1_ENST00000448038.1_Silent_p.T8632T|SYNE1_ENST00000423061.1_Silent_p.T8632T|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000354674.4_Silent_p.T858T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8680	Ser-rich.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T8680T(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGACCCTGAGGTGTCCAGTT	0.507										HNSCC(10;0.0054)																											p.T3204T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C9612A	6						.						179.0	157.0	164.0					6																	152453311		2203	4300	6503	152495004	SO:0001819	synonymous_variant	23345	exon59			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.26040C>A	6.37:g.152453311G>T			152495004	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.507	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MBOAT1	154141	broad.mit.edu	37	6	20113183	20113183	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:20113183G>A	ENST00000324607.7	-	11	1297	c.1133C>T	c.(1132-1134)gCt>gTt	p.A378V	MBOAT1_ENST00000541730.1_Missense_Mutation_p.A229V	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	378					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)	p.A378V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			ATGCCACAAAGCAGACAGGAT	0.478																																					p.A378V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1133T	6						.						131.0	105.0	114.0					6																	20113183		2203	4300	6503	20221162	SO:0001583	missense	154141	exon11			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.1133C>T	6.37:g.20113183G>A	ENSP00000324944:p.Ala378Val		20221162	NM_001080480	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	ENST00000324607.7	37	CCDS34346.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250527	0.95305	.	.	ENSG00000172197	ENST00000541730;ENST00000324607	D;D	0.81659	-1.52;-1.52	5.83	5.83	0.93111	.	0.047842	0.85682	D	0.000000	D	0.92153	0.7512	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.981	D	0.93842	0.7137	10	0.87932	D	0	-16.459	15.2422	0.73480	0.0:0.14:0.86:0.0	.	229;378	Q6ZNC8-2;Q6ZNC8	.;MBOA1_HUMAN	V	229;378	ENSP00000441568:A229V;ENSP00000324944:A378V	ENSP00000324944:A378V	A	-	2	0	MBOAT1	20221162	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.366000	0.79548	2.770000	0.95276	0.655000	0.94253	GCT		0.478	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039980.1		
GRM4	2914	broad.mit.edu	37	6	34008040	34008040	+	Missense_Mutation	SNP	C	C	T	rs528782611		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:34008040C>T	ENST00000538487.2	-	8	1864	c.1421G>A	c.(1420-1422)cGc>cAc	p.R474H	GRM4_ENST00000374177.3_Missense_Mutation_p.R358H|GRM4_ENST00000455714.2_Missense_Mutation_p.R334H|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374181.4_Missense_Mutation_p.R474H|GRM4_ENST00000609222.1_Missense_Mutation_p.R341H|GRM4_ENST00000535756.1_Missense_Mutation_p.R341H|GRM4_ENST00000544773.2_Missense_Mutation_p.R305H	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	474					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.R474H(2)|p.R358H(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GATGTCATAGCGCCCAGGCGC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19104	0.0		0.001	False		,,,				2504	0.0				p.R474H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1421A	6						.						157.0	150.0	152.0					6																	34008040		2203	4300	6503	34116018	SO:0001583	missense	2914	exon7			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1421G>A	6.37:g.34008040C>T	ENSP00000440556:p.Arg474His		34116018	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598951	0.87055	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	4.59	4.59	0.56863	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	M	0.87038	2.855	0.80722	D	1	B;B;D;D;B	0.64830	0.114;0.016;0.987;0.994;0.029	B;B;B;P;B	0.55667	0.026;0.005;0.347;0.781;0.013	D	0.90005	0.4117	10	0.54805	T	0.06	.	17.579	0.87960	0.0:1.0:0.0:0.0	.	427;305;334;474;341	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	H	474;358;166;341;305;474;334	ENSP00000363296:R474H;ENSP00000363292:R358H;ENSP00000445533:R166H;ENSP00000437925:R341H;ENSP00000437730:R305H;ENSP00000440556:R474H;ENSP00000398456:R334H	ENSP00000363292:R358H	R	-	2	0	GRM4	34116018	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.636000	0.83301	2.361000	0.80049	0.585000	0.79938	CGC		0.567	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
DNAH8	1769	broad.mit.edu	37	6	38942189	38942189	+	Missense_Mutation	SNP	C	C	T	rs569195029		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:38942189C>T	ENST00000359357.3	+	83	12321	c.12067C>T	c.(12067-12069)Cgc>Tgc	p.R4023C	DNAH8_ENST00000441566.1_Missense_Mutation_p.R3987C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4023	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R4023C(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCAAGGTGTACGCGCAGGTTT	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		17816	0.0		0.0	False		,,,				2504	0.001				p.R4023C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C12067T	6						.						76.0	69.0	72.0					6																	38942189		2203	4300	6503	39050167	SO:0001583	missense	1769	exon83			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12067C>T	6.37:g.38942189C>T	ENSP00000352312:p.Arg4023Cys		39050167	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	23.4	4.412605	0.83340	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.09350	2.99;2.99;2.99	5.84	5.84	0.93424	Dynein heavy chain (1);	0.065044	0.56097	D	0.000021	T	0.41880	0.1178	H	0.97659	4.05	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74023	0.969;0.982	T	0.60480	-0.7255	10	0.87932	D	0	.	14.9201	0.70832	0.143:0.857:0.0:0.0	.	3987;4023	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	C	4228;4023;3987	ENSP00000333363:R4228C;ENSP00000352312:R4023C;ENSP00000402294:R3987C	ENSP00000333363:R4228C	R	+	1	0	DNAH8	39050167	0.888000	0.30383	0.725000	0.30721	0.955000	0.61496	2.052000	0.41316	2.764000	0.94973	0.655000	0.94253	CGC		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
SAYSD1	55776	broad.mit.edu	37	6	39073338	39073338	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:39073338G>A	ENST00000229903.4	-	2	521	c.422C>T	c.(421-423)cCt>cTt	p.P141L	SAYSD1_ENST00000373249.1_Missense_Mutation_p.P74L	NM_018322.1	NP_060792.1	Q9NPB0	SMDC1_HUMAN	SAYSVFN motif domain containing 1	141						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)		p.P141L(1)									CTTCTCTTCAGGGCCTCGTGT	0.542																																					p.P141L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C422T	6						.						174.0	174.0	174.0					6																	39073338		2203	4300	6503	39181316	SO:0001583	missense	55776	exon2			BC022007	CCDS4840.1	6p21.1	2011-12-13	2011-12-13	2011-12-13	ENSG00000112167	ENSG00000112167			21025	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 64"""	C6orf64			Standard	XM_005249222		Approved	FLJ11101	uc003ook.1	Q9NPB0	OTTHUMG00000014641	ENST00000229903.4:c.422C>T	6.37:g.39073338G>A	ENSP00000229903:p.Pro141Leu		39181316	NM_018322	Q9H0D8	Missense_Mutation	SNP	ENST00000229903.4	37	CCDS4840.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821361	0.90873	.	.	ENSG00000112167	ENST00000373249;ENST00000229903	.	.	.	6.08	6.08	0.98989	Uncharacterised domain SAYSvFN (1);	0.050586	0.85682	D	0.000000	T	0.73257	0.3564	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.73075	-0.4097	9	0.72032	D	0.01	-15.7844	20.2585	0.98435	0.0:0.0:1.0:0.0	.	141	Q9NPB0	CF064_HUMAN	L	74;141	.	ENSP00000229903:P141L	P	-	2	0	C6orf64	39181316	1.000000	0.71417	0.110000	0.21437	0.744000	0.42396	6.901000	0.75693	2.894000	0.99253	0.655000	0.94253	CCT		0.542	SAYSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040448.1	NM_018322	
EFHC1	114327	broad.mit.edu	37	6	52303267	52303267	+	Missense_Mutation	SNP	C	C	T	rs200375854	byFrequency	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:52303267C>T	ENST00000371068.5	+	3	554	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	EFHC1_ENST00000433625.2_Missense_Mutation_p.R60C|EFHC1_ENST00000491749.1_3'UTR|EFHC1_ENST00000538167.1_Missense_Mutation_p.R132C	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	151	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.R151C(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					GTTAATAAAACGCCAGCGGCT	0.418													C|||	3	0.000599042	0.0	0.0	5008	,	,		19481	0.0		0.001	False		,,,				2504	0.002				p.R151C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C451T	6						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	56.0	59.0	58.0		394,451	4.7	1.0	6		58	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EFHC1	NM_001172420.1,NM_018100.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	132/622,151/641	52303267	1,13005	2203	4300	6503	52411226	SO:0001583	missense	114327	exon3			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.451C>T	6.37:g.52303267C>T	ENSP00000360107:p.Arg151Cys		52411226	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	37	CCDS4942.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	24.0	4.481157	0.84747	0.0	1.16E-4	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.78246	-1.16;-1.16;-1.16	5.56	4.67	0.58626	Uncharacterised domain DM10 (2);	0.000000	0.85682	D	0.000000	D	0.90307	0.6968	H	0.95950	3.745	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93578	0.6910	10	0.87932	D	0	-12.1289	15.5549	0.76184	0.139:0.861:0.0:0.0	.	132;60;151	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	C	151;60;132	ENSP00000360107:R151C;ENSP00000416492:R60C;ENSP00000444521:R132C	ENSP00000360107:R151C	R	+	1	0	EFHC1	52411226	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.777000	0.55364	1.306000	0.44926	0.655000	0.94253	CGC		0.418	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
LCA5	167691	broad.mit.edu	37	6	80198861	80198861	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:80198861T>A	ENST00000392959.1	-	8	1782	c.1171A>T	c.(1171-1173)Aaa>Taa	p.K391*	LCA5_ENST00000369846.4_Nonsense_Mutation_p.K391*|LCA5_ENST00000467898.3_Nonsense_Mutation_p.K391*	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	391					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)	p.K391*(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		GTAACAAATTTTTCTTCTCTT	0.368																																					p.K391X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1171T	6						.						159.0	149.0	152.0					6																	80198861		2202	4300	6502	80255580	SO:0001587	stop_gained	167691	exon8				CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1171A>T	6.37:g.80198861T>A	ENSP00000376686:p.Lys391*		80255580	NM_181714	E1P542|Q9BWX7	Nonsense_Mutation	SNP	ENST00000392959.1	37	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	T	37	6.493404	0.97612	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	.	.	.	5.51	1.52	0.23074	.	0.747671	0.13104	N	0.413560	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.2569	5.4575	0.16598	0.0:0.1747:0.1437:0.6816	.	.	.	.	X	391	.	ENSP00000358861:K391X	K	-	1	0	LCA5	80255580	0.934000	0.31675	0.336000	0.25522	0.358000	0.29455	1.090000	0.30902	0.068000	0.16574	0.533000	0.62120	AAA		0.368	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
BACH2	60468	broad.mit.edu	37	6	90661256	90661256	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:90661256A>T	ENST00000257749.4	-	7	1276	c.569T>A	c.(568-570)aTc>aAc	p.I190N	RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.I190N|BACH2_ENST00000343122.3_Missense_Mutation_p.I190N|RP3-512E2.2_ENST00000445838.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	190						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.I190N(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTCAAAGCTGATGGGCTCTGG	0.597																																					p.I190N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T569A	6						.						97.0	94.0	95.0					6																	90661256		2203	4300	6503	90717977	SO:0001583	missense	60468	exon7			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.569T>A	6.37:g.90661256A>T	ENSP00000257749:p.Ile190Asn		90717977	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.512712	0.27123	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.38240	1.15;1.15;1.15	5.55	3.15	0.36227	.	0.664388	0.16428	N	0.214834	T	0.08088	0.0202	N	0.14661	0.345	0.33622	D	0.6049	B	0.28128	0.201	B	0.23716	0.048	T	0.16364	-1.0405	10	0.32370	T	0.25	-17.0582	8.8554	0.35225	0.7417:0.1323:0.0:0.126	.	190	Q9BYV9	BACH2_HUMAN	N	190	ENSP00000257749:I190N;ENSP00000437473:I190N;ENSP00000345642:I190N	ENSP00000257749:I190N	I	-	2	0	BACH2	90717977	0.988000	0.35896	0.982000	0.44146	0.954000	0.61252	2.602000	0.46257	0.395000	0.25257	0.460000	0.39030	ATC		0.597	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
FNDC1	84624	broad.mit.edu	37	6	159653063	159653063	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr6:159653063C>G	ENST00000297267.9	+	11	1719	c.1519C>G	c.(1519-1521)Ctt>Gtt	p.L507V	FNDC1_ENST00000340366.6_Missense_Mutation_p.L444V	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	507					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L507V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGACCTTCTTCTTGACTTGAA	0.537																																					p.L507V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1519G	6						.						31.0	33.0	32.0					6																	159653063		1862	4107	5969	159573053	SO:0001583	missense	84624	exon11			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1519C>G	6.37:g.159653063C>G	ENSP00000297267:p.Leu507Val		159573053	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.998|7.998	0.754687|0.754687	0.15778|0.15778	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.07688|.	3.17;3.95|.	5.93|5.93	3.15|3.15	0.36227|0.36227	.|.	1.004840|.	0.08011|.	N|.	0.990400|.	T|T	0.09598|0.09598	0.0236|0.0236	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	P;P|.	0.41848|.	0.763;0.651|.	B;B|.	0.42361|.	0.385;0.057|.	T|T	0.32025|0.32025	-0.9922|-0.9922	10|5	0.29301|.	T|.	0.29|.	-7.3606|-7.3606	4.4867|4.4867	0.11794|0.11794	0.0:0.5357:0.1616:0.3027|0.0:0.5357:0.1616:0.3027	.|.	444;507|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	V|C	507;444|402	ENSP00000297267:L507V;ENSP00000342460:L444V|.	ENSP00000297267:L507V|.	L|S	+|+	1|2	0|0	FNDC1|FNDC1	159573053|159573053	0.889000|0.889000	0.30405|0.30405	0.001000|0.001000	0.08648|0.08648	0.818000|0.818000	0.46254|0.46254	1.055000|1.055000	0.30467|0.30467	0.388000|0.388000	0.25054|0.25054	-0.140000|-0.140000	0.14226|0.14226	CTT|TCT		0.537	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
ATG9B	285973	broad.mit.edu	37	7	150721376	150721377	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:150721376_150721377insC	ENST00000377974.2	-	1	209_210	c.134_135insG	c.(133-135)ggafs	p.G45fs	ATG9B_ENST00000605952.1_Frame_Shift_Ins_p.G45fs|ATG9B_ENST00000605938.1_Frame_Shift_Ins_p.G45fs|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	45	Pro-rich.				autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGATCCTCCCTCCCCCAGGTCC	0.668																																					p.G45fs												.	.	0			c.135_136insG	7						.																																			150352310	SO:0001589	frameshift_variant	285973	exon1			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.135dupG	7.37:g.150721381_150721381dupC	ENSP00000475005:p.Gly45fs		150352309	NM_173681	A1A5D3|Q6JRW5|Q8N8I8	Frame_Shift_Ins	INS	ENST00000377974.2	37																																																																																					0.668	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681	
HBP1	26959	broad.mit.edu	37	7	106823003	106823003	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:106823003A>G	ENST00000222574.4	+	3	541	c.355A>G	c.(355-357)Acc>Gcc	p.T119A	HBP1_ENST00000468410.1_Missense_Mutation_p.T119A|HBP1_ENST00000485846.1_Missense_Mutation_p.T119A	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	119					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.T119A(1)		large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						AAATATCGCGACCAGTCCACA	0.368																																					p.T119A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A355G	7						.						56.0	51.0	53.0					7																	106823003		2203	4300	6503	106610239	SO:0001583	missense	26959	exon3			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.355A>G	7.37:g.106823003A>G	ENSP00000222574:p.Thr119Ala		106610239	NM_012257	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	ENST00000222574.4	37	CCDS5741.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813826	0.90790	.	.	ENSG00000105856	ENST00000468410;ENST00000464009;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99527	-6.09;-6.09;-6.09	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.99111	0.9694	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	0.993;1.0;0.999	D;D;D	0.85130	0.978;0.997;0.994	D	0.99914	1.1217	10	0.87932	D	0	-15.0142	16.255	0.82510	1.0:0.0:0.0:0.0	.	129;119;119	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	A	119;119;119;119;111	ENSP00000420500:T119A;ENSP00000222574:T119A;ENSP00000418738:T119A	ENSP00000222574:T119A	T	+	1	0	HBP1	106610239	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.170000	0.94795	2.240000	0.73641	0.533000	0.62120	ACC		0.368	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
COG5	10466	broad.mit.edu	37	7	107167772	107167772	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:107167772G>A	ENST00000347053.3	-	6	591	c.541C>T	c.(541-543)Cgt>Tgt	p.R181C	COG5_ENST00000393603.2_Missense_Mutation_p.R181C|COG5_ENST00000297135.3_Missense_Mutation_p.R181C|COG5_ENST00000475638.2_5'UTR	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	181					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.R181C(1)		breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						TTCAAGATACGAATAATCCTC	0.363																																					p.R181C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C541T	7						.						84.0	79.0	81.0					7																	107167772		2203	4300	6503	106955008	SO:0001583	missense	10466	exon6			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.541C>T	7.37:g.107167772G>A	ENSP00000334703:p.Arg181Cys		106955008	NM_001161520	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	G	32	5.173454	0.94807	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.28666	1.64;1.62;1.6	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.63885	0.2549	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69135	-0.5225	10	0.72032	D	0.01	-6.4823	19.6818	0.95967	0.0:0.0:1.0:0.0	.	181;181	Q9UP83;Q9UP83-2	COG5_HUMAN;.	C	181	ENSP00000334703:R181C;ENSP00000297135:R181C;ENSP00000377228:R181C	ENSP00000297135:R181C	R	-	1	0	COG5	106955008	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.420000	0.97426	2.724000	0.93272	0.650000	0.86243	CGT		0.363	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4		
PTPRZ1	5803	broad.mit.edu	37	7	121651459	121651459	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:121651459G>T	ENST00000393386.2	+	12	2770	c.2359G>T	c.(2359-2361)Gct>Tct	p.A787S	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	787					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A787S(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TACCCCTGCTGCTTCAAGTAG	0.473																																					p.A787S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2359T	7						.						274.0	234.0	247.0					7																	121651459		2203	4300	6503	121438695	SO:0001583	missense	5803	exon12			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2359G>T	7.37:g.121651459G>T	ENSP00000377047:p.Ala787Ser		121438695	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920932	0.52653	.	.	ENSG00000106278	ENST00000393386	T	0.49720	0.77	5.87	5.87	0.94306	.	0.262975	0.33792	N	0.004548	T	0.45975	0.1369	M	0.67953	2.075	0.80722	D	1	P	0.48294	0.908	B	0.41860	0.368	T	0.45396	-0.9264	10	0.39692	T	0.17	.	10.254	0.43385	0.151:0.0:0.849:0.0	.	787	P23471	PTPRZ_HUMAN	S	787	ENSP00000377047:A787S	ENSP00000377047:A787S	A	+	1	0	PTPRZ1	121438695	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.404000	0.59735	2.778000	0.95560	0.655000	0.94253	GCT		0.473	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
ELMO1	9844	broad.mit.edu	37	7	36895251	36895251	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:36895251G>A	ENST00000310758.4	-	22	2736	c.2089C>T	c.(2089-2091)Cgc>Tgc	p.R697C	ELMO1_ENST00000442504.1_Missense_Mutation_p.R697C|ELMO1_ENST00000396045.3_Missense_Mutation_p.R217C|ELMO1_ENST00000341056.3_Missense_Mutation_p.R399C|ELMO1_ENST00000396040.2_Missense_Mutation_p.R217C|ELMO1_ENST00000448602.1_Missense_Mutation_p.R697C	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	697					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.R697C(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						TCCAGGAGGCGGAGCTTGATT	0.552																																					p.R217C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C649T	7						.						158.0	142.0	148.0					7																	36895251		2203	4300	6503	36861776	SO:0001583	missense	9844	exon7			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2089C>T	7.37:g.36895251G>A	ENSP00000312185:p.Arg697Cys		36861776	NM_001039459	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010785	0.93346	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.57595	1.06;0.39;2.02;0.39;2.02;2.02	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.74884	0.3775	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78881	-0.2029	10	0.87932	D	0	.	18.3562	0.90358	0.0:0.0:1.0:0.0	.	697	Q92556	ELMO1_HUMAN	C	399;217;697;601;217;697;697	ENSP00000342142:R399C;ENSP00000379360:R217C;ENSP00000312185:R697C;ENSP00000379355:R217C;ENSP00000406952:R697C;ENSP00000394458:R697C	ENSP00000312185:R697C	R	-	1	0	ELMO1	36861776	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.639000	0.89480	0.650000	0.86243	CGC		0.552	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
SUN3	256979	broad.mit.edu	37	7	48046872	48046872	+	Missense_Mutation	SNP	C	C	T	rs145833872		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:48046872C>T	ENST00000297325.4	-	5	541	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	SUN3_ENST00000412142.1_Missense_Mutation_p.E28K|SUN3_ENST00000453192.2_Missense_Mutation_p.E116K|SUN3_ENST00000395572.2_Missense_Mutation_p.E128K	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	128						integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)		p.E128K(2)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTATTTGTTCGATCAAAAAT	0.418																																					p.E128K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G382A	7						.	T	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	120.0	115.0	117.0		382,382	4.5	0.7	7	dbSNP_134	117	0,8600		0,0,4300	no	missense,missense	SUN3	NM_001030019.1,NM_152782.3	56,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	128/358,128/358	48046872	1,13005	2203	4300	6503	48013397	SO:0001583	missense	256979	exon6			AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.382G>A	7.37:g.48046872C>T	ENSP00000297325:p.Glu128Lys		48013397	NM_152782	A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	37	CCDS34636.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718938	0.30503	2.27E-4	0.0	ENSG00000164744	ENST00000297325;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771	T;T;T;T;T	0.23348	1.91;1.95;1.91;2.52;1.95	5.56	4.49	0.54785	.	0.156786	0.41294	D	0.000903	T	0.10723	0.0262	N	0.24115	0.695	0.23144	N	0.998224	B;B;P	0.48230	0.152;0.374;0.907	B;B;B	0.30316	0.014;0.109;0.114	T	0.24261	-1.0165	10	0.10111	T	0.7	.	10.1888	0.43013	0.0:0.8957:0.0:0.1043	.	116;28;128	E7EWC8;Q8TAQ9-2;Q8TAQ9	.;.;SUN3_HUMAN	K	128;28;128;116;28	ENSP00000297325:E128K;ENSP00000410204:E28K;ENSP00000378939:E128K;ENSP00000387525:E116K;ENSP00000409077:E28K	ENSP00000297325:E128K	E	-	1	0	SUN3	48013397	0.835000	0.29415	0.739000	0.30968	0.314000	0.28054	1.259000	0.32956	2.613000	0.88420	0.655000	0.94253	GAA		0.418	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782	
CCDC132	55610	broad.mit.edu	37	7	92881978	92881978	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:92881978G>A	ENST00000305866.5	+	3	243	c.115G>A	c.(115-117)Gaa>Aaa	p.E39K	CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000544910.1_Missense_Mutation_p.E9K|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000541136.1_Intron|CCDC132_ENST00000251739.5_Missense_Mutation_p.E39K	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	39						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.E39K(2)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AGAATTCAGGGAACTTCGAGA	0.294																																					p.E39K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G115A	7						.						68.0	73.0	72.0					7																	92881978		2203	4300	6503	92719914	SO:0001583	missense	55610	exon3			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.115G>A	7.37:g.92881978G>A	ENSP00000307666:p.Glu39Lys		92719914	NM_024553	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022704	0.93462	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	5.25	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.33440	0.0863	N	0.24115	0.695	0.80722	D	1	B;B;B	0.33637	0.002;0.002;0.42	B;B;B	0.25506	0.006;0.004;0.061	T	0.13442	-1.0509	9	0.17369	T	0.5	0.5918	13.6136	0.62094	0.0749:0.0:0.9251:0.0	.	9;39;39	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	K	39;39;9;39	.	ENSP00000251739:E39K	E	+	1	0	CCDC132	92719914	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.055000	0.76656	2.638000	0.89438	0.467000	0.42956	GAA		0.294	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
COL1A2	1278	broad.mit.edu	37	7	94043011	94043011	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:94043011G>A	ENST00000297268.6	+	27	2038	c.1567G>A	c.(1567-1569)Ggt>Agt	p.G523S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	523					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G523S(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGGTGCTCCAGGTCCTGATGG	0.438										HNSCC(75;0.22)																											p.G523S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1567A	7						.						103.0	98.0	99.0					7																	94043011		2203	4300	6503	93880947	SO:0001583	missense	1278	exon27			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1567G>A	7.37:g.94043011G>A	ENSP00000297268:p.Gly523Ser		93880947	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800925	0.90538	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.98762	-5.12	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.99453	0.9806	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98463	1.0597	10	0.87932	D	0	.	19.5643	0.95386	0.0:0.0:1.0:0.0	.	523	P08123	CO1A2_HUMAN	S	523;524	ENSP00000297268:G523S	ENSP00000297268:G523S	G	+	1	0	COL1A2	93880947	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.010000	0.88615	2.700000	0.92200	0.655000	0.94253	GGT		0.438	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
ASIC3	9311	broad.mit.edu	37	7	150749267	150749267	+	Silent	SNP	G	G	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr7:150749267G>A	ENST00000349064.5	+	9	1599	c.1401G>A	c.(1399-1401)aaG>aaA	p.K467K	ASIC3_ENST00000357922.4_Silent_p.K467K|ASIC3_ENST00000297512.8_Silent_p.K467K	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	467					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)	p.K467K(2)									TCCGAGACAAGGTCCTGGGAT	0.612																																					p.K467K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1401A	7						.						132.0	135.0	134.0					7																	150749267		2203	4300	6503	150380200	SO:0001819	synonymous_variant	9311	exon9			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.1401G>A	7.37:g.150749267G>A			150380200	NM_020321	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	G	2.987	-0.209026	0.06140	.	.	ENSG00000213199	ENST00000485929	.	.	.	4.15	-0.978	0.10279	.	.	.	.	.	T	0.43344	0.1243	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22591	-1.0212	4	.	.	.	-7.4465	3.9133	0.09213	0.4499:0.1851:0.365:0.0	.	.	.	.	K	93	.	.	R	+	2	0	ACCN3	150380200	0.326000	0.24669	0.166000	0.22797	0.334000	0.28698	0.057000	0.14279	-0.452000	0.07087	0.561000	0.74099	AGG		0.612	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
VPS13B	157680	broad.mit.edu	37	8	100654166	100654166	+	Missense_Mutation	SNP	T	T	G	rs180177363		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr8:100654166T>G	ENST00000358544.2	+	34	5534	c.5423T>G	c.(5422-5424)aTa>aGa	p.I1808R	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.I1783R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1808					protein transport (GO:0015031)			p.I1808R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATAGTGCAAATAGAGCAGCAC	0.423																																					p.I1783R	Colon(161;2205 2542 7338 31318)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5348G	8						.						110.0	102.0	105.0					8																	100654166		2203	4300	6503	100723342	SO:0001583	missense	157680	exon34			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.5423T>G	8.37:g.100654166T>G	ENSP00000351346:p.Ile1808Arg		100723342	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252600	0.80135	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.71222	-0.55;-0.55	5.93	5.93	0.95920	.	0.057743	0.64402	D	0.000003	T	0.72890	0.3517	L	0.29908	0.895	0.80722	D	1	D;D	0.63880	0.993;0.989	P;P	0.56700	0.804;0.641	T	0.75144	-0.3421	10	0.54805	T	0.06	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	1783;1808	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	R	1783;1808	ENSP00000349685:I1783R;ENSP00000351346:I1808R	ENSP00000349685:I1783R	I	+	2	0	VPS13B	100723342	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.030000	0.70903	2.281000	0.76405	0.533000	0.62120	ATA		0.423	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
LRP12	29967	broad.mit.edu	37	8	105503733	105503733	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr8:105503733C>A	ENST00000276654.5	-	7	1856	c.1748G>T	c.(1747-1749)cGa>cTa	p.R583L	LRP12_ENST00000424843.2_Missense_Mutation_p.R564L|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	583					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R583L(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AAGCTGAGATCGTACCGCTAG	0.358																																					p.R583L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1748T	8						.						51.0	53.0	52.0					8																	105503733		2203	4300	6503	105572909	SO:0001583	missense	29967	exon7			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1748G>T	8.37:g.105503733C>A	ENSP00000276654:p.Arg583Leu		105572909	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346521	0.95807	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523007	D;D;D	0.94793	-2.08;-2.01;-3.52	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.95812	0.8637	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79108	0.992;0.987	D	0.95701	0.8749	10	0.59425	D	0.04	-15.4184	20.5373	0.99239	0.0:1.0:0.0:0.0	.	564;583	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	L	564;583;172	ENSP00000399148:R564L;ENSP00000276654:R583L;ENSP00000429305:R172L	ENSP00000276654:R583L	R	-	2	0	LRP12	105572909	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	7.263000	0.78421	2.857000	0.98124	0.650000	0.86243	CGA		0.358	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
MSR1	4481	broad.mit.edu	37	8	16021576	16021576	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr8:16021576T>G	ENST00000262101.5	-	5	936	c.815A>C	c.(814-816)cAa>cCa	p.Q272P	MSR1_ENST00000381998.4_Missense_Mutation_p.Q272P|MSR1_ENST00000350896.3_Missense_Mutation_p.Q272P|MSR1_ENST00000536385.1_Missense_Mutation_p.Q46P|MSR1_ENST00000445506.2_Missense_Mutation_p.Q290P|MSR1_ENST00000355282.2_Missense_Mutation_p.Q272P			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	272					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.Q272P(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CATTTTACCTTGAATTAAAGT	0.289																																					p.Q272P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A815C	8						.						104.0	95.0	98.0					8																	16021576		2203	4297	6500	16065947	SO:0001583	missense	4481	exon5			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.815A>C	8.37:g.16021576T>G	ENSP00000262101:p.Gln272Pro		16065947	NM_138716	D3DSP3|O60505|P21759|Q45F10	Missense_Mutation	SNP	ENST00000262101.5	37	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	T	18.10	3.548772	0.65311	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000522672;ENST00000381998;ENST00000536385	D;D;D;D;D;D;D	0.95482	-3.72;-3.28;-3.28;-3.72;-3.72;-3.28;-3.28	4.8	4.8	0.61643	Macrophage scavenger receptor (1);	0.000000	0.56097	D	0.000034	D	0.94029	0.8087	N	0.05554	-0.025	0.43360	D	0.995434	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.997;0.994;0.999	D	0.94933	0.8084	10	0.59425	D	0.04	.	12.971	0.58513	0.0:0.0:0.0:1.0	.	46;290;272;272;272	F5GZJ2;B4DDJ5;P21757-2;P21757-3;P21757	.;.;.;.;MSRE_HUMAN	P	272;272;290;272;62;272;46	ENSP00000262100:Q272P;ENSP00000262101:Q272P;ENSP00000405453:Q290P;ENSP00000347430:Q272P;ENSP00000430536:Q62P;ENSP00000371428:Q272P;ENSP00000444414:Q46P	ENSP00000262101:Q272P	Q	-	2	0	MSR1	16065947	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.320000	0.59203	2.100000	0.63781	0.533000	0.62120	CAA		0.289	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
LOXL2	4017	broad.mit.edu	37	8	23198662	23198662	+	Missense_Mutation	SNP	G	G	A	rs143674437		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr8:23198662G>A	ENST00000389131.3	-	4	955	c.586C>T	c.(586-588)Cgc>Tgc	p.R196C	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	196	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)	p.R196C(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GTGCGCTTGCGGTAGGTTGAG	0.572																																					p.R196C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C586T	8						.	G	CYS/ARG	0,4406		0,0,2203	152.0	121.0	132.0		586	5.7	1.0	8	dbSNP_134	132	3,8597	3.0+/-9.4	0,3,4297	yes	missense	LOXL2	NM_002318.2	180	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	196/775	23198662	3,13003	2203	4300	6503	23254607	SO:0001583	missense	4017	exon4			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.586C>T	8.37:g.23198662G>A	ENSP00000373783:p.Arg196Cys		23254607	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225123	0.58668	0.0	3.49E-4	ENSG00000134013	ENST00000389131	T	0.01379	4.96	5.68	5.68	0.88126	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.050644	0.85682	D	0.000000	T	0.06188	0.0160	M	0.81682	2.555	0.58432	D	0.999997	D	0.55605	0.972	P	0.51701	0.677	T	0.01500	-1.1339	10	0.72032	D	0.01	.	16.5119	0.84288	0.0:0.0:1.0:0.0	.	196	Q9Y4K0	LOXL2_HUMAN	C	196	ENSP00000373783:R196C	ENSP00000373783:R196C	R	-	1	0	LOXL2	23254607	1.000000	0.71417	0.998000	0.56505	0.118000	0.20060	4.543000	0.60684	2.670000	0.90874	0.655000	0.94253	CGC		0.572	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
DENND3	22898	broad.mit.edu	37	8	142188188	142188188	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr8:142188188C>T	ENST00000262585.2	+	16	2767	c.2489C>T	c.(2488-2490)gCg>gTg	p.A830V	DENND3_ENST00000519811.1_Missense_Mutation_p.A910V|DENND3_ENST00000518806.1_3'UTR|DENND3_ENST00000424248.1_Missense_Mutation_p.A778V	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	830					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A830V(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GTCCAGCAGGCGCTGACCAAC	0.517																																					p.A830V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2489T	8						.						75.0	73.0	73.0					8																	142188188		2203	4300	6503	142257370	SO:0001583	missense	22898	exon16			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2489C>T	8.37:g.142188188C>T	ENSP00000262585:p.Ala830Val		142257370	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813126	0.90707	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811	T;T;T	0.48836	1.3;0.8;1.26	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.69967	0.3170	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74722	-0.3569	10	0.87932	D	0	-42.1167	18.1377	0.89624	0.0:1.0:0.0:0.0	.	910;830	E9PF32;A2RUS2	.;DEND3_HUMAN	V	830;778;910	ENSP00000262585:A830V;ENSP00000410594:A778V;ENSP00000428714:A910V	ENSP00000262585:A830V	A	+	2	0	DENND3	142257370	1.000000	0.71417	0.991000	0.47740	0.549000	0.35272	7.257000	0.78362	2.285000	0.76669	0.655000	0.94253	GCG		0.517	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
FAM214B	80256	broad.mit.edu	37	9	35107646	35107646	+	Missense_Mutation	SNP	C	C	A	rs201785916		TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr9:35107646C>A	ENST00000378561.1	-	2	3681	c.626G>T	c.(625-627)gGt>gTt	p.G209V	FAM214B_ENST00000488109.2_Missense_Mutation_p.G209V|FAM214B_ENST00000378554.2_Missense_Mutation_p.G209V|FAM214B_ENST00000322813.5_Missense_Mutation_p.G209V|FAM214B_ENST00000603301.1_Missense_Mutation_p.G209V|FAM214B_ENST00000378557.1_Missense_Mutation_p.G209V|FAM214B_ENST00000605244.1_Missense_Mutation_p.G209V|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000378566.1_Intron			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	209						nucleus (GO:0005634)		p.G209V(2)									CCAGAGGCTACCCCCATTGCC	0.657																																					p.G209V												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G626T	9						.						31.0	37.0	35.0					9																	35107646		2203	4299	6502	35097646	SO:0001583	missense	80256	exon3			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.626G>T	9.37:g.35107646C>A	ENSP00000367823:p.Gly209Val		35097646	NM_025182	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	ENST00000378561.1	37	CCDS6578.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.447740	0.26074	.	.	ENSG00000005238	ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	4.87	4.87	0.63330	.	0.273372	0.30959	N	0.008539	T	0.36717	0.0977	N	0.22421	0.69	0.42183	D	0.991695	B	0.34329	0.449	B	0.33799	0.17	T	0.19257	-1.0311	8	.	.	.	-22.7504	12.0625	0.53570	0.0:0.9099:0.0:0.0901	.	209	Q7L5A3	K1539_HUMAN	V	209	.	.	G	-	2	0	KIAA1539	35097646	0.998000	0.40836	0.998000	0.56505	0.556000	0.35491	2.928000	0.48908	2.532000	0.85374	0.555000	0.69702	GGT		0.657	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182	
GAPVD1	26130	broad.mit.edu	37	9	128094306	128094306	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chr9:128094306C>T	ENST00000495955.1	+	14	2565	c.2275C>T	c.(2275-2277)Cgc>Tgc	p.R759C	GAPVD1_ENST00000470056.1_Missense_Mutation_p.R759C|GAPVD1_ENST00000265956.4_Missense_Mutation_p.R759C|GAPVD1_ENST00000394105.2_Missense_Mutation_p.R759C|GAPVD1_ENST00000297933.6_Missense_Mutation_p.R759C|GAPVD1_ENST00000394083.2_Missense_Mutation_p.R738C|GAPVD1_ENST00000312123.9_Missense_Mutation_p.R738C|GAPVD1_ENST00000394104.2_Missense_Mutation_p.R759C			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	759					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.R759C(1)|p.R759S(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GGTCAGTTCCCGCCCCAGCAC	0.537																																					p.R759C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C2275T	9						.						111.0	86.0	95.0					9																	128094306		2203	4300	6503	127134127	SO:0001583	missense	26130	exon12				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2275C>T	9.37:g.128094306C>T	ENSP00000419063:p.Arg759Cys		127134127	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.685438|4.685438	0.88639|0.88639	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000436712|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|T;T;T;T;T;T;T;T;T	.|0.15603	.|2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.29093|0.29093	0.0723|0.0723	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.81914	.|0.992;0.982;0.992;0.992;0.992;0.995	T|T	0.02167|0.02167	-1.1202|-1.1202	5|9	.|.	.|.	.|.	.|.	19.5023|19.5023	0.95100|0.95100	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|759;759;759;738;759;759	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	.|.;GAPD1_HUMAN;.;.;.;.	L|C	595|759;759;759;759;738;759;759;759;738	.|ENSP00000419767:R759C;ENSP00000377665:R759C;ENSP00000377664:R759C;ENSP00000265956:R759C;ENSP00000377645:R738C;ENSP00000419063:R759C;ENSP00000418747:R759C;ENSP00000297933:R759C;ENSP00000309582:R738C	.|.	P|R	+|+	2|1	0|0	GAPVD1|GAPVD1	127134127|127134127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	3.936000|3.936000	0.56568|0.56568	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.537	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
BTK	695	broad.mit.edu	37	X	100614312	100614312	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chrX:100614312C>T	ENST00000308731.7	-	10	1026	c.863G>A	c.(862-864)cGg>cAg	p.R288Q	BTK_ENST00000372880.1_Missense_Mutation_p.R288Q	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	288	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		R -> Q (in XLA). {ECO:0000269|PubMed:9545398}.|R -> W (in XLA). {ECO:0000269|PubMed:7711734, ECO:0000269|PubMed:8162018, ECO:0000269|PubMed:8162056, ECO:0000269|PubMed:8834236}.		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.R288Q(1)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AGCCTGACTCCGAGTCATGTG	0.512									Agammaglobulinemia, X-linked																												p.R288Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G863A	X	GRCh37	CM980269	BTK	M		.						263.0	196.0	219.0					X																	100614312		2203	4300	6503	100500968	SO:0001583	missense	695	exon10	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.863G>A	X.37:g.100614312C>T	ENSP00000308176:p.Arg288Gln		100500968	NM_000061	B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	C	34	5.326700	0.95708	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;D	0.92805	-3.11;-3.11	5.78	5.78	0.91487	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.97766	0.9267	H	0.97415	4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.99097	1.0842	10	0.87932	D	0	.	18.5803	0.91168	0.0:1.0:0.0:0.0	.	288;288;288	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	Q	288	ENSP00000361971:R288Q;ENSP00000308176:R288Q	ENSP00000308176:R288Q	R	-	2	0	BTK	100500968	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	5.882000	0.69714	2.431000	0.82371	0.594000	0.82650	CGG		0.512	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061	
GLUD2	2747	broad.mit.edu	37	X	120181965	120181965	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chrX:120181965C>T	ENST00000328078.1	+	1	504	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	143					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.R143C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CAGCCAGCACCGCACGCCCTG	0.572																																					p.R143C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C427T	X						.						73.0	55.0	61.0					X																	120181965		2202	4300	6502	120009646	SO:0001583	missense	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.427C>T	X.37:g.120181965C>T	ENSP00000327589:p.Arg143Cys		120009646	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829575	0.50845	.	.	ENSG00000182890	ENST00000328078	D	0.97041	-4.22	1.8	-1.28	0.09318	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.059193	0.64402	D	0.000004	D	0.96506	0.8860	M	0.84433	2.695	0.80722	D	1	P	0.47545	0.897	P	0.49226	0.603	D	0.93310	0.6684	10	0.87932	D	0	.	6.4519	0.21908	0.0:0.5692:0.0:0.4308	.	143	P49448	DHE4_HUMAN	C	143	ENSP00000327589:R143C	ENSP00000327589:R143C	R	+	1	0	GLUD2	120009646	0.999000	0.42202	0.957000	0.39632	0.934000	0.57294	0.325000	0.19628	-0.515000	0.06479	0.472000	0.43445	CGC		0.572	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
FAM47C	442444	broad.mit.edu	37	X	37027670	37027670	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chrX:37027670A>G	ENST00000358047.3	+	1	1239	c.1187A>G	c.(1186-1188)aAg>aGg	p.K396R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	396								p.K396R(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GAGACCCCCAAGAATGGAGTG	0.612																																					p.K396R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1187G	X						.						54.0	56.0	55.0					X																	37027670		2202	4300	6502	36937591	SO:0001583	missense	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1187A>G	X.37:g.37027670A>G	ENSP00000367913:p.Lys396Arg		36937591	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	a	4.597	0.110937	0.08831	.	.	ENSG00000198173	ENST00000358047	T	0.15372	2.43	1.23	-1.12	0.09808	.	.	.	.	.	T	0.14270	0.0345	M	0.65975	2.015	0.09310	N	1	B	0.27732	0.187	B	0.27500	0.08	T	0.35076	-0.9803	9	0.17832	T	0.49	.	3.8193	0.08828	0.677:0.0:0.0:0.323	.	396	Q5HY64	FA47C_HUMAN	R	396	ENSP00000367913:K396R	ENSP00000367913:K396R	K	+	2	0	FAM47C	36937591	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.237000	0.08990	0.405000	0.25532	0.153000	0.16174	AAG		0.612	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
AFF2	2334	broad.mit.edu	37	X	148048395	148048395	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3956-01A-02W-0995-10	TCGA-AA-3956-10A-01W-0995-10	g.chrX:148048395A>G	ENST00000370460.2	+	14	3468	c.2989A>G	c.(2989-2991)Act>Gct	p.T997A	AFF2_ENST00000286437.5_Missense_Mutation_p.T638A|AFF2_ENST00000342251.3_Missense_Mutation_p.T964A|AFF2_ENST00000370457.5_Missense_Mutation_p.T962A	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	997					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.T997A(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					tgctactgtcactgctactgc	0.512																																					p.T997A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2989G	X						.						265.0	163.0	198.0					X																	148048395		2203	4300	6503	147856089	SO:0001583	missense	2334	exon14			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2989A>G	X.37:g.148048395A>G	ENSP00000359489:p.Thr997Ala		147856089	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	13.49	2.251687	0.39797	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.72167	-0.04;-0.31;-0.3;-0.63	3.81	2.62	0.31277	.	0.930568	0.08926	N	0.873746	T	0.47581	0.1453	N	0.14661	0.345	0.23381	N	0.997793	B;B;B;B;B;B	0.23650	0.089;0.073;0.073;0.073;0.073;0.089	B;B;B;B;B;B	0.22152	0.038;0.022;0.022;0.022;0.022;0.038	T	0.34675	-0.9819	10	0.07482	T	0.82	.	5.6838	0.17790	0.7567:0.0:0.0:0.2433	.	638;962;962;958;987;997	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	A	997;962;964;638	ENSP00000359489:T997A;ENSP00000359486:T962A;ENSP00000345459:T964A;ENSP00000286437:T638A	ENSP00000286437:T638A	T	+	1	0	AFF2	147856089	1.000000	0.71417	0.942000	0.38095	0.927000	0.56198	2.010000	0.40913	0.620000	0.30215	0.417000	0.27973	ACT		0.512	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
