#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC16A9	220963	broad.mit.edu	37	10	61412676	61412676	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr10:61412676T>A	ENST00000395348.3	-	6	2020	c.1384A>T	c.(1384-1386)Att>Ttt	p.I462F	SLC16A9_ENST00000395347.1_Missense_Mutation_p.I462F	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	462					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.I462V(1)|p.I462F(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						TAAAATGCAATATCATAGGTC	0.428																																					p.I462F												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.A1384T	10						.						72.0	77.0	75.0					10																	61412676		2203	4300	6503	61082682	SO:0001583	missense	220963	exon6			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1384A>T	10.37:g.61412676T>A	ENSP00000378757:p.Ile462Phe		61082682	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	T	3.674	-0.066955	0.07273	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.80909	-1.43;-1.43	5.68	4.52	0.55395	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.589490	0.19066	N	0.123623	T	0.66376	0.2783	N	0.20986	0.625	0.33382	D	0.574947	B	0.10296	0.003	B	0.08055	0.003	T	0.62666	-0.6806	10	0.11485	T	0.65	.	11.6615	0.51349	0.0:0.0:0.2821:0.7179	.	462	Q7RTY1	MOT9_HUMAN	F	462	ENSP00000378757:I462F;ENSP00000378756:I462F	ENSP00000378756:I462F	I	-	1	0	SLC16A9	61082682	1.000000	0.71417	0.806000	0.32338	0.193000	0.23685	1.900000	0.39828	0.941000	0.37499	0.528000	0.53228	ATT		0.428	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
ARHGAP19	84986	broad.mit.edu	37	10	99025672	99025672	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr10:99025672G>A	ENST00000358531.4	-	2	295	c.267C>T	c.(265-267)ggC>ggT	p.G89G	ARHGAP19-SLIT1_ENST00000316676.8_Silent_p.G89G|ARHGAP19_ENST00000371027.1_Silent_p.G80G|ARHGAP19-SLIT1_ENST00000453547.2_Silent_p.G89G|ARHGAP19-SLIT1_ENST00000358308.3_Silent_p.G89G|ARHGAP19_ENST00000355366.5_Silent_p.G80G	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	89					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.G89G(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GGCCAGCCCCGCCAGGCAACT	0.542																																					p.G89G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C267T	10						.						84.0	80.0	81.0					10																	99025672		2203	4300	6503	99015662	SO:0001819	synonymous_variant	84986	exon2			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.267C>T	10.37:g.99025672G>A			99015662	NM_032900	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Silent	SNP	ENST00000358531.4	37	CCDS7454.2																																																																																				0.542	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
SORCS1	114815	broad.mit.edu	37	10	108337186	108337186	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr10:108337186C>T	ENST00000263054.6	-	26	3506	c.3499G>A	c.(3499-3501)Gca>Aca	p.A1167T	SORCS1_ENST00000369698.1_3'UTR|SORCS1_ENST00000344440.6_Intron	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	1167					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.A1167T(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCTTAAATTGCATACTGTGCC	0.502																																					p.A1167T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3499A	10						.						114.0	114.0	114.0					10																	108337186		2203	4300	6503	108327176	SO:0001583	missense	114815	exon26			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3499G>A	10.37:g.108337186C>T	ENSP00000263054:p.Ala1167Thr		108327176	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144439	0.37825	.	.	ENSG00000108018	ENST00000263054	T	0.16073	2.37	5.73	3.76	0.43208	.	.	.	.	.	T	0.05364	0.0142	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39461	-0.9613	8	.	.	.	.	6.5916	0.22649	0.0:0.6794:0.1727:0.1479	.	1167	Q8WY21	SORC1_HUMAN	T	1167	ENSP00000263054:A1167T	.	A	-	1	0	SORCS1	108327176	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.039000	0.30266	2.868000	0.98415	0.555000	0.69702	GCA		0.502	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR8B2	26595	broad.mit.edu	37	11	124252986	124252987	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:124252986_124252987insC	ENST00000375013.2	-	1	271_272	c.253_254insG	c.(253-255)tttfs	p.F85fs		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F85fs*27(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TTTTGACACAAAGTTCATTAGC	0.371																																					p.F85fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.254_255insG	11						.																																			123758197	SO:0001589	frameshift_variant	26595	exon1			AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.253_254insG	11.37:g.124252986_124252987insC	ENSP00000364152:p.Phe85fs		123758196	NM_001005468	Q8NGH2	Frame_Shift_Ins	INS	ENST00000375013.2	37	CCDS31708.1																																																																																				0.371	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	NM_001005468	
UBQLN3	50613	broad.mit.edu	37	11	5528864	5528865	+	Frame_Shift_Ins	INS	-	-	A	rs143088595	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:5528864_5528865insA	ENST00000311659.4	-	2	2071_2072	c.1924_1925insT	c.(1924-1926)gggfs	p.G642fs	HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380252.1_5'Flank|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	642	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.									NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACGTCGCCCCCCGTAGCAATG	0.535																																					p.G642fs	Ovarian(72;684 1260 12332 41642 52180)											.	.	0			c.1925_1926insT	11						.																																			5485441	SO:0001589	frameshift_variant	50613	exon2			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1924_1925insT	11.37:g.5528864_5528865insA	ENSP00000347997:p.Gly642fs		5485440	NM_017481	Q9NRE0	Frame_Shift_Ins	INS	ENST00000311659.4	37	CCDS7758.1																																																																																				0.535	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
PCNXL3	399909	broad.mit.edu	37	11	65404302	65404303	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:65404302_65404303insC	ENST00000355703.3	+	35	6497_6498	c.5958_5959insC	c.(5959-5961)cccfs	p.P1987fs	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1987						integral component of membrane (GO:0016021)		p.R1989fs*15(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTGAGGCCTCACCCCCCAGAGC	0.658																																					p.S1986fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.5958_5959insC	11						.																																			65160879	SO:0001589	frameshift_variant	399909	exon35			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.5964dupC	11.37:g.65404308_65404308dupC	ENSP00000347931:p.Pro1987fs		65160878	NM_032223	Q6MZN8	Frame_Shift_Ins	INS	ENST00000355703.3	37	CCDS44650.1																																																																																				0.658	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
GRIA4	2893	broad.mit.edu	37	11	105804510	105804510	+	Silent	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:105804510A>G	ENST00000530497.1	+	13	2109	c.2109A>G	c.(2107-2109)gtA>gtG	p.V703V	GRIA4_ENST00000393127.2_Silent_p.V703V|GRIA4_ENST00000525187.1_Silent_p.V703V|AP000673.1_ENST00000583628.1_RNA|GRIA4_ENST00000282499.5_Silent_p.V703V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	703					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.V703V(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AGCCATCAGTATTCACTAGGA	0.413																																					p.V703V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A2109G	11						.						65.0	59.0	61.0					11																	105804510		2202	4299	6501	105309720	SO:0001819	synonymous_variant	2893	exon14			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2109A>G	11.37:g.105804510A>G			105309720	NM_001077243	Q86XE8	Silent	SNP	ENST00000530497.1	37	CCDS8333.1																																																																																				0.413	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
CUL5	8065	broad.mit.edu	37	11	107920751	107920751	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:107920751C>T	ENST00000393094.2	+	4	985	c.369C>T	c.(367-369)ggC>ggT	p.G123G		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	123					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)	p.G123G(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		GTAAACAGGGCAGCAATAAAA	0.313																																					p.G123G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	11						.						76.0	79.0	78.0					11																	107920751		2201	4298	6499	107425961	SO:0001819	synonymous_variant	8065	exon4			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.369C>T	11.37:g.107920751C>T			107425961	NM_003478	A8K960|O14766|Q9BZC6	Silent	SNP	ENST00000393094.2	37	CCDS31668.1																																																																																				0.313	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1		
PARVA	55742	broad.mit.edu	37	11	12499396	12499396	+	Silent	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:12499396A>G	ENST00000550549.1	+	4	349	c.300A>G	c.(298-300)gtA>gtG	p.V100V	PARVA_ENST00000526746.1_3'UTR|PARVA_ENST00000538608.1_Silent_p.V47V|PARVA_ENST00000539723.1_Silent_p.V100V|PARVA_ENST00000334956.8_Silent_p.V140V			Q9NVD7	PARVA_HUMAN	parvin, alpha	100	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|actin-mediated cell contraction (GO:0070252)|cell junction assembly (GO:0034329)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|heterotypic cell-cell adhesion (GO:0034113)|outflow tract septum morphogenesis (GO:0003148)|regulation of cell shape (GO:0008360)|smooth muscle cell chemotaxis (GO:0071670)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V100V(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)	11				Epithelial(150;0.00624)		CTCTGTAGGTATTAATTGACT	0.363																																					p.V140V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A420G	11						.						142.0	133.0	136.0					11																	12499396		1835	4080	5915	12455972	SO:0001819	synonymous_variant	55742	exon4			AF237771	CCDS44541.1, CCDS44541.2	11p15.3	2014-06-13	2005-05-26		ENSG00000197702	ENSG00000197702		"""Parvins"""	14652	protein-coding gene	gene with protein product		608120	"""matrix-remodelling associated 2"""	MXRA2		11171322	Standard	NM_018222		Approved	FLJ12254, FLJ10793	uc001mki.4	Q9NVD7	OTTHUMG00000165778	ENST00000550549.1:c.300A>G	11.37:g.12499396A>G			12455972	NM_018222	Q96C85|Q9HA48	Silent	SNP	ENST00000550549.1	37																																																																																					0.363	PARVA-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018222	
C11orf63	79864	broad.mit.edu	37	11	122805259	122805259	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:122805259T>A	ENST00000531316.1	+	4	1202	c.1110T>A	c.(1108-1110)tgT>tgA	p.C370*	C11orf63_ENST00000227349.2_Nonsense_Mutation_p.C370*			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	370					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.C370*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GAAAGCAGTGTAAACACCAGA	0.478																																					p.C370X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1110A	11						.						81.0	69.0	73.0					11																	122805259		2202	4299	6501	122310469	SO:0001587	stop_gained	79864	exon5			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.1110T>A	11.37:g.122805259T>A	ENSP00000431669:p.Cys370*		122310469	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Nonsense_Mutation	SNP	ENST00000531316.1	37	CCDS8438.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.956144	0.92726	.	.	ENSG00000109944	ENST00000227349;ENST00000531316	.	.	.	5.46	-7.26	0.01466	.	1.743960	0.02780	N	0.120780	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	0.0162	10.6234	0.45493	0.0:0.4856:0.3684:0.146	.	.	.	.	X	370	.	ENSP00000227349:C370X	C	+	3	2	C11orf63	122310469	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.407000	0.07178	-1.532000	0.01747	0.477000	0.44152	TGT		0.478	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
NUP98	4928	broad.mit.edu	37	11	3720428	3720428	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:3720428G>C	ENST00000324932.7	-	25	4313	c.3893C>G	c.(3892-3894)aCa>aGa	p.T1298R	NUP98_ENST00000488828.1_5'Flank|NUP98_ENST00000355260.3_Missense_Mutation_p.T1298R|NUP98_ENST00000359171.4_Missense_Mutation_p.T1298R	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1315					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.T1298R(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AATCTGAGGTGTGGCAGTACA	0.498			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.T1298R			Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3893G	11						.						184.0	191.0	189.0					11																	3720428		2201	4298	6499	3677004	SO:0001583	missense	4928	exon25			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.3893C>G	11.37:g.3720428G>C	ENSP00000316032:p.Thr1298Arg		3677004	NM_139132	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.09|12.09	1.833541|1.833541	0.32421|0.32421	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000429801|ENST00000324932;ENST00000359171;ENST00000355260	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.431995	.|0.27076	.|N	.|0.021047	T|T	0.25901|0.25901	0.0631|0.0631	N|N	0.14661|0.14661	0.345|0.345	0.26382|0.26382	N|N	0.976717|0.976717	.|B;B;B	.|0.27416	.|0.178;0.178;0.078	.|B;B;B	.|0.26310	.|0.068;0.068;0.033	T|T	0.11446|0.11446	-1.0587|-1.0587	5|9	.|0.17832	.|T	.|0.49	-0.7379|-0.7379	13.5797|13.5797	0.61896|0.61896	0.0:0.0:0.8448:0.1552|0.0:0.0:0.8448:0.1552	.|.	.|1298;1298;1212	.|P52948-2;P52948-5;P52948-6	.|.;.;.	Q|R	250|1298	.|.	.|ENSP00000316032:T1298R	H|T	-|-	3|2	2|0	NUP98|NUP98	3677004|3677004	0.996000|0.996000	0.38824|0.38824	0.853000|0.853000	0.33588|0.33588	0.735000|0.735000	0.41995|0.41995	6.897000|6.897000	0.75671|0.75671	2.715000|2.715000	0.92844|0.92844	0.655000|0.655000	0.94253|0.94253	CAC|ACA		0.498	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
OR52J3	119679	broad.mit.edu	37	11	5068162	5068162	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:5068162C>T	ENST00000380370.1	+	1	407	c.407C>T	c.(406-408)aCc>aTc	p.T136I		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T136I(1)		NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTACGCAACCATCTTGACA	0.483																																					p.T136I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C407T	11						.						185.0	119.0	142.0					11																	5068162		2201	4298	6499	5024738	SO:0001583	missense	119679	exon1			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.407C>T	11.37:g.5068162C>T	ENSP00000369728:p.Thr136Ile		5024738	NM_001001916	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	C	5.815	0.334649	0.11013	.	.	ENSG00000205495	ENST00000380370	T	0.14516	2.5	4.19	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	0.279937	0.25450	N	0.030584	T	0.18923	0.0454	M	0.68952	2.095	0.23341	N	0.997877	B	0.26635	0.155	B	0.36922	0.236	T	0.22765	-1.0207	10	0.62326	D	0.03	.	9.5028	0.39028	0.1514:0.556:0.2925:0.0	.	136	Q8NH60	O52J3_HUMAN	I	136	ENSP00000369728:T136I	ENSP00000369728:T136I	T	+	2	0	OR52J3	5024738	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	0.222000	0.17699	0.069000	0.16605	-0.127000	0.14921	ACC		0.483	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916	
DCHS1	8642	broad.mit.edu	37	11	6644782	6644782	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:6644782T>A	ENST00000299441.3	-	21	8536	c.8125A>T	c.(8125-8127)Aac>Tac	p.N2709Y	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2709	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N2709Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGAGTAAGTTCAGTGGGAAG	0.572																																					p.N2709Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8125T	11						.						61.0	52.0	55.0					11																	6644782		2201	4296	6497	6601358	SO:0001583	missense	8642	exon21			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.8125A>T	11.37:g.6644782T>A	ENSP00000299441:p.Asn2709Tyr		6601358	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	T	8.450	0.852832	0.17106	.	.	ENSG00000166341	ENST00000299441	T	0.59502	0.26	5.41	3.04	0.35103	Cadherin (2);Cadherin-like (1);	0.740232	0.11621	N	0.545757	T	0.44664	0.1304	L	0.37561	1.115	0.09310	N	1	B	0.15930	0.015	B	0.19148	0.024	T	0.39941	-0.9589	10	0.62326	D	0.03	.	4.9051	0.13795	0.0:0.1746:0.2564:0.569	.	2709	Q96JQ0	PCD16_HUMAN	Y	2709	ENSP00000299441:N2709Y	ENSP00000299441:N2709Y	N	-	1	0	DCHS1	6601358	0.002000	0.14202	0.815000	0.32552	0.984000	0.73092	0.391000	0.20784	1.072000	0.40860	0.533000	0.62120	AAC		0.572	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
IGSF22	283284	broad.mit.edu	37	11	18740191	18740191	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:18740191C>T	ENST00000513874.1	-	8	920	c.781G>A	c.(781-783)Gac>Aac	p.D261N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	261	Ig-like 2.							p.D261N(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						ACATTGGGGTCTTTCAGTTCC	0.483																																					p.D261N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G781A	11						.						174.0	181.0	178.0					11																	18740191		1904	4125	6029	18696767	SO:0001583	missense	283284	exon8			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.781G>A	11.37:g.18740191C>T	ENSP00000421191:p.Asp261Asn		18696767	NM_173588	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	19.63	3.862710	0.71949	.	.	ENSG00000179057	ENST00000513874	T	0.40756	1.02	5.09	5.09	0.68999	.	0.000000	0.39615	U	0.001306	T	0.57829	0.2080	L	0.56769	1.78	0.31070	N	0.713124	D	0.76494	0.999	D	0.81914	0.995	T	0.56811	-0.7917	10	0.16896	T	0.51	.	15.3989	0.74823	0.0:1.0:0.0:0.0	.	261	D6RGV7	.	N	261	ENSP00000421191:D261N	ENSP00000322422:D261N	D	-	1	0	IGSF22	18696767	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	5.488000	0.66869	2.367000	0.80283	0.591000	0.81541	GAC		0.483	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
KCNA4	3739	broad.mit.edu	37	11	30032713	30032713	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:30032713T>G	ENST00000328224.6	-	2	2746	c.1513A>C	c.(1513-1515)Act>Cct	p.T505P	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	505					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.T505P(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	AAATGGGTAGTAGGTTCATCC	0.517																																					p.T505P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1513C	11						.						56.0	58.0	57.0					11																	30032713		2178	4293	6471	29989289	SO:0001583	missense	3739	exon2			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1513A>C	11.37:g.30032713T>G	ENSP00000328511:p.Thr505Pro		29989289	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.683160	0.29872	.	.	ENSG00000182255	ENST00000328224	D	0.96992	-4.2	5.57	5.57	0.84162	Ion transport (1);	0.057789	0.64402	D	0.000002	D	0.86785	0.6016	N	0.01242	-0.935	0.45161	D	0.998174	B	0.11235	0.004	B	0.11329	0.006	T	0.82659	-0.0348	10	0.54805	T	0.06	.	8.3778	0.32453	0.0:0.1161:0.0:0.8839	.	505	P22459	KCNA4_HUMAN	P	505	ENSP00000328511:T505P	ENSP00000328511:T505P	T	-	1	0	KCNA4	29989289	0.998000	0.40836	0.076000	0.20297	0.951000	0.60555	2.203000	0.42752	2.117000	0.64856	0.528000	0.53228	ACT		0.517	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
OR4C6	219432	broad.mit.edu	37	11	55433275	55433275	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:55433275C>G	ENST00000314259.3	+	1	662	c.633C>G	c.(631-633)atC>atG	p.I211M		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I211M(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TCTTTCTTATCTTAATTGCGT	0.517																																					p.I211M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C633G	11						.						138.0	122.0	127.0					11																	55433275		2200	4296	6496	55189851	SO:0001583	missense	219432	exon1			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.633C>G	11.37:g.55433275C>G	ENSP00000324769:p.Ile211Met		55189851	NM_001004704	B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	C	5.901	0.350388	0.11182	.	.	ENSG00000181903	ENST00000314259	T	0.43688	0.94	4.07	-4.48	0.03515	GPCR, rhodopsin-like superfamily (1);	0.601948	0.13522	N	0.381615	T	0.20333	0.0489	N	0.17474	0.49	0.09310	N	1	B	0.25105	0.118	B	0.31390	0.129	T	0.19647	-1.0299	10	0.31617	T	0.26	.	3.5722	0.07921	0.114:0.1689:0.4801:0.2371	.	211	Q8NH72	OR4C6_HUMAN	M	211	ENSP00000324769:I211M	ENSP00000324769:I211M	I	+	3	3	OR4C6	55189851	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.079000	0.00299	-0.487000	0.06735	0.543000	0.68304	ATC		0.517	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704	
OR5F1	338674	broad.mit.edu	37	11	55761827	55761827	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:55761827A>G	ENST00000278409.1	-	1	274	c.275T>C	c.(274-276)aTc>aCc	p.I92T		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	92					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I92T(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AGCAAAAGAGATGGTTTTCTT	0.453																																					p.I92T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T275C	11						.						77.0	75.0	76.0					11																	55761827		2201	4296	6497	55518403	SO:0001583	missense	338674	exon1			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.275T>C	11.37:g.55761827A>G	ENSP00000278409:p.Ile92Thr		55518403	NM_003697	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297626	0.60086	.	.	ENSG00000149133	ENST00000278409	T	0.02916	4.11	3.03	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.12518	0.0304	M	0.94101	3.495	0.40337	D	0.978994	D	0.58620	0.983	P	0.51193	0.662	T	0.04454	-1.0950	9	0.72032	D	0.01	.	10.279	0.43528	1.0:0.0:0.0:0.0	.	92	O95221	OR5F1_HUMAN	T	92	ENSP00000278409:I92T	ENSP00000278409:I92T	I	-	2	0	OR5F1	55518403	0.987000	0.35691	0.847000	0.33407	0.829000	0.46940	5.258000	0.65479	1.167000	0.42706	0.247000	0.18012	ATC		0.453	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
SLC43A1	8501	broad.mit.edu	37	11	57268687	57268687	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:57268687G>A	ENST00000278426.3	-	3	625	c.270C>T	c.(268-270)acC>acT	p.T90T	SLC43A1_ENST00000528450.1_Silent_p.T90T|SLC43A1_ENST00000533515.1_5'Flank	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1									p.T90T(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GTGGCAGGGTGGTGGCGCTGA	0.652																																					p.T90T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C270T	11						.						91.0	81.0	84.0					11																	57268687		2201	4296	6497	57025263	SO:0001819	synonymous_variant	8501	exon3			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.270C>T	11.37:g.57268687G>A			57025263	NM_003627		Silent	SNP	ENST00000278426.3	37	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	g	9.222	1.033653	0.19590	.	.	ENSG00000149150	ENST00000525764	.	.	.	5.33	2.35	0.29111	.	.	.	.	.	T	0.60805	0.2297	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54417	-0.8297	4	.	.	.	-35.2211	10.9011	0.47051	0.0:0.3965:0.4671:0.1364	.	.	.	.	Y	36	.	.	H	-	1	0	SLC43A1	57025263	1.000000	0.71417	0.998000	0.56505	0.857000	0.48899	2.070000	0.41491	0.205000	0.20568	-0.155000	0.13514	CAC		0.652	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	
IGSF9B	22997	broad.mit.edu	37	11	133790087	133790087	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr11:133790087C>T	ENST00000321016.8	-	18	3763	c.3533G>A	c.(3532-3534)cGg>cAg	p.R1178Q	IGSF9B_ENST00000533871.2_Missense_Mutation_p.R1178Q			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1178	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.R1178Q(1)|p.R634Q(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		AGGGCTAGGCCGGGGCCGGGG	0.711																																					p.R1178Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3533A	11						.						26.0	32.0	30.0					11																	133790087		1861	4075	5936	133295297	SO:0001583	missense	22997	exon18			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3533G>A	11.37:g.133790087C>T	ENSP00000317980:p.Arg1178Gln		133295297	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	C	15.70	2.910476	0.52439	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.67345	0.07;-0.26	5.08	5.08	0.68730	.	0.000000	0.40554	N	0.001075	T	0.44912	0.1316	N	0.08118	0	0.43279	D	0.995247	B	0.14438	0.01	B	0.06405	0.002	T	0.38308	-0.9667	10	0.32370	T	0.25	.	11.5826	0.50900	0.0:0.9165:0.0:0.0835	.	1178	Q9UPX0	TUTLB_HUMAN	Q	1178;1020	ENSP00000317980:R1178Q;ENSP00000436552:R1020Q	ENSP00000317980:R1178Q	R	-	2	0	IGSF9B	133295297	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.601000	0.61090	2.358000	0.79984	0.455000	0.32223	CGG		0.711	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
DYRK4	8798	broad.mit.edu	37	12	4722842	4722842	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:4722842G>C	ENST00000540757.2	+	13	1646	c.1486G>C	c.(1486-1488)Gag>Cag	p.E496Q	RP11-500M8.7_ENST00000536588.1_Intron|DYRK4_ENST00000545342.1_Missense_Mutation_p.E133Q|DYRK4_ENST00000543431.1_Missense_Mutation_p.E495Q|DYRK4_ENST00000010132.5_Missense_Mutation_p.E496Q	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	496						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.E897Q(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			TGTCGGGGCGGAGGTGTCCAT	0.542																																					p.E496Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1486C	12						.						59.0	59.0	59.0					12																	4722842		2203	4300	6503	4593103	SO:0001583	missense	8798	exon13			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1486G>C	12.37:g.4722842G>C	ENSP00000441755:p.Glu496Gln		4593103	NM_003845	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.949660	0.34377	.	.	ENSG00000010219	ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342	T;T;T;T	0.65732	-0.17;-0.17;-0.12;0.62	5.77	2.91	0.33838	.	6.027210	0.00424	N	0.000079	T	0.55609	0.1931	L	0.48642	1.525	0.09310	N	1	B;B;B	0.26195	0.144;0.057;0.034	B;B;B	0.20955	0.032;0.022;0.01	T	0.29549	-1.0008	10	0.25751	T	0.34	.	6.5382	0.22365	0.1642:0.1474:0.6884:0.0	.	209;495;496	B4E1A4;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	Q	496;496;495;133	ENSP00000441755:E496Q;ENSP00000010132:E496Q;ENSP00000439697:E495Q;ENSP00000446005:E133Q	ENSP00000010132:E496Q	E	+	1	0	DYRK4	4593103	0.008000	0.16893	0.001000	0.08648	0.001000	0.01503	1.741000	0.38238	0.775000	0.33450	0.650000	0.86243	GAG		0.542	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2		
KRAS	3845	broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	KRAS_ENST00000311936.3_Missense_Mutation_p.A146T|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,0 	.	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A	12						.						207.0	188.0	195.0					12																	25378562		2203	4300	6503	25269829	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr		25269829	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA		0.323	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
B4GALNT3	283358	broad.mit.edu	37	12	663018	663018	+	Silent	SNP	C	C	T	rs376820641		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:663018C>T	ENST00000266383.5	+	14	1942	c.1929C>T	c.(1927-1929)ctC>ctT	p.L643L		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	643					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.L643L(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CCCGGAATCTCGACTTCCAAG	0.537																																					p.L643L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1929T	12						.	C		0,4406		0,0,2203	133.0	108.0	117.0		1929	-11.5	0.0	12		117	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	B4GALNT3	NM_173593.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		643/999	663018	1,13005	2203	4300	6503	533279	SO:0001819	synonymous_variant	283358	exon14			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1929C>T	12.37:g.663018C>T			533279	NM_173593	Q6ZNC1|Q8N7T6	Silent	SNP	ENST00000266383.5	37	CCDS8504.1																																																																																				0.537	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
ATN1	1822	broad.mit.edu	37	12	7045254	7045254	+	Missense_Mutation	SNP	C	C	T	rs201165264		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:7045254C>T	ENST00000356654.4	+	5	1061	c.824C>T	c.(823-825)cCg>cTg	p.P275L	ATN1_ENST00000396684.2_Missense_Mutation_p.P275L	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	275					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.P275L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CCAACAAAGCCGCCTACCACT	0.612																																					p.P275L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C824T	12						.	C	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	64.0	54.0	57.0		824,824	3.5	1.0	12		57	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	ATN1	NM_001007026.1,NM_001940.3	98,98	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging,probably-damaging	275/1191,275/1191	7045254	4,13002	2203	4300	6503	6915515	SO:0001583	missense	1822	exon5			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.824C>T	12.37:g.7045254C>T	ENSP00000349076:p.Pro275Leu		6915515	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	c	13.04	2.119575	0.37436	2.27E-4	3.49E-4	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.64991	-0.13;-0.13;-0.13	3.51	3.51	0.40186	.	0.000000	0.33712	U	0.004636	T	0.43433	0.1247	N	0.08118	0	0.53005	D	0.999966	B;D	0.63880	0.125;0.993	B;B	0.42555	0.038;0.391	T	0.55438	-0.8141	10	0.51188	T	0.08	.	15.6336	0.76933	0.0:1.0:0.0:0.0	.	275;275	Q86V38;P54259	.;ATN1_HUMAN	L	275	ENSP00000349076:P275L;ENSP00000379915:P275L;ENSP00000441744:P275L	ENSP00000349076:P275L	P	+	2	0	ATN1	6915515	0.938000	0.31826	0.953000	0.39169	0.527000	0.34593	3.194000	0.51005	1.964000	0.57103	0.580000	0.79431	CCG		0.612	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
KRT71	112802	broad.mit.edu	37	12	52942007	52942007	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:52942007C>T	ENST00000267119.5	-	5	976	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	303	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E303K(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		GTGCGGACTTCGTCAATGATG	0.567																																					p.E303K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G907A	12						.						195.0	155.0	169.0					12																	52942007		2203	4300	6503	51228274	SO:0001583	missense	112802	exon5			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.907G>A	12.37:g.52942007C>T	ENSP00000267119:p.Glu303Lys		51228274	NM_033448	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429898	0.43122	.	.	ENSG00000139648	ENST00000267119	D	0.92199	-2.99	4.3	4.3	0.51218	Filament (1);	0.000000	0.45361	D	0.000363	D	0.92090	0.7493	M	0.92691	3.335	0.47737	D	0.999507	P	0.46142	0.873	B	0.33568	0.166	D	0.93717	0.7029	10	0.72032	D	0.01	.	13.1764	0.59629	0.0:0.918:0.0:0.082	.	303	Q3SY84	K2C71_HUMAN	K	303	ENSP00000267119:E303K	ENSP00000267119:E303K	E	-	1	0	KRT71	51228274	0.997000	0.39634	0.859000	0.33776	0.073000	0.16967	4.049000	0.57397	2.343000	0.79666	0.603000	0.83216	GAA		0.567	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448	
RIMKLB	57494	broad.mit.edu	37	12	8926159	8926159	+	Missense_Mutation	SNP	C	C	T	rs201378504		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:8926159C>T	ENST00000538135.1	+	6	1765	c.940C>T	c.(940-942)Cgg>Tgg	p.R314W	A2ML1-AS1_ENST00000537288.1_RNA|RIMKLB_ENST00000535829.1_Missense_Mutation_p.R314W|RIMKLB_ENST00000357529.3_Missense_Mutation_p.R314W|RIMKLB_ENST00000299673.5_Intron			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	314					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)	p.R314W(1)		central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CCGGCTCACCCGGCGTATGTC	0.552																																					p.R314W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C940T	12						.	C	TRP/ARG	0,3872		0,0,1936	61.0	64.0	63.0		940	4.8	1.0	12		63	2,8272		0,2,4135	yes	missense	RIMKLB	NM_020734.2	101	0,2,6071	TT,TC,CC		0.0242,0.0,0.0165	probably-damaging	314/387	8926159	2,12144	1936	4137	6073	8817426	SO:0001583	missense	57494	exon7			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.940C>T	12.37:g.8926159C>T	ENSP00000440943:p.Arg314Trp		8817426	NM_020734	B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	ENST00000538135.1	37	CCDS41748.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854515	0.51376	0.0	2.42E-4	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	5.72	4.82	0.62117	.	0.069207	0.56097	U	0.000025	T	0.39682	0.1087	L	0.29908	0.895	0.58432	D	0.999994	D	0.58620	0.983	B	0.39738	0.308	T	0.21449	-1.0245	8	.	.	.	.	14.7578	0.69579	0.1458:0.8542:0.0:0.0	.	314	Q9ULI2	RIMKB_HUMAN	W	314	.	.	R	+	1	2	RIMKLB	8817426	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.397000	0.59690	1.387000	0.46486	0.591000	0.81541	CGG		0.552	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398874.1	NM_020734	
TRHDE	29953	broad.mit.edu	37	12	73056832	73056832	+	Splice_Site	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr12:73056832C>A	ENST00000261180.4	+	19	3028	c.2932C>A	c.(2932-2934)Ctc>Atc	p.L978I		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	978					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L978I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CTCTTTCCAGCTCAAGAACTT	0.368																																					p.L978I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2932A	12						.						57.0	61.0	59.0					12																	73056832		2203	4300	6503	71343099	SO:0001630	splice_region_variant	29953	exon19			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2932-1C>A	12.37:g.73056832C>A			71343099	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.891937	0.52014	.	.	ENSG00000072657	ENST00000261180	T	0.04758	3.56	5.35	4.46	0.54185	.	0.000000	0.64402	D	0.000001	T	0.15435	0.0372	L	0.57130	1.785	0.58432	D	0.999996	D	0.63046	0.992	D	0.63192	0.912	T	0.01042	-1.1471	9	.	.	.	.	14.4741	0.67535	0.0:0.9288:0.0:0.0712	.	978	Q9UKU6	TRHDE_HUMAN	I	978	ENSP00000261180:L978I	.	L	+	1	0	TRHDE	71343099	1.000000	0.71417	0.997000	0.53966	0.593000	0.36681	3.188000	0.50958	1.398000	0.46701	0.557000	0.71058	CTC		0.368	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	Missense_Mutation
MYO16	23026	broad.mit.edu	37	13	109445874	109445874	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr13:109445874G>C	ENST00000357550.2	+	5	602	c.561G>C	c.(559-561)ttG>ttC	p.L187F	MYO16_ENST00000251041.5_Missense_Mutation_p.L187F|MYO16_ENST00000356711.2_Missense_Mutation_p.L187F	NM_001198950.1	NP_001185879.1			myosin XVI									p.L187F(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GAGTGGATTTGACCTCACTGC	0.428																																					p.L209F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G627C	13						.						122.0	116.0	118.0					13																	109445874		2203	4300	6503	108243875	SO:0001583	missense	23026	exon6				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.561G>C	13.37:g.109445874G>C	ENSP00000350160:p.Leu187Phe		108243875	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569292	0.45798	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.55052	0.54;0.54;0.54	5.76	0.901	0.19284	Ankyrin repeat-containing domain (3);	0.000000	0.32503	U	0.006019	T	0.50017	0.1591	L	0.37750	1.13	0.09310	N	1	P;D	0.67145	0.886;0.996	P;D	0.65140	0.689;0.932	T	0.36335	-0.9752	9	.	.	.	.	1.4562	0.02386	0.1522:0.2635:0.3138:0.2705	.	187;187	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	F	187	ENSP00000349145:L187F;ENSP00000350160:L187F;ENSP00000251041:L187F	.	L	+	3	2	MYO16	108243875	0.008000	0.16893	0.004000	0.12327	0.719000	0.41307	0.087000	0.14958	0.053000	0.16036	0.591000	0.81541	TTG		0.428	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
RASA3	22821	broad.mit.edu	37	13	114762046	114762046	+	Missense_Mutation	SNP	G	G	A	rs550150036		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr13:114762046G>A	ENST00000334062.7	-	21	2223	c.2102C>T	c.(2101-2103)gCg>gTg	p.A701V	RASA3_ENST00000389544.4_Missense_Mutation_p.A669V	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	701					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.A701V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GTCGGATGGCGCCCTACAGCA	0.642													g|||	1	0.000199681	0.0	0.0	5008	,	,		18040	0.0		0.0	False		,,,				2504	0.001				p.A701V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2102T	13						.						75.0	66.0	69.0					13																	114762046		2203	4299	6502	113780148	SO:0001583	missense	22821	exon21				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2102C>T	13.37:g.114762046G>A	ENSP00000335029:p.Ala701Val		113780148	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701786	0.30142	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.93859	-3.3;-3.3	5.37	4.51	0.55191	Pleckstrin homology-type (1);Zinc finger, Btk motif (4);	0.230028	0.45126	D	0.000393	D	0.91402	0.7287	L	0.48642	1.525	0.80722	D	1	P	0.36315	0.547	B	0.40375	0.327	D	0.89263	0.3599	9	.	.	.	.	15.501	0.75698	0.0:0.0:0.8605:0.1395	.	701	Q14644	RASA3_HUMAN	V	701;669	ENSP00000335029:A701V;ENSP00000374195:A669V	.	A	-	2	0	RASA3	113780148	1.000000	0.71417	0.801000	0.32222	0.053000	0.15095	4.235000	0.58666	1.238000	0.43771	0.561000	0.74099	GCG		0.642	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
ZFP36L1	677	broad.mit.edu	37	14	69256943	69256944	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr14:69256943_69256944insC	ENST00000439696.2	-	2	624_625	c.323_324insG	c.(322-324)ggcfs	p.G108fs	ZFP36L1_ENST00000336440.3_Frame_Shift_Ins_p.G108fs|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	108					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q109fs*16(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGTTGACCTGGCCGCCCCCGGG	0.673											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G108fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.324_325insG	14						.																																			68326697	SO:0001589	frameshift_variant	677	exon2			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.324dupG	14.37:g.69256945_69256945dupC	ENSP00000388402:p.Gly108fs	1113	68326696	NM_004926	Q13851	Frame_Shift_Ins	INS	ENST00000439696.2	37	CCDS9791.1																																																																																				0.673	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
C15orf39	56905	broad.mit.edu	37	15	75498918	75498919	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr15:75498918_75498919insC	ENST00000360639.2	+	2	849_850	c.529_530insC	c.(529-531)gccfs	p.A177fs	C15orf39_ENST00000394987.4_Frame_Shift_Ins_p.A177fs|C15orf39_ENST00000567617.1_Frame_Shift_Ins_p.A177fs			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	177						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CTGCTCTCTGGCCCCAGCTCCT	0.624																																					p.A177fs												.	.	0			c.529_530insC	15						.																																			73285972	SO:0001589	frameshift_variant	56905	exon2			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.533dupC	15.37:g.75498922_75498922dupC	ENSP00000353854:p.Ala177fs		73285971	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Frame_Shift_Ins	INS	ENST00000360639.2	37	CCDS10276.1																																																																																				0.624	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
ALPK3	57538	broad.mit.edu	37	15	85401313	85401314	+	Frame_Shift_Ins	INS	-	-	G	rs199640850		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr15:85401313_85401314insG	ENST00000258888.5	+	6	4117_4118	c.3950_3951insG	c.(3949-3954)ctggggfs	p.LG1317fs		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1317					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCTGGTCGACTGGGGGAGGCGG	0.678																																					p.L1317fs												.	.	0			c.3950_3951insG	15						.																																			83202318	SO:0001589	frameshift_variant	57538	exon6			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3955dupG	15.37:g.85401318_85401318dupG	ENSP00000258888:p.Leu1317fs		83202317	NM_020778	Q9P2L6	Frame_Shift_Ins	INS	ENST00000258888.5	37	CCDS10333.1																																																																																				0.678	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
GABRA5	2558	broad.mit.edu	37	15	27126105	27126105	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr15:27126105G>A	ENST00000335625.5	+	4	1087	c.199G>A	c.(199-201)Ggg>Agg	p.G67R	GABRA5_ENST00000400081.3_Missense_Mutation_p.G67R|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000355395.5_Missense_Mutation_p.G67R|GABRA5_ENST00000557449.1_3'UTR	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	67					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G67R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	ACTTCGGCCCGGGCTGGGAGG	0.512																																					p.G67R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	15						.						66.0	67.0	66.0					15																	27126105		2002	4165	6167	24677198	SO:0001583	missense	2558	exon4				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.199G>A	15.37:g.27126105G>A	ENSP00000335592:p.Gly67Arg		24677198	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924484	0.92319	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554038;ENST00000554596;ENST00000554599;ENST00000554083	T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.55	5.55	0.83447	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.87010	0.6071	M	0.64080	1.96	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.87817	0.2635	10	0.87932	D	0	.	18.5045	0.90892	0.0:0.0:1.0:0.0	.	67	P31644	GBRA5_HUMAN	R	67;67;35;67;67;67;67;35	ENSP00000335592:G67R;ENSP00000347557:G67R;ENSP00000450653:G35R;ENSP00000382953:G67R;ENSP00000451527:G67R;ENSP00000450806:G67R;ENSP00000450717:G67R;ENSP00000450529:G35R	ENSP00000335592:G67R	G	+	1	0	GABRA5	24677198	1.000000	0.71417	0.595000	0.28798	0.837000	0.47467	9.607000	0.98328	2.614000	0.88457	0.561000	0.74099	GGG		0.512	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
POTEB2	100287399	broad.mit.edu	37	15	21066794	21066794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr15:21066794delG	ENST00000454856.4	-	2	467	c.435delC	c.(433-435)gccfs	p.A145fs		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	145								p.N146fs*6(1)									AATTTCCATTGGCAGAGGCCA	0.413																																					p.A182fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.546delC	15						.																																			19331373	SO:0001589	frameshift_variant	339010	exon2				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.435delC	15.37:g.21066794delG	ENSP00000456953:p.Ala145fs		19331373	NM_207355		Frame_Shift_Del	DEL	ENST00000454856.4	37	CCDS59248.1																																																																																				0.413	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
ALPK3	57538	broad.mit.edu	37	15	85360113	85360113	+	Missense_Mutation	SNP	A	A	C	rs148968322		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr15:85360113A>C	ENST00000258888.5	+	1	203	c.36A>C	c.(34-36)caA>caC	p.Q12H		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	12					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGCTGGGCCAACAGCCACTGG	0.642																																					p.Q12H												.	.	0			c.A36C	15						.						52.0	47.0	49.0					15																	85360113		2203	4299	6502	83161117	SO:0001583	missense	57538	exon1			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.36A>C	15.37:g.85360113A>C	ENSP00000258888:p.Gln12His		83161117	NM_020778	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980076	0.34942	.	.	ENSG00000136383	ENST00000258888	T	0.61274	0.12	2.92	-4.76	0.03229	.	.	.	.	.	T	0.32823	0.0842	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19712	-1.0297	9	0.87932	D	0	8.053	4.5182	0.11947	0.3236:0.343:0.3333:0.0	.	12	Q96L96	ALPK3_HUMAN	H	12	ENSP00000258888:Q12H	ENSP00000258888:Q12H	Q	+	3	2	ALPK3	83161117	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.218000	0.09240	-1.079000	0.03113	0.402000	0.26972	CAA		0.642	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
MAPK8IP3	23162	broad.mit.edu	37	16	1817905	1817906	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:1817905_1817906insC	ENST00000250894.4	+	28	3663_3664	c.3506_3507insC	c.(3505-3510)atccccfs	p.IP1169fs	MAPK8IP3_ENST00000356010.5_Frame_Shift_Ins_p.IP1163fs	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1169					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.L1177fs*19(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GTCATCTCCATCCCCCTGACAG	0.658																																					p.I1163fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3488_3489insC	16						.																																			1757907	SO:0001589	frameshift_variant	23162	exon27			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3511dupC	16.37:g.1817910_1817910dupC	ENSP00000250894:p.Ile1169fs		1757906	NM_001040439	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Frame_Shift_Ins	INS	ENST00000250894.4	37	CCDS10442.2																																																																																				0.658	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	
ACSM5	54988	broad.mit.edu	37	16	20432625	20432625	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:20432625C>T	ENST00000331849.4	+	5	816	c.669C>T	c.(667-669)gaC>gaT	p.D223D		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	223					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.D223D(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						AGAGTCGAGACCCGCTGGCCA	0.542																																					p.D223D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C669T	16						.						60.0	58.0	59.0					16																	20432625		2203	4300	6503	20340126	SO:0001819	synonymous_variant	54988	exon5				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.669C>T	16.37:g.20432625C>T			20340126	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	CCDS10585.1																																																																																				0.542	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
DNAH3	55567	broad.mit.edu	37	16	20994175	20994175	+	Missense_Mutation	SNP	C	C	T	rs544149586		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:20994175C>T	ENST00000261383.3	-	49	7726	c.7727G>A	c.(7726-7728)cGc>cAc	p.R2576H	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2576	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R2576H(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CATCCGCAGGCGGTTCCTGAA	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		16459	0.0		0.0	False		,,,				2504	0.001				p.R2576H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7727A	16						.						103.0	99.0	100.0					16																	20994175		2201	4300	6501	20901676	SO:0001583	missense	55567	exon49			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7727G>A	16.37:g.20994175C>T	ENSP00000261383:p.Arg2576His		20901676	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	34	5.339835	0.95783	.	.	ENSG00000158486	ENST00000261383	T	0.57273	0.41	5.83	4.89	0.63831	Dynein heavy chain, P-loop containing D4 domain (1);	0.064404	0.64402	D	0.000006	T	0.76737	0.4029	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82099	-0.0625	10	0.72032	D	0.01	.	15.2161	0.73267	0.0:0.9326:0.0:0.0674	.	2576	Q8TD57	DYH3_HUMAN	H	2576	ENSP00000261383:R2576H	ENSP00000261383:R2576H	R	-	2	0	DNAH3	20901676	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.904000	0.63279	1.484000	0.48361	0.655000	0.94253	CGC		0.507	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
SLC5A2	6524	broad.mit.edu	37	16	31500618	31500618	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:31500618C>T	ENST00000330498.3	+	12	1643	c.1624C>T	c.(1624-1626)Ctc>Ttc	p.L542F	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	542					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.L542F(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	CCTCCTCACCCTCACGGTCTC	0.642																																					p.L542F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1624T	16						.						123.0	72.0	89.0					16																	31500618		2197	4300	6497	31408119	SO:0001583	missense	6524	exon12				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1624C>T	16.37:g.31500618C>T	ENSP00000327943:p.Leu542Phe		31408119	NM_003041	A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	CCDS10714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.215|9.215	1.031793|1.031793	0.19590|0.19590	.|.	.|.	ENSG00000140675|ENSG00000140675	ENST00000330498|ENST00000419665	D|D	0.81739|0.87029	-1.53|-2.2	5.02|5.02	0.708|0.708	0.18144|0.18144	.|.	0.139060|.	0.49305|.	D|.	0.000145|.	D|D	0.90208|0.90208	0.6939|0.6939	M|M	0.83603|0.83603	2.65|2.65	0.44852|0.44852	D|D	0.99786|0.99786	B|.	0.34329|.	0.449|.	B|.	0.36885|.	0.235|.	D|D	0.87634|0.87634	0.2518|0.2518	10|7	0.62326|0.87932	D|D	0.03|0	.|.	7.4514|7.4514	0.27240|0.27240	0.4515:0.4692:0.0:0.0793|0.4515:0.4692:0.0:0.0793	.|.	542|.	P31639|.	SC5A2_HUMAN|.	F|L	542|435	ENSP00000327943:L542F|ENSP00000410601:P435L	ENSP00000327943:L542F|ENSP00000410601:P435L	L|P	+|+	1|2	0|0	SLC5A2|SLC5A2	31408119|31408119	0.007000|0.007000	0.16637|0.16637	0.008000|0.008000	0.14137|0.14137	0.005000|0.005000	0.04900|0.04900	0.202000|0.202000	0.17295|0.17295	-0.000000|-0.000000	0.14550|0.14550	-0.268000|-0.268000	0.10319|0.10319	CTC|CCT		0.642	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2		
CENPT	80152	broad.mit.edu	37	16	67860110	67860110	+	IGR	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:67860110C>T	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Silent_p.S346S|TSNAXIP1_ENST00000415766.3_Silent_p.S331S|TSNAXIP1_ENST00000561639.1_Silent_p.S400S	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S346S(1)		NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GCAAGAACAGCGACCAGCTGG	0.642																																					p.S346S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1038T	16						.						53.0	55.0	54.0					16																	67860110		2198	4300	6498	66417611	SO:0001628	intergenic_variant	55815	exon10			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67860110C>T			66417611	NM_018430	Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	37	CCDS42182.1																																																																																				0.642	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
TANGO6	79613	broad.mit.edu	37	16	68941401	68941401	+	Missense_Mutation	SNP	G	G	C	rs374999949		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:68941401G>C	ENST00000261778.1	+	10	1735	c.1723G>C	c.(1723-1725)Gtg>Ctg	p.V575L		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	575						integral component of membrane (GO:0016021)		p.V104L(1)|p.V575L(1)									GCAGGGCCGGGTGGAGCATCT	0.488																																					p.V575L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1723C	16						.						96.0	96.0	96.0					16																	68941401		1894	4100	5994	67498902	SO:0001583	missense	79613	exon10				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1723G>C	16.37:g.68941401G>C	ENSP00000261778:p.Val575Leu		67498902	NM_024562	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	37	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	G	1.128	-0.653129	0.03480	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.95	0.499	0.16914	Armadillo-type fold (1);	0.666605	0.15651	N	0.251413	T	0.28665	0.0710	L	0.50333	1.59	0.19300	N	0.999974	B	0.06786	0.001	B	0.06405	0.002	T	0.27226	-1.0080	9	0.11182	T	0.66	-2.9025	5.5057	0.16852	0.2854:0.2428:0.4717:0.0	.	575	Q9C0B7	TMCO7_HUMAN	L	575	.	ENSP00000261778:V575L	V	+	1	0	TMCO7	67498902	0.171000	0.23029	0.085000	0.20634	0.115000	0.19883	-0.044000	0.12023	0.111000	0.17947	-0.150000	0.13652	GTG		0.488	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
HYDIN	54768	broad.mit.edu	37	16	70989429	70989429	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr16:70989429G>A	ENST00000393567.2	-	40	6315	c.6165C>T	c.(6163-6165)agC>agT	p.S2055S		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2055					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.S2054S(1)|p.S2006S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACTTGGCCACGCTAACGGCAT	0.537																																					p.S2054S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C6162T	16						.						22.0	21.0	21.0					16																	70989429		1833	4047	5880	69546930	SO:0001819	synonymous_variant	54768	exon40			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6165C>T	16.37:g.70989429G>A			69546930	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																				0.537	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
SPECC1	92521	broad.mit.edu	37	17	20108262	20108263	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:20108262_20108263insA	ENST00000261503.5	+	4	951_952	c.900_901insA	c.(901-903)aaafs	p.K301fs	SPECC1_ENST00000395527.4_Frame_Shift_Ins_p.K301fs|SPECC1_ENST00000395525.3_Frame_Shift_Ins_p.K220fs|SPECC1_ENST00000395529.3_Frame_Shift_Ins_p.K301fs|SPECC1_ENST00000395522.2_Frame_Shift_Ins_p.K220fs|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395530.2_Frame_Shift_Ins_p.K220fs|AC004702.2_ENST00000580225.1_lincRNA	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	301	Ser-rich.				cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.N303fs*15(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TTGATGAGTATAAAAAAAACAT	0.455																																					p.Y219fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.657_658insA	17						.																																			20048855	SO:0001589	frameshift_variant	92521	exon2			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.908dupA	17.37:g.20108270_20108270dupA	ENSP00000261503:p.Lys301fs		20048854	NM_001033554	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Frame_Shift_Ins	INS	ENST00000261503.5	37	CCDS32590.1																																																																																				0.455	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
SOX9	6662	broad.mit.edu	37	17	70119762	70119763	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	GG	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:70119762_70119763insGG	ENST00000245479.2	+	3	1136_1137	c.764_765insGG	c.(763-768)gaggggfs	p.EG255fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	255					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R257fs*23(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CTGAAGCGAGAGGGGCGCCCCT	0.639																																					p.E255fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.764_765insGG	17						.																																			67631358	SO:0001589	frameshift_variant	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.767_768dupGG	17.37:g.70119765_70119766dupGG	ENSP00000245479:p.Glu255fs		67631357	NM_000346	Q53Y80	Frame_Shift_Ins	INS	ENST00000245479.2	37	CCDS11689.1																																																																																				0.639	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
WNT3	7473	broad.mit.edu	37	17	44895944	44895944	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:44895944C>A	ENST00000225512.5	-	1	182	c.20G>T	c.(19-21)gGg>gTg	p.G7V		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	7					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.G7V(1)		endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GAGGAGCAGCCCGAGCAGGTG	0.637																																					p.G7V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G20T	17						.						18.0	19.0	19.0					17																	44895944		2191	4296	6487	42250943	SO:0001583	missense	7473	exon1			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.20G>T	17.37:g.44895944C>A	ENSP00000225512:p.Gly7Val		42250943	NM_030753	Q2M237|Q9H1J9	Missense_Mutation	SNP	ENST00000225512.5	37	CCDS11505.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290632	0.23564	.	.	ENSG00000108379	ENST00000225512	T	0.75704	-0.96	4.1	3.12	0.35913	.	1.715650	0.03192	N	0.173403	T	0.72203	0.3431	N	0.08118	0	0.52501	D	0.999955	D	0.64830	0.994	D	0.67725	0.953	T	0.66767	-0.5840	10	0.12766	T	0.61	.	10.0562	0.42246	0.0:0.9033:0.0:0.0967	.	7	P56703	WNT3_HUMAN	V	7	ENSP00000225512:G7V	ENSP00000225512:G7V	G	-	2	0	WNT3	42250943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.303000	0.43646	1.063000	0.40649	0.561000	0.74099	GGG		0.637	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
TTLL6	284076	broad.mit.edu	37	17	46862384	46862384	+	Silent	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:46862384A>G	ENST00000393382.3	-	13	2082	c.1941T>C	c.(1939-1941)aaT>aaC	p.N647N	TTLL6_ENST00000433608.2_Silent_p.N340N	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6									p.N325N(1)|p.N599N(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						TGAGATTGATATTCCTCAGAT	0.552																																					p.N647N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1941C	17						.						145.0	145.0	145.0					17																	46862384		2203	4300	6503	44217383	SO:0001819	synonymous_variant	284076	exon13			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1941T>C	17.37:g.46862384A>G			44217383	NM_001130918		Silent	SNP	ENST00000393382.3	37	CCDS45724.1																																																																																				0.552	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,lymph_node,Substitution - Missense,+1 	.	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	c.C742T	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651	.						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		7518264	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SCN4A	6329	broad.mit.edu	37	17	62021185	62021185	+	Missense_Mutation	SNP	G	G	A	rs121908547		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr17:62021185G>A	ENST00000435607.1	-	22	4014	c.3938C>T	c.(3937-3939)aCg>aTg	p.T1313M	SCN4A_ENST00000578147.1_Missense_Mutation_p.T1313M	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1313			T -> M (in PMC). {ECO:0000269|PubMed:1310898, ECO:0000269|PubMed:18166706}.		membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T1313M(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGTTCCTCCGTCATAAAGAT	0.552																																					p.T1313M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3938T	17	GRCh37	CM941270	SCN4A	M	rs121908547	.						82.0	85.0	84.0					17																	62021185		2153	4285	6438	59374917	SO:0001583	missense	6329	exon22			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3938C>T	17.37:g.62021185G>A	ENSP00000396320:p.Thr1313Met		59374917	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074254	0.76415	.	.	ENSG00000007314	ENST00000435607	D	0.97430	-4.38	3.38	3.38	0.38709	.	0.056477	0.64402	N	0.000001	D	0.99064	0.9679	H	0.98738	4.315	0.58432	D	0.999995	D	0.89917	1.0	D	0.79108	0.992	D	0.98609	1.0662	10	0.72032	D	0.01	.	14.2846	0.66238	0.0:0.0:1.0:0.0	.	1313	P35499	SCN4A_HUMAN	M	1313	ENSP00000396320:T1313M	ENSP00000396320:T1313M	T	-	2	0	SCN4A	59374917	1.000000	0.71417	0.991000	0.47740	0.941000	0.58515	9.592000	0.98245	1.903000	0.55091	0.448000	0.29417	ACG		0.552	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
NOL4	8715	broad.mit.edu	37	18	31803201	31803201	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr18:31803201T>G	ENST00000261592.5	-	1	314	c.17A>C	c.(16-18)gAc>gCc	p.D6A	RP11-379L18.1_ENST00000587528.1_RNA|NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000589544.1_Missense_Mutation_p.D6A|NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000535475.1_5'Flank	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	6						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.D6A(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GCGGTACATGTCGCGCTCGCT	0.612																																					p.D6A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A17C	18						.						84.0	88.0	87.0					18																	31803201		2060	4199	6259	30057199	SO:0001583	missense	8715	exon1			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.17A>C	18.37:g.31803201T>G	ENSP00000261592:p.Asp6Ala		30057199	NM_001198546	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	T	17.95	3.512770	0.64522	.	.	ENSG00000101746	ENST00000261592	D	0.82433	-1.61	5.57	5.57	0.84162	.	.	.	.	.	D	0.85089	0.5617	N	0.22421	0.69	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.75484	0.986;0.986	D	0.87083	0.2167	9	0.66056	D	0.02	-11.2674	14.5559	0.68100	0.0:0.0:0.0:1.0	.	6;6	O94818;O94818-2	NOL4_HUMAN;.	A	6	ENSP00000261592:D6A	ENSP00000261592:D6A	D	-	2	0	NOL4	30057199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.479000	0.66813	2.117000	0.64856	0.459000	0.35465	GAC		0.612	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
CIRBP	1153	broad.mit.edu	37	19	1271569	1271570	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:1271569_1271570insG	ENST00000588030.1	+	5	629_630	c.369_370insG	c.(370-372)gggfs	p.G124fs	CIRBP_ENST00000444172.2_Frame_Shift_Ins_p.G71fs|CIRBP_ENST00000589686.1_Frame_Shift_Ins_p.G124fs|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000587896.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000589710.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000413636.2_Frame_Shift_Ins_p.G90fs|CIRBP_ENST00000588090.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000320936.5_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000585630.1_Frame_Shift_Ins_p.G124fs|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000591935.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000589235.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000588230.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000589660.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000586773.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000587323.1_Frame_Shift_Ins_p.G124fs|CIRBP_ENST00000586472.1_Frame_Shift_Ins_p.G124fs			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	124	Gly-rich.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGAGGCTATGGGGGGAACCG	0.624																																					p.Y123fs												.	.	0			c.369_370insG	19						.																																			1222570	SO:0001589	frameshift_variant	1153	exon5			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.375dupG	19.37:g.1271575_1271575dupG	ENSP00000468788:p.Gly124fs		1222569	NM_001280	B3KT17|B4E2X2	Frame_Shift_Ins	INS	ENST00000588030.1	37	CCDS12059.1																																																																																				0.624	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449969.1	NM_001280	
PODNL1	79883	broad.mit.edu	37	19	14045174	14045175	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:14045174_14045175insG	ENST00000339560.5	-	6	837_838	c.564_565insC	c.(562-567)cccgacfs	p.D189fs	PODNL1_ENST00000538371.2_Frame_Shift_Ins_p.D187fs|PODNL1_ENST00000538517.2_Intron|PODNL1_ENST00000254320.3_Frame_Shift_Ins_p.D107fs	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	189	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)		p.D189fs*56(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			CGGAAGGCGTCGGGGGGCAGGC	0.698																																					p.D189fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.565_566insC	19						.																																			13906175	SO:0001589	frameshift_variant	79883	exon6			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.565dupC	19.37:g.14045180_14045180dupG	ENSP00000345175:p.Asp189fs		13906174	NM_024825	B7Z564|Q9H5G9	Frame_Shift_Ins	INS	ENST00000339560.5	37	CCDS12300.1																																																																																				0.698	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
ZNF714	148206	broad.mit.edu	37	19	21300959	21300959	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:21300959A>T	ENST00000596143.1	+	5	1814	c.1489A>T	c.(1489-1491)Aaa>Taa	p.K497*	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000601416.1_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K497*(1)		endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						AACTCTTACTAAACATAGGAA	0.413																																					p.K497X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1489T	19						.						76.0	84.0	81.0					19																	21300959		2203	4300	6503	21092799	SO:0001587	stop_gained	148206	exon5			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.1489A>T	19.37:g.21300959A>T	ENSP00000472368:p.Lys497*		21092799	NM_182515	Q49AI1|Q86W65|Q8ND40	Nonsense_Mutation	SNP	ENST00000596143.1	37	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.649124	0.87958	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.926	-1.32	0.09201	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.1232	0.03731	0.3555:0.3404:0.3041:0.0	.	.	.	.	X	497	.	ENSP00000291770:K497X	K	+	1	0	ZNF714	21092799	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-1.045000	0.03528	0.263000	0.21812	0.260000	0.18958	AAA		0.413	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515	
ZNF599	148103	broad.mit.edu	37	19	35250786	35250786	+	Missense_Mutation	SNP	C	C	A	rs142778619	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:35250786C>A	ENST00000329285.8	-	4	1293	c.920G>T	c.(919-921)cGa>cTa	p.R307L		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R307L(1)		endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GGGTTTTTCTCGAGTGTGAGT	0.413																																					p.R307L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920T	19						.						103.0	115.0	111.0					19																	35250786		2203	4300	6503	39942626	SO:0001583	missense	148103	exon4			AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.920G>T	19.37:g.35250786C>A	ENSP00000333802:p.Arg307Leu		39942626	NM_001007248	Q569K0|Q5PRG1	Missense_Mutation	SNP	ENST00000329285.8	37	CCDS32991.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.396919	0.25205	.	.	ENSG00000153896	ENST00000392231;ENST00000329285	T	0.18174	2.23	2.36	-0.0346	0.13896	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13713	0.0332	L	0.50919	1.6	0.46260	D	0.998956	B	0.19935	0.04	B	0.15052	0.012	T	0.07986	-1.0744	9	0.87932	D	0	.	5.0816	0.14659	0.0:0.646:0.2151:0.1389	.	307	Q96NL3	ZN599_HUMAN	L	306;307	ENSP00000333802:R307L	ENSP00000333802:R307L	R	-	2	0	ZNF599	39942626	0.000000	0.05858	0.247000	0.24249	0.874000	0.50279	0.862000	0.27899	0.066000	0.16515	-0.424000	0.05967	CGA		0.413	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460648.2	XM_086046	
TRPM4	54795	broad.mit.edu	37	19	49713617	49713617	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:49713617C>T	ENST00000252826.5	+	21	3409	c.3283C>T	c.(3283-3285)Cga>Tga	p.R1095*	TRPM4_ENST00000355712.5_Nonsense_Mutation_p.R741*|TRPM4_ENST00000427978.2_Nonsense_Mutation_p.R950*	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1095	Calmodulin-binding.				calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.R1095*(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		ATTGTGCAGGCGACCCCGGAG	0.622																																					p.R1095X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3283T	19						.						38.0	41.0	40.0					19																	49713617		2203	4300	6503	54405429	SO:0001587	stop_gained	54795	exon21			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3283C>T	19.37:g.49713617C>T	ENSP00000252826:p.Arg1095*		54405429	NM_017636	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Nonsense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	.	.	.	.	.	.	.	.	.	.	C	39	7.775985	0.98483	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	.	.	.	5.34	0.531	0.17108	.	0.707747	0.14145	N	0.338404	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-4.9386	8.097	0.30835	0.5257:0.3991:0.0:0.0752	.	.	.	.	X	1095;950;741	.	ENSP00000252826:R1095X	R	+	1	2	TRPM4	54405429	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.549000	0.06041	0.021000	0.15133	-0.714000	0.03626	CGA		0.622	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
KLK12	43849	broad.mit.edu	37	19	51535329	51535329	+	Missense_Mutation	SNP	C	C	T	rs372208750		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:51535329C>T	ENST00000525263.1	-	3	379	c.260G>A	c.(259-261)cGg>cAg	p.R87Q	CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000250352.11_Intron|KLK12_ENST00000529888.1_Intron|KLK12_ENST00000250351.4_Missense_Mutation_p.R87Q|KLK12_ENST00000319590.4_Missense_Mutation_p.R87Q			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	87	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R87Q(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		GCCGCTGTGCCGGATCTGCTC	0.706													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12668	0.0		0.0	False		,,,				2504	0.0				p.R87Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G260A	19						.	C	GLN/ARG,GLN/ARG,	3,4399		0,3,2198	31.0	23.0	26.0		260,260,	4.1	0.9	19		26	0,8594		0,0,4297	no	missense,missense,intron	KLK12	NM_019598.2,NM_145894.1,NM_145895.1	43,43,	0,3,6495	TT,TC,CC		0.0,0.0682,0.0231	probably-damaging,probably-damaging,	87/255,87/249,	51535329	3,12993	2201	4297	6498	56227141	SO:0001583	missense	43849	exon4				CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.260G>A	19.37:g.51535329C>T	ENSP00000436458:p.Arg87Gln		56227141	NM_145894	Q9UKR1|Q9UKR2	Missense_Mutation	SNP	ENST00000525263.1	37	CCDS12821.1	.	.	.	.	.	.	.	.	.	.	c	16.42	3.118497	0.56505	6.82E-4	0.0	ENSG00000186474	ENST00000525263;ENST00000319590;ENST00000250351	D;D;D	0.93547	-3.24;-3.24;-3.24	4.07	4.07	0.47477	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.35320	N	0.003290	D	0.88782	0.6530	L	0.47190	1.495	0.34190	D	0.671997	P;D	0.54772	0.938;0.968	B;B	0.37780	0.248;0.258	D	0.92733	0.6201	10	0.66056	D	0.02	.	11.9678	0.53047	0.0:1.0:0.0:0.0	.	87;87	Q9UKR0-2;Q9UKR0	.;KLK12_HUMAN	Q	87	ENSP00000436458:R87Q;ENSP00000324181:R87Q;ENSP00000250351:R87Q	ENSP00000250351:R87Q	R	-	2	0	KLK12	56227141	0.249000	0.23941	0.923000	0.36655	0.480000	0.33159	0.430000	0.21428	2.300000	0.77407	0.650000	0.86243	CGG		0.706	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598	
MAP1S	55201	broad.mit.edu	37	19	17838385	17838385	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:17838385delC	ENST00000324096.4	+	5	2343	c.2192delC	c.(2191-2193)tccfs	p.S731fs	MAP1S_ENST00000597681.1_3'UTR|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Frame_Shift_Del_p.S705fs	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	731	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the microtubule-organizing center localization.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.P732fs*278(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CGCTCGGCTTCCCCACACGAT	0.687																																					p.S731fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2192delC	19						.						21.0	19.0	20.0					19																	17838385		2198	4298	6496	17699385	SO:0001589	frameshift_variant	55201	exon5			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2192delC	19.37:g.17838385delC	ENSP00000325313:p.Ser731fs		17699385	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Frame_Shift_Del	DEL	ENST00000324096.4	37	CCDS32954.1																																																																																				0.687	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
CGB	1082	broad.mit.edu	37	19	49526209	49526209	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:49526209delA	ENST00000357383.4	-	3	793	c.432delT	c.(430-432)cctfs	p.P146fs	CTB-60B18.6_ENST00000591656.1_Intron	NM_000737.3	NP_000728.1	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide	146					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.S147fs*>19(1)		large_intestine(1)	1		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GGCTGGGGGGAGGGGCCTTTG	0.642																																					p.P144fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.432delT	19						.						19.0	18.0	18.0					19																	49526209		2131	4208	6339	54218021	SO:0001589	frameshift_variant	1082	exon3			J00117	CCDS12749.1	19q13.3	2013-02-25				ENSG00000104827		"""Endogenous ligands"""	1886	protein-coding gene	gene with protein product		118860				6774259, 6194155	Standard	NM_000737		Approved	CGB3	uc002plv.2	P01233		ENST00000357383.4:c.432delT	19.37:g.49526209delA	ENSP00000349954:p.Pro146fs		54218021	NM_000737	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Frame_Shift_Del	DEL	ENST00000357383.4	37	CCDS12749.1																																																																																				0.642	CGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452164.2	NM_000737	
LAIR2	3904	broad.mit.edu	37	19	55014943	55014943	+	Missense_Mutation	SNP	C	C	T	rs202049649		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr19:55014943C>T	ENST00000301202.2	+	2	184	c.62C>T	c.(61-63)aCg>aTg	p.T21M	LAIR2_ENST00000351841.2_Missense_Mutation_p.T21M	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	21						extracellular region (GO:0005576)		p.T21M(1)		central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		ACCATCCACACGCAGGAGGGT	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		13457	0.001		0.0	False		,,,				2504	0.0				p.T21M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C62T	19						.						75.0	70.0	72.0					19																	55014943		2203	4297	6500	59706755	SO:0001583	missense	3904	exon2			AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.62C>T	19.37:g.55014943C>T	ENSP00000301202:p.Thr21Met		59706755	NM_002288	Q6PEZ4	Missense_Mutation	SNP	ENST00000301202.2	37	CCDS12897.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	9.994	1.231585	0.22626	.	.	ENSG00000167618	ENST00000412608;ENST00000301202;ENST00000351841	T;T;T	0.00745	5.75;6.72;6.77	2.18	-0.0355	0.13892	.	1.539810	0.04119	N	0.316018	T	0.01695	0.0054	L	0.48362	1.52	0.09310	N	1	B;D;B	0.65815	0.32;0.995;0.343	B;P;B	0.53861	0.049;0.736;0.014	T	0.44050	-0.9353	10	0.48119	T	0.1	.	4.1716	0.10332	0.0:0.62:0.0:0.38	.	15;21;21	C9JFQ0;Q6ISS4-2;Q6ISS4	.;.;LAIR2_HUMAN	M	15;21;21	ENSP00000390729:T15M;ENSP00000301202:T21M;ENSP00000301203:T21M	ENSP00000301202:T21M	T	+	2	0	LAIR2	59706755	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.246000	0.18160	0.053000	0.16036	0.313000	0.20887	ACG		0.587	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140801.1		
SHC1	6464	broad.mit.edu	37	1	154942910	154942911	+	Frame_Shift_Ins	INS	-	-	G	rs115641580	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:154942910_154942911insG	ENST00000368445.5	-	1	306_307	c.92_93insC	c.(91-93)ccgfs	p.P31fs	SHC1_ENST00000368453.4_Intron|SHC1_ENST00000368449.4_Intron|SHC1_ENST00000606391.1_Intron|SHC1_ENST00000368450.1_Intron|SHC1_ENST00000448116.2_Frame_Shift_Ins_p.P31fs	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	31					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.E32fs*23(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCAGCTCCTCCGGGGGGGTGGA	0.619																																					p.P31fs	NSCLC(4;32 234 1864 2492 3259 13747 17376)											.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.93_94insC	1						.																																			153209535	SO:0001589	frameshift_variant	6464	exon1			U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.93dupC	1.37:g.154942917_154942917dupG	ENSP00000357430:p.Pro31fs		153209534	NM_001130040	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Frame_Shift_Ins	INS	ENST00000368445.5	37	CCDS30881.1																																																																																				0.619	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	
SLC1A7	6512	broad.mit.edu	37	1	53555719	53555720	+	Intron	INS	-	-	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:53555719_53555720insG	ENST00000371494.4	-	9	1354				SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7						dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		CCATTTGGTGCGGGGGGTGGGT	0.624																																					.	NSCLC(128;80 1811 21245 38490 51715)											.	.	0			.	1						.																																			53328308	SO:0001627	intron_variant	6512	.			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1227-113->C	1.37:g.53555725_53555725dupG			53328307	.	Q5VVZ0|Q969Z8|Q9BW45	Frame_Shift_Ins	INS	ENST00000371494.4	37	CCDS574.1																																																																																				0.624	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	
AMY2A	279	broad.mit.edu	37	1	104162316	104162316	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:104162316G>C	ENST00000414303.2	+	4	718	c.654G>C	c.(652-654)tgG>tgC	p.W218C		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	218					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)	p.W218C(1)		endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	AGCACATGTGGCCTGGAGACA	0.423																																					p.W218C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G654C	1						.						39.0	26.0	30.0					1																	104162316		2046	4033	6079	103963839	SO:0001583	missense	279	exon4			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.654G>C	1.37:g.104162316G>C	ENSP00000397582:p.Trp218Cys		103963839	NM_000699	B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	CCDS783.1	.	.	.	.	.	.	.	.	.	.	g	16.06	3.015014	0.54468	.	.	ENSG00000243480	ENST00000414303;ENST00000393932	D	0.98264	-4.83	2.96	2.96	0.34315	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99190	0.9719	H	0.96175	3.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98914	1.0781	10	0.72032	D	0.01	.	13.9731	0.64255	0.0:0.0:1.0:0.0	.	218;218	B9EJG1;P04746	.;AMYP_HUMAN	C	218	ENSP00000397582:W218C	ENSP00000377509:W218C	W	+	3	0	AMY2A	103963839	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.205000	0.95048	1.637000	0.50538	0.305000	0.20034	TGG		0.423	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699	
CFAP74	85452	broad.mit.edu	37	1	1888152	1888152	+	IGR	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:1888152C>T								TMEM52 (37440 upstream) : C1orf222 (31410 downstream)														p.T641T(1)									CGTTGGTCAGCGTGATGGTCC	0.572																																					p.T641T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1923A	1						.						72.0	78.0	76.0					1																	1888152		2173	4272	6445	1878012	SO:0001628	intergenic_variant	85452	exon17																															1.37:g.1888152C>T			1878012	NM_001080484		Silent	SNP		37																																																																																				0	0.572								
IGSF21	84966	broad.mit.edu	37	1	18692101	18692101	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:18692101C>T	ENST00000251296.1	+	6	1308	c.925C>T	c.(925-927)Ctc>Ttc	p.L309F		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	309						extracellular region (GO:0005576)		p.L309F(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CACCTGGACCCTCAACCCACA	0.642																																					p.L309F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C925T	1						.						114.0	92.0	100.0					1																	18692101		2203	4300	6503	18564688	SO:0001583	missense	84966	exon6			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.925C>T	1.37:g.18692101C>T	ENSP00000251296:p.Leu309Phe		18564688	NM_032880	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.19|16.19	3.053536|3.053536	0.55218|0.55218	.|.	.|.	ENSG00000117154|ENSG00000117154	ENST00000251296|ENST00000412684	T|.	0.35789|.	1.29|.	4.28|4.28	4.28|4.28	0.50868|0.50868	Immunoglobulin-like fold (1);|.	0.059113|.	0.64402|.	D|.	0.000003|.	T|T	0.55210|0.55210	0.1906|0.1906	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	B|.	0.18310|.	0.027|.	B|.	0.15870|.	0.014|.	T|T	0.51616|0.51616	-0.8683|-0.8683	10|5	0.14252|.	T|.	0.57|.	-13.8353|-13.8353	15.7859|15.7859	0.78304|0.78304	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	309|.	Q96ID5|.	IGS21_HUMAN|.	F|L	309|261	ENSP00000251296:L309F|.	ENSP00000251296:L309F|.	L|P	+|+	1|2	0|0	IGSF21|IGSF21	18564688|18564688	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.283000|5.283000	0.65621|0.65621	2.383000|2.383000	0.81215|0.81215	0.561000|0.561000	0.74099|0.74099	CTC|CCT		0.642	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
SORT1	6272	broad.mit.edu	37	1	109878868	109878868	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:109878868C>A	ENST00000256637.6	-	11	1423	c.1365G>T	c.(1363-1365)aaG>aaT	p.K455N	SORT1_ENST00000538502.1_Missense_Mutation_p.K318N	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	455					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.K455N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		AAACCTCATTCTTGTTTTTTG	0.428																																					p.K455N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1365T	1						.						209.0	168.0	182.0					1																	109878868		2203	4300	6503	109680391	SO:0001583	missense	6272	exon11			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1365G>T	1.37:g.109878868C>A	ENSP00000256637:p.Lys455Asn		109680391	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	37	CCDS798.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410781	0.25465	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.29917	1.55;1.55	5.69	2.39	0.29439	VPS10 (1);	0.330777	0.31636	N	0.007302	T	0.05914	0.0154	N	0.11427	0.14	0.41171	D	0.98616	B;B	0.14805	0.003;0.011	B;B	0.06405	0.001;0.002	T	0.17258	-1.0375	10	0.17832	T	0.49	-7.9236	11.5244	0.50571	0.0:0.7612:0.0:0.2388	.	318;455	B4DWI3;Q99523	.;SORT_HUMAN	N	455;318	ENSP00000256637:K455N;ENSP00000438597:K318N	ENSP00000256637:K455N	K	-	3	2	SORT1	109680391	1.000000	0.71417	0.993000	0.49108	0.550000	0.35303	1.111000	0.31159	0.762000	0.33152	-0.140000	0.14226	AAG		0.428	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
RGS13	6003	broad.mit.edu	37	1	192628592	192628592	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:192628592T>A	ENST00000391995.2	+	7	707	c.419T>A	c.(418-420)tTt>tAt	p.F140Y	RGS13_ENST00000543215.1_Missense_Mutation_p.F140Y|RGS13_ENST00000482095.1_3'UTR	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	140	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.F140Y(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						TACCCCAGATTTCTAAAGTCA	0.343																																					p.F140Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T419A	1						.						61.0	59.0	60.0					1																	192628592		2203	4300	6503	190895215	SO:0001583	missense	6003	exon6			AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.419T>A	1.37:g.192628592T>A	ENSP00000375853:p.Phe140Tyr		190895215	NM_144766	Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	ENST00000391995.2	37	CCDS1376.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.951808	0.92660	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.09350	2.99;2.99	5.89	5.89	0.94794	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	M	0.82132	2.575	0.58432	D	0.99999	D	0.89917	1.0	D	0.87578	0.998	T	0.14309	-1.0477	10	0.87932	D	0	.	14.2432	0.65971	0.0:0.0:0.0:1.0	.	140	O14921	RGS13_HUMAN	Y	140	ENSP00000375853:F140Y;ENSP00000442837:F140Y	ENSP00000375853:F140Y	F	+	2	0	RGS13	190895215	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.354000	0.79424	2.251000	0.74343	0.482000	0.46254	TTT		0.343	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927	
SSBP3	23648	broad.mit.edu	37	1	54693980	54693980	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:54693980C>T	ENST00000371320.3	-	17	1495	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q	SSBP3_ENST00000371319.3_Missense_Mutation_p.R335Q|SSBP3_ENST00000417664.2_Missense_Mutation_p.R252Q|SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000357475.4_Missense_Mutation_p.R342Q	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	362	Gly-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)	p.R335Q(1)		central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GCCGTCATCTCGAGGGGTGCC	0.572																																					p.R362Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1085A	1						.						112.0	107.0	109.0					1																	54693980		2203	4300	6503	54466568	SO:0001583	missense	23648	exon17				CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.1085G>A	1.37:g.54693980C>T	ENSP00000360371:p.Arg362Gln		54466568	NM_145716	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	C	35	5.443984	0.96187	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	4.38	4.38	0.52667	.	0.000000	0.64402	U	0.000001	T	0.79088	0.4387	M	0.75085	2.285	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.975;0.955;0.999	T	0.82226	-0.0562	9	0.62326	D	0.03	-2.6249	17.3743	0.87387	0.0:1.0:0.0:0.0	.	335;342;362	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	Q	252;362;335;342	.	ENSP00000350067:R342Q	R	-	2	0	SSBP3	54466568	0.996000	0.38824	0.994000	0.49952	0.986000	0.74619	7.481000	0.81124	2.151000	0.67156	0.449000	0.29647	CGA		0.572	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070	
KCNT2	343450	broad.mit.edu	37	1	196250003	196250003	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:196250003A>C	ENST00000294725.9	-	25	3812	c.2897T>G	c.(2896-2898)cTt>cGt	p.L966R	KCNT2_ENST00000367433.5_Missense_Mutation_p.L942R|KCNT2_ENST00000609185.1_Missense_Mutation_p.L892R|KCNT2_ENST00000367431.4_Missense_Mutation_p.L892R|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	966					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.L966R(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGATGTAGTAAGTTTCTGAGA	0.328																																					p.L966R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2897G	1						.						93.0	95.0	94.0					1																	196250003		2203	4300	6503	194516626	SO:0001583	missense	343450	exon25			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2897T>G	1.37:g.196250003A>C	ENSP00000294725:p.Leu966Arg		194516626	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.021575	0.54576	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.78246	-1.16;-1.16;-1.16	5.52	5.52	0.82312	.	0.000000	0.53938	D	0.000056	T	0.77075	0.4077	L	0.50333	1.59	0.80722	D	1	P;P;P;P;P	0.51147	0.904;0.942;0.714;0.823;0.904	B;P;P;P;B	0.49799	0.418;0.622;0.499;0.499;0.418	T	0.73216	-0.4053	10	0.13470	T	0.59	-12.0344	14.9129	0.70773	1.0:0.0:0.0:0.0	.	966;924;942;892;966	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	R	942;892;966	ENSP00000356403:L942R;ENSP00000356401:L892R;ENSP00000294725:L966R	ENSP00000294725:L966R	L	-	2	0	KCNT2	194516626	1.000000	0.71417	0.507000	0.27676	0.995000	0.86356	8.347000	0.90062	2.222000	0.72286	0.455000	0.32223	CTT		0.328	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
ELF3	1999	broad.mit.edu	37	1	201984358	201984358	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr1:201984358delC	ENST00000359651.3	+	8	4215	c.1023delC	c.(1021-1023)atcfs	p.I341fs	ELF3_ENST00000367284.5_Frame_Shift_Del_p.I341fs|ELF3_ENST00000367283.3_Frame_Shift_Del_p.I341fs|RP11-510N19.5_ENST00000504773.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.L342fs*>30(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						AACGGGAGATCCTGGAACGGG	0.597																																					p.I341fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1023delC	1						.						78.0	81.0	80.0					1																	201984358		2203	4300	6503	200250981	SO:0001589	frameshift_variant	1999	exon9			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1023delC	1.37:g.201984358delC	ENSP00000352673:p.Ile341fs		200250981	NM_001114309		Frame_Shift_Del	DEL	ENST00000359651.3	37	CCDS1419.1																																																																																				0.597	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
TOP1	7150	broad.mit.edu	37	20	39658297	39658298	+	Intron	INS	-	-	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:39658297_39658298insA	ENST00000361337.2	+	2	308					NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I						chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	CCGGCCCTCCCAAGAGGGGACA	0.698			T	NUP98	AML*																																.			Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	.	.	0			.	20						.																																			39091712	SO:0001627	intron_variant	7150	.				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.58+202->A	20.37:g.39658299_39658299dupA			39091711	.	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Frame_Shift_Ins	INS	ENST00000361337.2	37	CCDS13312.1																																																																																				0.698	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2		
SLC24A3	57419	broad.mit.edu	37	20	19193556	19193556	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:19193556C>A	ENST00000328041.6	+	1	267	c.70C>A	c.(70-72)Ctg>Atg	p.L24M	RP11-97N19.2_ENST00000446849.1_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	24					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.L24M(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGACCTTCTGCTGAGCCAGCT	0.771																																					p.L24M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C70A	20						.						6.0	5.0	6.0					20																	19193556		2104	4134	6238	19141556	SO:0001583	missense	57419	exon1			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.70C>A	20.37:g.19193556C>A	ENSP00000333519:p.Leu24Met		19141556	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Missense_Mutation	SNP	ENST00000328041.6	37	CCDS13140.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998804	0.54147	.	.	ENSG00000185052	ENST00000328041	T	0.62639	0.01	4.36	2.24	0.28232	.	0.136569	0.29537	U	0.011864	T	0.48519	0.1504	L	0.29908	0.895	0.21841	N	0.999511	P	0.49090	0.919	P	0.47299	0.543	T	0.32052	-0.9921	9	.	.	.	.	4.603	0.12363	0.2161:0.6681:0.0:0.1157	.	24	Q9HC58	NCKX3_HUMAN	M	24	ENSP00000333519:L24M	.	L	+	1	2	SLC24A3	19141556	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.119000	0.41958	0.831000	0.34780	0.289000	0.19496	CTG		0.771	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	
EPB41L1	2036	broad.mit.edu	37	20	34773186	34773186	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:34773186C>T	ENST00000338074.2	+	7	875	c.714C>T	c.(712-714)agC>agT	p.S238S	EPB41L1_ENST00000373950.2_Silent_p.S141S|EPB41L1_ENST00000202028.5_Silent_p.S176S|EPB41L1_ENST00000441639.1_Silent_p.S176S|EPB41L1_ENST00000373946.3_Silent_p.S207S|EPB41L1_ENST00000373941.1_Silent_p.S238S	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	238	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.S238S(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					ACTATGTCAGCGAGCTCCGCT	0.582																																					p.S238S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C714T	20						.						69.0	60.0	63.0					20																	34773186		2203	4300	6503	34236600	SO:0001819	synonymous_variant	2036	exon7			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.714C>T	20.37:g.34773186C>T			34236600	NM_012156	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1																																																																																				0.582	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
CTSA	5476	broad.mit.edu	37	20	44520336	44520336	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:44520336G>A	ENST00000372459.2	+	1	322	c.129G>A	c.(127-129)aaG>aaA	p.K43K	CTSA_ENST00000191018.5_Silent_p.K43K|CTSA_ENST00000354880.5_Silent_p.K61K|RP3-337O18.9_ENST00000607703.1_RNA|NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000372484.3_Silent_p.K61K			P10619	PPGB_HUMAN	cathepsin A	43					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.K61K(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				GGCTGGCCAAGCAGCCGTCTT	0.677																																					p.K61K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G183A	20						.						57.0	63.0	61.0					20																	44520336		2203	4297	6500	43953743	SO:0001819	synonymous_variant	5476	exon2			M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.129G>A	20.37:g.44520336G>A			43953743	NM_000308	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Silent	SNP	ENST00000372459.2	37	CCDS46609.1																																																																																				0.677	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
PLCB4	5332	broad.mit.edu	37	20	9388678	9388678	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:9388678A>C	ENST00000378493.1	+	18	1741	c.1726A>C	c.(1726-1728)Aag>Cag	p.K576Q	PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.K576Q|PLCB4_ENST00000278655.4_Missense_Mutation_p.K576Q|PLCB4_ENST00000414679.2_Missense_Mutation_p.K588Q|PLCB4_ENST00000378473.3_Missense_Mutation_p.K588Q|PLCB4_ENST00000334005.3_Missense_Mutation_p.K576Q			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	576	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.K576Q(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCAGCCTGTAAAGTTTCAAGG	0.403																																					p.K576Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1726C	20						.						161.0	156.0	157.0					20																	9388678		2203	4300	6503	9336678	SO:0001583	missense	5332	exon18				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1726A>C	20.37:g.9388678A>C	ENSP00000367754:p.Lys576Gln		9336678	NM_000933	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454163	0.84209	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.56	5.56	0.83823	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.108090	0.64402	D	0.000008	D	0.82323	0.5012	M	0.84219	2.685	0.80722	D	1	D;D;P;B	0.61080	0.989;0.975;0.874;0.446	D;P;D;B	0.67103	0.949;0.787;0.914;0.239	D	0.84899	0.0841	10	0.62326	D	0.03	.	15.713	0.77646	1.0:0.0:0.0:0.0	.	588;423;576;576	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	Q	576;588;576;576;576;424	ENSP00000334105:K576Q;ENSP00000367734:K588Q;ENSP00000278655:K576Q;ENSP00000367754:K576Q;ENSP00000367762:K576Q;ENSP00000390616:K424Q	ENSP00000278655:K576Q	K	+	1	0	PLCB4	9336678	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.339000	0.96797	2.114000	0.64651	0.460000	0.39030	AAG		0.403	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PREX1	57580	broad.mit.edu	37	20	47271846	47271846	+	Missense_Mutation	SNP	C	C	T	rs139250516		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr20:47271846C>T	ENST00000371941.3	-	19	2213	c.2191G>A	c.(2191-2193)Gtc>Atc	p.V731I	PREX1_ENST00000396220.1_Missense_Mutation_p.V731I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	731					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V731I(4)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ACAGCATAGACGTACGGTGGG	0.572																																					p.V731I												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G2191A	20						.	C	ILE/VAL	0,4406		0,0,2203	145.0	97.0	114.0		2191	3.9	0.4	20	dbSNP_134	114	3,8597	3.0+/-9.4	0,3,4297	no	missense	PREX1	NM_020820.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign	731/1660	47271846	3,13003	2203	4300	6503	46705253	SO:0001583	missense	57580	exon19			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2191G>A	20.37:g.47271846C>T	ENSP00000361009:p.Val731Ile		46705253	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652121	0.47362	0.0	3.49E-4	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.19394	2.15;2.15	4.85	3.9	0.45041	PDZ/DHR/GLGF (2);	0.000000	0.48767	U	0.000165	T	0.16599	0.0399	L	0.31120	0.905	0.45930	D	0.998761	P;D	0.54047	0.846;0.964	B;B	0.42462	0.185;0.388	T	0.02087	-1.1216	10	0.33940	T	0.23	.	12.9814	0.58567	0.0:0.9215:0.0:0.0785	.	731;28	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	I	731	ENSP00000361009:V731I;ENSP00000379522:V731I	ENSP00000361009:V731I	V	-	1	0	PREX1	46705253	0.441000	0.25626	0.445000	0.26908	0.401000	0.30781	1.075000	0.30716	1.021000	0.39600	0.655000	0.94253	GTC		0.572	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PCNT	5116	broad.mit.edu	37	21	47746420	47746420	+	Missense_Mutation	SNP	G	G	A	rs375098069		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr21:47746420G>A	ENST00000359568.5	+	2	291	c.184G>A	c.(184-186)Gca>Aca	p.A62T	C21orf58_ENST00000397682.3_5'Flank|PCNT_ENST00000480896.1_3'UTR|C21orf58_ENST00000397680.1_5'Flank|C21orf58_ENST00000291691.7_5'Flank|C21orf58_ENST00000397685.4_5'Flank	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	62					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.A62T(2)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GGAGGACAGCGCACTCTGTGG	0.562																																					p.A62T												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G184A	21						.						127.0	113.0	118.0					21																	47746420		2203	4300	6503	46570848	SO:0001583	missense	5116	exon2			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.184G>A	21.37:g.47746420G>A	ENSP00000352572:p.Ala62Thr		46570848	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.224435	0.39300	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01484	4.84	4.65	2.86	0.33363	.	0.912680	0.08894	N	0.878206	T	0.01592	0.0051	N	0.22421	0.69	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.49560	-0.8927	10	0.15499	T	0.54	.	8.1138	0.30930	0.1859:0.0:0.8141:0.0	.	62	O95613	PCNT_HUMAN	T	62	ENSP00000352572:A62T	ENSP00000338675:A62T	A	+	1	0	PCNT	46570848	0.108000	0.22018	0.000000	0.03702	0.000000	0.00434	3.434000	0.52841	0.592000	0.29728	-0.379000	0.06801	GCA		0.562	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
DRICH1	51233	broad.mit.edu	37	22	23968211	23968211	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr22:23968211A>T	ENST00000317749.5	-	2	530	c.233T>A	c.(232-234)tTa>tAa	p.L78*		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		78								p.L78*(1)		endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						CAGAAATTTTAAACTCAGGCG	0.488																																					p.L78X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T233A	22						.						88.0	87.0	87.0					22																	23968211		1880	4104	5984	22298211	SO:0001587	stop_gained	51233	exon2																														ENST00000317749.5:c.233T>A	22.37:g.23968211A>T	ENSP00000316137:p.Leu78*		22298211	NM_016449	Q6ICJ8|Q6P4I3|Q9NU31	Nonsense_Mutation	SNP	ENST00000317749.5	37	CCDS42985.1	.	.	.	.	.	.	.	.	.	.	a	17.02	3.281521	0.59758	.	.	ENSG00000189269	ENST00000317749	.	.	.	0.827	-1.65	0.08291	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.734	0.02937	0.3259:0.3961:0.0:0.2781	.	.	.	.	X	78	.	ENSP00000316137:L78X	L	-	2	0	C22orf43	22298211	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.636000	0.05465	-0.917000	0.03813	0.145000	0.16022	TTA		0.488	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319708.2		
SPECC1L	23384	broad.mit.edu	37	22	24717468	24717468	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr22:24717468C>T	ENST00000314328.9	+	5	805	c.520C>T	c.(520-522)Cag>Tag	p.Q174*	SPECC1L_ENST00000541492.1_Nonsense_Mutation_p.Q174*|SPECC1L_ENST00000416735.1_Intron|SPECC1L-ADORA2A_ENST00000358654.2_Nonsense_Mutation_p.Q174*|SPECC1L_ENST00000437398.1_Nonsense_Mutation_p.Q174*	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	174					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)		p.Q174*(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						GTCAGACAATCAGATCAGTGA	0.463																																					p.Q174X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C520T	22						.						86.0	78.0	80.0					22																	24717468		2203	4300	6503	23047468	SO:0001587	stop_gained	23384	exon4			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.520C>T	22.37:g.24717468C>T	ENSP00000325785:p.Gln174*		23047468	NM_001145468	B7Z758|F5H1H6|O15081	Nonsense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	C	36	5.887076	0.97068	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.4026	18.8711	0.92315	0.0:1.0:0.0:0.0	.	.	.	.	X	202;174;174;174;174;113	.	ENSP00000325785:Q174X	Q	+	1	0	SPECC1L	23047468	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.598000	0.82745	2.717000	0.92951	0.650000	0.86243	CAG		0.463	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
ELFN2	114794	broad.mit.edu	37	22	37770245	37770245	+	Missense_Mutation	SNP	C	C	T	rs142330872		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr22:37770245C>T	ENST00000402918.2	-	3	2115	c.1330G>A	c.(1330-1332)Ggg>Agg	p.G444R	RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	444					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.G444W(1)|p.G444R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					ACATCAGCCCCGTAGCGCATC	0.627																																					p.G444R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1330A	22						.	C	ARG/GLY	0,4406		0,0,2203	145.0	142.0	143.0		1330	4.6	0.2	22	dbSNP_134	143	2,8598	2.2+/-6.3	0,2,4298	no	missense	ELFN2	NM_052906.3	125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	444/821	37770245	2,13004	2203	4300	6503	36100191	SO:0001583	missense	114794	exon3			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.1330G>A	22.37:g.37770245C>T	ENSP00000385277:p.Gly444Arg		36100191	NM_052906	Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	37	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559713	0.45590	0.0	2.33E-4	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.60548	0.18;0.18	4.57	4.57	0.56435	.	0.104255	0.64402	D	0.000004	T	0.76278	0.3965	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80578	-0.1320	10	0.87932	D	0	-34.2882	17.3539	0.87330	0.0:1.0:0.0:0.0	.	444	Q5R3F8	PPR29_HUMAN	R	444	ENSP00000300147:G444R;ENSP00000385277:G444R	ENSP00000300147:G444R	G	-	1	0	ELFN2	36100191	1.000000	0.71417	0.188000	0.23233	0.199000	0.23934	5.919000	0.70005	2.079000	0.62486	0.609000	0.83330	GGG		0.627	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906	
HMGXB4	10042	broad.mit.edu	37	22	35661575	35661576	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	AG	AG	AG	-	AG	-	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr22:35661575_35661576delAG	ENST00000216106.5	+	5	1322_1323	c.1194_1195delAG	c.(1192-1197)aaagagfs	p.E399fs	HMGXB4_ENST00000444518.2_Frame_Shift_Del_p.E290fs	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	399					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						agaaggacaaagagagagagag	0.465																																					p.398_399del												.	.	0			c.1194_1195del	22						.																																			33991576	SO:0001589	frameshift_variant	10042	exon5			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1194_1195delAG	22.37:g.35661585_35661586delAG	ENSP00000216106:p.Glu399fs		33991575	NM_001003681	O75672|O75673|Q9UMT5	Frame_Shift_Del	DEL	ENST00000216106.5	37	CCDS33641.1																																																																																				0.465	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
ATF4	468	broad.mit.edu	37	22	39917992	39917992	+	Silent	SNP	T	T	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr22:39917992T>C	ENST00000337304.2	+	2	1323	c.441T>C	c.(439-441)agT>agC	p.S147S	ATF4_ENST00000404241.2_Silent_p.S147S|ATF4_ENST00000396680.1_Silent_p.S147S	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	147					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S147S(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TCCCAGAAAGTTTAACAAAAC	0.527																																					p.S147S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T441C	22						.						115.0	129.0	125.0					22																	39917992		2203	4300	6503	38247938	SO:0001819	synonymous_variant	468	exon2			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.441T>C	22.37:g.39917992T>C			38247938	NM_001675	Q9UH31	Silent	SNP	ENST00000337304.2	37	CCDS13996.1																																																																																				0.527	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
ZC3H6	376940	broad.mit.edu	37	2	113067542	113067542	+	Missense_Mutation	SNP	G	G	C	rs576103507	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:113067542G>C	ENST00000409871.1	+	4	818	c.417G>C	c.(415-417)gaG>gaC	p.E139D	ZC3H6_ENST00000343936.4_Missense_Mutation_p.E139D	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	139							metal ion binding (GO:0046872)	p.E139D(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						AATATGATGAGTACAGCACCT	0.373													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19899	0.0		0.0	False		,,,				2504	0.0				p.E139D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G417C	2						.						59.0	54.0	55.0					2																	113067542		1865	4099	5964	112784013	SO:0001583	missense	376940	exon4			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.417G>C	2.37:g.113067542G>C	ENSP00000386764:p.Glu139Asp		112784013	NM_198581	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	37	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293263	0.23564	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.14516	2.5;2.5	5.86	-6.58	0.01836	.	0.789850	0.12286	N	0.482438	T	0.03608	0.0103	N	0.08118	0	0.25348	N	0.988894	B	0.06786	0.001	B	0.06405	0.002	T	0.40079	-0.9582	10	0.10902	T	0.67	-6.5415	1.8539	0.03174	0.3156:0.338:0.1898:0.1566	.	139	P61129	ZC3H6_HUMAN	D	139;139;116	ENSP00000386764:E139D;ENSP00000340298:E139D	ENSP00000340298:E139D	E	+	3	2	ZC3H6	112784013	0.828000	0.29307	0.923000	0.36655	0.964000	0.63967	-0.169000	0.09911	-0.914000	0.03827	-0.367000	0.07326	GAG		0.373	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
UBXN4	23190	broad.mit.edu	37	2	136513161	136513161	+	Silent	SNP	G	G	A	rs149655604		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:136513161G>A	ENST00000272638.9	+	5	719	c.408G>A	c.(406-408)gcG>gcA	p.A136A	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	136					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A136A(2)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						CTCCATCTGCGTCATTTGAAC	0.393													g|||	1	0.000199681	0.0008	0.0	5008	,	,		13577	0.0		0.0	False		,,,				2504	0.0				p.A136A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G408A	2						.	G		13,3697		0,13,1842	97.0	92.0	94.0		408	2.3	1.0	2	dbSNP_134	94	0,8216		0,0,4108	no	coding-synonymous	UBXN4	NM_014607.3		0,13,5950	AA,AG,GG		0.0,0.3504,0.109		136/509	136513161	13,11913	1855	4108	5963	136229631	SO:0001819	synonymous_variant	23190	exon5			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.408G>A	2.37:g.136513161G>A			136229631	NM_014607	A8K9W4|Q4ZG56|Q8IYM5	Silent	SNP	ENST00000272638.9	37	CCDS42761.1																																																																																				0.393	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607	
LRP1B	53353	broad.mit.edu	37	2	141625248	141625248	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:141625248T>C	ENST00000389484.3	-	27	5461	c.4490A>G	c.(4489-4491)aAg>aGg	p.K1497R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1497					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.K1497T(1)|p.K1497R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCCTGTCCACTTATTGGCTTT	0.488										TSP Lung(27;0.18)																											p.K1497R	Colon(99;50 2074 2507 20106)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4490G	2						.						201.0	177.0	185.0					2																	141625248		2203	4300	6503	141341718	SO:0001583	missense	53353	exon27			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4490A>G	2.37:g.141625248T>C	ENSP00000374135:p.Lys1497Arg		141341718	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436253	0.83885	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.91577	-2.87;-2.87	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.95014	0.8386	M	0.79011	2.435	0.58432	D	0.999997	D;D	0.76494	0.999;0.997	D;D	0.87578	0.998;0.985	D	0.94985	0.8129	10	0.49607	T	0.09	.	15.4528	0.75285	0.0:0.0:0.0:1.0	.	680;1497	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	R	1497;1435;642	ENSP00000374135:K1497R;ENSP00000413239:K642R	ENSP00000374135:K1497R	K	-	2	0	LRP1B	141341718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.942000	0.87708	2.060000	0.61445	0.533000	0.62120	AAG		0.488	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
PLA2R1	22925	broad.mit.edu	37	2	160804044	160804044	+	Silent	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:160804044A>G	ENST00000283243.7	-	26	3942	c.3736T>C	c.(3736-3738)Ttg>Ctg	p.L1246L	PLA2R1_ENST00000392771.1_Silent_p.L1246L|PLA2R1_ENST00000460710.1_5'Flank	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1246					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.L1246L(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TCTGAGCACAACTCTGGGTGT	0.348																																					p.L1246L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3736C	2						.						102.0	111.0	108.0					2																	160804044		2203	4300	6503	160512290	SO:0001819	synonymous_variant	22925	exon26			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3736T>C	2.37:g.160804044A>G			160512290	NM_007366	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	CCDS33309.1																																																																																				0.348	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
MYL1	4632	broad.mit.edu	37	2	211159129	211159129	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:211159129C>G	ENST00000352451.3	-	4	465	c.318G>C	c.(316-318)aaG>aaC	p.K106N	MYL1_ENST00000496436.1_5'UTR|MYL1_ENST00000341685.4_Missense_Mutation_p.K62N	NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	106					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.K106N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		ACTCAATTTTCTTGGCATTCA	0.378																																					p.K62N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G186C	2						.						123.0	115.0	118.0					2																	211159129		2203	4300	6503	210867374	SO:0001583	missense	4632	exon4				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.318G>C	2.37:g.211159129C>G	ENSP00000307280:p.Lys106Asn		210867374	NM_079422	B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	ENST00000352451.3	37	CCDS2390.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827348	0.71143	.	.	ENSG00000168530	ENST00000341685;ENST00000352451	D;D	0.90004	-2.6;-2.6	5.77	3.96	0.45880	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94311	0.8172	M	0.85462	2.755	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.997	D	0.94885	0.8042	10	0.87932	D	0	.	12.6706	0.56864	0.0:0.8647:0.0:0.1353	.	106;62	P05976;P05976-2	MYL1_HUMAN;.	N	62;106	ENSP00000343321:K62N;ENSP00000307280:K106N	ENSP00000343321:K62N	K	-	3	2	MYL1	210867374	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.485000	0.45250	1.467000	0.48044	0.650000	0.86243	AAG		0.378	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420	
NYAP2	57624	broad.mit.edu	37	2	226447360	226447360	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:226447360G>A	ENST00000272907.6	+	4	1640	c.1227G>A	c.(1225-1227)gcG>gcA	p.A409A	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	409	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.A409A(1)									CCACCCCTGCGCTCTCCTCGT	0.692																																					p.A409A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1227A	2						.						20.0	25.0	23.0					2																	226447360		2029	4164	6193	226155604	SO:0001819	synonymous_variant	57624	exon4			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1227G>A	2.37:g.226447360G>A			226155604	NM_020864	A2RRN4|Q96NL2	Silent	SNP	ENST00000272907.6	37	CCDS46529.1																																																																																				0.692	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
TMEM214	54867	broad.mit.edu	37	2	27263669	27263669	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:27263669C>T	ENST00000238788.9	+	17	2096	c.2034C>T	c.(2032-2034)ttC>ttT	p.F678F	TMEM214_ENST00000404032.3_Silent_p.F633F	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	678					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.F678F(1)		kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CAGTGGCTTTCTTGGACTGGG	0.557																																					p.F633F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1899T	2						.						103.0	103.0	103.0					2																	27263669		2065	4191	6256	27117173	SO:0001819	synonymous_variant	54867	exon16				CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.2034C>T	2.37:g.27263669C>T			27117173	NM_001083590	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Silent	SNP	ENST00000238788.9	37	CCDS42664.1																																																																																				0.557	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
GPR75-ASB3	100302652	broad.mit.edu	37	2	53955976	53955976	+	Silent	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:53955976A>C	ENST00000263634.3	-	5	611	c.477T>G	c.(475-477)gcT>gcG	p.A159A	ASB3_ENST00000406625.2_Silent_p.A194A|GPR75-ASB3_ENST00000482829.1_5'UTR|GPR75-ASB3_ENST00000394717.2_Silent_p.A86A|GPR75-ASB3_ENST00000406687.1_Silent_p.A86A|GPR75-ASB3_ENST00000352846.3_Silent_p.A197A|ASB3_ENST00000498475.2_5'UTR	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough									p.A159A(1)									TTATGATCTCAGCATTTTCCT	0.328																																					p.A159A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T477G	2						.						95.0	92.0	93.0					2																	53955976		2202	4300	6502	53809480	SO:0001819	synonymous_variant	51130	exon5				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.477T>G	2.37:g.53955976A>C			53809480	NM_016115		Silent	SNP	ENST00000263634.3	37	CCDS1846.1	.	.	.	.	.	.	.	.	.	.	A	8.397	0.841124	0.16891	.	.	ENSG00000115239	ENST00000406053	.	.	.	5.46	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.554	0.27814	0.715:0.1454:0.0:0.1396	.	.	.	.	G	152	.	.	X	-	1	0	ASB3	53809480	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.241000	0.43097	2.192000	0.70111	0.533000	0.62120	TGA		0.328	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251402.3		
PCBP1	5093	broad.mit.edu	37	2	70315180	70315180	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:70315180T>A	ENST00000303577.5	+	1	596	c.305T>A	c.(304-306)cTg>cAg	p.L102Q	PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000601396.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	102	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L102Q(2)|p.L102P(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						ACCCTGAGGCTGGTGGTGCCG	0.612																																					p.L102Q	Colon(85;1146 1307 3484 18706 25380)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T305A	2						.						57.0	70.0	66.0					2																	70315180		2200	4299	6499	70168684	SO:0001583	missense	5093	exon1				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.305T>A	2.37:g.70315180T>A	ENSP00000305556:p.Leu102Gln		70168684	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.469571	0.63625	.	.	ENSG00000169564	ENST00000303577	T	0.34859	1.34	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.082382	0.49916	U	0.000122	T	0.72070	0.3415	H	0.97783	4.075	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.81777	-0.0777	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	102	Q15365	PCBP1_HUMAN	Q	102	ENSP00000305556:L102Q	ENSP00000305556:L102Q	L	+	2	0	PCBP1	70168684	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	4.781000	0.62389	2.120000	0.65058	0.477000	0.44152	CTG		0.612	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
ACTR1B	10120	broad.mit.edu	37	2	98277098	98277098	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:98277098G>A	ENST00000289228.5	-	3	341	c.125C>T	c.(124-126)cCg>cTg	p.P42L		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	42					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.P42L(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CATGTGCTTCGGCCGCCCGAC	0.602																																					p.P42L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C125T	2						.						92.0	92.0	92.0					2																	98277098		2203	4300	6503	97643530	SO:0001583	missense	10120	exon3			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.125C>T	2.37:g.98277098G>A	ENSP00000289228:p.Pro42Leu		97643530	NM_005735	D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	ENST00000289228.5	37	CCDS2033.1	.	.	.	.	.	.	.	.	.	.	.	24.6	4.553865	0.86231	.	.	ENSG00000115073	ENST00000289228	D	0.97378	-4.36	5.47	5.47	0.80525	.	0.062767	0.64402	N	0.000004	D	0.98579	0.9525	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99616	1.0982	10	0.87932	D	0	.	16.8234	0.85924	0.0:0.0:1.0:0.0	.	42	P42025	ACTY_HUMAN	L	42	ENSP00000289228:P42L	ENSP00000289228:P42L	P	-	2	0	ACTR1B	97643530	1.000000	0.71417	0.965000	0.40720	0.580000	0.36256	9.839000	0.99476	2.591000	0.87537	0.561000	0.74099	CCG		0.602	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
SATB2	23314	broad.mit.edu	37	2	200320686	200320686	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:200320686delC	ENST00000417098.1	-	2	891	c.75delG	c.(73-75)gggfs	p.G25fs	SATB2_ENST00000428695.1_Frame_Shift_Del_p.G25fs|SATB2-AS1_ENST00000442967.1_RNA|SATB2_ENST00000457245.1_Frame_Shift_Del_p.G25fs|SATB2_ENST00000260926.5_Frame_Shift_Del_p.G25fs|SATB2_ENST00000443023.1_Frame_Shift_Del_p.G25fs|SATB2-AS1_ENST00000441234.1_RNA	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	25					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.P26fs*4(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGGGGGAGGCCCCTTGACGT	0.721																																					p.G25fs	Colon(30;262 767 11040 24421 36230)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.75delG	2						.						3.0	3.0	3.0					2																	200320686		1870	3830	5700	200028931	SO:0001589	frameshift_variant	23314	exon2			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.75delG	2.37:g.200320686delC	ENSP00000401112:p.Gly25fs		200028931	NM_001172509	A8K5Z8|Q3ZB87|Q4V763	Frame_Shift_Del	DEL	ENST00000417098.1	37	CCDS2327.1																																																																																				0.721	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
OR6B3	150681	broad.mit.edu	37	2	240984738	240984738	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr2:240984738A>C	ENST00000319423.4	-	1	751	c.752T>G	c.(751-753)tTc>tGc	p.F251C	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F251C(1)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GGCTGTATAGAAGACGGTGAC	0.572																																					p.F251C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T752G	2						.						74.0	81.0	79.0					2																	240984738		2040	4190	6230	240633411	SO:0001583	missense	150681	exon1				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.752T>G	2.37:g.240984738A>C	ENSP00000322435:p.Phe251Cys		240633411	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	a	9.349	1.065019	0.20067	.	.	ENSG00000178586	ENST00000319423	T	0.00299	8.22	3.88	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000158	T	0.00356	0.0011	M	0.84773	2.715	0.35061	D	0.761561	B	0.33044	0.395	B	0.37387	0.248	T	0.54503	-0.8284	10	0.87932	D	0	.	8.0311	0.30465	0.8179:0.0:0.0:0.1821	.	251	Q8NGW1	OR6B3_HUMAN	C	251	ENSP00000322435:F251C	ENSP00000322435:F251C	F	-	2	0	OR6B3	240633411	1.000000	0.71417	0.995000	0.50966	0.041000	0.13682	3.185000	0.50934	0.785000	0.33685	0.491000	0.48974	TTC		0.572	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
ATR	545	broad.mit.edu	37	3	142281841	142281842	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:142281841_142281842insA	ENST00000350721.4	-	4	523_524	c.402_403insT	c.(400-405)tttaaafs	p.K135fs	ATR_ENST00000383101.3_Frame_Shift_Ins_p.K135fs	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	135					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTCTTGCTTTTAAAAAGAAATA	0.366								Other conserved DNA damage response genes																													p.K135_S136delinsX												.	.	0			c.403_404insT	3						.																																			143764532	SO:0001589	frameshift_variant	545	exon4			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.403dupT	3.37:g.142281846_142281846dupA	ENSP00000343741:p.Lys135fs		143764531	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Frame_Shift_Ins	INS	ENST00000350721.4	37	CCDS3124.1																																																																																				0.366	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
BSN	8927	broad.mit.edu	37	3	49691073	49691074	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:49691073_49691074insC	ENST00000296452.4	+	5	4198_4199	c.4084_4085insC	c.(4084-4086)tccfs	p.S1362fs		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1362					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTCTCCTGCCTCCCCCAGCTCA	0.624																																					p.S1362fs												.	.	0			c.4084_4085insC	3						.																																			49666078	SO:0001589	frameshift_variant	8927	exon5			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.4089dupC	3.37:g.49691078_49691078dupC	ENSP00000296452:p.Ser1362fs		49666077	NM_003458	O43161|Q7LGH3	Frame_Shift_Ins	INS	ENST00000296452.4	37	CCDS2800.1																																																																																				0.624	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
HPS3	84343	broad.mit.edu	37	3	148876528	148876528	+	Silent	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:148876528C>G	ENST00000296051.2	+	10	1907	c.1767C>G	c.(1765-1767)gcC>gcG	p.A589A	HPS3_ENST00000460120.1_Silent_p.A424A	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	589					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.A589A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AAGTTCTGGCCCGCACGGACT	0.403									Hermansky-Pudlak syndrome																												p.A589A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1767G	3						.						115.0	120.0	118.0					3																	148876528		2203	4300	6503	150359218	SO:0001819	synonymous_variant	84343	exon10	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1767C>G	3.37:g.148876528C>G			150359218	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	ENST00000296051.2	37	CCDS3140.1																																																																																				0.403	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
PLCH1	23007	broad.mit.edu	37	3	155311776	155311776	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:155311776T>C	ENST00000340059.7	-	3	387	c.388A>G	c.(388-390)Atc>Gtc	p.I130V	PLCH1_ENST00000460012.1_Missense_Mutation_p.I112V|PLCH1_ENST00000494598.1_Missense_Mutation_p.I130V|PLCH1_ENST00000414191.1_Missense_Mutation_p.I112V|PLCH1_ENST00000334686.6_Missense_Mutation_p.I112V|PLCH1_ENST00000447496.2_Missense_Mutation_p.I130V	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	130					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.I112V(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCATCACTGATGCCAGCCATC	0.527																																					p.I130V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A388G	3						.						91.0	88.0	89.0					3																	155311776		2203	4300	6503	156794470	SO:0001583	missense	23007	exon3			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.388A>G	3.37:g.155311776T>C	ENSP00000345988:p.Ile130Val		156794470	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386668	0.82902	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.29655	2.08;2.04;1.56;2.04;2.04;2.04	5.63	5.63	0.86233	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.294956	0.29972	N	0.010728	T	0.42720	0.1215	L	0.33485	1.01	0.80722	D	1	P;D;P	0.58268	0.832;0.982;0.537	P;P;B	0.62089	0.621;0.898;0.396	T	0.17653	-1.0362	10	0.41790	T	0.15	.	16.1371	0.81494	0.0:0.0:0.0:1.0	.	112;130;130	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	V	130;112;130;130;112;112	ENSP00000419100:I130V;ENSP00000417502:I112V;ENSP00000402759:I130V;ENSP00000345988:I130V;ENSP00000335469:I112V;ENSP00000412977:I112V	ENSP00000335469:I112V	I	-	1	0	PLCH1	156794470	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.887000	0.87295	2.271000	0.75665	0.459000	0.35465	ATC		0.527	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
ZMAT3	64393	broad.mit.edu	37	3	178785492	178785492	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:178785492G>A	ENST00000311417.2	-	2	790	c.49C>T	c.(49-51)Ccc>Tcc	p.P17S	ZMAT3_ENST00000432729.1_Missense_Mutation_p.P17S	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3									p.P17S(2)		breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			GGAGGCGAGGGTGAGGGCTGC	0.572																																					p.P17S												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C49T	3						.						143.0	146.0	145.0					3																	178785492		2203	4300	6503	180268186	SO:0001583	missense	64393	exon3			AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.49C>T	3.37:g.178785492G>A	ENSP00000311221:p.Pro17Ser		180268186	NM_152240		Missense_Mutation	SNP	ENST00000311417.2	37	CCDS3224.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.864240	0.00552	.	.	ENSG00000172667	ENST00000311417;ENST00000432729;ENST00000414084	T;T;T	0.43294	0.99;0.99;0.95	5.86	-2.84	0.05751	.	0.786148	0.12500	N	0.463406	T	0.15825	0.0381	N	0.12182	0.205	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29792	-1.0000	10	0.06891	T	0.86	-28.3924	4.2761	0.10809	0.4076:0.0:0.3359:0.2565	.	17;17	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	S	17	ENSP00000311221:P17S;ENSP00000396506:P17S;ENSP00000398920:P17S	ENSP00000311221:P17S	P	-	1	0	ZMAT3	180268186	0.010000	0.17322	0.461000	0.27105	0.039000	0.13416	-0.484000	0.06528	-0.380000	0.07894	-1.283000	0.01379	CCC		0.572	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240	
DGKG	1608	broad.mit.edu	37	3	185906067	185906067	+	Silent	SNP	G	G	A	rs34284245	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:185906067G>A	ENST00000265022.3	-	22	2558	c.2019C>T	c.(2017-2019)aaC>aaT	p.N673N	DGKG_ENST00000344484.4_Silent_p.N648N|DGKG_ENST00000382164.4_Silent_p.N634N|DGKG_ENST00000544847.1_Silent_p.N614N	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	673					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.N673N(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GGTTCTTCTTGTTTTCTCCCC	0.512																																					p.N648N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1944T	3						.						144.0	131.0	135.0					3																	185906067		2203	4300	6503	187388761	SO:0001819	synonymous_variant	1608	exon21			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.2019C>T	3.37:g.185906067G>A			187388761	NM_001080744	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	ENST00000265022.3	37	CCDS3274.1																																																																																				0.512	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
ZKSCAN7	55888	broad.mit.edu	37	3	44612491	44612491	+	Missense_Mutation	SNP	C	C	T	rs373307729		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:44612491C>T	ENST00000273320.3	+	6	2318	c.1889C>T	c.(1888-1890)aCg>aTg	p.T630M	ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.T630M|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	630					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T630M(1)									AGACTTCACACGGGTGAAAAG	0.408																																					p.T630M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1889T	3						.	C	MET/THR,	1,4405		0,1,2202	66.0	70.0	69.0		1889,	4.2	0.9	3		69	0,8600		0,0,4300	no	missense,intron	ZNF167	NM_018651.2,NM_025169.1	81,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,	630/755,	44612491	1,13005	2203	4300	6503	44587495	SO:0001583	missense	55888	exon6			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1889C>T	3.37:g.44612491C>T	ENSP00000273320:p.Thr630Met		44587495	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	ENST00000273320.3	37	CCDS2715.1	.	.	.	.	.	.	.	.	.	.	.	19.67	3.870147	0.72065	2.27E-4	0.0	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000315777	T;T	0.26373	1.74;1.74	4.2	4.2	0.49525	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.241708	0.21541	N	0.072899	T	0.52933	0.1765	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.60831	-0.7185	10	0.87932	D	0	-6.8142	15.5027	0.75713	0.0:1.0:0.0:0.0	.	630	Q9P0L1	ZN167_HUMAN	M	630;630;68	ENSP00000395524:T630M;ENSP00000273320:T630M	ENSP00000273320:T630M	T	+	2	0	ZNF167	44587495	0.125000	0.22332	0.913000	0.36048	0.946000	0.59487	1.167000	0.31847	2.179000	0.69175	0.655000	0.94253	ACG		0.408	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
RRP9	9136	broad.mit.edu	37	3	51971272	51971272	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:51971272A>C	ENST00000232888.6	-	6	526	c.453T>G	c.(451-453)tgT>tgG	p.C151W		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	151					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.C151W(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		TGACGACCAAACATGTGATAG	0.592																																					p.C151W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T453G	3						.						133.0	127.0	129.0					3																	51971272		2203	4300	6503	51946312	SO:0001583	missense	9136	exon6			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.453T>G	3.37:g.51971272A>C	ENSP00000232888:p.Cys151Trp		51946312	NM_004704	B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	CCDS2837.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.741746	0.49151	.	.	ENSG00000114767	ENST00000232888	T	0.66099	-0.19	5.12	-5.23	0.02798	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81061	-0.1103	10	0.72032	D	0.01	-12.5668	15.8039	0.78477	0.3785:0.0:0.6215:0.0	.	151	O43818	U3IP2_HUMAN	W	151	ENSP00000232888:C151W	ENSP00000232888:C151W	C	-	3	2	RRP9	51946312	0.968000	0.33430	0.443000	0.26883	0.401000	0.30781	0.123000	0.15708	-0.922000	0.03789	0.459000	0.35465	TGT		0.592	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704	
NEK4	6787	broad.mit.edu	37	3	52802607	52802607	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:52802607T>G	ENST00000233027.5	-	2	309	c.107A>C	c.(106-108)aAa>aCa	p.K36T	NEK4_ENST00000535191.1_Intron|NEK4_ENST00000383721.4_Missense_Mutation_p.K36T	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	36	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.K36T(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GAGGTTCAGTTTTTTGATGAC	0.438																																					p.K36T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A107C	3						.						77.0	80.0	79.0					3																	52802607		2203	4300	6503	52777647	SO:0001583	missense	6787	exon2			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.107A>C	3.37:g.52802607T>G	ENSP00000233027:p.Lys36Thr		52777647	NM_003157	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	ENST00000233027.5	37	CCDS2863.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.989273	0.53934	.	.	ENSG00000114904	ENST00000233027;ENST00000383721	T;T	0.25414	1.8;1.8	5.86	3.46	0.39613	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.135606	0.45867	D	0.000338	T	0.35624	0.0938	L	0.35249	1.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	T	0.05632	-1.0873	10	0.66056	D	0.02	.	8.7008	0.34325	0.0:0.0664:0.1296:0.8041	.	36;36	P51957-2;P51957	.;NEK4_HUMAN	T	36	ENSP00000233027:K36T;ENSP00000373227:K36T	ENSP00000233027:K36T	K	-	2	0	NEK4	52777647	1.000000	0.71417	0.997000	0.53966	0.212000	0.24457	3.026000	0.49689	0.471000	0.27319	-0.316000	0.08728	AAA		0.438	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157	
ROBO1	6091	broad.mit.edu	37	3	78689015	78689015	+	Silent	SNP	C	C	T	rs376608893	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:78689015C>T	ENST00000464233.1	-	22	3029	c.2916G>A	c.(2914-2916)gcG>gcA	p.A972A	ROBO1_ENST00000467549.1_Silent_p.A927A|ROBO1_ENST00000436010.2_Silent_p.A933A|ROBO1_ENST00000495273.1_Silent_p.A927A	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	972					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.A949A(1)|p.A972A(1)|p.A927A(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCCATGGCTGCGCGGCAGGTT	0.428													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		16880	0.0		0.0	False		,,,				2504	0.0				p.A972A												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G2916A	3						.	C	,,	5,3893		0,5,1944	54.0	51.0	52.0		2781,2916,2781	-11.3	0.1	3		52	0,8304		0,0,4152	no	coding-synonymous,coding-synonymous,coding-synonymous	ROBO1	NM_001145845.1,NM_002941.3,NM_133631.3	,,	0,5,6096	TT,TC,CC		0.0,0.1283,0.041	,,	927/1552,972/1652,927/1607	78689015	5,12197	1949	4152	6101	78771705	SO:0001819	synonymous_variant	6091	exon22			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2916G>A	3.37:g.78689015C>T			78771705	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.428	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
TP63	8626	broad.mit.edu	37	3	189604318	189604318	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr3:189604318T>G	ENST00000264731.3	+	11	1574	c.1485T>G	c.(1483-1485)atT>atG	p.I495M	TP63_ENST00000392461.3_Missense_Mutation_p.I401M|TP63_ENST00000392460.3_Missense_Mutation_p.I495M|TP63_ENST00000320472.5_Missense_Mutation_p.I495M|TP63_ENST00000456148.1_Missense_Mutation_p.I397M|TP63_ENST00000382063.4_Missense_Mutation_p.I410M|TP63_ENST00000392463.2_Missense_Mutation_p.I401M|TP63_ENST00000354600.5_Missense_Mutation_p.I401M|TP63_ENST00000440651.2_Missense_Mutation_p.I491M|TP63_ENST00000449992.1_Missense_Mutation_p.I316M	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	495					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.I495M(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CTACAACCATTCCTGATGGCA	0.517										HNSCC(45;0.13)																											p.I401M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1203G	3						.						108.0	89.0	96.0					3																	189604318		2203	4300	6503	191087012	SO:0001583	missense	8626	exon9			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1485T>G	3.37:g.189604318T>G	ENSP00000264731:p.Ile495Met		191087012	NM_001114980	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038616	0.35989	.	.	ENSG00000073282	ENST00000264731;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D	0.99660	-5.97;-6.2;-6.2;-5.98;-6.31;-5.97;-6.2;-6.21;-6.32;-5.98	6.08	-2.85	0.05734	.	0.092104	0.85682	N	0.000000	D	0.94241	0.8151	N	0.01705	-0.755	0.32647	N	0.51987	B;B;B;B;B;B	0.12013	0.005;0.004;0.004;0.003;0.004;0.003	B;B;B;B;B;B	0.14023	0.007;0.008;0.007;0.007;0.01;0.004	D	0.92294	0.5844	9	.	.	.	-6.1357	2.571	0.04795	0.1028:0.3324:0.2618:0.3029	.	316;495;401;401;495;495	Q9H3D4-10;Q9H3D4-7;Q9H3D4-4;Q9H3D4-2;Q9H3D4-3;Q9H3D4	.;.;.;.;.;P63_HUMAN	M	495;495;495;491;410;401;401;401;316;397	ENSP00000264731:I495M;ENSP00000317510:I495M;ENSP00000376253:I495M;ENSP00000394337:I491M;ENSP00000371495:I410M;ENSP00000346614:I401M;ENSP00000376256:I401M;ENSP00000376254:I401M;ENSP00000387839:I316M;ENSP00000389485:I397M	.	I	+	3	3	TP63	191087012	0.993000	0.37304	0.968000	0.41197	0.961000	0.63080	0.282000	0.18829	-0.330000	0.08514	0.482000	0.46254	ATT		0.517	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
FAT4	79633	broad.mit.edu	37	4	126238904	126238905	+	Frame_Shift_Ins	INS	-	-	C	rs531772242		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:126238904_126238905insC	ENST00000394329.3	+	1	1351_1352	c.1338_1339insC	c.(1339-1341)cccfs	p.P447fs		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACTACGGGGCGCCCCCTGGCGC	0.554											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A446fs												.	.	0			c.1338_1339insC	4						.																																			126458355	SO:0001589	frameshift_variant	79633	exon1			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.1343dupC	4.37:g.126238909_126238909dupC	ENSP00000377862:p.Pro447fs	1548	126458354	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Frame_Shift_Ins	INS	ENST00000394329.3	37	CCDS3732.3																																																																																				0.554	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TMEM192	201931	broad.mit.edu	37	4	166033911	166033912	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:166033911_166033912insC	ENST00000306480.6	-	1	159_160	c.14_15insG	c.(13-15)ggcfs	p.G5fs	TMEM192_ENST00000506087.1_Intron	NM_001100389.1	NP_001093859.1	Q8IY95	TM192_HUMAN	transmembrane protein 192	5						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)	p.R6fs*14(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		CCTCCATCCTGCCCCCCGCCGC	0.698																																					p.G5fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.15_16insG	4						.																																			166253362	SO:0001589	frameshift_variant	201931	exon1			BC036301	CCDS43279.1	4q32.3	2008-04-22			ENSG00000170088	ENSG00000170088			26775	protein-coding gene	gene with protein product						12477932	Standard	NM_001100389		Approved	FLJ38482	uc003iqz.4	Q8IY95	OTTHUMG00000161254	ENST00000306480.6:c.15dupG	4.37:g.166033917_166033917dupC	ENSP00000305069:p.Gly5fs		166253361	NM_001100389	Q7Z3A1|Q8N928	Frame_Shift_Ins	INS	ENST00000306480.6	37	CCDS43279.1																																																																																				0.698	TMEM192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364310.3	NM_152681	
MAB21L2	10586	broad.mit.edu	37	4	151504742	151504742	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:151504742G>T	ENST00000317605.4	+	1	1666	c.561G>T	c.(559-561)tgG>tgT	p.W187C	LRBA_ENST00000510413.1_Intron|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000535741.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000357115.3_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	187					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.W187C(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CGGCACAGTGGCCTATGCCCC	0.632																																					p.W187C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G561T	4						.						44.0	45.0	45.0					4																	151504742		2203	4300	6503	151724192	SO:0001583	missense	10586	exon1			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.561G>T	4.37:g.151504742G>T	ENSP00000324701:p.Trp187Cys		151724192	NM_006439	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579732	0.65992	.	.	ENSG00000181541	ENST00000317605	T	0.11277	2.79	5.55	5.55	0.83447	.	0.065727	0.64402	D	0.000003	T	0.42877	0.1222	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48811	-0.9002	10	0.72032	D	0.01	-9.9155	19.4978	0.95081	0.0:0.0:1.0:0.0	.	187	Q9Y586	MB212_HUMAN	C	187	ENSP00000324701:W187C	ENSP00000324701:W187C	W	+	3	0	MAB21L2	151724192	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.608000	0.88229	0.462000	0.41574	TGG		0.632	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
TRIM2	23321	broad.mit.edu	37	4	154237093	154237093	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:154237093T>A	ENST00000437508.2	+	8	1844	c.1643T>A	c.(1642-1644)aTc>aAc	p.I548N	TRIM2_ENST00000338700.5_Missense_Mutation_p.I575N	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	548					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I548N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GGGGACATAATCATTGCCGAT	0.463																																					p.I575N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1724A	4						.						65.0	71.0	69.0					4																	154237093		2203	4300	6503	154456543	SO:0001583	missense	23321	exon8			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1643T>A	4.37:g.154237093T>A	ENSP00000415812:p.Ile548Asn		154456543	NM_015271	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559793	0.86335	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	T;T	0.72725	-0.68;-0.68	5.07	5.07	0.68467	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.88481	0.6448	H	0.95294	3.65	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.81914	0.995;0.995	D	0.91992	0.5604	10	0.87932	D	0	-7.256	15.1207	0.72441	0.0:0.0:0.0:1.0	.	575;548	D3DP09;Q9C040	.;TRIM2_HUMAN	N	548;575	ENSP00000415812:I548N;ENSP00000339659:I575N	ENSP00000339659:I575N	I	+	2	0	TRIM2	154456543	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.997000	0.88414	2.028000	0.59812	0.528000	0.53228	ATC		0.463	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
DCHS2	54798	broad.mit.edu	37	4	155156074	155156074	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:155156074A>G	ENST00000357232.4	-	25	8364	c.8365T>C	c.(8365-8367)Ttc>Ctc	p.F2789L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2789					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F2789L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGAGGTTGGAATTTGGGCTCC	0.388																																					p.F2789L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8365C	4						.						115.0	116.0	116.0					4																	155156074		2203	4300	6503	155375524	SO:0001583	missense	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8365T>C	4.37:g.155156074A>G	ENSP00000349768:p.Phe2789Leu		155375524	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.945805	0.92593	.	.	ENSG00000197410	ENST00000357232	T	0.64618	-0.11	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.83154	-0.0102	10	0.72032	D	0.01	.	16.1341	0.81471	1.0:0.0:0.0:0.0	.	2789	Q6V1P9	PCD23_HUMAN	L	2789	ENSP00000349768:F2789L	ENSP00000349768:F2789L	F	-	1	0	DCHS2	155375524	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	9.339000	0.96797	2.200000	0.70718	0.455000	0.32223	TTC		0.388	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
TENM3	55714	broad.mit.edu	37	4	183600915	183600915	+	Missense_Mutation	SNP	G	G	A	rs182946886	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:183600915G>A	ENST00000511685.1	+	8	1546	c.1423G>A	c.(1423-1425)Gtc>Atc	p.V475I	TENM3_ENST00000406950.2_Missense_Mutation_p.V475I			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	475					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V475I(1)									GGCGAGATCCGTCAGCCTTCA	0.537													G|||	4	0.000798722	0.0	0.0029	5008	,	,		14377	0.0		0.002	False		,,,				2504	0.0				p.V475I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1423A	4						.	G	ILE/VAL	0,3736		0,0,1868	50.0	56.0	54.0		1423	2.8	0.8	4		54	3,8193		0,3,4095	yes	missense	ODZ3	NM_001080477.1	29	0,3,5963	AA,AG,GG		0.0366,0.0,0.0251	benign	475/2700	183600915	3,11929	1868	4098	5966	183837909	SO:0001583	missense	55714	exon7			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1423G>A	4.37:g.183600915G>A	ENSP00000424226:p.Val475Ile		183837909	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	1	0.0017482517482517483	1	0.0013192612137203166	G	14.13	2.443649	0.43429	0.0	3.66E-4	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.22336	1.96;1.96	5.52	2.79	0.32731	.	.	.	.	.	T	0.09949	0.0244	L	0.34521	1.04	0.44547	D	0.997509	B	0.02656	0.0	B	0.01281	0.0	T	0.10337	-1.0634	9	0.22109	T	0.4	.	8.207	0.31461	0.3132:0.0:0.6868:0.0	.	475	Q9P273	TEN3_HUMAN	I	475	ENSP00000424226:V475I;ENSP00000385276:V475I	ENSP00000385276:V475I	V	+	1	0	ODZ3	183837909	0.802000	0.28943	0.804000	0.32291	0.784000	0.44337	1.148000	0.31614	0.404000	0.25506	0.563000	0.77884	GTC		0.537	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
SLIT2	9353	broad.mit.edu	37	4	20568936	20568936	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:20568936C>T	ENST00000504154.1	+	27	3029	c.2777C>T	c.(2776-2778)cCg>cTg	p.P926L	SLIT2_ENST00000503837.1_Missense_Mutation_p.P922L|SLIT2_ENST00000503823.1_Missense_Mutation_p.P918L|SLIT2_ENST00000273739.5_Missense_Mutation_p.P930L	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	926	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.P926L(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CTATCAAATCCGTGTAAAAAT	0.378																																					p.P926L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2777T	4						.						204.0	198.0	200.0					4																	20568936		2203	4299	6502	20178034	SO:0001583	missense	9353	exon27			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2777C>T	4.37:g.20568936C>T	ENSP00000422591:p.Pro926Leu		20178034	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942277	0.92526	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000511508	D;D;D;D;D	0.99741	-3.6;-3.6;-3.6;-3.6;-6.6	5.67	5.67	0.87782	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	D	0.97292	0.9925	10	0.87932	D	0	.	19.7654	0.96337	0.0:1.0:0.0:0.0	.	918;926	O94813-3;O94813	.;SLIT2_HUMAN	L	918;926;930;922;922;138	ENSP00000427548:P918L;ENSP00000422591:P926L;ENSP00000273739:P930L;ENSP00000422261:P922L;ENSP00000421975:P138L	ENSP00000273739:P930L	P	+	2	0	SLIT2	20178034	1.000000	0.71417	0.917000	0.36280	0.991000	0.79684	7.818000	0.86416	2.659000	0.90383	0.655000	0.94253	CCG		0.378	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
IRF2	3660	broad.mit.edu	37	4	185339727	185339727	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr4:185339727A>C	ENST00000393593.3	-	4	530	c.323T>G	c.(322-324)gTc>gGc	p.V108G	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	108					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V108G(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CATTCGGTAGACCCTGAAGGC	0.403																																					p.V108G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T323G	4						.						153.0	146.0	149.0					4																	185339727		2203	4300	6503	185576721	SO:0001583	missense	3660	exon4				CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.323T>G	4.37:g.185339727A>C	ENSP00000377218:p.Val108Gly		185576721	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114913	0.77210	.	.	ENSG00000168310	ENST00000393593;ENST00000502750;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D;D	0.98777	-5.13;-1.62;-5.13;-5.13;-5.13	4.98	4.98	0.66077	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	0.173223	0.51477	D	0.000084	D	0.99230	0.9732	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99177	1.0866	10	0.87932	D	0	-11.5769	15.1179	0.72419	1.0:0.0:0.0:0.0	.	108	P14316	IRF2_HUMAN	G	108;20;108;108;108;108	ENSP00000377218:V108G;ENSP00000423074:V20G;ENSP00000427204:V108G;ENSP00000424552:V108G;ENSP00000422860:V108G	ENSP00000377218:V108G	V	-	2	0	IRF2	185576721	1.000000	0.71417	0.943000	0.38184	0.788000	0.44548	9.076000	0.94009	2.219000	0.72066	0.533000	0.62120	GTC		0.403	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
SLC34A1	6569	broad.mit.edu	37	5	176815065	176815066	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:176815065_176815066insC	ENST00000324417.5	+	7	806_807	c.715_716insC	c.(715-717)gctfs	p.A239fs	SLC34A1_ENST00000512593.1_Frame_Shift_Ins_p.A239fs	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	239					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCCTGGAGGCTGCCACTGGC	0.614																																					p.A239fs												.	.	0			c.715_716insC	5						.																																			176747672	SO:0001589	frameshift_variant	6569	exon7			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.716dupC	5.37:g.176815066_176815066dupC	ENSP00000321424:p.Ala239fs		176747671	NM_003052	B4DPE3	Frame_Shift_Ins	INS	ENST00000324417.5	37	CCDS4418.1																																																																																				0.614	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
CTNND2	1501	broad.mit.edu	37	5	11364842	11364842	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:11364842C>T	ENST00000304623.8	-	8	1527	c.1338G>A	c.(1336-1338)ccG>ccA	p.P446P	CTNND2_ENST00000458100.2_Silent_p.P13P|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.P446P|CTNND2_ENST00000511377.1_Silent_p.P355P|CTNND2_ENST00000503622.1_Silent_p.P109P	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	446					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P446P(2)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGTGTGCTGGCGGCAGAGGGT	0.617																																					p.P446P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G1338A	5						.						35.0	40.0	38.0					5																	11364842		2203	4300	6503	11417842	SO:0001819	synonymous_variant	1501	exon8			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1338G>A	5.37:g.11364842C>T			11417842	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																				0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
APC	324	broad.mit.edu	37	5	112173560	112173560	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:112173560C>T	ENST00000457016.1	+	16	2649	c.2269C>T	c.(2269-2271)Caa>Taa	p.Q757*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q757*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q757*			P25054	APC_HUMAN	adenomatous polyposis coli	757	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q757*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGTTAGGAAACAAAAAGCCCT	0.413		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q739X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C2215T	5	GRCh37	CM086469	APC	M		.						46.0	45.0	45.0					5																	112173560		2202	4300	6502	112201459	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2269C>T	5.37:g.112173560C>T	ENSP00000413133:p.Gln757*		112201459	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.767546	0.96914	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.0958	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	757;739;757;757;757	.	ENSP00000257430:Q757X	Q	+	1	0	APC	112201459	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	CAA		0.413	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	broad.mit.edu	37	5	13708348	13708348	+	Missense_Mutation	SNP	G	G	A	rs150046963	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:13708348G>A	ENST00000265104.4	-	76	13326	c.13222C>T	c.(13222-13224)Cgc>Tgc	p.R4408C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4408					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R4408C(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGGTGCTGCGGACAAGGCTG	0.483									Kartagener syndrome																												p.R4408C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C13222T	5						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	196.0	172.0	180.0		13222	4.3	1.0	5	dbSNP_134	180	2,8598	2.2+/-6.3	0,2,4298	no	missense	DNAH5	NM_001369.2	180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	4408/4625	13708348	3,13003	2203	4300	6503	13761348	SO:0001583	missense	1767	exon76	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13222C>T	5.37:g.13708348G>A	ENSP00000265104:p.Arg4408Cys		13761348	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609703	0.66558	2.27E-4	2.33E-4	ENSG00000039139	ENST00000265104	T	0.10763	2.84	5.2	4.27	0.50696	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.46112	0.1376	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62548	-0.6831	10	0.87932	D	0	.	13.3259	0.60459	0.0:0.0:0.7301:0.2699	.	4408	Q8TE73	DYH5_HUMAN	C	4408	ENSP00000265104:R4408C	ENSP00000265104:R4408C	R	-	1	0	DNAH5	13761348	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	2.163000	0.42377	2.581000	0.87130	0.655000	0.94253	CGC		0.483	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
CDC23	8697	broad.mit.edu	37	5	137527577	137527577	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:137527577G>C	ENST00000394886.2	-	12	1366	c.1336C>G	c.(1336-1338)Ctc>Gtc	p.L446V		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	446					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)	p.L440V(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGTTGATTGAGTTTCTCGTAA	0.418																																					p.L446V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1336G	5						.						132.0	130.0	131.0					5																	137527577		2203	4300	6503	137555476	SO:0001583	missense	8697	exon12			AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.1336C>G	5.37:g.137527577G>C	ENSP00000378350:p.Leu446Val		137555476	NM_004661	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Missense_Mutation	SNP	ENST00000394886.2	37	CCDS4200.2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520793	0.85495	.	.	ENSG00000094880	ENST00000394886	T	0.70631	-0.5	5.9	5.9	0.94986	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.83092	0.5179	M	0.82323	2.585	0.80722	D	1	P	0.45474	0.859	P	0.58620	0.842	D	0.83659	0.0160	10	0.52906	T	0.07	-8.6921	14.4291	0.67238	0.07:0.0:0.93:0.0	.	446	Q9UJX2	CDC23_HUMAN	V	446	ENSP00000378350:L446V	ENSP00000378350:L446V	L	-	1	0	CDC23	137555476	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.561000	0.73955	2.800000	0.96347	0.455000	0.32223	CTC		0.418	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
PCDHB1	29930	broad.mit.edu	37	5	140431241	140431241	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:140431241C>T	ENST00000306549.3	+	1	263	c.186C>T	c.(184-186)cgC>cgT	p.R62R		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R62R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCTGCGCGCGGGGCGCGGC	0.562																																					p.R62R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C186T	5						.						47.0	50.0	49.0					5																	140431241		2203	4300	6503	140411425	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.186C>T	5.37:g.140431241C>T			140411425	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				0.562	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHGA7	56108	broad.mit.edu	37	5	140764450	140764450	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:140764450G>A	ENST00000518325.1	+	1	1984	c.1984G>A	c.(1984-1986)Gtg>Atg	p.V662M	PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	662	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V662M(2)		NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACACTCACCGTGGCTGTGGC	0.637																																					p.V662M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1984A	5						.						34.0	43.0	40.0					5																	140764450		2195	4293	6488	140744634	SO:0001583	missense	56108	exon1			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.1984G>A	5.37:g.140764450G>A	ENSP00000430024:p.Val662Met		140744634	NM_032087	B2RN87|Q9Y5D0	Missense_Mutation	SNP	ENST00000518325.1	37	CCDS54927.1	.	.	.	.	.	.	.	.	.	.	.	16.69	3.193324	0.58017	.	.	ENSG00000253537	ENST00000518325	T	0.69685	-0.42	5.01	5.01	0.66863	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.83317	0.5228	M	0.93062	3.375	0.30202	N	0.798502	D;D	0.71674	0.989;0.998	P;P	0.59115	0.852;0.846	D	0.83565	0.0109	9	0.72032	D	0.01	.	14.0097	0.64488	0.0:0.1515:0.8485:0.0	.	662;662	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	M	662	ENSP00000430024:V662M	ENSP00000430024:V662M	V	+	1	0	PCDHGA7	140744634	0.941000	0.31946	0.922000	0.36590	0.547000	0.35210	1.432000	0.34936	2.484000	0.83849	0.655000	0.94253	GTG		0.637	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920	
ADAMTS2	9509	broad.mit.edu	37	5	178552110	178552110	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:178552110C>T	ENST00000251582.7	-	19	2923	c.2822G>A	c.(2821-2823)cGc>cAc	p.R941H		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	941	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R941H(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CTGAATGCAGCGCACGGAGCG	0.692																																					p.R941H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2822A	5						.						107.0	107.0	107.0					5																	178552110		2203	4300	6503	178484716	SO:0001583	missense	9509	exon19			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2822G>A	5.37:g.178552110C>T	ENSP00000251582:p.Arg941His		178484716	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.522394	0.64747	.	.	ENSG00000087116	ENST00000251582	T	0.54866	0.55	5.31	5.31	0.75309	.	0.221905	0.31922	N	0.006848	T	0.68081	0.2962	M	0.73598	2.24	0.80722	D	1	D	0.69078	0.997	D	0.63793	0.918	T	0.70103	-0.4964	10	0.52906	T	0.07	.	11.4457	0.50123	0.0:0.9177:0.0:0.0823	.	941	O95450	ATS2_HUMAN	H	941	ENSP00000251582:R941H	ENSP00000251582:R941H	R	-	2	0	ADAMTS2	178484716	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	4.631000	0.61304	2.481000	0.83766	0.655000	0.94253	CGC		0.692	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
HTR1A	3350	broad.mit.edu	37	5	63256966	63256966	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:63256966C>G	ENST00000323865.3	-	1	814	c.581G>C	c.(580-582)gGc>gCc	p.G194A	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	194					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.G194A(1)		cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GATAGTGTAGCCATGATCCTT	0.582																																					p.G194A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581C	5						.						127.0	141.0	137.0					5																	63256966		2203	4300	6503	63292722	SO:0001583	missense	3350	exon1			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.581G>C	5.37:g.63256966C>G	ENSP00000316244:p.Gly194Ala		63292722	NM_000524	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392403	0.62066	.	.	ENSG00000178394	ENST00000323865	T	0.34859	1.34	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.052663	0.85682	D	0.000000	T	0.37210	0.0995	L	0.48935	1.535	0.80722	D	1	P	0.43909	0.821	B	0.44108	0.441	T	0.06041	-1.0849	10	0.10636	T	0.68	.	18.8287	0.92128	0.0:1.0:0.0:0.0	.	194	P08908	5HT1A_HUMAN	A	194	ENSP00000316244:G194A	ENSP00000316244:G194A	G	-	2	0	HTR1A	63292722	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.203000	0.51075	2.692000	0.91855	0.655000	0.94253	GGC		0.582	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
BTF3	689	broad.mit.edu	37	5	72801039	72801039	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:72801039G>C	ENST00000335895.8	+	6	616	c.465G>C	c.(463-465)gaG>gaC	p.E155D	BTF3_ENST00000380591.3_Missense_Mutation_p.E199D|BTF3_ENST00000514505.2_3'UTR	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	0	Ig-like V-type 2.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.E199D(1)		endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		ATTTTGATGAGGCTTCCAAGA	0.328																																					p.E155D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G465C	5						.						104.0	107.0	106.0					5																	72801039		2202	4297	6499	72836795	SO:0001583	missense	689	exon6			M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	ENST00000335895.8:c.465G>C	5.37:g.72801039G>C	ENSP00000338516:p.Glu155Asp		72836795	NM_001207	B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000335895.8	37	CCDS4019.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129811	0.37630	.	.	ENSG00000145741	ENST00000335895;ENST00000380591;ENST00000509708	.	.	.	5.37	2.6	0.31112	.	0.061993	0.64402	N	0.000008	T	0.46386	0.1390	L	0.55017	1.72	0.58432	D	0.999998	B	0.32893	0.389	B	0.25291	0.059	T	0.30268	-0.9984	9	0.33141	T	0.24	-12.8433	10.0926	0.42456	0.2974:0.0:0.7026:0.0	.	199	P20290	BTF3_HUMAN	D	155;199;78	.	ENSP00000338516:E155D	E	+	3	2	BTF3	72836795	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.952000	0.40343	0.337000	0.23665	0.650000	0.86243	GAG		0.328	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219815.2	NM_001207	
CMYA5	202333	broad.mit.edu	37	5	79035026	79035026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:79035026G>T	ENST00000446378.2	+	2	10469	c.10438G>T	c.(10438-10440)Gag>Tag	p.E3480*		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3480					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.E3480*(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGAACAAAAAGAGTTGGGCAG	0.413																																					p.E3480X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G10438T	5						.						74.0	67.0	69.0					5																	79035026		1895	4124	6019	79070782	SO:0001587	stop_gained	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10438G>T	5.37:g.79035026G>T	ENSP00000394770:p.Glu3480*		79070782	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Nonsense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	50	16.901364	0.99874	.	.	ENSG00000164309	ENST00000446378	.	.	.	6.03	6.03	0.97812	.	0.493042	0.18799	N	0.130825	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	.	.	.	X	3480	.	ENSP00000394770:E3480X	E	+	1	0	CMYA5	79070782	0.999000	0.42202	0.017000	0.16124	0.003000	0.03518	5.102000	0.64572	2.854000	0.98071	0.655000	0.94253	GAG		0.413	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
VCAN	1462	broad.mit.edu	37	5	82786248	82786248	+	Silent	SNP	C	C	T	rs558279284		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:82786248C>T	ENST00000265077.3	+	3	967	c.402C>T	c.(400-402)taC>taT	p.Y134Y	VCAN_ENST00000502527.2_Silent_p.Y134Y|VCAN_ENST00000512590.2_Silent_p.Y86Y|VCAN_ENST00000342785.4_Silent_p.Y134Y|VCAN_ENST00000343200.5_Silent_p.Y134Y|VCAN_ENST00000513984.1_Silent_p.Y134Y	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	134	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.Y134Y(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ACGTCATGTACGGGATTGAAG	0.517													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21301	0.0		0.0	False		,,,				2504	0.0				p.Y134Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	5						.						145.0	139.0	141.0					5																	82786248		2203	4300	6503	82822004	SO:0001819	synonymous_variant	1462	exon3			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.402C>T	5.37:g.82786248C>T			82822004	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.517	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
TRIM41	90933	broad.mit.edu	37	5	180659719	180659719	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr5:180659719C>G	ENST00000315073.5	+	3	1680	c.970C>G	c.(970-972)Ctg>Gtg	p.L324V	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Missense_Mutation_p.L324V	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	324					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.L324V(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACACGGTTTCTGGCTGAAGA	0.622																																					p.L324V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C970G	5						.						60.0	50.0	53.0					5																	180659719		2203	4300	6503	180592325	SO:0001583	missense	90933	exon3			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.970C>G	5.37:g.180659719C>G	ENSP00000320869:p.Leu324Val		180592325	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855893	0.71834	.	.	ENSG00000146063	ENST00000515499;ENST00000351937;ENST00000315073;ENST00000438174	T;T;T	0.63255	2.9;0.39;-0.03	5.41	5.41	0.78517	.	0.000000	0.47455	D	0.000234	T	0.79528	0.4461	M	0.81341	2.54	0.40456	D	0.980197	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.79108	0.987;0.947;0.992	T	0.81597	-0.0860	10	0.56958	D	0.05	.	15.0369	0.71754	0.0:1.0:0.0:0.0	.	34;324;324	D6REK2;Q8WV44;Q8WV44-2	.;TRI41_HUMAN;.	V	34;324;324;34	ENSP00000426803:L34V;ENSP00000336749:L324V;ENSP00000320869:L324V	ENSP00000320869:L324V	L	+	1	2	TRIM41	180592325	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	5.122000	0.64697	2.700000	0.92200	0.462000	0.41574	CTG		0.622	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
FBXO30	84085	broad.mit.edu	37	6	146126645	146126645	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:146126645C>G	ENST00000237281.4	-	2	1063	c.897G>C	c.(895-897)caG>caC	p.Q299H		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	299							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q299H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		AATTCTGATTCTGGTCTATGA	0.378																																					p.Q299H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G897C	6						.						122.0	119.0	120.0					6																	146126645		2203	4300	6503	146168338	SO:0001583	missense	84085	exon2			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.897G>C	6.37:g.146126645C>G	ENSP00000237281:p.Gln299His		146168338	NM_032145	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	C	2.731	-0.264481	0.05754	.	.	ENSG00000118496	ENST00000237281	T	0.18502	2.21	5.41	-0.0495	0.13834	.	0.456009	0.25394	N	0.031000	T	0.02304	0.0071	N	0.25144	0.715	0.26675	N	0.971649	B	0.02656	0.0	B	0.04013	0.001	T	0.42965	-0.9420	10	0.27785	T	0.31	0.2167	1.8081	0.03084	0.205:0.4063:0.2006:0.188	.	299	Q8TB52	FBX30_HUMAN	H	299	ENSP00000237281:Q299H	ENSP00000237281:Q299H	Q	-	3	2	FBXO30	146168338	0.984000	0.35163	0.666000	0.29783	0.936000	0.57629	0.068000	0.14531	0.044000	0.15775	0.655000	0.94253	CAG		0.378	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2		
HLA-DQA1	3117	broad.mit.edu	37	6	32610140	32610140	+	Intron	DEL	T	T	-	rs375747014|rs375806726		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:32610140delT	ENST00000343139.5	+	3	715				HLA-DQA1_ENST00000374949.2_Intron|HLA-DQA1_ENST00000395363.1_Intron	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						CATGGGTTTCTTTTCTGTCTC	0.348																																					.												.	.	0			.	6						.																																			32718118	SO:0001627	intron_variant	3117	.				CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.613+110T>-	6.37:g.32610140delT			32718118	.	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Frame_Shift_Del	DEL	ENST00000343139.5	37	CCDS4752.1																																																																																				0.348	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
DEFB112	245915	broad.mit.edu	37	6	50011380	50011380	+	Missense_Mutation	SNP	C	C	T	rs146242544		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:50011380C>T	ENST00000322246.4	-	2	249	c.250G>A	c.(250-252)Gtg>Atg	p.V84M		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	84					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.V84M(1)		central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					CATTCTGTCACGCAGCAATGA	0.428																																					p.V84M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250A	6						.	C	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	202.0	161.0	175.0		250	-6.9	0.0	6	dbSNP_134	175	0,8600		0,0,4300	no	missense	DEFB112	NM_001037498.1	21	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	84/114	50011380	2,13004	2203	4300	6503	50119339	SO:0001583	missense	245915	exon2			DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.250G>A	6.37:g.50011380C>T	ENSP00000319126:p.Val84Met		50119339	NM_001037498	Q8NET0	Missense_Mutation	SNP	ENST00000322246.4	37	CCDS34476.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.101525	0.00360	4.54E-4	0.0	ENSG00000180872	ENST00000322246	T	0.22134	1.97	3.43	-6.86	0.01676	.	1.587890	0.04096	N	0.312074	T	0.01558	0.0050	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.21449	-1.0245	10	0.19590	T	0.45	-1.6115	1.0496	0.01577	0.4211:0.2311:0.1964:0.1514	.	84	Q30KQ8	DB112_HUMAN	M	84	ENSP00000319126:V84M	ENSP00000319126:V84M	V	-	1	0	DEFB112	50119339	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.097000	0.01348	-3.883000	0.00095	-1.767000	0.00664	GTG		0.428	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359672.1	NM_001037498	
COL21A1	81578	broad.mit.edu	37	6	56032961	56032961	+	Silent	SNP	G	G	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:56032961G>T	ENST00000244728.5	-	6	1558	c.1161C>A	c.(1159-1161)acC>acA	p.T387T	COL21A1_ENST00000535941.1_Silent_p.T387T|COL21A1_ENST00000370819.1_Silent_p.T387T	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	387	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.T387T(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTCCAATTTGGGTTTGCCCAT	0.318																																					p.T387T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1161A	6						.						71.0	61.0	64.0					6																	56032961		1812	4066	5878	56140920	SO:0001819	synonymous_variant	81578	exon6			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1161C>A	6.37:g.56032961G>T			56140920	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1																																																																																				0.318	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
LMBRD1	55788	broad.mit.edu	37	6	70428877	70428877	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:70428877C>G	ENST00000370577.3	-	8	962	c.733G>C	c.(733-735)Gaa>Caa	p.E245Q	LMBRD1_ENST00000370570.1_Missense_Mutation_p.E172Q	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	245					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.E245Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						ATGTGTTGTTCTACTTCTTCA	0.368																																					p.E245Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G733C	6						.						188.0	153.0	165.0					6																	70428877		2203	4300	6503	70485598	SO:0001583	missense	55788	exon8			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.733G>C	6.37:g.70428877C>G	ENSP00000359609:p.Glu245Gln		70485598	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679804	0.68042	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.34859	1.34;1.34	5.21	5.21	0.72293	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	L	0.35723	1.085	0.80722	D	1	P	0.43788	0.817	B	0.41988	0.372	T	0.01945	-1.1242	10	0.22109	T	0.4	-9.9253	18.7413	0.91774	0.0:1.0:0.0:0.0	.	245	Q9NUN5	LMBD1_HUMAN	Q	245;172	ENSP00000359609:E245Q;ENSP00000359602:E172Q	ENSP00000359602:E172Q	E	-	1	0	LMBRD1	70485598	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	7.407000	0.80029	2.398000	0.81561	0.467000	0.42956	GAA		0.368	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
B3GAT2	135152	broad.mit.edu	37	6	71666058	71666058	+	Silent	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:71666058C>G	ENST00000230053.6	-	1	683	c.75G>C	c.(73-75)gtG>gtC	p.V25V		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	25					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)	p.V25V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						TGCGCGTGTCCACGTCGAGCA	0.682																																					p.V25V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G75C	6						.						13.0	17.0	15.0					6																	71666058		2054	4066	6120	71722779	SO:0001819	synonymous_variant	135152	exon1			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.75G>C	6.37:g.71666058C>G			71722779	NM_080742	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1																																																																																				0.682	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
RIMS1	22999	broad.mit.edu	37	6	72962469	72962469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:72962469C>T	ENST00000521978.1	+	16	2704	c.2704C>T	c.(2704-2706)Cag>Tag	p.Q902*	RIMS1_ENST00000517827.1_Nonsense_Mutation_p.Q361*|RIMS1_ENST00000401910.3_Nonsense_Mutation_p.Q376*|RIMS1_ENST00000491071.2_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000425662.2_Nonsense_Mutation_p.Q295*|RIMS1_ENST00000520567.1_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000518273.1_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000523963.1_Nonsense_Mutation_p.Q376*|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000264839.7_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000348717.5_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000517960.1_Nonsense_Mutation_p.Q902*|RIMS1_ENST00000522291.1_Nonsense_Mutation_p.Q902*	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	902					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.Q902*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGCAGGATCTCAGCGAATCAG	0.433																																					p.Q295X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C883T	6						.						173.0	179.0	177.0					6																	72962469		2119	4220	6339	73019190	SO:0001587	stop_gained	22999	exon11			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2704C>T	6.37:g.72962469C>T	ENSP00000428417:p.Gln902*		73019190	NM_001168409	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Nonsense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.163961|12.163961	0.99642|0.99642	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420|ENST00000517433	.|T	.|0.16457	.|2.34	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.093745|.	0.46145|.	D|.	0.000319|.	.|T	.|0.36303	.|0.0962	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.08310	.|-1.0728	.|6	0.07175|0.87932	T|D	0.84|0	-18.7365|-18.7365	20.5373|20.5373	0.99239|0.99239	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	902;902;902;902;902;902;902;902;902;902;902;902;376;376;295;295;361;127|475	.|ENSP00000430359:S475L	ENSP00000264839:Q902X|ENSP00000430359:S475L	Q|S	+|+	1|2	0|0	RIMS1|RIMS1	73019190|73019190	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	7.606000|7.606000	0.82863|0.82863	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	CAG|TCA		0.433	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
KIF25	3834	broad.mit.edu	37	6	168439382	168439382	+	Missense_Mutation	SNP	G	G	A	rs535182976		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr6:168439382G>A	ENST00000443060.2	+	6	858	c.467G>A	c.(466-468)cGg>cAg	p.R156Q	KIF25_ENST00000351261.3_Missense_Mutation_p.R156Q|KIF25_ENST00000354419.2_Missense_Mutation_p.R156Q			Q9UIL4	KIF25_HUMAN	kinesin family member 25	156	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R156Q(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AAGGATGGACGGACAGAGGTT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		18684	0.001		0.0	False		,,,				2504	0.0				p.R156Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G467A	6						.						107.0	96.0	100.0					6																	168439382		2203	4300	6503	168182231	SO:0001583	missense	3834	exon5			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.467G>A	6.37:g.168439382G>A	ENSP00000388878:p.Arg156Gln		168182231	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352624	0.24512	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.72505	-0.66;-0.66;0.99	4.65	-0.0541	0.13815	Kinesin, motor domain (4);	0.658638	0.14014	N	0.347243	T	0.30978	0.0782	N	0.20807	0.61	0.09310	N	1	B;B	0.21452	0.035;0.056	B;B	0.17098	0.008;0.017	T	0.25467	-1.0131	10	0.52906	T	0.07	-7.8421	8.1655	0.31224	0.7826:0.0:0.2174:0.0	.	156;156	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	Q	156	ENSP00000388878:R156Q;ENSP00000346401:R156Q;ENSP00000252688:R156Q	ENSP00000252688:R156Q	R	+	2	0	KIF25	168182231	0.016000	0.18221	0.000000	0.03702	0.001000	0.01503	0.298000	0.19120	-0.276000	0.09206	0.655000	0.94253	CGG		0.572	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
SDK1	221935	broad.mit.edu	37	7	4185414	4185414	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr7:4185414T>G	ENST00000404826.2	+	29	4428	c.4289T>G	c.(4288-4290)gTc>gGc	p.V1430G	SDK1_ENST00000389531.3_Missense_Mutation_p.V1430G	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1430	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V1430G(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCGTGGAGGTCGGCGCCACA	0.662																																					p.V1430G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4289G	7						.						62.0	57.0	59.0					7																	4185414		2203	4300	6503	4151940	SO:0001583	missense	221935	exon29			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4289T>G	7.37:g.4185414T>G	ENSP00000385899:p.Val1430Gly		4151940	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784039	0.49891	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.61274	0.12;0.12	4.96	4.96	0.65561	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000011	T	0.71921	0.3397	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.962;0.999	T	0.75255	-0.3382	10	0.87932	D	0	.	13.8361	0.63410	0.0:0.0:0.0:1.0	.	1430;1430	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	G	1430	ENSP00000385899:V1430G;ENSP00000374182:V1430G	ENSP00000374182:V1430G	V	+	2	0	SDK1	4151940	1.000000	0.71417	0.989000	0.46669	0.807000	0.45602	7.549000	0.82163	1.862000	0.54008	0.379000	0.24179	GTC		0.662	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SCRN1	9805	broad.mit.edu	37	7	30008594	30008594	+	Silent	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr7:30008594C>A	ENST00000426154.1	-	2	266	c.90G>T	c.(88-90)cgG>cgT	p.R30R	SCRN1_ENST00000425819.2_Intron|SCRN1_ENST00000409570.1_Silent_p.R30R|SCRN1_ENST00000409497.1_Silent_p.R30R|SCRN1_ENST00000494620.1_5'UTR|SCRN1_ENST00000242059.5_Silent_p.R30R|SCRN1_ENST00000434476.2_Silent_p.R50R	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	30					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)	p.R30R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						CATCTCTGGGCCGGGCTGAAT	0.522																																					p.R30R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G90T	7						.						123.0	100.0	108.0					7																	30008594		2203	4300	6503	29975119	SO:0001819	synonymous_variant	9805	exon2			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.90G>T	7.37:g.30008594C>A			29975119	NM_014766	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Silent	SNP	ENST00000426154.1	37	CCDS5422.1																																																																																				0.522	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766	
AQP1	358	broad.mit.edu	37	7	30963109	30963109	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr7:30963109C>T	ENST00000311813.4	+	4	730	c.675C>T	c.(673-675)ctC>ctT	p.L225L	AQP1_ENST00000509504.1_Silent_p.L402L|AQP1_ENST00000434909.2_Silent_p.L285L|AQP1_ENST00000482461.1_3'UTR|AQP1_ENST00000441328.2_Silent_p.L142L|AQP1_ENST00000409899.1_Silent_p.L110L|AQP1_ENST00000409611.1_Silent_p.L174L	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	225					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.L225L(1)|p.L142L(1)		kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	TGGCTGTACTCATCTACGACT	0.602																																					p.L142L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C426T	7						.						56.0	49.0	51.0					7																	30963109		2203	4300	6503	30929634	SO:0001819	synonymous_variant	358	exon5			M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.675C>T	7.37:g.30963109C>T			30929634	NM_001185060	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Silent	SNP	ENST00000311813.4	37	CCDS5431.1																																																																																				0.602	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215002.3	NM_000385	
WBSCR17	64409	broad.mit.edu	37	7	70885902	70885902	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr7:70885902C>T	ENST00000333538.5	+	5	1407	c.773C>T	c.(772-774)cCg>cTg	p.P258L	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	258	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P258L(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGGGCTGAGCCGGTTCTATCC	0.507																																					p.P258L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C773T	7						.						177.0	168.0	171.0					7																	70885902		2203	4300	6503	70523838	SO:0001583	missense	64409	exon5			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.773C>T	7.37:g.70885902C>T	ENSP00000329654:p.Pro258Leu		70523838	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849445	0.91277	.	.	ENSG00000185274	ENST00000333538	T	0.61274	0.12	5.31	5.31	0.75309	Glycosyl transferase, family 2 (1);	0.053133	0.85682	D	0.000000	T	0.80105	0.4562	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83795	0.0233	10	0.87932	D	0	.	17.9635	0.89093	0.0:1.0:0.0:0.0	.	258	Q6IS24	GLTL3_HUMAN	L	258	ENSP00000329654:P258L	ENSP00000329654:P258L	P	+	2	0	WBSCR17	70523838	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	7.487000	0.81328	2.478000	0.83669	0.650000	0.86243	CCG		0.507	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
KEL	3792	broad.mit.edu	37	7	142643345	142643345	+	Silent	SNP	C	C	T	rs140212054	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr7:142643345C>T	ENST00000355265.2	-	11	1737	c.1263G>A	c.(1261-1263)acG>acA	p.T421T	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	421					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.T421T(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AAGCCGCCAGCGTGGGCTCGA	0.597													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18293	0.0		0.0	False		,,,				2504	0.0				p.T421T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1263A	7						.	C		7,4399	11.4+/-27.6	0,7,2196	92.0	81.0	85.0		1263	-9.0	0.0	7	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous	KEL	NM_000420.2		0,7,6496	TT,TC,CC		0.0,0.1589,0.0538		421/733	142643345	7,12999	2203	4300	6503	142353467	SO:0001819	synonymous_variant	3792	exon11			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1263G>A	7.37:g.142643345C>T			142353467	NM_000420	B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	CCDS34766.1																																																																																				0.597	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
RIMS2	9699	broad.mit.edu	37	8	104898246	104898247	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	C	-	C	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:104898246_104898247insC	ENST00000436393.2	+	2	994_995	c.753_754insC	c.(754-756)atgfs	p.M252fs	RIMS2_ENST00000406091.3_Frame_Shift_Ins_p.M474fs|RIMS2_ENST00000262231.10_Frame_Shift_Ins_p.M282fs|RIMS2_ENST00000507740.1_Frame_Shift_Ins_p.M282fs			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	505					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AACGGGAAAAAATGGAAACAAT	0.431										HNSCC(12;0.0054)																											p.K281fs												.	.	0			c.843_844insC	8						.																																			104967423	SO:0001589	frameshift_variant	9699	exon2			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		Exception_encountered	8.37:g.104898246_104898247insC	ENSP00000390665:p.Met252fs		104967422	NM_014677	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Frame_Shift_Ins	INS	ENST00000436393.2	37																																																																																					0.431	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
RP1L1	94137	broad.mit.edu	37	8	10467806	10467806	+	Missense_Mutation	SNP	C	C	T	rs368855563		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:10467806C>T	ENST00000382483.3	-	4	4025	c.3802G>A	c.(3802-3804)Gct>Act	p.A1268T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1268					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.A1268T(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GTGGCACAAGCGCAGGCTCGG	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		21824	0.001		0.0	False		,,,				2504	0.0				p.A1268T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3802A	8						.	C	THR/ALA	1,4107		0,1,2053	125.0	126.0	126.0		3802	-1.2	0.0	8		126	0,8396		0,0,4198	no	missense	RP1L1	NM_178857.5	58	0,1,6251	TT,TC,CC		0.0,0.0243,0.0080	possibly-damaging	1268/2401	10467806	1,12503	2054	4198	6252	10505216	SO:0001583	missense	94137	exon4			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3802G>A	8.37:g.10467806C>T	ENSP00000371923:p.Ala1268Thr		10505216	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555581	0.27739	2.43E-4	0.0	ENSG00000183638	ENST00000382483	T	0.05447	3.44	3.1	-1.17	0.09648	.	0.234102	0.22103	N	0.064596	T	0.02533	0.0077	L	0.29908	0.895	0.09310	N	1	P	0.48162	0.906	B	0.27380	0.079	T	0.47686	-0.9098	10	0.56958	D	0.05	-0.1936	2.5641	0.04778	0.22:0.3642:0.0:0.4158	.	1268	A6NKC6	.	T	1268	ENSP00000371923:A1268T	ENSP00000371923:A1268T	A	-	1	0	RP1L1	10505216	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.165000	0.03132	-0.136000	0.11475	0.313000	0.20887	GCT		0.527	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
CYP11B1	1584	broad.mit.edu	37	8	143958447	143958447	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:143958447G>C	ENST00000292427.4	-	3	619	c.587C>G	c.(586-588)aCc>aGc	p.T196S	CYP11B1_ENST00000377675.3_Missense_Mutation_p.T267S|CYP11B1_ENST00000517471.1_Missense_Mutation_p.T196S	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	196					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.T196S(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	ACCTTCTATGGTGTAGTGGAA	0.647									Familial Hyperaldosteronism type I																												p.T196S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C587G	8						.						49.0	44.0	46.0					8																	143958447		2203	4300	6503	143955449	SO:0001583	missense	1584	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.587C>G	8.37:g.143958447G>C	ENSP00000292427:p.Thr196Ser		143955449	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	10.32	1.317698	0.23994	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.69806	-0.43;-0.43;-0.43	3.88	0.921	0.19403	.	0.490025	0.18812	N	0.130474	T	0.57577	0.2063	L	0.48642	1.525	0.24037	N	0.996092	P;P;B	0.40909	0.732;0.537;0.243	B;P;B	0.46917	0.431;0.531;0.136	T	0.45731	-0.9241	10	0.16896	T	0.51	.	4.3012	0.10925	0.2291:0.1912:0.5796:0.0	.	267;196;196	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	S	196;196;267	ENSP00000292427:T196S;ENSP00000428043:T196S;ENSP00000366903:T267S	ENSP00000292427:T196S	T	-	2	0	CYP11B1	143955449	1.000000	0.71417	0.003000	0.11579	0.185000	0.23345	2.440000	0.44855	0.045000	0.15804	0.650000	0.86243	ACC		0.647	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
MSR1	4481	broad.mit.edu	37	8	16021581	16021581	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:16021581T>A	ENST00000262101.5	-	5	931	c.810A>T	c.(808-810)ttA>ttT	p.L270F	MSR1_ENST00000536385.1_Missense_Mutation_p.L44F|MSR1_ENST00000445506.2_Missense_Mutation_p.L288F|MSR1_ENST00000381998.4_Missense_Mutation_p.L270F|MSR1_ENST00000350896.3_Missense_Mutation_p.L270F|MSR1_ENST00000355282.2_Missense_Mutation_p.L270F			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	270					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.L270F(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TACCTTGAATTAAAGTGATAT	0.299																																					p.L270F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A810T	8						.						116.0	105.0	109.0					8																	16021581		2203	4297	6500	16065952	SO:0001583	missense	4481	exon5			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.810A>T	8.37:g.16021581T>A	ENSP00000262101:p.Leu270Phe		16065952	NM_138716	D3DSP3|O60505|P21759|Q45F10	Missense_Mutation	SNP	ENST00000262101.5	37	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293195	0.40594	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000522672;ENST00000381998;ENST00000536385	D;T;T;D;D;D;D	0.94280	-3.39;-0.68;-0.68;-3.39;-3.39;-3.39;-3.39	4.8	-0.425	0.12317	Macrophage scavenger receptor (1);	0.156238	0.30043	N	0.010542	D	0.89518	0.6738	M	0.77103	2.36	0.22342	N	0.999186	B;B;P;B;B	0.38078	0.202;0.125;0.617;0.197;0.246	B;B;B;B;B	0.34385	0.058;0.041;0.181;0.09;0.088	T	0.81193	-0.1044	10	0.42905	T	0.14	.	5.2742	0.15641	0.0:0.2365:0.1425:0.621	.	44;288;270;270;270	F5GZJ2;B4DDJ5;P21757-2;P21757-3;P21757	.;.;.;.;MSRE_HUMAN	F	270;270;288;270;60;270;44	ENSP00000262100:L270F;ENSP00000262101:L270F;ENSP00000405453:L288F;ENSP00000347430:L270F;ENSP00000430536:L60F;ENSP00000371428:L270F;ENSP00000444414:L44F	ENSP00000262101:L270F	L	-	3	2	MSR1	16065952	0.660000	0.27420	0.962000	0.40283	0.925000	0.55904	0.072000	0.14617	-0.149000	0.11215	0.533000	0.62120	TTA		0.299	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
CNBD1	168975	broad.mit.edu	37	8	88365898	88365898	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:88365898T>G	ENST00000518476.1	+	10	1238	c.1187T>G	c.(1186-1188)cTt>cGt	p.L396R		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	396								p.L396R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						ATGGGGAAACTTAAGGAGAAG	0.323																																					p.L396R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1187G	8						.						84.0	81.0	82.0					8																	88365898		1814	4073	5887	88435014	SO:0001583	missense	168975	exon10			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1187T>G	8.37:g.88365898T>G	ENSP00000430073:p.Leu396Arg		88435014	NM_173538		Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.20|12.20	1.865846|1.865846	0.32977|0.32977	.|.	.|.	ENSG00000176571|ENSG00000176571	ENST00000518476|ENST00000523299;ENST00000521593	D|D;D	0.94966|0.94046	-3.57|-3.34;-3.34	4.98|4.98	4.98|4.98	0.66077|0.66077	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);|.	0.000000|0.000000	0.42964|0.42964	D|D	0.000627|0.000627	D|D	0.93884|0.93884	0.8043|0.8043	M|M	0.66939|0.66939	2.045|2.045	0.09310|0.09310	N|N	0.999992|0.999992	D|.	0.89917|.	1.0|.	D|.	0.75020|.	0.985|.	D|D	0.89347|0.89347	0.3658|0.3658	10|8	0.87932|0.72032	D|D	0|0.01	-15.9692|-15.9692	11.1056|11.1056	0.48201|0.48201	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	396|.	Q8NA66|.	CNBD1_HUMAN|.	R|V	396|88;33	ENSP00000430073:L396R|ENSP00000430986:L88V;ENSP00000427742:L33V	ENSP00000430073:L396R|ENSP00000427742:L33V	L|L	+|+	2|1	0|2	CNBD1|CNBD1	88435014|88435014	0.353000|0.353000	0.24904|0.24904	0.063000|0.063000	0.19743|0.19743	0.162000|0.162000	0.22319|0.22319	3.947000|3.947000	0.56652|0.56652	1.880000|1.880000	0.54463|0.54463	0.454000|0.454000	0.30748|0.30748	CTT|TTA		0.323	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
MMP16	4325	broad.mit.edu	37	8	89209441	89209441	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:89209441A>G	ENST00000286614.6	-	2	508	c.227T>C	c.(226-228)aTg>aCg	p.M76T	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	76					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M76T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GAACTGCTGCATGGCAGCTAG	0.488																																					p.M76T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T227C	8						.						112.0	88.0	96.0					8																	89209441		2203	4300	6503	89278557	SO:0001583	missense	4325	exon2			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.227T>C	8.37:g.89209441A>G	ENSP00000286614:p.Met76Thr		89278557	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579594	0.86645	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.40225	1.04;1.04	6.08	6.08	0.98989	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76449	0.3989	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84370	0.0543	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	76;76	P51512-2;P51512	.;MMP16_HUMAN	T	76;93	ENSP00000286614:M76T;ENSP00000429147:M93T	ENSP00000286614:M76T	M	-	2	0	MMP16	89278557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.333000	0.79357	0.482000	0.46254	ATG		0.488	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
SLC26A7	115111	broad.mit.edu	37	8	92352763	92352763	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:92352763C>A	ENST00000276609.3	+	8	1249	c.1010C>A	c.(1009-1011)tCa>tAa	p.S337*	SLC26A7_ENST00000309536.2_Nonsense_Mutation_p.S337*|SLC26A7_ENST00000523719.1_Nonsense_Mutation_p.S337*	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.S337*(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTCAAATATTCAATTGATGAC	0.473																																					p.S337X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1010A	8						.						90.0	83.0	86.0					8																	92352763		2203	4300	6503	92421939	SO:0001587	stop_gained	115111	exon8			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1010C>A	8.37:g.92352763C>A	ENSP00000276609:p.Ser337*		92421939	NM_134266		Nonsense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.248446|4.248446	0.80024|0.80024	.|.	.|.	ENSG00000147606|ENSG00000147606	ENST00000520818|ENST00000523719;ENST00000276609;ENST00000309536	.|.	.|.	.|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.278895	.|0.30686	.|N	.|0.009091	T|.	0.60261|.	0.2255|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.50145|.	-0.8862|.	3|.	.|0.07990	.|T	.|0.79	.|.	20.2441|20.2441	0.98394|0.98394	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|X	205|337	.|.	.|ENSP00000276609:S337X	Q|S	+|+	1|2	0|0	SLC26A7|SLC26A7	92421939|92421939	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.445000|3.445000	0.52921|0.52921	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.473	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
SDC2	6383	broad.mit.edu	37	8	97621773	97621773	+	Silent	SNP	G	G	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:97621773G>A	ENST00000302190.4	+	5	1524	c.603G>A	c.(601-603)gcG>gcA	p.A201A	SDC2_ENST00000519914.1_Silent_p.A172A|SDC2_ENST00000518385.1_Silent_p.A165A|SDC2_ENST00000522911.1_Silent_p.A172A	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	201					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)	p.A201A(1)		breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	AGTTTTATGCGTAAAACTCCA	0.358																																					p.A201A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G603A	8						.						79.0	71.0	74.0					8																	97621773		2203	4300	6503	97690949	SO:0001819	synonymous_variant	6383	exon5			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.603G>A	8.37:g.97621773G>A			97690949	NM_002998	B3KQA3|Q6PIS6|Q9H6V1	Silent	SNP	ENST00000302190.4	37	CCDS6272.1																																																																																				0.358	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998	
MTDH	92140	broad.mit.edu	37	8	98673309	98673309	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:98673309C>T	ENST00000336273.3	+	2	719	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	MTDH_ENST00000519934.1_Missense_Mutation_p.R108W	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	131	Interaction with BCCIP.|Interaction with RELA.				lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)	p.R131W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			GCCAAATGGGCGGACTGTTGA	0.408																																					p.R131W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C391T	8						.						92.0	80.0	84.0					8																	98673309		2203	4300	6503	98742485	SO:0001583	missense	92140	exon2			AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.391C>T	8.37:g.98673309C>T	ENSP00000338235:p.Arg131Trp		98742485	NM_178812	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	ENST00000336273.3	37	CCDS6274.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085180	0.76642	.	.	ENSG00000147649	ENST00000336273;ENST00000519934	T;T	0.09723	2.95;2.95	4.63	4.63	0.57726	.	0.128427	0.53938	D	0.000057	T	0.25568	0.0622	L	0.48642	1.525	0.48830	D	0.999715	D	0.89917	1.0	D	0.80764	0.994	T	0.00417	-1.1752	10	0.72032	D	0.01	-6.7867	13.7088	0.62656	0.0:1.0:0.0:0.0	.	131	Q86UE4	LYRIC_HUMAN	W	131;108	ENSP00000338235:R131W;ENSP00000428168:R108W	ENSP00000338235:R131W	R	+	1	2	MTDH	98742485	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.290000	0.51755	2.486000	0.83907	0.563000	0.77884	CGG		0.408	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2		
ZHX2	22882	broad.mit.edu	37	8	123965893	123965893	+	Frame_Shift_Del	DEL	C	C	-	rs74549937	byFrequency	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:123965893delC	ENST00000314393.4	+	3	2978	c.2143delC	c.(2143-2145)cccfs	p.P715fs		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	715					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.M716fs*31(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AGCAACAAAACCCATGGCCGA	0.532																																					p.P715fs	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2143delC	8						.						97.0	95.0	96.0					8																	123965893		2203	4300	6503	124035074	SO:0001589	frameshift_variant	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2143delC	8.37:g.123965893delC	ENSP00000314709:p.Pro715fs		124035074	NM_014943		Frame_Shift_Del	DEL	ENST00000314393.4	37	CCDS6336.1																																																																																				0.532	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
CYC1	1537	broad.mit.edu	37	8	145152212	145152212	+	Silent	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr8:145152212G>C	ENST00000318911.4	+	7	1024	c.951G>C	c.(949-951)cgG>cgC	p.R317R	SHARPIN_ENST00000533948.1_5'Flank	NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	317					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R317R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGAAGAGTCGGAAGCTGGCAT	0.577																																					p.R317R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G951C	8						.						112.0	89.0	96.0					8																	145152212		2203	4300	6503	145224200	SO:0001819	synonymous_variant	1537	exon7			BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.951G>C	8.37:g.145152212G>C			145224200	NM_001916	Q5U062|Q6FHS7	Silent	SNP	ENST00000318911.4	37	CCDS6415.1																																																																																				0.577	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916	
PRRC2B	84726	broad.mit.edu	37	9	134366940	134366941	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-	-	C	-	C	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:134366940_134366941insC	ENST00000357304.4	+	28	6409_6410	c.6354_6355insC	c.(6355-6357)ccgfs	p.P2119fs	PRRC2B_ENST00000405995.1_Frame_Shift_Ins_p.P1425fs|SNORD62B_ENST00000426867.1_RNA|PRRC2B_ENST00000372249.1_Frame_Shift_Ins_p.P216fs|PRRC2B_ENST00000465931.1_3'UTR|PRRC2B_ENST00000458550.1_Frame_Shift_Ins_p.P1425fs	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2119							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CCGGGTCCCAGCCGCCAGTCCT	0.629																																					p.Q2118fs												.	.	0			c.6354_6355insC	9						.																																			133356762	SO:0001589	frameshift_variant	84726	exon28			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6356dupC	9.37:g.134366942_134366942dupC	ENSP00000349856:p.Pro2119fs		133356761	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Frame_Shift_Ins	INS	ENST00000357304.4	37	CCDS48044.1																																																																																				0.629	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SMC2	10592	broad.mit.edu	37	9	106864396	106864396	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:106864396G>C	ENST00000286398.7	+	8	1080	c.792G>C	c.(790-792)caG>caC	p.Q264H	SMC2_ENST00000374793.3_Missense_Mutation_p.Q264H|SMC2_ENST00000303219.8_Missense_Mutation_p.Q264H|SMC2_ENST00000374787.3_Missense_Mutation_p.Q264H	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	264					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.Q264H(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TAAAGCTTCAGGAAGAATTGT	0.299																																					p.Q264H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G792C	9						.						55.0	62.0	60.0					9																	106864396		2202	4299	6501	105904217	SO:0001583	missense	10592	exon8			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.792G>C	9.37:g.106864396G>C	ENSP00000286398:p.Gln264His		105904217	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625266	0.28889	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T;T	0.79454	-1.27;3.26;-1.27;3.26;-1.27	5.86	3.52	0.40303	RecF/RecN/SMC (1);	0.167136	0.53938	D	0.000046	T	0.65801	0.2726	L	0.38531	1.155	0.40061	D	0.975894	B;B;B	0.26318	0.066;0.146;0.014	B;B;B	0.29077	0.098;0.058;0.01	T	0.61569	-0.7036	10	0.37606	T	0.19	-12.825	6.8532	0.24026	0.6948:0.0:0.3052:0.0	.	264;264;264	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	H	264;119;264;264;264;264	ENSP00000286398:Q264H;ENSP00000414999:Q119H;ENSP00000363925:Q264H;ENSP00000306152:Q264H;ENSP00000363919:Q264H	ENSP00000286398:Q264H	Q	+	3	2	SMC2	105904217	0.980000	0.34600	1.000000	0.80357	0.975000	0.68041	0.207000	0.17395	1.160000	0.42584	-0.312000	0.09012	CAG		0.299	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
OR13C3	138803	broad.mit.edu	37	9	107298301	107298301	+	Missense_Mutation	SNP	C	C	T	rs375831267		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:107298301C>T	ENST00000374781.2	-	1	836	c.794G>A	c.(793-795)cGc>cAc	p.R265H		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R265H(1)		endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						AAATGCCTTGCGTCTTCCTGT	0.428																																					p.R265H	GBM(86;1248 1274 14222 15028 46219)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	9						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	112.0	113.0		794	-3.4	0.7	9		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR13C3	NM_001001961.1	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	265/348	107298301	2,13004	2203	4300	6503	106338122	SO:0001583	missense	138803	exon1				CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.794G>A	9.37:g.107298301C>T	ENSP00000363913:p.Arg265His		106338122	NM_001001961	Q5VVG1|Q6IF52	Missense_Mutation	SNP	ENST00000374781.2	37	CCDS35089.1	.	.	.	.	.	.	.	.	.	.	C	7.595	0.671598	0.14776	2.27E-4	1.16E-4	ENSG00000204246	ENST00000374781	T	0.00034	8.87	4.27	-3.36	0.04913	GPCR, rhodopsin-like superfamily (1);	0.563642	0.14676	N	0.305012	T	0.00109	0.0003	N	0.20881	0.62	0.09310	N	1	B	0.23591	0.088	B	0.16289	0.015	T	0.12656	-1.0539	10	0.33940	T	0.23	.	10.605	0.45390	0.0:0.4438:0.0:0.5562	.	265	Q8NGS6	O13C3_HUMAN	H	265	ENSP00000363913:R265H	ENSP00000363913:R265H	R	-	2	0	OR13C3	106338122	0.000000	0.05858	0.737000	0.30932	0.826000	0.46750	-1.528000	0.02225	-0.935000	0.03728	-0.793000	0.03317	CGC		0.428	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053477.2		
C5	727	broad.mit.edu	37	9	123744983	123744983	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:123744983C>G	ENST00000223642.1	-	26	3369	c.3340G>C	c.(3340-3342)Gat>Cat	p.D1114H		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1114					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.D1114H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	GATCCATTATCTAATTGATAA	0.284																																					p.D1114H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3340C	9						.						65.0	66.0	65.0					9																	123744983		2201	4289	6490	122784804	SO:0001583	missense	727	exon26			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3340G>C	9.37:g.123744983C>G	ENSP00000223642:p.Asp1114His		122784804	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302106	0.40694	.	.	ENSG00000106804	ENST00000223642	T	0.37752	1.18	5.42	4.52	0.55395	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.548959	0.20018	N	0.100962	T	0.32941	0.0846	L	0.43923	1.385	0.24006	N	0.996191	P	0.39883	0.693	B	0.42282	0.382	T	0.19095	-1.0316	10	0.52906	T	0.07	.	8.379	0.32459	0.0:0.5958:0.3229:0.0813	.	1114	P01031	CO5_HUMAN	H	1114	ENSP00000223642:D1114H	ENSP00000223642:D1114H	D	-	1	0	C5	122784804	0.210000	0.23517	0.869000	0.34112	0.445000	0.32107	0.351000	0.20096	1.270000	0.44297	0.484000	0.47621	GAT		0.284	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
DOCK8	81704	broad.mit.edu	37	9	286581	286581	+	Missense_Mutation	SNP	G	G	T	rs375686155		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:286581G>T	ENST00000453981.1	+	3	389	c.277G>T	c.(277-279)Gtg>Ttg	p.V93L	DOCK8_ENST00000432829.2_Missense_Mutation_p.V25L|DOCK8_ENST00000469391.1_Missense_Mutation_p.V25L			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	93					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V25M(1)|p.V25L(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CGACTTGGACGTGGTGTTCAC	0.498																																					p.V25L												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G73T	9						.	G	LEU/VAL,LEU/VAL,LEU/VAL	0,4406		0,0,2203	139.0	121.0	127.0		73,73,277	5.5	0.9	9		127	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DOCK8	NM_001190458.1,NM_001193536.1,NM_203447.3	32,32,32	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign,benign,benign	25/2000,25/2032,93/2100	286581	1,13005	2203	4300	6503	276581	SO:0001583	missense	81704	exon2			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.277G>T	9.37:g.286581G>T	ENSP00000408464:p.Val93Leu		276581	NM_001190458	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007804	0.54361	0.0	1.16E-4	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000479404;ENST00000487230;ENST00000469391	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.47	5.47	0.80525	.	0.213930	0.40640	N	0.001041	T	0.51329	0.1668	L	0.37630	1.12	0.50813	D	0.99989	P;D;B	0.69078	0.515;0.997;0.085	B;P;B	0.62435	0.341;0.902;0.131	T	0.37731	-0.9693	10	0.19590	T	0.45	.	10.8737	0.46899	0.1453:0.0:0.8547:0.0	.	25;93;93	E9PH09;A2A349;Q8NF50	.;.;DOCK8_HUMAN	L	93;93;25;25;25;25	ENSP00000408464:V93L;ENSP00000394888:V25L;ENSP00000417082:V25L;ENSP00000418318:V25L;ENSP00000419438:V25L	ENSP00000287364:V93L	V	+	1	0	DOCK8	276581	1.000000	0.71417	0.854000	0.33618	0.943000	0.58893	3.147000	0.50639	2.574000	0.86865	0.563000	0.77884	GTG		0.498	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
FREM1	158326	broad.mit.edu	37	9	14819249	14819249	+	Silent	SNP	G	G	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:14819249G>C	ENST00000380880.3	-	14	3312	c.2529C>G	c.(2527-2529)ctC>ctG	p.L843L	FREM1_ENST00000380881.4_Silent_p.L844L|FREM1_ENST00000422223.2_Silent_p.L843L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	843					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.L844L(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTAAGGTATGGAGATCGCCCC	0.413																																					p.L843L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2529G	9						.						89.0	84.0	85.0					9																	14819249		1880	4128	6008	14809249	SO:0001819	synonymous_variant	158326	exon15			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2529C>G	9.37:g.14819249G>C			14809249	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																				0.413	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
PTPLAD2	401494	broad.mit.edu	37	9	21026623	21026623	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:21026623G>T	ENST00000495827.2	-	3	287	c.242C>A	c.(241-243)tCa>tAa	p.S81*	PTPLAD2_ENST00000488436.1_5'UTR|PTPLAD2_ENST00000513293.2_Nonsense_Mutation_p.S81*	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	81					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)	p.S81*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		AAGATGGTTTGACTCAATGCC	0.363																																					p.S81X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C242A	9						.						153.0	154.0	154.0					9																	21026623		1895	4120	6015	21016623	SO:0001587	stop_gained	401494	exon3				CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.242C>A	9.37:g.21026623G>T	ENSP00000419503:p.Ser81*		21016623	NM_001010915	Q7Z385	Nonsense_Mutation	SNP	ENST00000495827.2	37	CCDS43791.1	.	.	.	.	.	.	.	.	.	.	G	33	5.225706	0.95173	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	.	.	.	5.66	3.83	0.44106	.	0.315698	0.29529	N	0.011890	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-18.6876	7.5619	0.27855	0.0769:0.0:0.5738:0.3493	.	.	.	.	X	81	.	ENSP00000419503:S81X	S	-	2	0	PTPLAD2	21016623	0.895000	0.30542	0.982000	0.44146	0.900000	0.52787	3.779000	0.55379	0.855000	0.35359	-0.152000	0.13540	TCA		0.363	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915	
PTAR1	375743	broad.mit.edu	37	9	72347067	72347067	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:72347067C>G	ENST00000340434.4	-	5	633	c.630G>C	c.(628-630)aaG>aaC	p.K210N	PTAR1_ENST00000377200.5_Missense_Mutation_p.K131N	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	210					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)	p.K210N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						TGACATCTAGCTTGGCCAAGT	0.468																																					p.K210N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G630C	9						.						96.0	87.0	90.0					9																	72347067		1942	4132	6074	71536887	SO:0001583	missense	375743	exon5			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.630G>C	9.37:g.72347067C>G	ENSP00000344299:p.Lys210Asn		71536887	NM_001099666	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	37	CCDS47978.1	.	.	.	.	.	.	.	.	.	.	C	9.552	1.116149	0.20795	.	.	ENSG00000188647	ENST00000377200;ENST00000340434	T;T	0.45276	0.9;0.9	6.03	4.18	0.49190	Protein prenyltransferase (1);	0.147481	0.56097	D	0.000021	T	0.20941	0.0504	N	0.12182	0.205	0.80722	D	1	B	0.13145	0.007	B	0.14023	0.01	T	0.07328	-1.0778	10	0.19590	T	0.45	.	6.297	0.21091	0.1337:0.6655:0.0:0.2008	.	210	Q7Z6K3	PTAR1_HUMAN	N	131;210	ENSP00000366405:K131N;ENSP00000344299:K210N	ENSP00000344299:K210N	K	-	3	2	PTAR1	71536887	0.892000	0.30473	1.000000	0.80357	0.998000	0.95712	0.038000	0.13862	1.551000	0.49450	0.655000	0.94253	AAG		0.468	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	
QSOX2	169714	broad.mit.edu	37	9	139113643	139113643	+	Splice_Site	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chr9:139113643C>T	ENST00000358701.5	-	6	857	c.820G>A	c.(820-822)Gtc>Atc	p.V274I		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	274					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.V274I(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		GGCACTCACACGTTAATCAAT	0.557																																					p.V274I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G820A	9						.						115.0	103.0	107.0					9																	139113643		2203	4300	6503	138253464	SO:0001630	splice_region_variant	169714	exon6			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.821+1G>A	9.37:g.139113643C>T			138253464	NM_181701	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.589140	0.28357	.	.	ENSG00000165661	ENST00000358701	T	0.20200	2.09	4.65	-4.1	0.03940	.	1.226220	0.05654	N	0.585640	T	0.16769	0.0403	L	0.33137	0.985	0.09310	N	0.999999	B	0.16396	0.017	B	0.12156	0.007	T	0.35895	-0.9770	10	0.39692	T	0.17	-10.9766	12.5046	0.55973	0.0:0.2918:0.0:0.7082	.	274	Q6ZRP7	QSOX2_HUMAN	I	274	ENSP00000351536:V274I	ENSP00000351536:V274I	V	-	1	0	QSOX2	138253464	0.000000	0.05858	0.007000	0.13788	0.002000	0.02628	-0.561000	0.05957	-0.703000	0.05049	-0.793000	0.03317	GTC		0.557	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	Missense_Mutation
KDM5C	8242	broad.mit.edu	37	X	53226186	53226187	+	Frame_Shift_Ins	INS	-	-	GG	rs375850872|rs376775932		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:53226186_53226187insGG	ENST00000375401.3	-	19	3194_3195	c.2662_2663insCC	c.(2662-2664)cgtfs	p.R888fs	KDM5C_ENST00000375379.3_Frame_Shift_Ins_p.R888fs|KDM5C_ENST00000452825.3_Frame_Shift_Ins_p.R821fs|KDM5C_ENST00000375383.3_Frame_Shift_Ins_p.R847fs|KDM5C_ENST00000404049.3_Frame_Shift_Ins_p.R887fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	888					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.R888fs*48(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CAGGGCCTCACGAGCCTCAGCC	0.649			"""N, F, S"""		clear cell renal carcinoma																																p.R888fs			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2663_2664insCC	X						.																																			53242912	SO:0001589	frameshift_variant	8242	exon19			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2662_2663insCC	X.37:g.53226186_53226187insGG	ENSP00000364550:p.Arg888fs		53242911	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Ins	INS	ENST00000375401.3	37	CCDS14351.1																																																																																				0.649	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
TEX13A	56157	broad.mit.edu	37	X	104463981	104463981	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:104463981A>T	ENST00000413579.1	-	5	1006	c.895T>A	c.(895-897)Tca>Aca	p.S299T	TEX13A_ENST00000372578.3_Silent_p.P299P|TEX13A_ENST00000372575.1_Silent_p.P299P|IL1RAPL2_ENST00000372582.1_Intron|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	299							zinc ion binding (GO:0008270)	p.P299P(1)		large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						TATGAGTATGAGGCAGGGAGC	0.522																																					p.P299P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T897A	X						.						116.0	117.0	116.0					X																	104463981		2179	4290	6469	104350637	SO:0001583	missense	56157	exon3			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.895T>A	X.37:g.104463981A>T	ENSP00000399753:p.Ser299Thr		104350637	NM_031274	B1B1G8|Q32NB6	Missense_Mutation	SNP	ENST00000413579.1	37		.	.	.	.	.	.	.	.	.	.	A	15.84	2.951568	0.53186	.	.	ENSG00000133149	ENST00000413579	.	.	.	3.45	3.45	0.39498	.	0.000000	0.30134	N	0.010324	T	0.54398	0.1856	L	0.59436	1.845	0.27414	N	0.954485	D	0.76494	0.999	D	0.75484	0.986	T	0.41805	-0.9488	9	0.48119	T	0.1	.	7.5143	0.27592	1.0:0.0:0.0:0.0	.	299	Q9BXU3	TX13A_HUMAN	T	299	.	ENSP00000399753:S299T	S	-	1	0	TEX13A	104350637	1.000000	0.71417	0.999000	0.59377	0.764000	0.43329	3.304000	0.51866	1.586000	0.49944	0.417000	0.27973	TCA		0.522	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274	
IRS4	8471	broad.mit.edu	37	X	107977758	107977758	+	Missense_Mutation	SNP	C	C	T	rs367909187		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:107977758C>T	ENST00000372129.2	-	1	1893	c.1817G>A	c.(1816-1818)cGt>cAt	p.R606H	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	606					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.R606L(1)|p.R606H(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGATTTTCCACGTTCACCATC	0.542																																					p.R606H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1817A	X						.						211.0	208.0	209.0					X																	107977758		2203	4300	6503	107864414	SO:0001583	missense	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1817G>A	X.37:g.107977758C>T	ENSP00000361202:p.Arg606His		107864414	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	8.865	0.947838	0.18356	.	.	ENSG00000133124	ENST00000372129	T	0.34275	1.37	4.77	0.795	0.18643	.	0.905593	0.09488	N	0.795383	T	0.31231	0.0790	L	0.57536	1.79	0.09310	N	0.999994	B	0.16603	0.018	B	0.08055	0.003	T	0.29119	-1.0022	10	0.42905	T	0.14	-1.5361	5.441	0.16509	0.0:0.3596:0.3205:0.3199	.	606	O14654	IRS4_HUMAN	H	606	ENSP00000361202:R606H	ENSP00000361202:R606H	R	-	2	0	IRS4	107864414	0.054000	0.20591	0.536000	0.28039	0.842000	0.47809	0.233000	0.17911	0.109000	0.17891	0.513000	0.50165	CGT		0.542	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
GLUD2	2747	broad.mit.edu	37	X	120181769	120181769	+	Silent	SNP	C	C	T			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:120181769C>T	ENST00000328078.1	+	1	308	c.231C>T	c.(229-231)ggC>ggT	p.G77G		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	77					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.G77G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TCGATCGCGGCGCCAGCATCG	0.642																																					p.G77G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C231T	X						.						87.0	73.0	78.0					X																	120181769		2203	4300	6503	120009450	SO:0001819	synonymous_variant	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.231C>T	X.37:g.120181769C>T			120009450	NM_012084	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																				0.642	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
MAGEA12	4111	broad.mit.edu	37	X	151900696	151900696	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:151900696C>A	ENST00000357916.4	-	2	260	c.105G>T	c.(103-105)gaG>gaT	p.E35D	MAGEA12_ENST00000393900.3_Missense_Mutation_p.E35D|CSAG1_ENST00000452779.2_5'Flank|CSAG1_ENST00000370287.3_5'Flank|MAGEA12_ENST00000393869.3_Missense_Mutation_p.E35D|CSAG1_ENST00000370291.2_5'Flank|CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	35								p.E35D(1)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCTCCTGCTCCTCAGTAG	0.632																																					p.E35D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G105T	X						.						46.0	48.0	48.0					X																	151900696		2203	4300	6503	151651352	SO:0001583	missense	4111	exon2				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.105G>T	X.37:g.151900696C>A	ENSP00000350592:p.Glu35Asp		151651352	NM_005367	Q9NSD3	Missense_Mutation	SNP	ENST00000357916.4	37	CCDS14710.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809734	0.31961	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.07567	3.18;3.18;3.18	1.14	0.158	0.14942	Melanoma associated antigen, MAGE, N-terminal (1);	3.321420	0.01112	N	0.005587	T	0.22282	0.0537	M	0.75777	2.31	0.09310	N	1	D	0.58970	0.984	P	0.57776	0.827	T	0.07046	-1.0793	10	0.54805	T	0.06	.	3.291	0.06949	0.0:0.6723:0.0:0.3277	.	35	P43365	MAGAC_HUMAN	D	35	ENSP00000350592:E35D;ENSP00000377447:E35D;ENSP00000377478:E35D	ENSP00000350592:E35D	E	-	3	2	MAGEA12	151651352	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.418000	0.07080	-0.023000	0.13963	0.179000	0.17066	GAG		0.632	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367	
ZNF645	158506	broad.mit.edu	37	X	22291526	22291526	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:22291526A>G	ENST00000323684.1	+	1	462	c.418A>G	c.(418-420)Aga>Gga	p.R140G		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	140	HYB domain.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R140G(1)		cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						CCGCCATAAGAGAGCTCGAAA	0.433																																					p.R140G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A418G	X						.						62.0	60.0	61.0					X																	22291526		2203	4300	6503	22201447	SO:0001583	missense	158506	exon1			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.418A>G	X.37:g.22291526A>G	ENSP00000323348:p.Arg140Gly		22201447	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	37	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.988847	0.35131	.	.	ENSG00000175809	ENST00000323684	T	0.34275	1.37	3.62	2.46	0.29980	Zinc finger, C2H2 (1);	0.184947	0.43919	U	0.000513	T	0.23806	0.0576	L	0.43152	1.355	0.09310	N	1	B	0.33044	0.395	B	0.26310	0.068	T	0.11155	-1.0599	10	0.36615	T	0.2	.	6.3662	0.21455	0.8738:0.0:0.1262:0.0	.	140	Q8N7E2	ZN645_HUMAN	G	140	ENSP00000323348:R140G	ENSP00000323348:R140G	R	+	1	2	ZNF645	22201447	1.000000	0.71417	0.002000	0.10522	0.013000	0.08279	1.680000	0.37607	0.605000	0.29947	0.430000	0.28490	AGA		0.433	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
CXorf22	170063	broad.mit.edu	37	X	35970073	35970073	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:35970073A>G	ENST00000297866.5	+	6	1105	c.1039A>G	c.(1039-1041)Acc>Gcc	p.T347A		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	347								p.T347A(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						ATTTTGTTTCACCCCAAAGTA	0.259																																					p.T347A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1039G	X						.						52.0	50.0	51.0					X																	35970073		2192	4246	6438	35879994	SO:0001583	missense	170063	exon6			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1039A>G	X.37:g.35970073A>G	ENSP00000297866:p.Thr347Ala		35879994	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	A	12.50	1.956205	0.34565	.	.	ENSG00000165164	ENST00000297866	T	0.54479	0.57	5.76	5.76	0.90799	.	0.171581	0.64402	D	0.000008	T	0.34337	0.0894	N	0.19112	0.55	0.23628	N	0.997256	B	0.18610	0.029	B	0.10450	0.005	T	0.17806	-1.0357	10	0.13853	T	0.58	-21.7833	10.6502	0.45645	0.855:0.0:0.0:0.145	.	347	Q6ZTR5	CX022_HUMAN	A	347	ENSP00000297866:T347A	ENSP00000297866:T347A	T	+	1	0	CXorf22	35879994	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	4.587000	0.60991	1.931000	0.55961	0.417000	0.27973	ACC		0.259	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
CXorf22	170063	broad.mit.edu	37	X	35971836	35971836	+	Splice_Site	SNP	A	A	C			TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:35971836A>C	ENST00000297866.5	+	7	1240	c.1174A>C	c.(1174-1176)Agt>Cgt	p.S392R		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	392								p.S392R(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AACCATCAAAAGTAAGTGTGA	0.294																																					p.S392R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1174C	X						.						56.0	52.0	53.0					X																	35971836		2202	4297	6499	35881757	SO:0001630	splice_region_variant	170063	exon7			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1174+1A>C	X.37:g.35971836A>C			35881757	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	A	9.251	1.040724	0.19669	.	.	ENSG00000165164	ENST00000297866	T	0.15139	2.45	5.69	3.17	0.36434	.	0.802180	0.12295	N	0.481628	T	0.13970	0.0338	L	0.59436	1.845	0.33102	D	0.539303	B	0.33171	0.4	B	0.30029	0.11	T	0.22487	-1.0215	10	0.15952	T	0.53	-33.0572	4.4757	0.11739	0.6077:0.0:0.0825:0.3098	.	392	Q6ZTR5	CX022_HUMAN	R	392	ENSP00000297866:S392R	ENSP00000297866:S392R	S	+	1	0	CXorf22	35881757	1.000000	0.71417	0.984000	0.44739	0.444000	0.32077	1.029000	0.30140	0.226000	0.20979	0.441000	0.28932	AGT		0.294	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	Missense_Mutation
ATP2B3	492	broad.mit.edu	37	X	152818543	152818543	+	Missense_Mutation	SNP	G	G	A	rs199524794		TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3979-01A-01W-0995-10	TCGA-AA-3979-10A-01W-0999-10	g.chrX:152818543G>A	ENST00000349466.2	+	12	2200	c.1874G>A	c.(1873-1875)cGg>cAg	p.R625Q	ATP2B3_ENST00000359149.3_Missense_Mutation_p.R625Q|ATP2B3_ENST00000263519.4_Missense_Mutation_p.R625Q|ATP2B3_ENST00000370186.1_Missense_Mutation_p.R611Q|ATP2B3_ENST00000370181.2_Missense_Mutation_p.R611Q|ATP2B3_ENST00000393842.1_Missense_Mutation_p.R611Q			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	625					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.R625Q(2)|p.R611Q(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTTCGGCCTCGGGACCGGGAC	0.612																																					p.R625Q												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1874A	X						.						67.0	60.0	62.0					X																	152818543		2203	4300	6503	152471737	SO:0001583	missense	492	exon11			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1874G>A	X.37:g.152818543G>A	ENSP00000343886:p.Arg625Gln		152471737	NM_021949	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301003	0.81136	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	T;T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	5.44	5.44	0.79542	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	N	0.00569	-1.365	0.37091	D	0.899441	B;B	0.26975	0.165;0.136	B;B	0.21708	0.036;0.021	T	0.48927	-0.8991	10	0.39692	T	0.17	-30.8357	16.9226	0.86167	0.0:0.0:1.0:0.0	.	625;625	Q16720;Q16720-2	AT2B3_HUMAN;.	Q	611;625;611;625;625;611	ENSP00000359205:R611Q;ENSP00000343886:R625Q;ENSP00000377425:R611Q;ENSP00000352062:R625Q;ENSP00000263519:R625Q;ENSP00000359200:R611Q	ENSP00000263519:R625Q	R	+	2	0	ATP2B3	152471737	0.004000	0.15560	0.953000	0.39169	0.877000	0.50540	1.083000	0.30815	2.257000	0.74773	0.600000	0.82982	CGG		0.612	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
