#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM196A	642938	broad.mit.edu	37	10	128973936	128973937	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr10:128973936_128973937insTA	ENST00000522781.1	-	4	1278_1279	c.723_724insTA	c.(721-726)gctccafs	p.P242fs	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Frame_Shift_Ins_p.P242fs	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	242										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AGGGCAGGTGGAGCGGGCTCCT	0.644																																					p.P242fs												.	.	0			c.724_725insTA	10						.																																			128863927	SO:0001589	frameshift_variant	642938	exon4				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.723_724insTA	10.37:g.128973936_128973937insTA	ENSP00000429763:p.Pro242fs		128863926	NM_001039762	B2RNT4|B7ZME7	Frame_Shift_Ins	INS	ENST00000522781.1	37	CCDS31312.1																																																																																				0.644	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
PCDH15	65217	broad.mit.edu	37	10	56138587	56138587	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr10:56138587C>G	ENST00000320301.6	-	4	667	c.273G>C	c.(271-273)aaG>aaC	p.K91N	PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.K91N|PCDH15_ENST00000373955.1_Missense_Mutation_p.K91N|PCDH15_ENST00000361849.3_Missense_Mutation_p.K91N|PCDH15_ENST00000395432.2_Missense_Mutation_p.K91N|PCDH15_ENST00000395438.1_Missense_Mutation_p.K91N|PCDH15_ENST00000395446.1_Missense_Mutation_p.K91N|PCDH15_ENST00000395440.1_Missense_Mutation_p.K91N|PCDH15_ENST00000414778.1_Missense_Mutation_p.K96N|PCDH15_ENST00000437009.1_Missense_Mutation_p.K91N|PCDH15_ENST00000395442.1_Missense_Mutation_p.K91N|PCDH15_ENST00000395433.1_Missense_Mutation_p.K69N|PCDH15_ENST00000395445.1_Missense_Mutation_p.K91N|PCDH15_ENST00000373965.2_Missense_Mutation_p.K91N|PCDH15_ENST00000373957.3_Missense_Mutation_p.K69N	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.K91N(2)|p.K96N(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAAGCATTTGCTTAACAGGAT	0.383										HNSCC(58;0.16)																											p.K91N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G273C	10						.						134.0	141.0	139.0					10																	56138587		2203	4300	6503	55808593	SO:0001583	missense	65217	exon4			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.273G>C	10.37:g.56138587C>G	ENSP00000322604:p.Lys91Asn		55808593	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127385	0.37533	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955;ENST00000458638	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58797	0.41;0.46;0.39;0.37;0.43;0.68;0.59;0.35;0.31;0.36;0.33;0.32;0.32;0.37;0.48;0.8	5.3	-9.36	0.00629	Cadherin (1);	.	.	.	.	T	0.34221	0.0890	N	0.14661	0.345	0.20403	N	0.999901	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.25390	0.004;0.017;0.017;0.017;0.125;0.017;0.004;0.001;0.004;0.004;0.002;0.004;0.001;0.002;0.017	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.24006	0.013;0.022;0.013;0.013;0.05;0.022;0.013;0.003;0.009;0.009;0.005;0.005;0.005;0.003;0.022	T	0.37842	-0.9688	9	0.49607	T	0.09	.	11.4987	0.50424	0.0834:0.6274:0.1414:0.1478	.	69;91;91;96;91;91;91;91;91;91;91;96;91;69;91	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	N	91;96;91;91;91;91;91;91;91;91;69;69;91;91;96;91;91;91	ENSP00000363076:K91N;ENSP00000410304:K96N;ENSP00000378826:K91N;ENSP00000378832:K91N;ENSP00000378833:K91N;ENSP00000378829:K91N;ENSP00000378827:K91N;ENSP00000378820:K91N;ENSP00000354950:K91N;ENSP00000378821:K69N;ENSP00000363068:K69N;ENSP00000322604:K91N;ENSP00000378818:K91N;ENSP00000412628:K91N;ENSP00000363066:K91N;ENSP00000394465:K91N	ENSP00000322604:K91N	K	-	3	2	PCDH15	55808593	0.000000	0.05858	0.402000	0.26371	0.915000	0.54546	-1.294000	0.02767	-1.991000	0.00976	-0.822000	0.03109	AAG		0.383	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
IDE	3416	broad.mit.edu	37	10	94223542	94223542	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr10:94223542C>T	ENST00000265986.6	-	21	2763	c.2707G>A	c.(2707-2709)Gag>Aag	p.E903K	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.E348K	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	903					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.E903K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TTAGCACACTCAGCAGATAGC	0.403																																					p.E903K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2707A	10						.						194.0	187.0	189.0					10																	94223542		2203	4300	6503	94213522	SO:0001583	missense	3416	exon21			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2707G>A	10.37:g.94223542C>T	ENSP00000265986:p.Glu903Lys		94213522	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783897	0.70222	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.45668	0.99;0.89	5.61	4.69	0.59074	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.059119	0.64402	D	0.000004	T	0.66107	0.2756	M	0.85859	2.78	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.62491	0.791;0.903	T	0.73569	-0.3941	10	0.66056	D	0.02	-15.8535	15.9745	0.80049	0.1359:0.8641:0.0:0.0	.	903;348	P14735;B3KSB8	IDE_HUMAN;.	K	903;348	ENSP00000265986:E903K;ENSP00000360637:E348K	ENSP00000265986:E903K	E	-	1	0	IDE	94213522	1.000000	0.71417	0.999000	0.59377	0.647000	0.38526	7.545000	0.82128	1.463000	0.47967	0.655000	0.94253	GAG		0.403	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
NOLC1	9221	broad.mit.edu	37	10	103919032	103919033	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr10:103919032_103919033delAG	ENST00000605788.1	+	6	925_926	c.690_691delAG	c.(688-693)tcagagfs	p.E233fs	NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Frame_Shift_Del_p.E233fs|NOLC1_ENST00000488254.2_Frame_Shift_Del_p.E234fs	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	233	11 X 12 AA approximate repeats of an acidic serine cluster.|Interacts with RPA194.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)	p.E231fs*14(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		gTGATGACTCAGAGGAGGAGAA	0.535																																					p.230_231del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.690_691del	10						.																																			103909023	SO:0001589	frameshift_variant	9221	exon6			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.690_691delAG	10.37:g.103919034_103919035delAG	ENSP00000474710:p.Glu233fs		103909022	NM_004741	Q15030|Q5VV70|Q9BUV3	Frame_Shift_Del	DEL	ENST00000605788.1	37	CCDS7530.1																																																																																				0.535	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
C11orf53	341032	broad.mit.edu	37	11	111156589	111156589	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:111156589C>T	ENST00000280325.4	+	4	668	c.521C>T	c.(520-522)cCg>cTg	p.P174L		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	174								p.P174L(1)		endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		CACCACACTCCGGGGTACCCT	0.622																																					p.P174L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C521T	11						.						103.0	100.0	101.0					11																	111156589		2201	4297	6498	110661799	SO:0001583	missense	341032	exon4			BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.521C>T	11.37:g.111156589C>T	ENSP00000280325:p.Pro174Leu		110661799	NM_198498		Missense_Mutation	SNP	ENST00000280325.4	37	CCDS31674.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.573359	0.45902	.	.	ENSG00000150750	ENST00000280325	.	.	.	4.95	3.01	0.34805	.	0.413716	0.26808	N	0.022386	T	0.45377	0.1339	L	0.59436	1.845	0.09310	N	0.999992	D	0.61080	0.989	P	0.48488	0.579	T	0.39742	-0.9599	9	0.72032	D	0.01	-8.0861	11.5006	0.50435	0.3489:0.6511:0.0:0.0	.	174	Q8IXP5	CK053_HUMAN	L	174	.	ENSP00000280325:P174L	P	+	2	0	C11orf53	110661799	0.030000	0.19436	0.001000	0.08648	0.590000	0.36582	3.179000	0.50887	0.448000	0.26722	0.561000	0.74099	CCG		0.622	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390989.1	NM_198498	
VPS11	55823	broad.mit.edu	37	11	118944521	118944521	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:118944521G>C	ENST00000300793.6	+	8	1137	c.1095G>C	c.(1093-1095)aaG>aaC	p.K365N	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	366					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.K365N(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TGCTGTTTAAGAAGAACCTAT	0.448																																					p.R366T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1097C	11						.						94.0	84.0	87.0					11																	118944521		1882	4108	5990	118449731	SO:0001583	missense	55823	exon7			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.1095G>C	11.37:g.118944521G>C	ENSP00000475301:p.Lys365Asn		118449731	NM_021729	Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	ENST00000300793.6	37																																																																																					0.448	VPS11-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021729	
OR8D2	283160	broad.mit.edu	37	11	124189712	124189712	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:124189712G>A	ENST00000357438.2	-	1	472	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R128C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AGCAGTGGGCGACAGATAGCA	0.428																																					p.R128C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C382T	11						.						96.0	89.0	91.0					11																	124189712		2201	4299	6500	123694922	SO:0001583	missense	283160	exon1			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.382C>T	11.37:g.124189712G>A	ENSP00000350022:p.Arg128Cys		123694922	NM_001002918	B9EH49|Q6IFR0	Missense_Mutation	SNP	ENST00000357438.2	37	CCDS31707.1	.	.	.	.	.	.	.	.	.	.	g	7.455	0.643419	0.14451	.	.	ENSG00000197263	ENST00000357438	T	0.00397	7.57	3.48	0.933	0.19471	GPCR, rhodopsin-like superfamily (1);	0.501509	0.18279	N	0.146081	T	0.00241	0.0007	L	0.42529	1.33	0.09310	N	1	D	0.62365	0.991	B	0.44315	0.446	T	0.52726	-0.8537	10	0.72032	D	0.01	.	1.9545	0.03373	0.1533:0.0933:0.3213:0.4321	.	128	Q9GZM6	OR8D2_HUMAN	C	128	ENSP00000350022:R128C	ENSP00000350022:R128C	R	-	1	0	OR8D2	123694922	0.000000	0.05858	0.056000	0.19401	0.068000	0.16541	-1.480000	0.02325	0.186000	0.20125	-0.851000	0.03033	CGC		0.428	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918	
SCUBE2	57758	broad.mit.edu	37	11	9080916	9080916	+	Missense_Mutation	SNP	C	C	T	rs147079601	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:9080916C>T	ENST00000309263.3	-	9	1096	c.1024G>A	c.(1024-1026)Gtg>Atg	p.V342M	SCUBE2_ENST00000457346.2_Missense_Mutation_p.V342M|SCUBE2_ENST00000450649.2_Missense_Mutation_p.V342M|RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000520467.1_Missense_Mutation_p.V342M|RP11-467K18.2_ENST00000521394.2_RNA			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	342	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.V342M(2)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		AAACTGCCCACGATGTTTTTG	0.443																																					p.V342M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1024A	11						.	C	MET/VAL,MET/VAL	3,4399	6.2+/-15.9	0,3,2198	90.0	79.0	83.0		1024,1024	4.9	1.0	11	dbSNP_134	83	2,8590	2.2+/-6.3	0,2,4294	yes	missense,missense	SCUBE2	NM_001170690.1,NM_020974.2	21,21	0,5,6492	TT,TC,CC		0.0233,0.0682,0.0385	possibly-damaging,possibly-damaging	342/808,342/972	9080916	5,12989	2201	4296	6497	9037492	SO:0001583	missense	57758	exon9			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.1024G>A	11.37:g.9080916C>T	ENSP00000310658:p.Val342Met		9037492	NM_020974	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.	.	.	.	.	.	.	.	.	.	C	17.51	3.407304	0.62399	6.82E-4	2.33E-4	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03	5.85	4.94	0.65067	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.107611	0.64402	D	0.000004	D	0.97148	0.9068	M	0.64567	1.98	0.49299	D	0.999774	D;D;D	0.65815	0.995;0.995;0.991	P;D;P	0.68483	0.9;0.958;0.908	D	0.96914	0.9669	10	0.51188	T	0.08	.	11.841	0.52355	0.0:0.8604:0.0:0.1396	.	342;342;342	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	M	342	ENSP00000390481:V342M;ENSP00000310658:V342M;ENSP00000415187:V342M;ENSP00000429969:V342M	ENSP00000310658:V342M	V	-	1	0	SCUBE2	9037492	0.958000	0.32768	0.993000	0.49108	0.991000	0.79684	2.004000	0.40854	1.488000	0.48433	0.585000	0.79938	GTG		0.443	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
LUZP2	338645	broad.mit.edu	37	11	24936056	24936056	+	Missense_Mutation	SNP	G	G	A	rs138554284	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:24936056G>A	ENST00000336930.6	+	7	560	c.494G>A	c.(493-495)cGt>cAt	p.R165H	LUZP2_ENST00000533227.1_Missense_Mutation_p.R79H			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	165	Leucine-zipper.					extracellular region (GO:0005576)		p.R165H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AAGGAGCTTCGTTATGGGAAG	0.318																																					p.R165H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G494A	11						.	G	HIS/ARG	0,4406		0,0,2203	94.0	96.0	96.0		494	4.6	1.0	11	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	missense	LUZP2	NM_001009909.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	165/347	24936056	1,13005	2203	4300	6503	24892632	SO:0001583	missense	338645	exon7			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.494G>A	11.37:g.24936056G>A	ENSP00000336817:p.Arg165His		24892632	NM_001009909	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382555	0.82792	0.0	1.16E-4	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.26223	1.75;1.75	5.54	4.62	0.57501	.	0.249769	0.34386	N	0.004003	T	0.21718	0.0523	L	0.34521	1.04	0.42144	D	0.991521	D	0.54772	0.968	B	0.42798	0.398	T	0.02721	-1.1119	10	0.72032	D	0.01	-7.3905	11.9125	0.52747	0.085:0.0:0.915:0.0	.	165	Q86TE4	LUZP2_HUMAN	H	165;79	ENSP00000336817:R165H;ENSP00000432952:R79H	ENSP00000336817:R165H	R	+	2	0	LUZP2	24892632	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.254000	0.72460	1.319000	0.45190	0.467000	0.42956	CGT		0.318	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
AMOTL1	154810	broad.mit.edu	37	11	94528288	94528288	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:94528288T>A	ENST00000433060.2	+	2	302	c.161T>A	c.(160-162)tTg>tAg	p.L54*	AMOTL1_ENST00000317829.8_Intron|AMOTL1_ENST00000317837.9_Nonsense_Mutation_p.L54*	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	54					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.L54S(1)|p.L54*(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				ACATCTGCTTTGACGGTGGAG	0.453																																					p.L54X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|endometrium(1)	c.T161A	11						.						167.0	157.0	160.0					11																	94528288		1873	4102	5975	94167936	SO:0001587	stop_gained	154810	exon2			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.161T>A	11.37:g.94528288T>A	ENSP00000387739:p.Leu54*		94167936	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Nonsense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	T	35	5.538815	0.96474	.	.	ENSG00000166025	ENST00000299004;ENST00000542840;ENST00000317837;ENST00000433060	.	.	.	5.63	5.63	0.86233	.	0.329620	0.21495	N	0.073617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.9661	14.4246	0.67207	0.0:0.0:0.0:1.0	.	.	.	.	X	83;60;54;54	.	ENSP00000299004:L83X	L	+	2	0	AMOTL1	94167936	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	4.579000	0.60936	2.149000	0.67028	0.528000	0.53228	TTG		0.453	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
HEPN1	641654	broad.mit.edu	37	11	124789851	124789851	+	Missense_Mutation	SNP	C	C	T	rs183886198	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr11:124789851C>T	ENST00000408930.5	+	1	706	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	HEPACAM_ENST00000298251.4_3'UTR	NM_001037558.2	NP_001032647.2	Q6WQI6	HEPN1_HUMAN	hepatocellular carcinoma, down-regulated 1	69						cytoplasm (GO:0005737)		p.R69W(1)		large_intestine(1)|lung(1)|stomach(1)	3	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)		GTTCAATAGGCGGTGGCATGG	0.498													C|||	2	0.000399361	0.0	0.0014	5008	,	,		20190	0.001		0.0	False		,,,				2504	0.0				p.R69W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T	11						.						84.0	83.0	84.0					11																	124789851		1911	4135	6046	124295061	SO:0001583	missense	641654	exon1			BC148521	CCDS41729.1	11q24	2013-07-02	2011-02-11		ENSG00000221932	ENSG00000221932			34400	protein-coding gene	gene with protein product	"""cancer susceptibility gene HEPN1"""	611641	"""HEPACAM opposite strand 1"""			12971969, 23548416	Standard	NM_001037558		Approved		uc001qbj.1	Q6WQI6	OTTHUMG00000165939	ENST00000408930.5:c.205C>T	11.37:g.124789851C>T	ENSP00000386143:p.Arg69Trp		124295061	NM_001037558		Missense_Mutation	SNP	ENST00000408930.5	37	CCDS41729.1	.	.	.	.	.	.	.	.	.	.	C	9.005	0.980951	0.18812	.	.	ENSG00000221932	ENST00000408930	T	0.56941	0.43	4.43	-4.94	0.03057	.	.	.	.	.	T	0.36991	0.0987	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30707	-0.9969	8	0.87932	D	0	.	7.3794	0.26847	0.0:0.5799:0.1324:0.2877	.	69	Q6WQI6	HEPN1_HUMAN	W	69	ENSP00000386143:R69W	ENSP00000386143:R69W	R	+	1	2	HEPN1	124295061	0.000000	0.05858	0.000000	0.03702	0.301000	0.27625	-1.112000	0.03299	-1.364000	0.02161	-0.600000	0.04104	CGG		0.498	HEPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387129.1	NM_001037558	
A2ML1	144568	broad.mit.edu	37	12	9009922	9009922	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr12:9009922G>T	ENST00000299698.7	+	24	3191	c.3011G>T	c.(3010-3012)gGt>gTt	p.G1004V	A2ML1_ENST00000539547.1_Missense_Mutation_p.G513V	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.G1004V(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CGGGCAGTGGGTTTCCTGGAA	0.512																																					p.G1004V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3011T	12						.						209.0	213.0	211.0					12																	9009922		1983	4166	6149	8901189	SO:0001583	missense	144568	exon24			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.3011G>T	12.37:g.9009922G>T	ENSP00000299698:p.Gly1004Val		8901189	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793633	0.50102	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.39056	1.1;1.1;1.1	3.76	2.87	0.33458	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.111424	0.38605	N	0.001633	T	0.58018	0.2093	M	0.76002	2.32	0.29656	N	0.843577	D	0.63046	0.992	P	0.62014	0.897	T	0.58967	-0.7542	10	0.72032	D	0.01	.	10.5306	0.44975	0.0992:0.0:0.9008:0.0	.	1004	A8K2U0	A2ML1_HUMAN	V	1004;1004;554;513	ENSP00000299698:G1004V;ENSP00000443174:G554V;ENSP00000438292:G513V	ENSP00000299698:G1004V	G	+	2	0	A2ML1	8901189	0.689000	0.27690	0.979000	0.43373	0.915000	0.54546	2.021000	0.41020	0.917000	0.36895	0.561000	0.74099	GGT		0.512	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
TMTC1	83857	broad.mit.edu	37	12	29904615	29904615	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr12:29904615C>A	ENST00000539277.1	-	5	980	c.922G>T	c.(922-924)Gtg>Ttg	p.V308L	TMTC1_ENST00000552618.1_Missense_Mutation_p.V308L|TMTC1_ENST00000256062.5_Missense_Mutation_p.V200L|TMTC1_ENST00000381224.2_Missense_Mutation_p.V200L|TMTC1_ENST00000551659.1_Missense_Mutation_p.V308L	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	308						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.V200L(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					atggaccacacagctcgtggg	0.577																																					p.V308L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G922T	12						.						120.0	106.0	110.0					12																	29904615		2203	4300	6503	29795882	SO:0001583	missense	83857	exon5				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.922G>T	12.37:g.29904615C>A	ENSP00000442046:p.Val308Leu		29795882	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	C	8.294	0.818296	0.16607	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.67345	0.97;-0.03;-0.26;0.97;1.54	4.47	-5.19	0.02832	Domain of unknown function DUF1736 (1);	0.840922	0.10680	N	0.646508	T	0.33294	0.0858	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.17961	-1.0352	9	.	.	.	-0.0108	2.1735	0.03856	0.1219:0.1496:0.3613:0.3673	.	200;308	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	L	200;308;308;308;200	ENSP00000256062:V200L;ENSP00000448112:V308L;ENSP00000449043:V308L;ENSP00000442046:V308L;ENSP00000370622:V200L	.	V	-	1	0	TMTC1	29795882	0.000000	0.05858	0.116000	0.21606	0.940000	0.58332	-2.054000	0.01399	-0.777000	0.04572	0.650000	0.86243	GTG		0.577	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
CCDC92	80212	broad.mit.edu	37	12	124421721	124421721	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr12:124421721G>A	ENST00000238156.3	-	5	1234	c.880C>T	c.(880-882)Cgg>Tgg	p.R294W	DNAH10OS_ENST00000514254.2_5'Flank|CCDC92_ENST00000545135.1_Missense_Mutation_p.R277W|CCDC92_ENST00000545891.1_Missense_Mutation_p.R277W|CCDC92_ENST00000544798.1_Intron|RP11-380L11.3_ENST00000602292.1_RNA	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	294						centriole (GO:0005814)		p.R294W(1)		large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		TGGTGGATCCGATGTGCCACC	0.706																																					p.R294W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C880T	12						.						26.0	25.0	25.0					12																	124421721		2202	4298	6500	122987674	SO:0001583	missense	80212	exon5			AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.880C>T	12.37:g.124421721G>A	ENSP00000238156:p.Arg294Trp		122987674	NM_025140	B3KNQ0|Q9H697	Missense_Mutation	SNP	ENST00000238156.3	37	CCDS9256.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102309	0.76983	.	.	ENSG00000119242	ENST00000238156;ENST00000545135;ENST00000545891	T;T;T	0.33865	1.39;1.43;1.43	5.43	4.54	0.55810	.	0.053631	0.85682	D	0.000000	T	0.45256	0.1333	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	P	0.60173	0.87	T	0.46978	-0.9152	10	0.87932	D	0	-17.4767	14.2666	0.66123	0.0719:0.0:0.9281:0.0	.	294	Q53HC0	CCD92_HUMAN	W	294;277;277	ENSP00000238156:R294W;ENSP00000439526:R277W;ENSP00000440024:R277W	ENSP00000238156:R294W	R	-	1	2	CCDC92	122987674	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	3.431000	0.52814	1.287000	0.44583	0.505000	0.49811	CGG		0.706	CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	NM_025140	
EDNRB	1910	broad.mit.edu	37	13	78492596	78492596	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr13:78492596G>A	ENST00000334286.5	-	1	349	c.113C>T	c.(112-114)cCg>cTg	p.P38L	EDNRB_ENST00000377211.4_Missense_Mutation_p.P128L|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000475537.1_5'UTR|EDNRB_ENST00000446573.1_Missense_Mutation_p.P38L	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	38					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.P38L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TTGCAAAAGCGGAGTGGCCCT	0.637											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P38L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C113T	13						.						57.0	62.0	60.0					13																	78492596		2203	4300	6503	77390597	SO:0001583	missense	1910	exon1			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.113C>T	13.37:g.78492596G>A	ENSP00000335311:p.Pro38Leu	1183	77390597	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	G	4.409	0.075513	0.08485	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.37411	1.2;1.2;1.2	3.77	-2.79	0.05841	.	1.852880	0.02282	N	0.069518	T	0.16769	0.0403	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.15473	0.0;0.013;0.001	B;B;B	0.08055	0.0;0.003;0.001	T	0.12604	-1.0541	10	0.34782	T	0.22	2.2983	4.6763	0.12713	0.5567:0.0:0.2791:0.1642	.	38;128;38	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	L	128;38;38	ENSP00000366416:P128L;ENSP00000403401:P38L;ENSP00000335311:P38L	ENSP00000335311:P38L	P	-	2	0	EDNRB	77390597	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.761000	0.04751	-0.570000	0.06022	-0.216000	0.12614	CCG		0.637	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
SLITRK5	26050	broad.mit.edu	37	13	88329272	88329272	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr13:88329272G>T	ENST00000325089.6	+	2	1848	c.1629G>T	c.(1627-1629)ttG>ttT	p.L543F	SLITRK5_ENST00000400028.3_Missense_Mutation_p.L302F	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	543					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.L543F(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCACCTCCTTGCCAGTGAGTG	0.507																																					p.L543F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1629T	13						.						94.0	93.0	94.0					13																	88329272		2203	4300	6503	87127273	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1629G>T	13.37:g.88329272G>T	ENSP00000366283:p.Leu543Phe		87127273	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309605	0.40895	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.61510	0.1;0.1	5.22	4.34	0.51931	.	0.000000	0.64402	D	0.000004	T	0.59528	0.2200	L	0.31578	0.945	0.47698	D	0.999493	D;D	0.89917	0.998;1.0	D;D	0.87578	0.978;0.998	T	0.57631	-0.7778	9	.	.	.	-8.1908	6.1151	0.20122	0.1007:0.0:0.7178:0.1815	.	302;543	B4DSH5;O94991	.;SLIK5_HUMAN	F	543;302	ENSP00000366283:L543F;ENSP00000442244:L302F	.	L	+	3	2	SLITRK5	87127273	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	2.198000	0.42705	1.121000	0.41925	0.555000	0.69702	TTG		0.507	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
RYR3	6263	broad.mit.edu	37	15	34118949	34118949	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr15:34118949C>G	ENST00000389232.4	+	84	11311	c.11241C>G	c.(11239-11241)aaC>aaG	p.N3747K	RYR3_ENST00000415757.3_Missense_Mutation_p.N3742K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3747					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.N3746K(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGGACATAACAGTGGTGAGT	0.428																																					p.N3747K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11241G	15						.						161.0	153.0	156.0					15																	34118949		1967	4153	6120	31906241	SO:0001583	missense	6263	exon84				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11241C>G	15.37:g.34118949C>G	ENSP00000373884:p.Asn3747Lys		31906241	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326733	0.60743	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.96300	-3.97	5.15	3.29	0.37713	RyR/IP3R Homology associated domain (1);	0.000000	0.85682	D	0.000000	D	0.98229	0.9414	M	0.93507	3.425	0.47276	D	0.999374	D;D	0.89917	0.998;1.0	D;D	0.85130	0.994;0.997	D	0.97914	1.0310	10	0.87932	D	0	.	9.1583	0.37007	0.0:0.7785:0.0:0.2215	.	3742;3747	Q15413-2;Q15413	.;RYR3_HUMAN	K	3747;3746;3743	ENSP00000373884:N3747K	ENSP00000354735:N3743K	N	+	3	2	RYR3	31906241	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.366000	0.44204	0.765000	0.33221	-0.143000	0.13931	AAC		0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
CILP	8483	broad.mit.edu	37	15	65489348	65489348	+	Silent	SNP	G	G	A	rs144863148		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr15:65489348G>A	ENST00000261883.4	-	9	3442	c.3276C>T	c.(3274-3276)ctC>ctT	p.L1092L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1092					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.L1092L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						AGCACCGGCCGAGCGCGATCT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		21060	0.0		0.0	False		,,,				2504	0.001				p.L1092L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3276T	15						.	G		0,4404		0,0,2202	76.0	54.0	61.0		3276	-5.4	0.9	15	dbSNP_134	61	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	CILP	NM_003613.3		0,2,6499	AA,AG,GG		0.0233,0.0,0.0154		1092/1185	65489348	2,13000	2202	4299	6501	63276401	SO:0001819	synonymous_variant	8483	exon9			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3276C>T	15.37:g.65489348G>A			63276401	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				0.577	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
AKAP13	11214	broad.mit.edu	37	15	86253847	86253847	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr15:86253847C>A	ENST00000394518.2	+	19	5665	c.5570C>A	c.(5569-5571)tCa>tAa	p.S1857*	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Nonsense_Mutation_p.S1861*|AKAP13_ENST00000394510.2_Nonsense_Mutation_p.S102*	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1857					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.S1861*(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GACACATCATCACTGCCCACG	0.453																																					p.S1861X	Melanoma(94;603 1453 3280 32295 32951)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C5582A	15						.						144.0	116.0	125.0					15																	86253847		2202	4299	6501	84054851	SO:0001587	stop_gained	11214	exon19			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.5570C>A	15.37:g.86253847C>A	ENSP00000378026:p.Ser1857*		84054851	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Nonsense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	C	47	13.208874	0.99727	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5491	0.87871	0.0:1.0:0.0:0.0	.	.	.	.	X	1861;1857;1860;1838;102	.	ENSP00000354718:S1861X	S	+	2	0	AKAP13	84054851	0.918000	0.31147	0.194000	0.23346	0.875000	0.50365	3.786000	0.55431	2.824000	0.97209	0.655000	0.94253	TCA		0.453	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
C16orf45	89927	broad.mit.edu	37	16	15675086	15675086	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr16:15675086C>A	ENST00000300006.4	+	4	676	c.317C>A	c.(316-318)aCc>aAc	p.T106N	C16orf45_ENST00000566490.1_Missense_Mutation_p.T106N|C16orf45_ENST00000452191.2_Missense_Mutation_p.T89N|C16orf45_ENST00000565913.1_3'UTR|C16orf45_ENST00000561692.1_Missense_Mutation_p.T58N	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	106								p.T106N(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						AAAGAAAAAACCAAACTGCAG	0.493																																					p.T89N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C266A	16						.						69.0	62.0	64.0					16																	15675086		2197	4300	6497	15582587	SO:0001583	missense	89927	exon4			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.317C>A	16.37:g.15675086C>A	ENSP00000300006:p.Thr106Asn		15582587	NM_001142469	O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	ENST00000300006.4	37	CCDS10561.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086918	0.55861	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.55760	0.5;0.5	5.33	5.33	0.75918	Domain of unknown function DUF3585 (1);	0.141685	0.64402	D	0.000005	T	0.52041	0.1710	L	0.58428	1.81	0.47905	D	0.999544	B;B	0.29552	0.248;0.01	B;B	0.25884	0.064;0.01	T	0.53774	-0.8391	10	0.54805	T	0.06	-4.0795	18.5994	0.91242	0.0:1.0:0.0:0.0	.	50;106	B4DE25;Q96MC5	.;CP045_HUMAN	N	106;89	ENSP00000300006:T106N;ENSP00000408976:T89N	ENSP00000300006:T106N	T	+	2	0	C16orf45	15582587	0.989000	0.36119	0.998000	0.56505	0.995000	0.86356	2.631000	0.46502	2.499000	0.84300	0.655000	0.94253	ACC		0.493	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201	
POLR3E	55718	broad.mit.edu	37	16	22320326	22320326	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr16:22320326C>T	ENST00000299853.5	+	5	413	c.246C>T	c.(244-246)gaC>gaT	p.D82D	POLR3E_ENST00000564256.1_3'UTR|POLR3E_ENST00000359210.4_Silent_p.D82D|POLR3E_ENST00000418581.2_Silent_p.D46D|POLR3E_ENST00000564209.1_Silent_p.D82D	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	82					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.D82D(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		TGAACGTGGACGGGGCCTGCG	0.607																																					p.D82D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C246T	16						.						127.0	99.0	108.0					16																	22320326		2197	4300	6497	22227827	SO:0001819	synonymous_variant	55718	exon5			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.246C>T	16.37:g.22320326C>T			22227827	NM_018119	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Silent	SNP	ENST00000299853.5	37	CCDS10605.1																																																																																				0.607	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
MPG	4350	broad.mit.edu	37	16	136808	136808	+	IGR	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr16:136808G>A	ENST00000219431.4	+	0	1193				NPRL3_ENST00000405960.3_5'UTR|NPRL3_ENST00000399951.3_Missense_Mutation_p.R356W|NPRL3_ENST00000399953.3_Missense_Mutation_p.R535W	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)	p.R535W(2)		endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				TGGGAGCGCCGCGTGTTCTCG	0.612								Base excision repair (BER), DNA glycosylases																													p.R535R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1605T	16						.						52.0	61.0	58.0					16																	136808		2128	4242	6370	76808	SO:0001628	intergenic_variant	8131	exon14				CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887		16.37:g.136808G>A			76808	NM_001077350	G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	Missense_Mutation	SNP	ENST00000219431.4	37	CCDS32346.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124504	0.77436	.	.	ENSG00000103148	ENST00000399953;ENST00000262313;ENST00000399951	.	.	.	5.36	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.78648	0.4316	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.80721	-0.1256	8	0.72032	D	0.01	-34.0231	13.6575	0.62346	0.0:0.0:0.7179:0.2821	.	536	Q12980	NPRL3_HUMAN	W	535;510;356	.	ENSP00000262313:R510W	R	-	1	2	NPRL3	76808	1.000000	0.71417	0.606000	0.28943	0.856000	0.48823	5.329000	0.65892	0.605000	0.29947	0.462000	0.41574	CGG		0.612	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109121.4		
GRIN2A	2903	broad.mit.edu	37	16	9858646	9858646	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr16:9858646T>C	ENST00000396573.2	-	14	3064	c.2755A>G	c.(2755-2757)Aaa>Gaa	p.K919E	GRIN2A_ENST00000404927.2_Missense_Mutation_p.K919E|GRIN2A_ENST00000535259.1_Missense_Mutation_p.K762E|GRIN2A_ENST00000330684.3_Missense_Mutation_p.K919E|GRIN2A_ENST00000396575.2_Missense_Mutation_p.K919E|GRIN2A_ENST00000562109.1_Missense_Mutation_p.K919E	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	919					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.K919E(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCAGCTCTTTTGGGTGAGTCC	0.463																																					p.K919E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2755G	16						.						218.0	191.0	200.0					16																	9858646		2197	4300	6497	9766147	SO:0001583	missense	2903	exon13				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2755A>G	16.37:g.9858646T>C	ENSP00000379818:p.Lys919Glu		9766147	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639041	0.67130	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56	5.52	5.52	0.82312	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.084250	0.85682	D	0.000000	T	0.37544	0.1007	M	0.74881	2.28	0.58432	D	0.999999	P;P;D	0.69078	0.767;0.804;0.997	P;P;D	0.79108	0.661;0.771;0.992	T	0.10222	-1.0639	9	.	.	.	.	14.8577	0.70351	0.0:0.0:0.0:1.0	.	762;919;919	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	E	919;919;762;919;919	ENSP00000379818:K919E;ENSP00000385872:K919E;ENSP00000441572:K762E;ENSP00000332549:K919E;ENSP00000379820:K919E	.	K	-	1	0	GRIN2A	9766147	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.836000	0.55813	2.099000	0.63709	0.533000	0.62120	AAA		0.463	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
FTO	79068	broad.mit.edu	37	16	53859942	53859942	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr16:53859942T>G	ENST00000471389.1	+	3	512	c.290T>G	c.(289-291)aTc>aGc	p.I97S	FTO_ENST00000394647.3_Intron	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	97	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)	p.I97S(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GTATCTCGCATCCTCATTGGT	0.507																																					p.I97S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T290G	16						.						96.0	86.0	90.0					16																	53859942		2198	4300	6498	52417443	SO:0001583	missense	79068	exon3			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.290T>G	16.37:g.53859942T>G	ENSP00000418823:p.Ile97Ser		52417443	NM_001080432	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	ENST00000471389.1	37	CCDS32448.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.209616	0.79240	.	.	ENSG00000140718	ENST00000471389	T	0.77877	-1.13	5.46	5.46	0.80206	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	0.255145	0.45606	D	0.000360	T	0.81113	0.4755	L	0.50333	1.59	0.80722	D	1	P	0.43633	0.813	P	0.51135	0.66	T	0.82872	-0.0242	10	0.66056	D	0.02	-8.565	15.5287	0.75932	0.0:0.0:0.0:1.0	.	97	Q9C0B1	FTO_HUMAN	S	97	ENSP00000418823:I97S	ENSP00000418823:I97S	I	+	2	0	FTO	52417443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.340000	0.65958	2.071000	0.62044	0.528000	0.53228	ATC		0.507	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432	
MLLT6	4302	broad.mit.edu	37	17	36865798	36865798	+	Silent	SNP	C	C	T	rs186310825	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:36865798C>T	ENST00000325718.7	+	6	613	c.522C>T	c.(520-522)tgC>tgT	p.C174C	MLLT6_ENST00000378137.5_Silent_p.C174C	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	174					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.C174C(1)		breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					TCAAGTACTGCGGCTACTGCA	0.567			T	MLL	AL								C|||	4	0.000798722	0.0	0.0	5008	,	,		20694	0.003		0.001	False		,,,				2504	0.0				p.C174C			Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C522T	17						.						150.0	105.0	120.0					17																	36865798		2203	4300	6503	34119324	SO:0001819	synonymous_variant	4302	exon6				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.522C>T	17.37:g.36865798C>T			34119324	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Silent	SNP	ENST00000325718.7	37	CCDS11327.1																																																																																				0.567	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
GSDMB	55876	broad.mit.edu	37	17	38066125	38066125	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:38066125T>C	ENST00000394179.1	-	4	590	c.460A>G	c.(460-462)Aac>Gac	p.N154D	GSDMB_ENST00000309481.7_Missense_Mutation_p.N154D|GSDMB_ENST00000520542.1_Missense_Mutation_p.N154D|GSDMB_ENST00000418519.1_Missense_Mutation_p.N154D|GSDMB_ENST00000394175.2_Missense_Mutation_p.N154D|GSDMB_ENST00000360317.3_Missense_Mutation_p.N154D			Q8TAX9	GSDMB_HUMAN	gasdermin B	154						cytoplasm (GO:0005737)		p.N154D(2)		breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						AGATACAGGTTTTCTCTCGTA	0.468																																					p.N154D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A460G	17						.						105.0	108.0	107.0					17																	38066125		2203	4300	6503	35319651	SO:0001583	missense	55876	exon4			AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.460A>G	17.37:g.38066125T>C	ENSP00000377733:p.Asn154Asp		35319651	NM_001042471	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Missense_Mutation	SNP	ENST00000394179.1	37		.	.	.	.	.	.	.	.	.	.	T	7.924	0.739173	0.15642	.	.	ENSG00000073605	ENST00000360317;ENST00000394175;ENST00000309481;ENST00000520542;ENST00000418519;ENST00000394179	T;T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76;1.76	3.58	-5.44	0.02624	.	1.170170	0.06404	N	0.719346	T	0.16981	0.0408	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.21071	0.051;0.002;0.001;0.001	B;B;B;B	0.23716	0.048;0.001;0.002;0.001	T	0.34004	-0.9846	10	0.31617	T	0.26	.	6.1312	0.20207	0.0:0.211:0.1888:0.6002	.	154;154;154;154	B4DKK7;Q8TAX9-4;Q8TAX9-3;Q8TAX9-2	.;.;.;.	D	154	ENSP00000353465:N154D;ENSP00000377729:N154D;ENSP00000312584:N154D;ENSP00000430157:N154D;ENSP00000415049:N154D;ENSP00000377733:N154D	ENSP00000312584:N154D	N	-	1	0	GSDMB	35319651	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.894000	0.04123	-0.969000	0.03573	-0.509000	0.04479	AAC		0.468	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530	
NLRP1	22861	broad.mit.edu	37	17	5462645	5462645	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:5462645C>T	ENST00000572272.1	-	4	1370	c.1371G>A	c.(1369-1371)acG>acA	p.T457T	NLRP1_ENST00000269280.4_Silent_p.T457T|NLRP1_ENST00000262467.5_Silent_p.T457T|NLRP1_ENST00000354411.3_Silent_p.T457T|NLRP1_ENST00000345221.3_Silent_p.T457T|NLRP1_ENST00000577119.1_Silent_p.T457T|NLRP1_ENST00000571307.1_5'UTR			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	457	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.T457T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TGGTCCGAGCCGTGATCAGGA	0.567																																					p.T457T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1371A	17						.						41.0	42.0	42.0					17																	5462645		2203	4300	6503	5403369	SO:0001819	synonymous_variant	22861	exon4			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1371G>A	17.37:g.5462645C>T			5403369	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	ENST00000572272.1	37	CCDS42246.1																																																																																				0.567	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
KRT33A	3883	broad.mit.edu	37	17	39502469	39502469	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:39502469C>T	ENST00000007735.3	-	7	1161	c.1117G>A	c.(1117-1119)Gcc>Acc	p.A373T		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	373	Tail.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A373T(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				TTGGTTGTGGCGCAGGGGTTG	0.498																																					p.A373T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1117A	17						.						100.0	95.0	97.0					17																	39502469		2203	4300	6503	36755995	SO:0001583	missense	3883	exon7			Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.1117G>A	17.37:g.39502469C>T	ENSP00000007735:p.Ala373Thr		36755995	NM_004138	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	37	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	8.437	0.850066	0.17034	.	.	ENSG00000006059	ENST00000007735	D	0.82433	-1.61	4.97	4.0	0.46444	.	0.105451	0.42294	N	0.000725	T	0.78947	0.4364	L	0.61387	1.9	0.30689	N	0.751489	B	0.13594	0.008	B	0.13407	0.009	T	0.75414	-0.3326	10	0.45353	T	0.12	.	9.5871	0.39524	0.0:0.9022:0.0:0.0978	.	373	O76009	KT33A_HUMAN	T	373	ENSP00000007735:A373T	ENSP00000007735:A373T	A	-	1	0	KRT33A	36755995	0.939000	0.31865	0.995000	0.50966	0.009000	0.06853	0.588000	0.23924	1.234000	0.43709	-0.142000	0.14014	GCC		0.498	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
CEP112	201134	broad.mit.edu	37	17	63923768	63923768	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:63923768G>C	ENST00000392769.2	-	19	2130	c.1912C>G	c.(1912-1914)Ctt>Gtt	p.L638V	CEP112_ENST00000537949.1_Missense_Mutation_p.L596V|CEP112_ENST00000541355.1_Missense_Mutation_p.L273V|CEP112_ENST00000535342.2_Missense_Mutation_p.L638V	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	638					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)		p.L638V(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						TTCTCACGAAGAGATTTGGAT	0.328																																					p.L638V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1912G	17						.						108.0	101.0	103.0					17																	63923768		2203	4300	6503	61354230	SO:0001583	missense	201134	exon19			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1912C>G	17.37:g.63923768G>C	ENSP00000376522:p.Leu638Val		61354230	NM_001199165	Q6PIB5|Q8NCR4|Q8NFR4	Missense_Mutation	SNP	ENST00000392769.2	37	CCDS32710.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478176	0.44044	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000541355;ENST00000537949	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000002	T	0.58963	0.2159	L	0.59436	1.845	0.38392	D	0.945429	D;D;D	0.67145	0.996;0.996;0.996	D;D;D	0.80764	0.994;0.986;0.994	T	0.57277	-0.7839	10	0.27785	T	0.31	-7.2961	15.4349	0.75137	0.0:0.0:1.0:0.0	.	596;596;638	F5GYE8;A2RRR7;Q8N8E3	.;.;CE112_HUMAN	V	638;638;273;596	ENSP00000442784:L638V;ENSP00000376522:L638V;ENSP00000443711:L273V;ENSP00000440775:L596V	ENSP00000376522:L638V	L	-	1	0	CEP112	61354230	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.002000	0.76304	2.446000	0.82766	0.650000	0.86243	CTT		0.328	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446582.1	NM_145036	
TP53	7157	broad.mit.edu	37	17	7578508	7578508	+	Missense_Mutation	SNP	C	C	T	rs587781288		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:7578508C>T	ENST00000269305.4	-	5	611	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	TP53_ENST00000445888.2_Missense_Mutation_p.C141Y|TP53_ENST00000359597.4_Missense_Mutation_p.C141Y|TP53_ENST00000455263.2_Missense_Mutation_p.C141Y|TP53_ENST00000413465.2_Missense_Mutation_p.C141Y|TP53_ENST00000420246.2_Missense_Mutation_p.C141Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCACAGGGCAGGTCTTGGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C141Y	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	121	Substitution - Missense(99)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Complex - deletion inframe(1)	large_intestine(23)|breast(17)|ovary(12)|haematopoietic_and_lymphoid_tissue(7)|oesophagus(7)|liver(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|endometrium(6)|urinary_tract(6)|lung(5)|prostate(5)|bone(5)|stomach(4)|soft_tissue(2)|biliary_tract(1)|testis(1)|pancreas(1)	c.G422A	17	GRCh37	CM993216	TP53	M		.						56.0	55.0	55.0					17																	7578508		2203	4300	6503	7519233	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.422G>A	17.37:g.7578508C>T	ENSP00000269305:p.Cys141Tyr		7519233	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720132	0.48728	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.48	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99832	0.9924	M	0.90309	3.105	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.987;1.0;0.999;1.0;1.0	D	0.96735	0.9542	10	0.87932	D	0	-26.1094	13.743	0.62860	0.1552:0.8448:0.0:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141Y;ENSP00000352610:C141Y;ENSP00000269305:C141Y;ENSP00000398846:C141Y;ENSP00000391127:C141Y;ENSP00000391478:C141Y;ENSP00000425104:C9Y;ENSP00000423862:C48Y;ENSP00000424104:C141Y	ENSP00000269305:C141Y	C	-	2	0	TP53	7519233	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.016000	0.70798	1.427000	0.47276	-0.182000	0.12963	TGC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CDR2L	30850	broad.mit.edu	37	17	72998269	72998269	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr17:72998269G>A	ENST00000337231.5	+	4	864	c.452G>A	c.(451-453)cGc>cAc	p.R151H		NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like	151								p.R145H(1)				all_lung(278;0.226)					AAGCGGGAACGCAGGCGTACC	0.642																																					p.R151H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G452A	17						.						67.0	48.0	55.0					17																	72998269		2203	4299	6502	70509864	SO:0001583	missense	30850	exon4				CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.452G>A	17.37:g.72998269G>A	ENSP00000336587:p.Arg151His		70509864	NM_014603	B4DFA7|Q15175	Missense_Mutation	SNP	ENST00000337231.5	37	CCDS11710.2	.	.	.	.	.	.	.	.	.	.	G	36	5.663332	0.96745	.	.	ENSG00000109089	ENST00000337231	T	0.50001	0.76	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74009	-0.3802	10	0.62326	D	0.03	-24.4178	19.155	0.93506	0.0:0.0:1.0:0.0	.	151	Q86X02	CDR2L_HUMAN	H	151	ENSP00000336587:R151H	ENSP00000336587:R151H	R	+	2	0	CDR2L	70509864	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.867000	0.87062	2.609000	0.88269	0.563000	0.77884	CGC		0.642	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318080.1	NM_014603	
ZNF521	25925	broad.mit.edu	37	18	22902055	22902055	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr18:22902055A>T	ENST00000361524.3	-	3	285	c.137T>A	c.(136-138)gTg>gAg	p.V46E	ZNF521_ENST00000584787.1_5'UTR|ZNF521_ENST00000538137.2_Missense_Mutation_p.V46E|ZNF521_ENST00000579111.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	46					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.V46E(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					ACAGCTGTGCACAGCTTCGTC	0.463			T	PAX5	ALL																																p.V46E			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T137A	18						.						155.0	142.0	146.0					18																	22902055		2203	4300	6503	21156053	SO:0001583	missense	25925	exon3			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.137T>A	18.37:g.22902055A>T	ENSP00000354794:p.Val46Glu		21156053	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545334	0.45280	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.35421	1.31;1.31	5.91	4.76	0.60689	.	0.194511	0.34338	N	0.004055	T	0.22244	0.0536	N	0.14661	0.345	0.39504	D	0.968248	B	0.25390	0.125	B	0.27715	0.082	T	0.07712	-1.0758	10	0.29301	T	0.29	-19.4311	10.4293	0.44398	0.9268:0.0:0.0732:0.0	.	46	Q96K83	ZN521_HUMAN	E	46;80;46	ENSP00000354794:V46E;ENSP00000382352:V46E	ENSP00000354794:V46E	V	-	2	0	ZNF521	21156053	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.455000	0.66658	1.070000	0.40811	0.533000	0.62120	GTG		0.463	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
POLI	11201	broad.mit.edu	37	18	51820334	51820334	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr18:51820334A>G	ENST00000579534.1	+	10	1863	c.1720A>G	c.(1720-1722)Aaa>Gaa	p.K574E	POLI_ENST00000579434.1_Missense_Mutation_p.K471E|POLI_ENST00000406285.3_Missense_Mutation_p.K495E|POLI_ENST00000217800.5_Missense_Mutation_p.K448E	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	574					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.K549E(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		TTTCTTTTCTAAAAAACAAAT	0.373								DNA polymerases (catalytic subunits)																													p.K574E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1720G	18						.						49.0	49.0	49.0					18																	51820334		2203	4300	6503	50074332	SO:0001583	missense	11201	exon10				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.1720A>G	18.37:g.51820334A>G	ENSP00000462664:p.Lys574Glu		50074332	NM_007195	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	.	.	.	.	.	.	.	.	.	.	A	8.278	0.814946	0.16607	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.44083	0.93	5.51	-1.51	0.08664	.	0.782132	0.11976	N	0.511268	T	0.14399	0.0348	N	0.08118	0	0.22066	N	0.999389	B;B	0.15473	0.013;0.013	B;B	0.09377	0.004;0.004	T	0.30650	-0.9971	10	0.02654	T	1	-3.6867	3.6805	0.08309	0.4338:0.3698:0.0761:0.1203	.	494;574	B7Z780;Q9UNA4	.;POLI_HUMAN	E	495;574	ENSP00000385196:K495E	ENSP00000217800:K574E	K	+	1	0	POLI	50074332	0.006000	0.16342	0.988000	0.46212	0.470000	0.32858	-0.072000	0.11486	0.101000	0.17610	-0.316000	0.08728	AAA		0.373	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195	
LRRC8E	80131	broad.mit.edu	37	19	7964762	7964763	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:7964762_7964763insC	ENST00000306708.6	+	3	1456_1457	c.1355_1356insC	c.(1354-1359)ttccccfs	p.FP452fs	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_Frame_Shift_Ins_p.K169fs	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	452					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P454fs*33(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						GATATCACCTTCCCCCCGGGGC	0.644																																					p.F452fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1355_1356insC	19						.																																			7870763	SO:0001589	frameshift_variant	80131	exon3				CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.1361dupC	19.37:g.7964768_7964768dupC	ENSP00000306524:p.Phe452fs		7870762	NM_025061	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Frame_Shift_Ins	INS	ENST00000306708.6	37	CCDS12189.1																																																																																				0.644	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
OR7C1	26664	broad.mit.edu	37	19	14910360	14910360	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:14910360C>T	ENST00000248073.2	-	1	663	c.589G>A	c.(589-591)Gtg>Atg	p.V197M	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	197					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V197M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						TATATCACCACGTTATTAATG	0.398																																					p.V197M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G589A	19						.						83.0	83.0	83.0					19																	14910360		2203	4300	6503	14771360	SO:0001583	missense	26664	exon1			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.589G>A	19.37:g.14910360C>T	ENSP00000248073:p.Val197Met		14771360	NM_198944	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	ENST00000248073.2	37	CCDS12317.1	.	.	.	.	.	.	.	.	.	.	c	2.715	-0.267897	0.05754	.	.	ENSG00000127530	ENST00000248073	T	0.00193	8.58	3.64	-4.51	0.03483	GPCR, rhodopsin-like superfamily (1);	1.061000	0.07618	N	0.926577	T	0.00073	0.0002	N	0.03268	-0.37	0.09310	N	1	P	0.37398	0.593	B	0.32677	0.15	T	0.12502	-1.0545	10	0.13108	T	0.6	.	6.1732	0.20429	0.0:0.3883:0.2586:0.353	.	197	O76099	OR7C1_HUMAN	M	197	ENSP00000248073:V197M	ENSP00000248073:V197M	V	-	1	0	OR7C1	14771360	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.069000	0.00619	-0.999000	0.03442	-1.382000	0.01172	GTG		0.398	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
CPAMD8	27151	broad.mit.edu	37	19	17108100	17108100	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:17108100C>A	ENST00000443236.1	-	11	1088	c.1057G>T	c.(1057-1059)Gcg>Tcg	p.A353S	CPAMD8_ENST00000388925.4_Missense_Mutation_p.A306S	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	306						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A353S(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGGACGTCCGCTGGGATCATG	0.627																																					p.A353S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1057T	19						.						13.0	15.0	14.0					19																	17108100		1953	4138	6091	16969100	SO:0001583	missense	27151	exon11			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1057G>T	19.37:g.17108100C>A	ENSP00000402505:p.Ala353Ser		16969100	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.155|0.155	-1.087207|-1.087207	0.01873|0.01873	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440;ENST00000388925|ENST00000443236	T;T|.	0.52526|.	0.66;0.67|.	3.0|3.0	1.94|1.94	0.25998|0.25998	.|.	0.974000|.	0.08331|.	U|.	0.962367|.	T|T	0.33411|0.33411	0.0862|0.0862	L|L	0.31578|0.31578	0.945|0.945	0.09310|0.09310	N|N	1|1	B|.	0.15141|.	0.012|.	B|.	0.10450|.	0.005|.	T|T	0.22661|0.22661	-1.0210|-1.0210	10|5	0.09590|.	T|.	0.72|.	.|.	9.986|9.986	0.41841|0.41841	0.0:0.8959:0.0:0.1041|0.0:0.8959:0.0:0.1041	.|.	306|.	Q8IZJ3|.	CPMD8_HUMAN|.	S|H	353;306|363	ENSP00000291440:A353S;ENSP00000373577:A306S|.	ENSP00000291440:A353S|.	A|Q	-|-	1|3	0|2	CPAMD8|CPAMD8	16969100|16969100	0.090000|0.090000	0.21635|0.21635	0.023000|0.023000	0.16930|0.16930	0.328000|0.328000	0.28507|0.28507	1.194000|1.194000	0.32174|0.32174	0.397000|0.397000	0.25310|0.25310	0.555000|0.555000	0.69702|0.69702	GCG|CAG		0.627	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
TMEM190	147744	broad.mit.edu	37	19	55889216	55889216	+	Silent	SNP	C	C	T	rs571214407		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:55889216C>T	ENST00000291934.3	+	4	285	c.267C>T	c.(265-267)agC>agT	p.S89S	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	89					hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.S89S(1)		large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGACGTGCAGCGGCCTCCTCC	0.697													C|||	1	0.000199681	0.0	0.0	5008	,	,		15266	0.0		0.0	False		,,,				2504	0.001				p.S89S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C267T	19						.						48.0	51.0	50.0					19																	55889216		2203	4300	6503	60581028	SO:0001819	synonymous_variant	147744	exon4			AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.267C>T	19.37:g.55889216C>T			60581028	NM_139172	A6NJL5	Silent	SNP	ENST00000291934.3	37	CCDS33113.1																																																																																				0.697	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453042.1	NM_139172	
KMT2B	9757	broad.mit.edu	37	19	36211573	36211573	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:36211573delC	ENST00000222270.7	+	3	1324	c.1324delC	c.(1324-1326)ccafs	p.P442fs	KMT2B_ENST00000341701.1_Frame_Shift_Del_p.P442fs|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Frame_Shift_Del_p.P442fs	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	442	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										accacctctaccatcccctcc	0.677																																					p.P442fs												.	.	0			c.1324delC	19						.						4.0	4.0	4.0					19																	36211573		1465	3228	4693	40903413	SO:0001589	frameshift_variant	9757	exon3			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1324delC	19.37:g.36211573delC	ENSP00000222270:p.Pro442fs		40903413	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Frame_Shift_Del	DEL	ENST00000222270.7	37	CCDS46055.1																																																																																				0.677	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
ZNF419	79744	broad.mit.edu	37	19	58002957	58002957	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr19:58002957C>T	ENST00000221735.7	+	3	377	c.191C>T	c.(190-192)gCc>gTc	p.A64V	ZNF419_ENST00000354197.4_Missense_Mutation_p.A52V|ZNF419_ENST00000347466.6_Missense_Mutation_p.A65V|ZNF419_ENST00000415379.2_Missense_Mutation_p.A51V|ZNF419_ENST00000520540.1_Missense_Mutation_p.A52V|ZNF419_ENST00000518999.1_Missense_Mutation_p.A65V|ZNF419_ENST00000424930.2_Missense_Mutation_p.A65V|ZNF419_ENST00000442920.2_Missense_Mutation_p.A51V|AC003005.4_ENST00000601674.1_Missense_Mutation_p.A51V|ZNF419_ENST00000426954.2_Missense_Mutation_p.A52V			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A65V(1)|p.A44V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		ACACTTCTGGCCTCTCTGGGT	0.537																																					p.A65V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C194T	19						.						72.0	74.0	73.0					19																	58002957		2203	4298	6501	62694769	SO:0001583	missense	79744	exon3			AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.191C>T	19.37:g.58002957C>T	ENSP00000221735:p.Ala64Val		62694769	NM_001098494	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	37	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804405	0.50315	.	.	ENSG00000105136	ENST00000284020;ENST00000524372;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000427558;ENST00000523882;ENST00000520540;ENST00000519310;ENST00000442920;ENST00000523312;ENST00000517598;ENST00000347466;ENST00000523138;ENST00000415379;ENST00000521754;ENST00000221735;ENST00000518999;ENST00000521137	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.25085	4.97;4.97;4.97;4.97;4.97;1.82;4.97;4.97;4.97;4.97;4.97;4.97;4.97;4.97;4.97	2.79	-0.774	0.10991	Krueppel-associated box (4);	.	.	.	.	T	0.22975	0.0555	N	0.20445	0.575	0.09310	N	1	D;B;D;D;B;D;D	0.76494	0.997;0.206;0.999;0.997;0.372;0.998;0.997	D;B;D;D;B;D;D	0.83275	0.983;0.037;0.996;0.983;0.274;0.994;0.983	T	0.22487	-1.0215	9	0.07990	T	0.79	.	2.182	0.03877	0.2508:0.4414:0.0:0.3078	.	51;51;51;52;65;65;64	E9PFX9;B4DXU7;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;.;ZN419_HUMAN	V	44;52;65;52;52;64;65;52;9;51;51;65;65;64;51;52;64;65;64	ENSP00000388864:A65V;ENSP00000390916:A52V;ENSP00000346136:A52V;ENSP00000428181:A65V;ENSP00000429471:A52V;ENSP00000429880:A9V;ENSP00000414709:A51V;ENSP00000428515:A51V;ENSP00000299860:A65V;ENSP00000429504:A64V;ENSP00000392129:A51V;ENSP00000428523:A52V;ENSP00000221735:A64V;ENSP00000427723:A65V;ENSP00000429628:A64V	ENSP00000221735:A64V	A	+	2	0	ZNF419	62694769	0.000000	0.05858	0.002000	0.10522	0.293000	0.27360	-0.665000	0.05286	0.035000	0.15519	0.511000	0.50034	GCC		0.537	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
DFFA	1676	broad.mit.edu	37	1	10527253	10527253	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:10527253G>T	ENST00000377038.3	-	3	502	c.435C>A	c.(433-435)gaC>gaA	p.D145E	DFFA_ENST00000377036.2_Missense_Mutation_p.D145E	NM_004401.2	NP_004392.1	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha polypeptide	145					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|negative regulation of apoptotic DNA fragmentation (GO:1902511)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of apoptotic process (GO:0043065)|thymocyte apoptotic process (GO:0070242)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D145E(2)		large_intestine(3)|lung(2)	5	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		TTACCTGGAGGTCCTCCTCTG	0.527																																					p.D145E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C435A	1						.						137.0	130.0	132.0					1																	10527253		2203	4300	6503	10449840	SO:0001583	missense	1676	exon3			AF087573	CCDS118.1, CCDS119.1	1p36.3-p36.2	2008-07-18	2002-08-29		ENSG00000160049	ENSG00000160049			2772	protein-coding gene	gene with protein product	"""DNA fragmentation factor, 45 kD, alpha subunit"""	601882	"""DNA fragmentation factor, 45 kD, alpha polypeptide"""			9605855, 9108473	Standard	NM_004401		Approved	DFF-45, DFF45, ICAD, DFF1	uc001arj.3	O00273	OTTHUMG00000001909	ENST00000377038.3:c.435C>A	1.37:g.10527253G>T	ENSP00000366237:p.Asp145Glu		10449840	NM_004401	Q5T6G5|Q5T6G6|Q96I97|Q9Y6C6	Missense_Mutation	SNP	ENST00000377038.3	37	CCDS118.1	.	.	.	.	.	.	.	.	.	.	G	5.732	0.319455	0.10845	.	.	ENSG00000160049	ENST00000377038;ENST00000377036	.	.	.	5.68	1.1	0.20463	DNA fragmentation factor 45kDa, C-terminal (2);	0.181714	0.56097	N	0.000022	T	0.25269	0.0614	N	0.19112	0.55	0.35048	D	0.760325	B;B	0.25169	0.119;0.117	B;B	0.29524	0.036;0.103	T	0.08166	-1.0735	9	0.25751	T	0.34	-5.5319	2.0098	0.03485	0.211:0.264:0.3908:0.1342	.	145;145	O00273-2;O00273	.;DFFA_HUMAN	E	145	.	ENSP00000366235:D145E	D	-	3	2	DFFA	10449840	0.985000	0.35326	0.992000	0.48379	0.070000	0.16714	0.090000	0.15025	0.323000	0.23307	0.650000	0.86243	GAC		0.527	DFFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005418.1	NM_004401	
FLG	2312	broad.mit.edu	37	1	152285790	152285790	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:152285790T>A	ENST00000368799.1	-	3	1607	c.1572A>T	c.(1570-1572)agA>agT	p.R524S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	524	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R524S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTTCCTCCTCTGCTTGACC	0.587									Ichthyosis																												p.R524S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1572T	1						.						365.0	362.0	363.0					1																	152285790		2203	4300	6503	150552414	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1572A>T	1.37:g.152285790T>A	ENSP00000357789:p.Arg524Ser		150552414	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	8.338	0.828109	0.16749	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04234	3.67	3.19	-6.38	0.01957	.	.	.	.	.	T	0.00845	0.0028	L	0.41824	1.3	0.09310	N	1	P	0.37276	0.589	B	0.39379	0.298	T	0.40683	-0.9550	9	0.08381	T	0.77	.	1.5263	0.02526	0.15:0.3012:0.3457:0.2031	.	524	P20930	FILA_HUMAN	S	524;56	ENSP00000357789:R524S	ENSP00000357789:R524S	R	-	3	2	FLG	150552414	.	.	0.000000	0.03702	0.013000	0.08279	.	.	-1.586000	0.01632	0.491000	0.48974	AGA		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SPTA1	6708	broad.mit.edu	37	1	158604454	158604454	+	Missense_Mutation	SNP	A	A	C	rs367644017		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:158604454A>C	ENST00000368147.4	-	39	5624	c.5444T>G	c.(5443-5445)tTg>tGg	p.L1815W		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1815					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L1815W(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGATTCTTCCAACTTAAGTCC	0.463																																					p.L1815W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5444G	1						.						113.0	103.0	106.0					1																	158604454		1947	4136	6083	156871078	SO:0001583	missense	6708	exon39			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5444T>G	1.37:g.158604454A>C	ENSP00000357129:p.Leu1815Trp		156871078	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498531	0.85069	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	D;T	0.83591	-1.74;-1.43	5.64	5.64	0.86602	.	0.000000	0.26983	N	0.021513	D	0.92103	0.7497	M	0.93978	3.48	0.37129	D	0.901154	D	0.89917	1.0	D	0.97110	1.0	D	0.94317	0.7550	10	0.87932	D	0	.	13.8576	0.63537	1.0:0.0:0.0:0.0	.	1815	P02549	SPTA1_HUMAN	W	1815	ENSP00000357130:L1815W;ENSP00000357129:L1815W	ENSP00000357129:L1815W	L	-	2	0	SPTA1	156871078	1.000000	0.71417	0.041000	0.18516	0.472000	0.32918	7.066000	0.76734	2.367000	0.80283	0.528000	0.53228	TTG		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
ATP1A4	480	broad.mit.edu	37	1	160147442	160147442	+	Silent	SNP	C	C	T	rs555177353		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:160147442C>T	ENST00000368081.4	+	18	3195	c.2724C>T	c.(2722-2724)taC>taT	p.Y908Y	ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_Silent_p.Y44Y	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	908					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.Y908Y(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGGACAGCTACGGACAGCAGT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20490	0.0		0.001	False		,,,				2504	0.0				p.Y908Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2724T	1						.						113.0	108.0	109.0					1																	160147442		2203	4300	6503	158414066	SO:0001819	synonymous_variant	480	exon18			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2724C>T	1.37:g.160147442C>T			158414066	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	CCDS1197.1																																																																																				0.483	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
EMC1	23065	broad.mit.edu	37	1	19563664	19563664	+	Silent	SNP	A	A	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:19563664A>G	ENST00000477853.1	-	12	1323	c.1281T>C	c.(1279-1281)gaT>gaC	p.D427D	EMC1_ENST00000375199.3_Silent_p.D426D|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Silent_p.D405D	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	427						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.D427D(1)									GTAGCAGATGATCCTCTGTCT	0.463																																					p.D427D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1281C	1						.						198.0	192.0	194.0					1																	19563664		2203	4300	6503	19436251	SO:0001819	synonymous_variant	23065	exon12				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1281T>C	1.37:g.19563664A>G			19436251	NM_015047	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Silent	SNP	ENST00000477853.1	37	CCDS190.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.251888	0.22880	.	.	ENSG00000127463	ENST00000375197	.	.	.	5.92	-3.06	0.05379	.	.	.	.	.	T	0.66406	0.2786	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66736	-0.5848	4	.	.	.	.	16.2387	0.82394	0.1429:0.0:0.8571:0.0	.	.	.	.	P	161	.	.	S	-	1	0	KIAA0090	19436251	0.998000	0.40836	0.946000	0.38457	0.973000	0.67179	0.354000	0.20146	-0.473000	0.06871	-0.256000	0.11100	TCA		0.463	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
DARS2	55157	broad.mit.edu	37	1	173806174	173806174	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:173806174G>A	ENST00000361951.4	+	8	1487	c.760G>A	c.(760-762)Ggt>Agt	p.G254S	DARS2_ENST00000239457.5_5'UTR	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	254					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.G254S(1)		breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	GATGGTTGGCGGTTTAGACAG	0.403																																					p.G254S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760A	1						.						130.0	146.0	141.0					1																	173806174		2203	4300	6503	172072797	SO:0001583	missense	55157	exon8			AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.760G>A	1.37:g.173806174G>A	ENSP00000355086:p.Gly254Ser		172072797	NM_018122		Missense_Mutation	SNP	ENST00000361951.4	37	CCDS1311.1	.	.	.	.	.	.	.	.	.	.	G	32	5.165756	0.94768	.	.	ENSG00000117593	ENST00000361951	D	0.88975	-2.45	5.21	5.21	0.72293	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.96642	0.9475	10	0.87932	D	0	-9.221	17.5262	0.87801	0.0:0.0:1.0:0.0	.	254	Q6PI48	SYDM_HUMAN	S	254	ENSP00000355086:G254S	ENSP00000355086:G254S	G	+	1	0	DARS2	172072797	1.000000	0.71417	0.978000	0.43139	0.957000	0.61999	9.355000	0.97087	2.430000	0.82344	0.655000	0.94253	GGT		0.403	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084220.1	NM_018122	
NFASC	23114	broad.mit.edu	37	1	204950995	204950995	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:204950995C>T	ENST00000401399.1	+	20	2516	c.2317C>T	c.(2317-2319)Cga>Tga	p.R773*	NFASC_ENST00000513543.1_Nonsense_Mutation_p.R769*|NFASC_ENST00000338515.6_Nonsense_Mutation_p.R773*|NFASC_ENST00000339876.6_Nonsense_Mutation_p.R773*|NFASC_ENST00000404907.1_Nonsense_Mutation_p.R769*|NFASC_ENST00000539706.1_Nonsense_Mutation_p.R769*|NFASC_ENST00000404076.1_Nonsense_Mutation_p.R752*|NFASC_ENST00000367170.4_Nonsense_Mutation_p.R773*|NFASC_ENST00000367172.4_Nonsense_Mutation_p.R773*|NFASC_ENST00000360049.4_Nonsense_Mutation_p.R769*|NFASC_ENST00000367171.4_Nonsense_Mutation_p.R758*|NFASC_ENST00000338586.6_Nonsense_Mutation_p.R773*|NFASC_ENST00000367169.4_Nonsense_Mutation_p.R773*			O94856	NFASC_HUMAN	neurofascin	773	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.R769*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GAGAGAGACTCGAGAGGCCTG	0.607																																					p.R784X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2350T	1						.						87.0	74.0	78.0					1																	204950995		2203	4300	6503	203217618	SO:0001587	stop_gained	23114	exon19			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2317C>T	1.37:g.204950995C>T	ENSP00000385637:p.Arg773*		203217618	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Nonsense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	45	11.901069	0.99615	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.	.	.	5.55	4.56	0.56223	.	0.000000	0.43919	D	0.000508	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	12.4199	0.55514	0.1358:0.7459:0.1183:0.0	.	.	.	.	X	773;758;773;773;773;773;784;769;769;773;752;773;769;769;760	.	ENSP00000295776:R784X	R	+	1	2	NFASC	203217618	0.986000	0.35501	0.980000	0.43619	0.980000	0.70556	2.420000	0.44679	2.614000	0.88457	0.563000	0.77884	CGA		0.607	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
SLC26A9	115019	broad.mit.edu	37	1	205904885	205904885	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:205904885C>T	ENST00000367135.3	-	2	177	c.64G>A	c.(64-66)Gat>Aat	p.D22N	RP4-681L3.2_ENST00000421166.1_RNA|SLC26A9_ENST00000340781.4_Missense_Mutation_p.D22N|SLC26A9_ENST00000367134.2_Missense_Mutation_p.D22N	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	22					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.D22N(1)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TCAAACTCATCGTCGAAGAGG	0.552																																					p.D22N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G64A	1						.						208.0	183.0	192.0					1																	205904885		2203	4300	6503	204171508	SO:0001583	missense	115019	exon2			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.64G>A	1.37:g.205904885C>T	ENSP00000356103:p.Asp22Asn		204171508	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.477863	0.63849	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92545	-3.06;-3.02;-3.06	5.21	4.28	0.50868	.	0.344623	0.29178	N	0.012903	D	0.84488	0.5483	N	0.22421	0.69	0.34436	D	0.699057	B;P	0.35551	0.031;0.509	B;B	0.20184	0.01;0.028	D	0.87617	0.2507	10	0.62326	D	0.03	.	15.3706	0.74560	0.0:0.8597:0.1403:0.0	.	22;22	Q7LBE3;B1AVM8	S26A9_HUMAN;.	N	22	ENSP00000341682:D22N;ENSP00000356103:D22N;ENSP00000356102:D22N	ENSP00000341682:D22N	D	-	1	0	SLC26A9	204171508	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	3.178000	0.50879	1.179000	0.42884	0.655000	0.94253	GAT		0.552	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
RYR2	6262	broad.mit.edu	37	1	237617806	237617806	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:237617806T>G	ENST00000366574.2	+	15	1725	c.1408T>G	c.(1408-1410)Tta>Gta	p.L470V	RYR2_ENST00000360064.6_Missense_Mutation_p.L468V|RYR2_ENST00000542537.1_Missense_Mutation_p.L454V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	470					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L468V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGATGAGCATTTAGAGCATGA	0.473																																					p.L470V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1408G	1						.						76.0	75.0	75.0					1																	237617806		1915	4123	6038	235684429	SO:0001583	missense	6262	exon15			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1408T>G	1.37:g.237617806T>G	ENSP00000355533:p.Leu470Val		235684429	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.767572	0.31320	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.89050	-2.46;-2.46;-2.46	5.8	-3.4	0.04853	Intracellular calcium-release channel (1);	0.000000	0.46442	U	0.000299	D	0.86657	0.5985	L	0.41824	1.3	0.80722	D	1	D	0.58620	0.983	P	0.54499	0.754	T	0.83186	-0.0086	10	0.33940	T	0.23	.	13.5865	0.61933	0.0:0.5395:0.0:0.4605	.	470	Q92736	RYR2_HUMAN	V	470;468;454	ENSP00000355533:L470V;ENSP00000353174:L468V;ENSP00000443798:L454V	ENSP00000353174:L468V	L	+	1	2	RYR2	235684429	0.001000	0.12720	0.019000	0.16419	0.866000	0.49608	-0.048000	0.11944	-0.614000	0.05687	0.450000	0.29827	TTA		0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
NOL9	79707	broad.mit.edu	37	1	6592599	6592599	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:6592599T>C	ENST00000377705.5	-	8	1491	c.1459A>G	c.(1459-1461)Agt>Ggt	p.S487G		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	487					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)	p.S487G(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCAACTGGACTCTCTTTTTCT	0.398																																					p.S487G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1459G	1						.						122.0	127.0	125.0					1																	6592599		2203	4300	6503	6515186	SO:0001583	missense	79707	exon8			AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1459A>G	1.37:g.6592599T>C	ENSP00000366934:p.Ser487Gly		6515186	NM_024654	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.010436	0.35511	.	.	ENSG00000162408	ENST00000377705	T	0.46451	0.87	5.85	-0.932	0.10435	Pre-mRNA cleavage complex II Clp1 (1);	0.807415	0.11475	N	0.560262	T	0.25344	0.0616	L	0.33485	1.01	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.18777	-1.0326	10	0.33940	T	0.23	-3.1416	3.0276	0.06096	0.3248:0.2573:0.0:0.4179	.	487	Q5SY16	NOL9_HUMAN	G	487	ENSP00000366934:S487G	ENSP00000366934:S487G	S	-	1	0	NOL9	6515186	0.000000	0.05858	0.001000	0.08648	0.182000	0.23217	-0.051000	0.11885	-0.098000	0.12285	0.402000	0.26972	AGT		0.398	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
GRIK3	2899	broad.mit.edu	37	1	37499622	37499622	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:37499622G>A	ENST00000373091.3	-	1	104	c.88C>T	c.(88-90)Cgc>Tgc	p.R30C	GRIK3_ENST00000373093.4_Missense_Mutation_p.R30C	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	30					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.R30C(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGCATCCCGCGCGAGTCCGGG	0.721																																					p.R30C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C88T	1						.						9.0	11.0	10.0					1																	37499622		2162	4225	6387	37272209	SO:0001583	missense	2899	exon1			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.88C>T	1.37:g.37499622G>A	ENSP00000362183:p.Arg30Cys		37272209	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897725	0.33535	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.12147	2.76;2.71	4.1	3.18	0.36537	.	0.680368	0.13154	N	0.409678	T	0.08133	0.0203	N	0.08118	0	0.37478	D	0.915869	P;P	0.44659	0.84;0.84	B;B	0.42522	0.39;0.276	T	0.32268	-0.9913	10	0.48119	T	0.1	.	8.3958	0.32557	0.1128:0.0:0.8872:0.0	.	30;30	A9Z1Z8;Q13003	.;GRIK3_HUMAN	C	30	ENSP00000362183:R30C;ENSP00000362185:R30C	ENSP00000362183:R30C	R	-	1	0	GRIK3	37272209	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.502000	0.53332	0.719000	0.32188	0.455000	0.32223	CGC		0.721	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
ZZZ3	26009	broad.mit.edu	37	1	78047725	78047725	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:78047725A>T	ENST00000370801.3	-	7	2206	c.1731T>A	c.(1729-1731)ttT>ttA	p.F577L	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.F83L	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	577					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F577L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						ATTCTCTTTCAAAATTCCCAA	0.353																																					p.F577L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1731A	1						.						75.0	85.0	82.0					1																	78047725		2198	4299	6497	77820313	SO:0001583	missense	26009	exon7			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.1731T>A	1.37:g.78047725A>T	ENSP00000359837:p.Phe577Leu		77820313	NM_015534	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	37	CCDS677.1	.	.	.	.	.	.	.	.	.	.	A	33	5.215204	0.95104	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	L	0.39020	1.185	0.80722	D	1	D;D;D	0.71674	0.996;0.997;0.998	D;D;D	0.80764	0.98;0.985;0.994	T	0.53570	-0.8420	9	0.22706	T	0.39	.	15.5949	0.76572	1.0:0.0:0.0:0.0	.	83;577;577	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	L	577;83	.	ENSP00000359834:F83L	F	-	3	2	ZZZ3	77820313	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.915000	0.48805	2.142000	0.66516	0.533000	0.62120	TTT		0.353	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534	
DNTTIP2	30836	broad.mit.edu	37	1	94337667	94337667	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:94337667G>T	ENST00000436063.2	-	5	2085	c.2028C>A	c.(2026-2028)taC>taA	p.Y676*		NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	676			Y -> F (in dbSNP:rs12748154).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Y676*(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		CATTTTTCTTGTAAAATCTTT	0.393																																					p.Y676X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2028A	1						.						272.0	265.0	267.0					1																	94337667		1859	4105	5964	94110255	SO:0001587	stop_gained	30836	exon5			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.2028C>A	1.37:g.94337667G>T	ENSP00000411010:p.Tyr676*		94110255	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Nonsense_Mutation	SNP	ENST00000436063.2	37	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	G	37	6.361914	0.97507	.	.	ENSG00000067334	ENST00000436063	.	.	.	6.02	-7.6	0.01303	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1107	0.89534	0.6945:0.0:0.3055:0.0	.	.	.	.	X	676	.	ENSP00000411010:Y676X	Y	-	3	2	DNTTIP2	94110255	0.997000	0.39634	0.605000	0.28930	0.987000	0.75469	0.370000	0.20433	-1.460000	0.01911	-0.355000	0.07637	TAC		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
NBPF20	100288142	broad.mit.edu	37	1	148342535	148342535	+	Silent	SNP	G	G	A	rs3977195	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:148342535G>A	ENST00000369202.1	-	5	698	c.501C>T	c.(499-501)gaC>gaT	p.D167D	NBPF20_ENST00000414710.2_Silent_p.D167D			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	167	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.D167D(1)		breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						CCTCATCTTCGTCATTTTCTA	0.423													.|||	2	0.000399361	0.0	0.0	5008	,	,		40163	0.001		0.0	False		,,,				2504	0.001				.												.	.	1	Substitution - coding silent(1)	large_intestine(1)	.	1						.						243.0	309.0	285.0					1																	148342535		1510	2706	4216	146709159	SO:0001819	synonymous_variant	200030	.				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.501C>T	1.37:g.148342535G>A			146709159	.		Silent	SNP	ENST00000369202.1	37																																																																																					0.423	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000100689.2		
NBPF20	100288142	broad.mit.edu	37	1	148346627	148346627	+	Missense_Mutation	SNP	C	C	G	rs76089733|rs9442115	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:148346627C>G	ENST00000369202.1	-	2	327	c.130G>C	c.(130-132)Gta>Cta	p.V44L	NBPF20_ENST00000414710.2_Missense_Mutation_p.V44L			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	44						cytoplasm (GO:0005737)		p.V44L(2)		breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						AGTTGAGTTACAAAACATCTC	0.453													.|||	6	0.00119808	0.0008	0.0	5008	,	,		24987	0.003		0.002	False		,,,				2504	0.0				.												.	.	2	Substitution - Missense(2)	large_intestine(2)	.	1						.						99.0	109.0	106.0					1																	148346627		2110	4268	6378	146713251	SO:0001583	missense	200030	.				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.130G>C	1.37:g.148346627C>G	ENSP00000358203:p.Val44Leu		146713251	.		Missense_Mutation	SNP	ENST00000369202.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.001|0.001	-2.930962|-2.930962	0.00053|0.00053	.|.	.|.	ENSG00000203832|ENSG00000203832	ENST00000369189|ENST00000369202;ENST00000369188;ENST00000414710	T|T;T;T	0.02140|0.04502	4.43|4.09;4.25;3.61	0.521|0.521	-1.04|-1.04	0.10068|0.10068	.|.	.|.	.|.	.|.	.|.	T|T	0.00845|0.00845	0.0028|0.0028	.|.	.|.	.|.	.|.	.|.	.|.	P|B;B	0.41041|0.12013	0.736|0.0;0.005	B|B;B	0.28784|0.14578	0.094|0.0;0.011	T|T	0.47623|0.47623	-0.9103|-0.9103	6|6	0.02654|0.27082	T|T	1|0.32	.|.	.|.	.|.	.|.	.|.	3|44;44	Q6P3W6-2|Q6P3W6;F5H1Q5	.|NBPFA_HUMAN;.	S|L	3|44	ENSP00000358190:C3S|ENSP00000358203:V44L;ENSP00000358189:V44L;ENSP00000389520:V44L	ENSP00000358190:C3S|ENSP00000358189:V44L	C|V	-|-	2|1	0|0	NBPF20|NBPF20	146713251|146713251	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.005000|0.005000	0.04900|0.04900	-0.390000|-0.390000	0.07332|0.07332	-0.716000|-0.716000	0.04962|0.04962	-1.109000|-1.109000	0.02080|0.02080	TGT|GTA		0.453	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000100689.2		
OR2T6	254879	broad.mit.edu	37	1	248551648	248551648	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr1:248551648G>C	ENST00000355728.2	+	1	739	c.739G>C	c.(739-741)Gtg>Ctg	p.V247L		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V247L(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACACATGATGGTGGTGACATT	0.483																																					p.V247L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G739C	1						.						254.0	219.0	231.0					1																	248551648		2203	4300	6503	246618271	SO:0001583	missense	254879	exon1			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.739G>C	1.37:g.248551648G>C	ENSP00000347965:p.Val247Leu		246618271	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307322	0.40795	.	.	ENSG00000198104	ENST00000355728	T	0.00216	8.53	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	D	0.000969	T	0.00815	0.0027	H	0.94808	3.585	0.34074	D	0.658758	D	0.71674	0.998	D	0.66084	0.941	T	0.44483	-0.9325	10	0.87932	D	0	.	16.2973	0.82783	0.0:0.0:1.0:0.0	.	247	Q8NHC8	OR2T6_HUMAN	L	247	ENSP00000347965:V247L	ENSP00000347965:V247L	V	+	1	0	OR2T6	246618271	1.000000	0.71417	0.618000	0.29105	0.024000	0.10985	5.037000	0.64170	2.237000	0.73441	0.643000	0.83706	GTG		0.483	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
DEFB116	245930	broad.mit.edu	37	20	29891232	29891232	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr20:29891232C>A	ENST00000400549.1	-	2	91	c.92G>T	c.(91-93)gGc>gTc	p.G31V		NM_001037731.1	NP_001032820.1	Q30KQ4	DB116_HUMAN	defensin, beta 116	31					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.G31V(1)		kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TCGGCTCTTGCCATTGTGGGA	0.458																																					p.G31V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G92T	20						.						140.0	126.0	130.0					20																	29891232		1912	4111	6023	29354893	SO:0001583	missense	245930	exon2			DQ012020	CCDS42860.1	20q11.21	2008-07-17			ENSG00000215545	ENSG00000215545		"""Defensins, beta"""	18097	protein-coding gene	gene with protein product	"""defensin, beta 16"""					11854508, 16033865	Standard	NM_001037731		Approved	DEFB-16	uc010ztm.2	Q30KQ4	OTTHUMG00000159285	ENST00000400549.1:c.92G>T	20.37:g.29891232C>A	ENSP00000383396:p.Gly31Val		29354893	NM_001037731		Missense_Mutation	SNP	ENST00000400549.1	37	CCDS42860.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021628	0.35701	.	.	ENSG00000215545	ENST00000400549	T	0.17691	2.26	3.23	-2.13	0.07144	.	.	.	.	.	T	0.10035	0.0246	L	0.27053	0.805	0.18873	N	0.999987	P	0.40476	0.718	B	0.36244	0.22	T	0.20371	-1.0277	9	0.56958	D	0.05	-20.0715	7.4392	0.27172	0.0:0.5141:0.0:0.4859	.	31	Q30KQ4	DB116_HUMAN	V	31	ENSP00000383396:G31V	ENSP00000383396:G31V	G	-	2	0	DEFB116	29354893	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-1.234000	0.02931	-0.441000	0.07201	-0.150000	0.13652	GGC		0.458	DEFB116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354403.1	NM_001037731	
BACH1	571	broad.mit.edu	37	21	30699668	30699668	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr21:30699668C>T	ENST00000399921.1	+	3	1766	c.1523C>T	c.(1522-1524)aCc>aTc	p.T508I	BACH1_ENST00000286800.3_Missense_Mutation_p.T508I	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T508I(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						GAGACGGACACCGAAGGAGAC	0.408																																					p.T508I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1523T	21						.						111.0	100.0	104.0					21																	30699668		2203	4300	6503	29621539	SO:0001583	missense	571	exon3			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.1523C>T	21.37:g.30699668C>T	ENSP00000382805:p.Thr508Ile		29621539	NM_206866	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000399921.1	37	CCDS13585.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.74|18.74	3.688227|3.688227	0.68271|0.68271	.|.	.|.	ENSG00000156273|ENSG00000156273	ENST00000551628|ENST00000286800;ENST00000399921	.|T;T	.|0.72835	.|-0.69;-0.69	5.86|5.86	4.97|4.97	0.65823|0.65823	.|Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);	.|0.070719	.|0.64402	.|D	.|0.000015	T|T	0.75148|0.75148	0.3810|0.3810	L|L	0.47716|0.47716	1.5|1.5	0.41900|0.41900	D|D	0.990416|0.990416	.|D	.|0.65815	.|0.995	.|P	.|0.60068	.|0.868	T|T	0.76454|0.76454	-0.2953|-0.2953	5|10	.|0.66056	.|D	.|0.02	-18.6248|-18.6248	10.8758|10.8758	0.46911|0.46911	0.0:0.8027:0.1284:0.0689|0.0:0.8027:0.1284:0.0689	.|.	.|508	.|O14867	.|BACH1_HUMAN	S|I	2|508	.|ENSP00000286800:T508I;ENSP00000382805:T508I	.|ENSP00000286800:T508I	P|T	+|+	1|2	0|0	BACH1|BACH1	29621539|29621539	1.000000|1.000000	0.71417|0.71417	0.810000|0.810000	0.32431|0.32431	0.848000|0.848000	0.48234|0.48234	5.666000|5.666000	0.68059|0.68059	2.776000|2.776000	0.95493|0.95493	0.655000|0.655000	0.94253|0.94253	CCG|ACC		0.408	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
CFAP221	200373	broad.mit.edu	37	2	120404570	120404570	+	Silent	SNP	C	C	T	rs371548429		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:120404570C>T	ENST00000413369.3	+	22	2349	c.2262C>T	c.(2260-2262)gaC>gaT	p.D754D	PCDP1_ENST00000602047.1_Silent_p.D468D	NM_001271049.1	NP_001257978												p.D468D(2)				Colorectal(110;0.196)					TTCCGATAGACGTCCCTGCCA	0.408													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18525	0.0		0.0	False		,,,				2504	0.0				p.D468D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.C1404T	2						.	C		3,4403	6.2+/-15.9	0,3,2200	128.0	128.0	128.0		1404	-9.1	0.0	2		128	0,8600		0,0,4300	no	coding-synonymous	PCDP1	NM_001029996.3		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		468/555	120404570	3,13003	2203	4300	6503	120121040	SO:0001819	synonymous_variant	200373	exon23																														ENST00000413369.3:c.2262C>T	2.37:g.120404570C>T			120121040	NM_001029996		Silent	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	C	3.001	-0.206036	0.06180	6.81E-4	0.0	ENSG00000163075	ENST00000443972;ENST00000434869	.	.	.	4.52	-9.05	0.00730	.	.	.	.	.	T	0.17195	0.0413	.	.	.	0.19575	N	0.999961	.	.	.	.	.	.	T	0.15723	-1.0427	4	.	.	.	-3.5938	4.3025	0.10932	0.2098:0.4925:0.109:0.1887	.	.	.	.	M	313;62	.	.	T	+	2	0	AC069154.2	120121040	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-3.884000	0.00342	-2.217000	0.00731	-1.871000	0.00553	ACG		0.408	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
NEUROD1	4760	broad.mit.edu	37	2	182542763	182542763	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:182542763C>T	ENST00000295108.3	-	2	1282	c.825G>A	c.(823-825)ccG>ccA	p.P275P	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	275					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.P275P(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGCTGAGCGGCGGGCTGAGGG	0.552																																					p.P275P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825A	2						.						71.0	73.0	73.0					2																	182542763		2203	4300	6503	182251008	SO:0001819	synonymous_variant	4760	exon2			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.825G>A	2.37:g.182542763C>T			182251008	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																				0.552	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
SDPR	8436	broad.mit.edu	37	2	192701401	192701401	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:192701401C>T	ENST00000304141.4	-	2	855	c.526G>A	c.(526-528)Gtt>Att	p.V176I		NM_004657.5	NP_004648.1			serum deprivation response									p.V176I(1)		NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			GCACCGGAAACGGGCTGTTTC	0.483																																					p.V176I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G526A	2						.						40.0	45.0	43.0					2																	192701401		2202	4295	6497	192409646	SO:0001583	missense	8436	exon2			AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.526G>A	2.37:g.192701401C>T	ENSP00000305675:p.Val176Ile		192409646	NM_004657		Missense_Mutation	SNP	ENST00000304141.4	37	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	C	6.005	0.369273	0.11352	.	.	ENSG00000168497	ENST00000304141	T	0.58797	0.31	5.16	4.29	0.51040	.	0.436377	0.25042	N	0.033583	T	0.47857	0.1468	L	0.44542	1.39	0.09310	N	1	B	0.22346	0.068	B	0.18871	0.023	T	0.35051	-0.9804	10	0.30854	T	0.27	-2.4024	12.1154	0.53861	0.0:0.8577:0.0:0.1423	.	176	O95810	SDPR_HUMAN	I	176	ENSP00000305675:V176I	ENSP00000305675:V176I	V	-	1	0	SDPR	192409646	0.001000	0.12720	0.002000	0.10522	0.018000	0.09664	1.239000	0.32719	1.435000	0.47434	-0.219000	0.12488	GTT		0.483	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
FZD7	8324	broad.mit.edu	37	2	202900753	202900753	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:202900753C>T	ENST00000286201.1	+	1	1444	c.1383C>T	c.(1381-1383)acC>acT	p.T461T	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	461					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.T461T(1)		breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						GCACCAAGACCGAGAAGCTGG	0.587											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T461T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1383T	2						.						116.0	93.0	101.0					2																	202900753		2203	4300	6503	202608998	SO:0001819	synonymous_variant	8324	exon1			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1383C>T	2.37:g.202900753C>T		2133	202608998	NM_003507	O94816|Q53S59|Q96B74	Silent	SNP	ENST00000286201.1	37	CCDS2351.1																																																																																				0.587	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
MFSD2B	388931	broad.mit.edu	37	2	24240414	24240414	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:24240414G>A	ENST00000406420.3	+	6	653	c.637G>A	c.(637-639)Gag>Aag	p.E213K	MFSD2B_ENST00000338315.4_Missense_Mutation_p.E213K	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	213					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.E213K(2)		cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CCACAGGTGCGAGGCCACTGC	0.667																																					p.E213K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G637A	2						.						12.0	15.0	14.0					2																	24240414		1988	4134	6122	24093918	SO:0001583	missense	388931	exon6				CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.637G>A	2.37:g.24240414G>A	ENSP00000385527:p.Glu213Lys		24093918	NM_001080473	B5MC32	Missense_Mutation	SNP	ENST00000406420.3	37	CCDS46228.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639541	0.29157	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	T;T	0.18174	2.23;2.24	4.5	1.56	0.23342	Major facilitator superfamily domain, general substrate transporter (1);	2.390050	0.02494	U	0.089833	T	0.10380	0.0254	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.25152	-1.0140	10	0.06625	T	0.88	-7.6391	5.4298	0.16446	0.2015:0.1679:0.6306:0.0	.	213	A6NFX1	MFS2B_HUMAN	K	213	ENSP00000385527:E213K;ENSP00000342501:E213K	ENSP00000342501:E213K	E	+	1	0	MFSD2B	24093918	0.881000	0.30235	0.209000	0.23619	0.038000	0.13279	1.052000	0.30429	0.418000	0.25898	0.561000	0.74099	GAG		0.667	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000324307.1	NM_001080473	
WDPCP	51057	broad.mit.edu	37	2	63609044	63609044	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:63609044C>T	ENST00000272321.7	-	11	2148	c.1621G>A	c.(1621-1623)Gaa>Aaa	p.E541K	WDPCP_ENST00000398544.3_Missense_Mutation_p.E382K|WDPCP_ENST00000409199.1_Missense_Mutation_p.E349K|WDPCP_ENST00000409562.3_Missense_Mutation_p.E541K|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409120.1_Missense_Mutation_p.E349K	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	541					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.E541K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GTCTGACCTTCTCTCTCTGGA	0.388																																					p.E541K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1621A	2						.						67.0	63.0	64.0					2																	63609044		1864	4105	5969	63462548	SO:0001583	missense	51057	exon11				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1621G>A	2.37:g.63609044C>T	ENSP00000272321:p.Glu541Lys		63462548	NM_015910	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	C	31	5.080212	0.94050	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.71558	0.3354	M	0.78801	2.425	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.993	T	0.74677	-0.3585	10	0.72032	D	0.01	.	19.3185	0.94226	0.0:1.0:0.0:0.0	.	541;541;382	O95876-2;O95876;O95876-3	.;FRITZ_HUMAN;.	K	541;349;349;382;541	ENSP00000272321:E541K;ENSP00000386592:E349K;ENSP00000386769:E349K;ENSP00000381552:E382K;ENSP00000387222:E541K	ENSP00000272321:E541K	E	-	1	0	WDPCP	63462548	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.587000	0.74071	2.553000	0.86117	0.650000	0.86243	GAA		0.388	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
PROKR1	10887	broad.mit.edu	37	2	68882463	68882463	+	Missense_Mutation	SNP	G	G	A	rs201464916		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:68882463G>A	ENST00000303786.3	+	3	1357	c.937G>A	c.(937-939)Gtg>Atg	p.V313M	PROKR1_ENST00000394342.2_Missense_Mutation_p.V313M			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	313					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.V313M(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTTCCCCACCGTGTTTGTGAA	0.562																																					p.V313M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A	2						.						173.0	126.0	142.0					2																	68882463		2203	4300	6503	68735967	SO:0001583	missense	10887	exon2			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.937G>A	2.37:g.68882463G>A	ENSP00000303775:p.Val313Met		68735967	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855264	0.32791	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.72051	-0.62;-0.62	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.255510	0.41500	D	0.000861	T	0.66036	0.2749	M	0.66439	2.03	0.36790	D	0.884803	B	0.21452	0.056	B	0.19946	0.027	T	0.68830	-0.5305	10	0.52906	T	0.07	.	9.0175	0.36179	0.0962:0.0:0.9038:0.0	.	313	Q8TCW9	PKR1_HUMAN	M	313	ENSP00000303775:V313M;ENSP00000377874:V313M	ENSP00000303775:V313M	V	+	1	0	PROKR1	68735967	0.221000	0.23642	0.971000	0.41717	0.987000	0.75469	0.650000	0.24858	2.884000	0.98904	0.655000	0.94253	GTG		0.562	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
ERBB4	2066	broad.mit.edu	37	2	212989571	212989571	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr2:212989571C>A	ENST00000342788.4	-	2	450	c.140G>T	c.(139-141)cGa>cTa	p.R47L	ERBB4_ENST00000436443.1_Missense_Mutation_p.R47L|ERBB4_ENST00000402597.1_Missense_Mutation_p.R47L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	47					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R47L(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GCGCAAGGCTCGGTACTGCTG	0.478										TSP Lung(8;0.080)																											p.R47L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G140T	2						.						130.0	116.0	121.0					2																	212989571		2203	4300	6503	212697816	SO:0001583	missense	2066	exon2			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.140G>T	2.37:g.212989571C>A	ENSP00000342235:p.Arg47Leu		212697816	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.00|14.00	2.406127|2.406127	0.42715|0.42715	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	.|T;T;T	.|0.80909	.|-1.43;-1.43;-1.43	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|0.071047	.|0.56097	.|D	.|0.000028	.|T	.|0.55673	.|0.1935	N|N	0.04203|0.04203	-0.255|-0.255	0.45183|0.45183	D|D	0.998191|0.998191	.|P;B;P;P	.|0.38129	.|0.619;0.01;0.619;0.485	.|B;B;B;B	.|0.25405	.|0.059;0.004;0.059;0.06	.|T	.|0.61768	.|-0.6995	.|10	.|0.28530	.|T	.|0.3	.|.	12.2896|12.2896	0.54810|0.54810	0.0:0.9224:0.0:0.0776|0.0:0.9224:0.0:0.0776	.|.	.|47;47;47;47	.|Q15303-4;Q15303-2;Q15303-3;Q15303	.|.;.;.;ERBB4_HUMAN	X|L	47|47	.|ENSP00000342235:R47L;ENSP00000403204:R47L;ENSP00000385565:R47L	.|ENSP00000342235:R47L	E|R	-|-	1|2	0|0	ERBB4|ERBB4	212697816|212697816	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.008000|4.008000	0.57103|0.57103	2.467000|2.467000	0.83353|0.83353	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.478	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
STXBP5L	9515	broad.mit.edu	37	3	120952519	120952519	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:120952519G>T	ENST00000273666.6	+	12	1439	c.1168G>T	c.(1168-1170)Gat>Tat	p.D390Y	STXBP5L_ENST00000472879.1_Missense_Mutation_p.D390Y|STXBP5L_ENST00000471454.1_Missense_Mutation_p.D390Y|STXBP5L_ENST00000492541.1_Missense_Mutation_p.D390Y|STXBP5L_ENST00000497029.1_Missense_Mutation_p.D390Y	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	390					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D390Y(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CATTGTAGTTGATCTGACACA	0.284																																					p.D390Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1168T	3						.						90.0	85.0	87.0					3																	120952519		1814	4077	5891	122435209	SO:0001583	missense	9515	exon12			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1168G>T	3.37:g.120952519G>T	ENSP00000273666:p.Asp390Tyr		122435209	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859467	0.71834	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.70516	0.21;0.25;0.02;-0.49;-0.01;0.2	4.27	4.27	0.50696	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87952	0.2724	10	0.72032	D	0.01	-24.668	16.8666	0.86030	0.0:0.0:1.0:0.0	.	390;390	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	Y	390	ENSP00000273666:D390Y;ENSP00000420019:D390Y;ENSP00000419627:D390Y;ENSP00000420287:D390Y;ENSP00000420666:D390Y;ENSP00000420167:D390Y	ENSP00000273666:D390Y	D	+	1	0	STXBP5L	122435209	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.211000	0.95120	2.194000	0.70268	0.491000	0.48974	GAT		0.284	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
RHO	6010	broad.mit.edu	37	3	129247762	129247762	+	Silent	SNP	C	C	T	rs367909246		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:129247762C>T	ENST00000296271.3	+	1	280	c.186C>T	c.(184-186)acC>acT	p.T62T		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	62					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)	p.T62T(1)		breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TCTACGTCACCGTCCAGCACA	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20212	0.0		0.0	False		,,,				2504	0.0				p.T62T	Esophageal Squamous(118;214 1623 30842 43234 46940)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C186T	3						.	C		1,4405	2.1+/-5.4	0,1,2202	218.0	160.0	180.0		186	-3.3	0.9	3		180	0,8600		0,0,4300	no	coding-synonymous	RHO	NM_000539.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		62/349	129247762	1,13005	2203	4300	6503	130730452	SO:0001819	synonymous_variant	6010	exon1			AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.186C>T	3.37:g.129247762C>T			130730452	NM_000539	Q16414|Q2M249	Silent	SNP	ENST00000296271.3	37	CCDS3063.1																																																																																				0.577	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
NPHP3	27031	broad.mit.edu	37	3	132432106	132432106	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:132432106T>G	ENST00000337331.5	-	6	1068	c.982A>C	c.(982-984)Atg>Ctg	p.M328L	NPHP3_ENST00000476742.1_5'UTR|NPHP3_ENST00000326682.8_Missense_Mutation_p.M328L	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	328					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)		p.M328L(1)		NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTCTCGCACATTCTCTTAAGT	0.284																																					p.M328L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A982C	3						.						43.0	44.0	44.0					3																	132432106		2198	4273	6471	133914796	SO:0001583	missense	27031	exon6			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.982A>C	3.37:g.132432106T>G	ENSP00000338766:p.Met328Leu		133914796	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	T	12.19	1.865005	0.32977	.	.	ENSG00000113971	ENST00000326682;ENST00000337331	D;D	0.90732	-2.72;-2.62	6.02	4.87	0.63330	.	0.072960	0.85682	D	0.000000	D	0.85643	0.5744	M	0.61703	1.905	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.75687	-0.3231	10	0.11485	T	0.65	-24.7943	6.2325	0.20742	0.1206:0.1335:0.0:0.7458	.	328	Q7Z494	NPHP3_HUMAN	L	328	ENSP00000319909:M328L;ENSP00000338766:M328L	ENSP00000319909:M328L	M	-	1	0	NPHP3	133914796	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.525000	0.45598	1.111000	0.41721	0.482000	0.46254	ATG		0.284	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
SHQ1	55164	broad.mit.edu	37	3	72866457	72866457	+	Missense_Mutation	SNP	C	C	T	rs375075276		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:72866457C>T	ENST00000325599.8	-	7	945	c.806G>A	c.(805-807)cGt>cAt	p.R269H	SHQ1_ENST00000463369.1_Missense_Mutation_p.R241H	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	269					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R269H(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		GCACACTTGACGACAGGCTCT	0.383																																					p.R269H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G806A	3						.	C	HIS/ARG	0,4406		0,0,2203	155.0	138.0	144.0		806	1.5	0.2	3		144	1,8597	1.2+/-3.3	0,1,4298	no	missense	SHQ1	NM_018130.2	29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	269/578	72866457	1,13003	2203	4299	6502	72949147	SO:0001583	missense	55164	exon7			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.806G>A	3.37:g.72866457C>T	ENSP00000315182:p.Arg269His		72949147	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	CCDS33788.1	.	.	.	.	.	.	.	.	.	.	C	7.267	0.606312	0.14002	0.0	1.16E-4	ENSG00000144736	ENST00000325599;ENST00000463369	T;T	0.31247	1.5;1.5	5.79	1.51	0.23008	SHQ1 protein (1);	0.849897	0.10755	N	0.637868	T	0.16514	0.0397	N	0.20685	0.6	0.09310	N	0.999993	B	0.20550	0.046	B	0.17433	0.018	T	0.33675	-0.9859	10	0.13470	T	0.59	-10.8533	6.6876	0.23154	0.0:0.3966:0.0:0.6034	.	269	Q6PI26	SHQ1_HUMAN	H	269;241	ENSP00000315182:R269H;ENSP00000417452:R241H	ENSP00000315182:R269H	R	-	2	0	SHQ1	72949147	0.015000	0.18098	0.152000	0.22495	0.860000	0.49131	0.148000	0.16224	0.378000	0.24764	0.591000	0.81541	CGT		0.383	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
ATP13A4	84239	broad.mit.edu	37	3	193120534	193120534	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:193120534C>T	ENST00000342695.4	-	30	3820	c.3498G>A	c.(3496-3498)ccG>ccA	p.P1166P	ATP13A4_ENST00000482964.1_5'UTR|ATP13A4_ENST00000400270.2_Silent_p.P182P|ATP13A4_ENST00000392443.3_Silent_p.P1147P	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	1166						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.P1166P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTTGGTTTAGCGGGGGCCAAC	0.483																																					p.P1166P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3498A	3						.						96.0	94.0	94.0					3																	193120534		2203	4300	6503	194603228	SO:0001819	synonymous_variant	84239	exon30			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.3498G>A	3.37:g.193120534C>T			194603228	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	CCDS3304.2																																																																																				0.483	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
MUC20	200958	broad.mit.edu	37	3	195453018	195453018	+	Frame_Shift_Del	DEL	C	C	-	rs144288174	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr3:195453018delC	ENST00000447234.2	+	2	1670	c.1544delC	c.(1543-1545)gccfs	p.A515fs	MUC20_ENST00000445522.2_Frame_Shift_Del_p.A480fs|MUC20_ENST00000436408.1_Frame_Shift_Del_p.A515fs|MUC20_ENST00000320736.6_Frame_Shift_Del_p.A344fs	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	515	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.		activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)		p.T516fs*39(2)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		GCACCCGGGGCCACGACCCTC	0.577													cc|CC|C|deletion	439	0.0876597	0.0295	0.1398	5008	,	,		26511	0.0377		0.169	False		,,,				2504	0.0971				p.A309fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.926delC	3						.		,	185,3935		1,183,1876	54.0	47.0	49.0		,	-0.7	0.0	3	dbSNP_134	54	1243,6833		18,1207,2813	no	frameshift,frameshift	MUC20	NM_152673.2,NM_001098516.1	,	19,1390,4689	A1A1,A1R,RR		15.3913,4.4903,11.7088	,	,	195453018	1428,10768	2136	4208	6344	196938689	SO:0001589	frameshift_variant	200958	exon2			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1544delC	3.37:g.195453018delC	ENSP00000414350:p.Ala515fs		196938689	NM_001098516	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Frame_Shift_Del	DEL	ENST00000447234.2	37																																																																																					0.577	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
JADE1	79960	broad.mit.edu	37	4	129778564	129778564	+	Silent	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:129778564G>A	ENST00000226319.6	+	8	1216	c.936G>A	c.(934-936)gcG>gcA	p.A312A	PHF17_ENST00000413543.2_Silent_p.A312A|PHF17_ENST00000512960.1_Silent_p.A312A|PHF17_ENST00000511647.1_Silent_p.A312A|PHF17_ENST00000452328.2_Silent_p.A300A	NM_199320.2	NP_955352.1												p.A312A(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GCCGGTGGGCGCTAGTGTGCA	0.532																																					p.A312A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G936A	4						.						156.0	161.0	159.0					4																	129778564		2203	4300	6503	129998014	SO:0001819	synonymous_variant	79960	exon8																														ENST00000226319.6:c.936G>A	4.37:g.129778564G>A			129998014	NM_199320		Silent	SNP	ENST00000226319.6	37	CCDS34062.1																																																																																				0.532	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
GC	2638	broad.mit.edu	37	4	72620804	72620804	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:72620804C>T	ENST00000273951.8	-	9	1398	c.1055G>A	c.(1054-1056)aGa>aAa	p.R352K	GC_ENST00000513476.1_Missense_Mutation_p.R352K|GC_ENST00000504199.1_Missense_Mutation_p.R371K|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	352	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)	p.R352K(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	ATGAGTCCTTCTGCTTAGTTC	0.343																																					p.R352K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1055A	4						.						112.0	105.0	107.0					4																	72620804		2203	4300	6503	72839668	SO:0001583	missense	2638	exon9			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1055G>A	4.37:g.72620804C>T	ENSP00000273951:p.Arg352Lys		72839668	NM_000583	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	ENST00000273951.8	37	CCDS3550.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607265	0.46527	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	D;D;D	0.87966	-2.32;-2.32;-2.32	4.81	3.07	0.35406	.	0.253491	0.39759	N	0.001275	D	0.88880	0.6557	M	0.74258	2.255	0.33568	D	0.598198	P;P	0.46512	0.7;0.879	B;P	0.53146	0.393;0.719	D	0.89551	0.3799	10	0.51188	T	0.08	.	6.629	0.22847	0.0:0.7219:0.1813:0.0968	.	371;352	D6RAK8;D6RF35	.;.	K	352;371;352	ENSP00000273951:R352K;ENSP00000421725:R371K;ENSP00000426683:R352K	ENSP00000273951:R352K	R	-	2	0	GC	72839668	0.829000	0.29322	0.881000	0.34555	0.551000	0.35334	2.210000	0.42816	0.719000	0.32188	0.561000	0.74099	AGA		0.343	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
FRAS1	80144	broad.mit.edu	37	4	79188077	79188077	+	Silent	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:79188077G>A	ENST00000325942.6	+	8	1217	c.777G>A	c.(775-777)ctG>ctA	p.L259L	FRAS1_ENST00000264895.6_Silent_p.L259L|FRAS1_ENST00000264899.6_Silent_p.L259L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	259	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.L259L(2)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GCCTGCCCCTGAGATGCGGAA	0.507																																					p.L259L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G777A	4						.						53.0	50.0	51.0					4																	79188077		2010	4173	6183	79407101	SO:0001819	synonymous_variant	80144	exon8			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.777G>A	4.37:g.79188077G>A			79407101	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	0.183	-1.060565	0.01950	.	.	ENSG00000138759	ENST00000508900	.	.	.	5.34	-1.94	0.07571	.	.	.	.	.	T	0.43366	0.1244	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	T	0.32771	-0.9894	4	.	.	.	.	4.3138	0.10982	0.3021:0.1244:0.4798:0.0936	.	.	.	.	K	102	.	.	E	+	1	0	FRAS1	79407101	0.018000	0.18449	0.568000	0.28447	0.015000	0.08874	-0.296000	0.08287	-0.150000	0.11195	0.655000	0.94253	GAG		0.507	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
HERC5	51191	broad.mit.edu	37	4	89384749	89384749	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:89384749G>A	ENST00000264350.3	+	5	908	c.755G>A	c.(754-756)gGc>gAc	p.G252D		NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	252					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.G252D(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GCTTGTGGTGGCTCTCACAGT	0.413																																					p.G252D	Esophageal Squamous(39;887 1012 34045 50514)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G755A	4						.						149.0	142.0	144.0					4																	89384749		2203	4300	6503	89603772	SO:0001583	missense	51191	exon5			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.755G>A	4.37:g.89384749G>A	ENSP00000264350:p.Gly252Asp		89603772	NM_016323	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	G	5.636	0.302020	0.10678	.	.	ENSG00000138646	ENST00000264350	D	0.84873	-1.91	4.72	3.87	0.44632	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.220372	0.31601	N	0.007380	T	0.69780	0.3149	N	0.25201	0.72	0.80722	D	1	B	0.23650	0.089	B	0.25291	0.059	T	0.60652	-0.7221	10	0.08381	T	0.77	.	6.4462	0.21877	0.1919:0.0:0.8081:0.0	.	252	Q9UII4	HERC5_HUMAN	D	252	ENSP00000264350:G252D	ENSP00000264350:G252D	G	+	2	0	HERC5	89603772	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	0.962000	0.29280	2.613000	0.88420	0.557000	0.71058	GGC		0.413	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
GRID2	2895	broad.mit.edu	37	4	94006262	94006262	+	Missense_Mutation	SNP	C	C	T	rs370298520		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:94006262C>T	ENST00000282020.4	+	3	619	c.361C>T	c.(361-363)Cgc>Tgc	p.R121C	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Intron	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	121					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.R121C(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CTTCATTCAGCGCTCAACAGC	0.567																																					p.R121C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C361T	4						.	C	CYS/ARG	0,4406		0,0,2203	122.0	105.0	111.0		361	5.1	1.0	4		111	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRID2	NM_001510.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	121/1008	94006262	1,13005	2203	4300	6503	94225285	SO:0001583	missense	2895	exon3			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.361C>T	4.37:g.94006262C>T	ENSP00000282020:p.Arg121Cys		94225285	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201989	0.79127	0.0	1.16E-4	ENSG00000152208	ENST00000282020	T	0.14640	2.49	5.12	5.12	0.69794	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.00621	-1.1640	10	0.56958	D	0.05	.	13.8373	0.63417	0.1529:0.847:0.0:0.0	.	121;62	O43424;B4DYB9	GRID2_HUMAN;.	C	121	ENSP00000282020:R121C	ENSP00000282020:R121C	R	+	1	0	GRID2	94225285	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	3.072000	0.50049	2.553000	0.86117	0.655000	0.94253	CGC		0.567	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
PDLIM5	10611	broad.mit.edu	37	4	95497010	95497010	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:95497010C>A	ENST00000317968.4	+	5	671	c.535C>A	c.(535-537)Ctg>Atg	p.L179M	PDLIM5_ENST00000542407.1_Missense_Mutation_p.L57M|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000380180.3_Intron|PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000318007.5_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	179					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)	p.L179M(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TGCATCTGGACTGCATGCTAA	0.577																																					p.L179M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C535A	4						.						196.0	151.0	166.0					4																	95497010		2203	4300	6503	95716033	SO:0001583	missense	10611	exon5			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.535C>A	4.37:g.95497010C>A	ENSP00000321746:p.Leu179Met		95716033	NM_006457	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326820	0.60743	.	.	ENSG00000163110	ENST00000317968;ENST00000542407	T;T	0.59224	0.66;0.28	5.03	4.18	0.49190	.	0.345964	0.25575	N	0.029740	T	0.62282	0.2415	M	0.63428	1.95	0.32113	N	0.589045	D	0.57899	0.981	P	0.55161	0.77	T	0.67393	-0.5682	10	0.35671	T	0.21	.	7.2666	0.26234	0.0:0.7085:0.1395:0.152	.	179	Q96HC4	PDLI5_HUMAN	M	179;57	ENSP00000321746:L179M;ENSP00000442187:L57M	ENSP00000321746:L179M	L	+	1	2	PDLIM5	95716033	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.079000	0.41577	1.088000	0.41272	0.655000	0.94253	CTG		0.577	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
FBXW7	55294	broad.mit.edu	37	4	153251991	153251991	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr4:153251991T>A	ENST00000281708.4	-	7	2244	c.1015A>T	c.(1015-1017)Aga>Tga	p.R339*	FBXW7_ENST00000603841.1_Nonsense_Mutation_p.R339*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.R221*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.R339*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.R259*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.R163*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	339					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R339*(2)|p.R100*(1)|p.?(1)|p.R259*(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATTACTTTTCTTCTCTTGATG	0.358			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R259X			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	5	Substitution - Nonsense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.A775T	4						.						258.0	226.0	237.0					4																	153251991		2202	4300	6502	153471441	SO:0001587	stop_gained	55294	exon6			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1015A>T	4.37:g.153251991T>A	ENSP00000281708:p.Arg339*		153471441	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	T	38	6.715762	0.97784	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0598	16.8061	0.85666	0.0:0.0:0.0:1.0	.	.	.	.	X	339;221;259;163	.	ENSP00000263981:R259X	R	-	1	2	FBXW7	153471441	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.247000	0.72411	2.367000	0.80283	0.528000	0.53228	AGA		0.358	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
WDR36	134430	broad.mit.edu	37	5	110459833	110459833	+	Missense_Mutation	SNP	G	G	C	rs372737092		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:110459833G>C	ENST00000513710.2	+	21	2468	c.2464G>C	c.(2464-2466)Gct>Cct	p.A822P	WDR36_ENST00000506538.2_Missense_Mutation_p.A822P			Q8NI36	WDR36_HUMAN	WD repeat domain 36	822					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.A822P(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TGGAGTTTTGGCTCAAAAATC	0.244																																					p.A822P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2464C	5						.						70.0	77.0	74.0					5																	110459833		2200	4293	6493	110487732	SO:0001583	missense	134430	exon21			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2464G>C	5.37:g.110459833G>C	ENSP00000424628:p.Ala822Pro		110487732	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083285	0.55861	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.77620	-1.11;-1.11	5.87	5.87	0.94306	Small-subunit processome, Utp21 (1);	0.137662	0.64402	D	0.000003	D	0.86928	0.6051	M	0.67953	2.075	0.80722	D	1	D	0.62365	0.991	P	0.62382	0.901	D	0.86841	0.2017	10	0.87932	D	0	-20.5993	20.5827	0.99408	0.0:0.0:1.0:0.0	.	822	Q8NI36	WDR36_HUMAN	P	822	ENSP00000423067:A822P;ENSP00000424628:A822P	ENSP00000423067:A822P	A	+	1	0	WDR36	110487732	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	6.024000	0.70857	2.941000	0.99782	0.655000	0.94253	GCT		0.244	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
APC	324	broad.mit.edu	37	5	112151261	112151261	+	Nonsense_Mutation	SNP	C	C	T	rs137854568		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:112151261C>T	ENST00000457016.1	+	9	1284	c.904C>T	c.(904-906)Cga>Tga	p.R302*	APC_ENST00000508376.2_Nonsense_Mutation_p.R302*|APC_ENST00000257430.4_Nonsense_Mutation_p.R302*			P25054	APC_HUMAN	adenomatous polyposis coli	302	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R302*(13)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCTGCACCTCGAAGGCTGAC	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R284X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	13	Substitution - Nonsense(13)	large_intestine(13)	c.C850T	5	GRCh37	CM910029	APC	M	rs137854568	.						113.0	100.0	104.0					5																	112151261		2202	4300	6502	112179160	SO:0001587	stop_gained	324	exon7	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.904C>T	5.37:g.112151261C>T	ENSP00000413133:p.Arg302*		112179160	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.654520	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5148	18.9031	0.92451	0.0:1.0:0.0:0.0	.	.	.	.	X	302;284;302;302;302	.	ENSP00000257430:R302X	R	+	1	2	APC	112179160	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.567000	0.60850	2.520000	0.84964	0.650000	0.86243	CGA		0.428	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*		112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SNX2	6643	broad.mit.edu	37	5	122163276	122163276	+	Nonsense_Mutation	SNP	C	C	T	rs537342925		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:122163276C>T	ENST00000379516.2	+	14	1552	c.1444C>T	c.(1444-1446)Cga>Tga	p.R482*	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Nonsense_Mutation_p.R365*	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	482					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.R482*(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		ACAGAAAGAACGAGTGAAGGA	0.308																																					p.R482X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1444T	5						.						84.0	88.0	87.0					5																	122163276		2203	4300	6503	122191175	SO:0001587	stop_gained	6643	exon14			AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1444C>T	5.37:g.122163276C>T	ENSP00000368831:p.Arg482*		122191175	NM_003100	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Nonsense_Mutation	SNP	ENST00000379516.2	37	CCDS34217.1	.	.	.	.	.	.	.	.	.	.	C	37	6.314845	0.97467	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	.	.	.	5.59	1.55	0.23275	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.5536	8.9004	0.35490	0.4951:0.4362:0.0:0.0687	.	.	.	.	X	482;365	.	ENSP00000368831:R482X	R	+	1	2	SNX2	122191175	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	2.012000	0.40932	0.048000	0.15891	-0.320000	0.08662	CGA		0.308	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	NM_003100	
PCDHA1	56147	broad.mit.edu	37	5	140167731	140167731	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:140167731G>A	ENST00000504120.2	+	1	1856	c.1856G>A	c.(1855-1857)cGc>cAc	p.R619H	PCDHA1_ENST00000378133.3_Missense_Mutation_p.R619H|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	619	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R619H(2)		breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGGCGCGCGCATCCCGTTC	0.667																																					p.R619H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1856A	5						.						71.0	75.0	73.0					5																	140167731		2203	4299	6502	140147915	SO:0001583	missense	56147	exon1			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1856G>A	5.37:g.140167731G>A	ENSP00000420840:p.Arg619His		140147915	NM_031410	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	g	6.560	0.471646	0.12461	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.52526	0.66;0.66	3.36	3.36	0.38483	Cadherin (4);Cadherin-like (1);	0.000000	0.36234	U	0.002701	T	0.36248	0.0960	L	0.44542	1.39	0.22851	N	0.99865	B;B	0.31383	0.241;0.321	B;B	0.30782	0.12;0.105	T	0.22800	-1.0206	10	0.38643	T	0.18	.	8.4722	0.32993	0.0:0.0:0.7472:0.2528	.	619;619	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	H	619	ENSP00000420840:R619H;ENSP00000367373:R619H	ENSP00000367373:R619H	R	+	2	0	PCDHA1	140147915	0.000000	0.05858	0.046000	0.18839	0.040000	0.13550	-0.978000	0.03778	1.572000	0.49736	0.484000	0.47621	CGC		0.667	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
MTMR12	54545	broad.mit.edu	37	5	32248222	32248222	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:32248222T>C	ENST00000382142.3	-	10	1077	c.907A>G	c.(907-909)Acc>Gcc	p.T303A	MTMR12_ENST00000280285.5_Missense_Mutation_p.T303A|MTMR12_ENST00000264934.5_Missense_Mutation_p.T303A	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	303	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)	p.T303A(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CTGTGGATGGTCTTGTAAATT	0.393																																					p.T303A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A907G	5						.						96.0	91.0	93.0					5																	32248222		2203	4300	6503	32283979	SO:0001583	missense	54545	exon10			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.907A>G	5.37:g.32248222T>C	ENSP00000371577:p.Thr303Ala		32283979	NM_001040446	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	ENST00000382142.3	37	CCDS34138.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725347	0.30593	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.89123	-2.47;-2.47;-2.47	5.46	4.3	0.51218	Myotubularin phosphatase domain (1);	0.402398	0.27876	N	0.017490	T	0.80088	0.4559	N	0.17248	0.465	0.40587	D	0.981451	P;B;B	0.47106	0.89;0.003;0.001	B;B;B	0.43413	0.419;0.01;0.003	T	0.75844	-0.3174	10	0.17369	T	0.5	.	11.208	0.48782	0.0:0.0727:0.0:0.9273	.	303;303;303	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	A	303	ENSP00000280285:T303A;ENSP00000371577:T303A;ENSP00000264934:T303A	ENSP00000264934:T303A	T	-	1	0	MTMR12	32283979	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.321000	0.51999	1.007000	0.39238	0.533000	0.62120	ACC		0.393	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	NM_019061	
UGT3A2	167127	broad.mit.edu	37	5	36066831	36066831	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:36066831C>G	ENST00000282507.3	-	1	162	c.61G>C	c.(61-63)Gag>Cag	p.E21Q	UGT3A2_ENST00000545528.1_5'UTR|UGT3A2_ENST00000504954.1_Intron|UGT3A2_ENST00000513300.1_Missense_Mutation_p.E21Q	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	21					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.E21Q(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTGGCAGCCTCTGAGAGCAGG	0.597																																					p.E21Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G61C	5						.						144.0	149.0	148.0					5																	36066831		2203	4300	6503	36102588	SO:0001583	missense	167127	exon1				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.61G>C	5.37:g.36066831C>G	ENSP00000282507:p.Glu21Gln		36102588	NM_001168316	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	37	CCDS3914.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079662	0.76528	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000515131	T;T;T	0.72725	-0.09;-0.68;1.31	3.15	2.27	0.28462	.	0.446042	0.16540	U	0.209974	T	0.74612	0.3739	L	0.54323	1.7	0.58432	D	0.999995	D;D	0.89917	0.997;1.0	D;D	0.83275	0.992;0.996	T	0.69157	-0.5219	10	0.14656	T	0.56	.	6.5224	0.22283	0.0:0.8643:0.0:0.1357	.	21;21	E9PFK7;Q3SY77	.;UD3A2_HUMAN	Q	21	ENSP00000282507:E21Q;ENSP00000427404:E21Q;ENSP00000420865:E21Q	ENSP00000282507:E21Q	E	-	1	0	UGT3A2	36102588	0.014000	0.17966	0.524000	0.27887	0.969000	0.65631	1.296000	0.33389	0.880000	0.35969	0.655000	0.94253	GAG		0.597	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
RAB3C	115827	broad.mit.edu	37	5	58021878	58021878	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:58021878G>A	ENST00000282878.4	+	3	471	c.302G>A	c.(301-303)cGt>cAt	p.R101H	RAB3C_ENST00000507977.1_3'UTR	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	101					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.R101H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		GCCTATTATCGTGGAGCCATG	0.348																																					p.R101H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G302A	5						.						144.0	138.0	140.0					5																	58021878		2203	4300	6503	58057635	SO:0001583	missense	115827	exon3			AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.302G>A	5.37:g.58021878G>A	ENSP00000282878:p.Arg101His		58057635	NM_138453		Missense_Mutation	SNP	ENST00000282878.4	37	CCDS3976.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326152	0.95708	.	.	ENSG00000152932	ENST00000282878	D	0.82255	-1.59	5.53	5.53	0.82687	Small GTP-binding protein domain (1);	0.000000	0.53938	D	0.000045	D	0.90830	0.7120	M	0.90542	3.125	0.80722	D	1	D	0.65815	0.995	P	0.52823	0.71	D	0.92611	0.6099	10	0.87932	D	0	-8.9813	19.4713	0.94963	0.0:0.0:1.0:0.0	.	101	Q96E17	RAB3C_HUMAN	H	101	ENSP00000282878:R101H	ENSP00000282878:R101H	R	+	2	0	RAB3C	58057635	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	9.808000	0.99193	2.587000	0.87381	0.563000	0.77884	CGT		0.348	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453	
CHD1	1105	broad.mit.edu	37	5	98232145	98232145	+	Splice_Site	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:98232145C>T	ENST00000284049.3	-	11	1644	c.1495G>A	c.(1495-1497)Gga>Aga	p.G499R		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	499	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)	p.G499R(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CAACTATTTCCTCTACAAAGT	0.284																																					p.G499R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1495A	5						.						50.0	53.0	52.0					5																	98232145		2201	4299	6500	98260045	SO:0001630	splice_region_variant	1105	exon11			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1494-1G>A	5.37:g.98232145C>T			98260045	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875095	0.51695	.	.	ENSG00000153922	ENST00000284049	D	0.94046	-3.34	5.12	5.12	0.69794	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.32987	U	0.005412	D	0.92130	0.7505	L	0.55743	1.74	0.80722	D	1	B	0.20887	0.049	B	0.25759	0.063	D	0.89104	0.3491	10	0.48119	T	0.1	.	18.9148	0.92501	0.0:1.0:0.0:0.0	.	499	O14646	CHD1_HUMAN	R	499	ENSP00000284049:G499R	ENSP00000284049:G499R	G	-	1	0	CHD1	98260045	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	3.041000	0.49807	2.537000	0.85549	0.585000	0.79938	GGA		0.284	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	Missense_Mutation
FAM193B	54540	broad.mit.edu	37	5	176965930	176965930	+	Silent	SNP	C	C	T	rs79172717		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr5:176965930C>T	ENST00000514747.1	-	2	477	c.429G>A	c.(427-429)caG>caA	p.Q143Q	FAM193B_ENST00000443375.2_Silent_p.Q30Q|FAM193B_ENST00000329540.5_5'UTR|FAM193B_ENST00000508298.1_Intron	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	143						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q30Q(1)		kidney(1)|large_intestine(3)	4						CTCGACCTGTCTGCCTTTCAT	0.572																																					p.Q143Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G429A	5						.						122.0	129.0	127.0					5																	176965930		2093	4223	6316	176898536	SO:0001819	synonymous_variant	54540	exon2				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.429G>A	5.37:g.176965930C>T			176898536	NM_001190946	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	37	CCDS54954.1																																																																																				0.572	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057	
ESR1	2099	broad.mit.edu	37	6	152163748	152163748	+	Nonsense_Mutation	SNP	C	C	T	rs104893956		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr6:152163748C>T	ENST00000206249.3	+	2	831	c.469C>T	c.(469-471)Cga>Tga	p.R157*	ESR1_ENST00000443427.1_Nonsense_Mutation_p.R157*|ESR1_ENST00000456483.2_Nonsense_Mutation_p.R157*|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000440973.1_Nonsense_Mutation_p.R157*|ESR1_ENST00000338799.5_Nonsense_Mutation_p.R157*|ESR1_ENST00000427531.2_5'UTR	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	157	Interaction with DDX5; self-association.|Modulating (transactivation AF-1); mediates interaction with MACROD1.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R157*(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	TTCAGATAATCGACGCCAGGG	0.458																																					p.R157X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C469T	6	GRCh37	CM940378	ESR1	M	rs104893956	.						59.0	55.0	56.0					6																	152163748		2203	4300	6503	152205441	SO:0001587	stop_gained	2099	exon3			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.469C>T	6.37:g.152163748C>T	ENSP00000206249:p.Arg157*		152205441	NM_001122740	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Nonsense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	C	41	9.136480	0.99077	.	.	ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000443427;ENST00000206249;ENST00000431590	.	.	.	6.05	6.05	0.98169	.	0.155635	0.46758	D	0.000280	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4635	0.61241	0.2558:0.7442:0.0:0.0	.	.	.	.	X	157;157;157;157;157;85	.	ENSP00000206249:R157X	R	+	1	2	ESR1	152205441	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.027000	0.49697	2.878000	0.98634	0.650000	0.86243	CGA		0.458	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
SYNE1	23345	broad.mit.edu	37	6	152557418	152557418	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr6:152557418A>C	ENST00000367255.5	-	110	20821	c.20220T>G	c.(20218-20220)aaT>aaG	p.N6740K	SYNE1_ENST00000356820.4_Missense_Mutation_p.N1264K|SYNE1_ENST00000448038.1_Missense_Mutation_p.N6669K|SYNE1_ENST00000423061.1_Missense_Mutation_p.N6669K|SYNE1_ENST00000341594.5_Missense_Mutation_p.N6352K|SYNE1_ENST00000265368.4_Missense_Mutation_p.N6740K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6740					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.N6740K(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCTGGTATTCATTAAGGCTAG	0.313										HNSCC(10;0.0054)																											p.N1264K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3792G	6						.						78.0	76.0	76.0					6																	152557418		2202	4300	6502	152599111	SO:0001583	missense	23345	exon25			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20220T>G	6.37:g.152557418A>C	ENSP00000356224:p.Asn6740Lys		152599111	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	13.12	2.143638	0.37825	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37	5.76	3.3	0.37823	.	0.295100	0.28671	N	0.014527	T	0.05593	0.0147	N	0.25647	0.755	0.26193	N	0.979566	B;B;B	0.31625	0.224;0.224;0.332	B;B;B	0.27076	0.035;0.035;0.076	T	0.39603	-0.9606	10	0.06236	T	0.91	.	5.6309	0.17510	0.7381:0.0:0.1363:0.1256	.	6740;6740;6669	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	K	6740;6669;6740;6669;6352;1264	ENSP00000356224:N6740K;ENSP00000396024:N6669K;ENSP00000265368:N6740K;ENSP00000390975:N6669K;ENSP00000341887:N6352K;ENSP00000349276:N1264K	ENSP00000265368:N6740K	N	-	3	2	SYNE1	152599111	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	0.911000	0.28584	0.414000	0.25790	0.533000	0.62120	AAT		0.313	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TRIM24	8805	broad.mit.edu	37	7	138269562	138269563	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:138269562_138269563insA	ENST00000343526.4	+	19	3234_3235	c.3019_3020insA	c.(3019-3021)gaafs	p.E1007fs	TRIM24_ENST00000415680.2_Frame_Shift_Ins_p.E973fs			O15164	TIF1A_HUMAN	tripartite motif containing 24	1007					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CCTCTATCCAGAAAAAAGGTTT	0.351																																					p.E1007fs	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)											.	.	0			c.3019_3020insA	7						.																																			137920103	SO:0001589	frameshift_variant	8805	exon19			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.3025dupA	7.37:g.138269568_138269568dupA	ENSP00000340507:p.Glu1007fs		137920102	NM_015905	A4D1R7|A4D1R8|O95854	Frame_Shift_Ins	INS	ENST00000343526.4	37	CCDS5847.1																																																																																				0.351	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
ETV1	2115	broad.mit.edu	37	7	13978837	13978837	+	Silent	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:13978837T>C	ENST00000430479.1	-	7	937	c.270A>G	c.(268-270)aaA>aaG	p.K90K	ETV1_ENST00000403527.1_Silent_p.K50K|ETV1_ENST00000405192.2_Silent_p.K90K|ETV1_ENST00000405358.4_Silent_p.K104K|ETV1_ENST00000399357.3_Silent_p.K50K|ETV1_ENST00000242066.5_Silent_p.K72K|ETV1_ENST00000420159.2_Silent_p.K32K|ETV1_ENST00000403685.1_Silent_p.K72K|ETV1_ENST00000343495.5_Silent_p.K72K|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000405218.2_Silent_p.K90K	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	90					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K90K(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						TGTGGGGTTCTTTCTTGATTT	0.383			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.K90K			Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A270G	7						.						116.0	103.0	107.0					7																	13978837		1850	4092	5942	13945362	SO:0001819	synonymous_variant	2115	exon6				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.270A>G	7.37:g.13978837T>C			13945362	NM_001163147	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	37	CCDS55088.1																																																																																				0.383	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956	
DFNA5	1687	broad.mit.edu	37	7	24784368	24784368	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:24784368C>T	ENST00000342947.3	-	3	642	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	DFNA5_ENST00000419307.1_De_novo_Start_InFrame|DFNA5_ENST00000409970.1_De_novo_Start_InFrame|DFNA5_ENST00000409775.3_Missense_Mutation_p.V73M|DFNA5_ENST00000545231.1_De_novo_Start_InFrame	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	73					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)		p.V73M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TCCGACTCCACGACCACTGGA	0.557																																					p.V73M	GBM(78;184 1250 20134 20900 23600)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G217A	7						.						49.0	44.0	45.0					7																	24784368		2203	4300	6503	24750893	SO:0001583	missense	1687	exon3			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.217G>A	7.37:g.24784368C>T	ENSP00000339587:p.Val73Met		24750893	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.594007	0.46214	.	.	ENSG00000105928	ENST00000342947;ENST00000409775	T;T	0.25912	1.77;1.77	5.7	2.62	0.31277	.	0.360129	0.29830	N	0.011090	T	0.48960	0.1529	M	0.73598	2.24	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.66847	0.947;0.905	T	0.57476	-0.7805	10	0.45353	T	0.12	-16.1268	16.6265	0.84971	0.0:0.6505:0.3494:0.0	.	73;73	A4FTY0;O60443	.;DFNA5_HUMAN	M	73	ENSP00000339587:V73M;ENSP00000386670:V73M	ENSP00000339587:V73M	V	-	1	0	DFNA5	24750893	0.636000	0.27207	0.966000	0.40874	0.295000	0.27426	0.830000	0.27462	1.400000	0.46741	0.650000	0.86243	GTG		0.557	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
IKZF1	10320	broad.mit.edu	37	7	50455118	50455118	+	Missense_Mutation	SNP	G	G	C	rs200163039	byFrequency	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:50455118G>C	ENST00000331340.3	+	6	820	c.665G>C	c.(664-666)cGc>cCc	p.R222P	IKZF1_ENST00000438033.1_Missense_Mutation_p.R135P|IKZF1_ENST00000359197.5_Intron|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000439701.1_Intron|IKZF1_ENST00000440768.2_Intron|IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000343574.5_Missense_Mutation_p.R135P	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	222					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CATAAAGAGCGCTGCCACAAC	0.527			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.R222P			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	.	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)	c.G665C	7						.						36.0	39.0	38.0					7																	50455118		1890	4111	6001	50422612	SO:0001583	missense	10320	exon6			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.665G>C	7.37:g.50455118G>C	ENSP00000331614:p.Arg222Pro		50422612	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	37		.	.	.	.	.	.	.	.	.	.	G	33	5.213515	0.95069	.	.	ENSG00000185811	ENST00000343574;ENST00000331340;ENST00000438033	T;T;T	0.15603	2.41;3.11;2.41	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.992	D;P	0.63877	0.919;0.615	T	0.31308	-0.9948	9	0.87932	D	0	-13.5436	19.9886	0.97358	0.0:0.0:1.0:0.0	.	135;222	Q13422-2;Q13422	.;IKZF1_HUMAN	P	135;222;135	ENSP00000342750:R135P;ENSP00000331614:R222P;ENSP00000396554:R135P	ENSP00000331614:R222P	R	+	2	0	IKZF1	50422612	1.000000	0.71417	0.985000	0.45067	1.000000	0.99986	9.823000	0.99369	2.726000	0.93360	0.655000	0.94253	CGC		0.527	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
EGFR	1956	broad.mit.edu	37	7	55223540	55223540	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:55223540G>C	ENST00000275493.2	+	8	1084	c.907G>C	c.(907-909)Gat>Cat	p.D303H	EGFR_ENST00000454757.2_Missense_Mutation_p.D250H|EGFR_ENST00000344576.2_Missense_Mutation_p.D303H|EGFR_ENST00000442591.1_Missense_Mutation_p.D303H|EGFR_ENST00000420316.2_Missense_Mutation_p.D303H|EGFR_ENST00000342916.3_Missense_Mutation_p.D303H|EGFR_ENST00000455089.1_Missense_Mutation_p.D258H	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	303					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.D303H(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGTGGTGACAGATCACGGCTC	0.597		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.D303H		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G907C	7						.						68.0	63.0	65.0					7																	55223540		2203	4300	6503	55191034	SO:0001583	missense	1956	exon8	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.907G>C	7.37:g.55223540G>C	ENSP00000275493:p.Asp303His		55191034	NM_201282	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878934	0.91740	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	D;D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	5.64	5.64	0.86602	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.88596	0.6479	L	0.43923	1.385	0.80722	D	1	B;B;D;D;D	0.89917	0.066;0.125;1.0;1.0;1.0	B;B;D;D;D	0.85130	0.084;0.19;0.991;0.991;0.997	D	0.89281	0.3612	10	0.87932	D	0	.	18.2675	0.90056	0.0:0.0:1.0:0.0	.	258;303;303;303;303	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	H	258;303;173;303;303;303;303;250;97	ENSP00000415559:D258H;ENSP00000342376:D303H;ENSP00000345973:D303H;ENSP00000413843:D303H;ENSP00000275493:D303H;ENSP00000410031:D303H;ENSP00000395243:D250H	ENSP00000275493:D303H	D	+	1	0	EGFR	55191034	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.838000	0.99474	2.655000	0.90218	0.655000	0.94253	GAT		0.597	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ZNF804B	219578	broad.mit.edu	37	7	88964471	88964471	+	Silent	SNP	T	T	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:88964471T>A	ENST00000333190.4	+	4	2784	c.2175T>A	c.(2173-2175)acT>acA	p.T725T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	725							metal ion binding (GO:0046872)	p.T725T(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGAGAAGTACTTGTTCAAGTC	0.398										HNSCC(36;0.09)																											p.T725T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2175A	7						.						96.0	95.0	95.0					7																	88964471		2203	4300	6503	88802407	SO:0001819	synonymous_variant	219578	exon4			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2175T>A	7.37:g.88964471T>A			88802407	NM_181646	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1																																																																																				0.398	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
GIMAP1	170575	broad.mit.edu	37	7	150417709	150417709	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr7:150417709G>A	ENST00000307194.5	+	3	757	c.617G>A	c.(616-618)gGg>gAg	p.G206E		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	206	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)	p.G206E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCTGCTGGGGATGGTCGAG	0.692																																					p.G206E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G617A	7						.						24.0	30.0	28.0					7																	150417709		2199	4299	6498	150048642	SO:0001583	missense	170575	exon3			AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.617G>A	7.37:g.150417709G>A	ENSP00000302833:p.Gly206Glu		150048642	NM_130759	B2RCI3|Q8NAZ0	Missense_Mutation	SNP	ENST00000307194.5	37	CCDS5906.1	.	.	.	.	.	.	.	.	.	.	g	4.858	0.159577	0.09287	.	.	ENSG00000213203	ENST00000307194	T	0.59083	0.29	4.81	-6.2	0.02072	AIG1 (1);	0.718365	0.12095	U	0.500063	T	0.15955	0.0384	N	0.01284	-0.91	0.09310	N	1	B	0.20780	0.048	B	0.22386	0.039	T	0.29941	-0.9995	10	0.02654	T	1	.	2.8306	0.05498	0.457:0.1974:0.2481:0.0976	.	206	Q8WWP7	GIMA1_HUMAN	E	206	ENSP00000302833:G206E	ENSP00000302833:G206E	G	+	2	0	GIMAP1	150048642	0.000000	0.05858	0.004000	0.12327	0.076000	0.17211	-2.630000	0.00871	-1.350000	0.02199	-0.788000	0.03338	GGG		0.692	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	NM_130759	
TCEA1	6917	broad.mit.edu	37	8	54900746	54900746	+	Missense_Mutation	SNP	G	G	A	rs199869556		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr8:54900746G>A	ENST00000521604.2	-	5	797	c.394C>T	c.(394-396)Cgg>Tgg	p.R132W	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_Missense_Mutation_p.R111W|TCEA1_ENST00000522635.1_Intron	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	132					DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R132W(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			CTTGGTGCCCGAGGAAAGGAT	0.463			T	PLAG1	salivary adenoma																																p.R111W			Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C331T	8						.						92.0	92.0	92.0					8																	54900746		1971	4140	6111	55063299	SO:0001583	missense	6917	exon4			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.394C>T	8.37:g.54900746G>A	ENSP00000428426:p.Arg132Trp		55063299	NM_201437	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	ENST00000521604.2	37	CCDS47858.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714855	0.89112	.	.	ENSG00000187735	ENST00000396401;ENST00000521604	T;T	0.44881	0.91;0.91	5.63	5.63	0.86233	Transcription elongation factor S-II, central domain (2);	0.062092	0.64402	D	0.000004	T	0.48114	0.1482	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.977	P;P	0.58520	0.84;0.586	T	0.43637	-0.9379	10	0.59425	D	0.04	-0.078	14.832	0.70156	0.0:0.0:0.8561:0.1439	.	111;132	P23193-2;P23193	.;TCEA1_HUMAN	W	111;132	ENSP00000395483:R111W;ENSP00000428426:R132W	ENSP00000395483:R111W	R	-	1	2	TCEA1	55063299	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.100000	0.71473	2.818000	0.97014	0.591000	0.81541	CGG		0.463	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377975.2	NM_006756	
SULF1	23213	broad.mit.edu	37	8	70533458	70533458	+	Silent	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr8:70533458G>A	ENST00000260128.4	+	14	2283	c.1566G>A	c.(1564-1566)cgG>cgA	p.R522R	SULF1_ENST00000458141.2_Silent_p.R522R|SULF1_ENST00000402687.4_Silent_p.R522R|SULF1_ENST00000419716.3_Silent_p.R522R|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	522					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.R522R(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGAGTCAACGGCAATTCTTGA	0.512																																					p.R522R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1566A	8						.						55.0	56.0	56.0					8																	70533458		2203	4300	6503	70696012	SO:0001819	synonymous_variant	23213	exon14			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1566G>A	8.37:g.70533458G>A			70696012	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	ENST00000260128.4	37	CCDS6204.1																																																																																				0.512	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
MTERF3	51001	broad.mit.edu	37	8	97251899	97251899	+	Silent	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr8:97251899C>T	ENST00000287025.3	-	8	1172	c.1074G>A	c.(1072-1074)agG>agA	p.R358R	MTERFD1_ENST00000524341.1_Silent_p.R114R|MTERFD1_ENST00000523821.1_3'UTR|KB-1043D8.6_ENST00000520575.1_RNA|MTERFD1_ENST00000522822.1_Silent_p.R237R	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		358					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.R358R(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					CCTTAAACAGCCTTGTATTAA	0.313																																					p.R358R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1074A	8						.						61.0	62.0	62.0					8																	97251899		2203	4297	6500	97321075	SO:0001819	synonymous_variant	51001	exon8																														ENST00000287025.3:c.1074G>A	8.37:g.97251899C>T			97321075	NM_015942	B3KMG6|G3V130|Q9Y301	Silent	SNP	ENST00000287025.3	37	CCDS6270.1																																																																																				0.313	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1		
ANGPT1	284	broad.mit.edu	37	8	108359294	108359294	+	IGR	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr8:108359294G>A								ANGPT1 (10544 upstream) : RNA5SP275 (537427 downstream)														p.S110L(1)									GGCCATCTCCGACTTCATGTT	0.453																																					p.S110L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C329T	8						.						145.0	134.0	138.0					8																	108359294		2203	4300	6503	108428470	SO:0001628	intergenic_variant	284	exon2																															8.37:g.108359294G>A			108428470	NM_001146		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	G	13.37	2.218045	0.39201	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520033	T;T	0.42900	0.96;0.96	5.94	5.94	0.96194	.	0.169238	0.52532	D	0.000075	T	0.30008	0.0751	N	0.20986	0.625	0.80722	D	1	B;B	0.28783	0.222;0.222	B;B	0.23419	0.046;0.046	T	0.05733	-1.0867	10	0.29301	T	0.29	.	15.1095	0.72343	0.0:0.0:0.8585:0.1415	.	110;110	Q5HYA0;Q15389	.;ANGP1_HUMAN	L	110;110;3	ENSP00000428340:S110L;ENSP00000297450:S110L	ENSP00000297450:S110L	S	-	2	0	ANGPT1	108428470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.984000	0.56923	2.807000	0.96579	0.650000	0.86243	TCG	0	0.453								
OR13C5	138799	broad.mit.edu	37	9	107360878	107360878	+	Missense_Mutation	SNP	A	A	T	rs141268591		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:107360878A>T	ENST00000374779.2	-	1	910	c.817T>A	c.(817-819)Ttg>Atg	p.L273M		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L273M(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GTGGCATCCAAGTCATCTGAA	0.428																																					p.L273M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T817A	9						.						136.0	126.0	129.0					9																	107360878		2203	4300	6503	106400699	SO:0001583	missense	138799	exon1				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.817T>A	9.37:g.107360878A>T	ENSP00000363911:p.Leu273Met		106400699	NM_001004482	B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	ENST00000374779.2	37	CCDS35091.1	.	.	.	.	.	.	.	.	.	.	A	2.261	-0.369183	0.05069	.	.	ENSG00000255800	ENST00000374779	T	0.38887	1.11	3.14	-6.29	0.02013	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.16642	0.0400	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.19946	0.027	T	0.12528	-1.0544	9	0.38643	T	0.18	.	1.7013	0.02873	0.1241:0.3406:0.1955:0.3397	.	273	Q8NGS8	O13C5_HUMAN	M	273	ENSP00000363911:L273M	ENSP00000363911:L273M	L	-	1	2	OR13C5	106400699	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.328000	0.07945	-3.187000	0.00220	0.347000	0.21830	TTG		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053479.2	NM_001004482	
PAPPA	5069	broad.mit.edu	37	9	118997801	118997801	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:118997801G>A	ENST00000328252.3	+	7	2986	c.2617G>A	c.(2617-2619)Gca>Aca	p.A873T	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	873					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A873S(1)|p.A873T(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GACCTCCACTGCAGACACCCC	0.552																																					p.A873T												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G2617A	9						.						94.0	71.0	79.0					9																	118997801		2203	4300	6503	118037622	SO:0001583	missense	5069	exon7				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2617G>A	9.37:g.118997801G>A	ENSP00000330658:p.Ala873Thr		118037622	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.485981	0.26686	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.35605	1.3	6.03	0.58	0.17402	.	0.252025	0.47093	D	0.000244	T	0.24353	0.0590	N	0.14661	0.345	0.80722	D	1	P;P	0.40834	0.73;0.611	B;B	0.36289	0.221;0.05	T	0.10636	-1.0621	10	0.45353	T	0.12	0.0061	21.7223	0.99959	0.0:0.7873:0.2127:0.0	.	317;873	E7EMD3;Q13219	.;PAPP1_HUMAN	T	873;317	ENSP00000330658:A873T	ENSP00000330658:A873T	A	+	1	0	PAPPA	118037622	0.942000	0.31987	0.127000	0.21898	0.125000	0.20455	2.395000	0.44459	0.098000	0.17522	0.655000	0.94253	GCA		0.552	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
DDX58	23586	broad.mit.edu	37	9	32491320	32491320	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:32491320C>T	ENST00000379883.2	-	5	827	c.670G>A	c.(670-672)Gag>Aag	p.E224K	DDX58_ENST00000379868.1_Missense_Mutation_p.E21K|DDX58_ENST00000545044.1_Missense_Mutation_p.E21K|DDX58_ENST00000379882.1_Missense_Mutation_p.E179K|DDX58_ENST00000542096.1_Missense_Mutation_p.E153K	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	224	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.E224K(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		CATGAATTCTCACTAAGATTC	0.398																																					p.E224K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G670A	9						.						110.0	107.0	108.0					9																	32491320		2203	4300	6503	32481320	SO:0001583	missense	23586	exon5			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.670G>A	9.37:g.32491320C>T	ENSP00000369213:p.Glu224Lys		32481320	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271684	0.23221	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044;ENST00000542960	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	4.94	1.69	0.24217	.	0.385250	0.21227	N	0.078054	T	0.20210	0.0486	N	0.14661	0.345	0.24748	N	0.992997	B;B;B;B	0.16166	0.004;0.003;0.004;0.016	B;B;B;B	0.12837	0.005;0.008;0.005;0.008	T	0.16512	-1.0400	10	0.13470	T	0.59	-4.2005	14.0905	0.64987	0.0:0.6456:0.3544:0.0	.	21;179;153;224	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	K	179;224;21;153;21;224	ENSP00000369212:E179K;ENSP00000369213:E224K;ENSP00000369197:E21K;ENSP00000442160:E153K;ENSP00000443055:E21K	ENSP00000369197:E21K	E	-	1	0	DDX58	32481320	0.997000	0.39634	1.000000	0.80357	0.150000	0.21749	0.277000	0.18734	0.593000	0.29745	-0.171000	0.13296	GAG		0.398	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
ROR2	4920	broad.mit.edu	37	9	94487153	94487153	+	Silent	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:94487153G>A	ENST00000375708.3	-	9	1821	c.1623C>T	c.(1621-1623)ggC>ggT	p.G541G	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Silent_p.G401G	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.G541G(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGGTCACCACGCCCAGCAGGC	0.647																																					p.G541G												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1623T	9						.						69.0	69.0	69.0					9																	94487153		2203	4300	6503	93526974	SO:0001819	synonymous_variant	4920	exon9			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1623C>T	9.37:g.94487153G>A			93526974	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	37	CCDS6691.1																																																																																				0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
CIZ1	25792	broad.mit.edu	37	9	130931756	130931756	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:130931756G>A	ENST00000393608.1	-	13	2276	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	CIZ1_ENST00000325721.8_Missense_Mutation_p.R663C|CIZ1_ENST00000541172.1_Missense_Mutation_p.R591C|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000372954.1_Missense_Mutation_p.R612C|CIZ1_ENST00000538431.1_Missense_Mutation_p.R718C|CIZ1_ENST00000357558.5_Missense_Mutation_p.R664C|CIZ1_ENST00000277465.4_Missense_Mutation_p.R664C|CIZ1_ENST00000372948.3_Missense_Mutation_p.R636C|CIZ1_ENST00000372938.5_Missense_Mutation_p.R692C	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	692					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R692C(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TTGAAGTAGCGGTTGCAAACG	0.557																																					p.R636C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1906T	9						.						138.0	121.0	127.0					9																	130931756		2203	4300	6503	129971577	SO:0001583	missense	25792	exon14			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.2074C>T	9.37:g.130931756G>A	ENSP00000377232:p.Arg692Cys		129971577	NM_001131015	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551328	0.86127	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.37235	1.21;1.39;1.34;1.54;1.39;1.81;1.54;1.22;1.39;1.97	5.34	5.34	0.76211	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.46758	D	0.000272	T	0.55513	0.1925	L	0.55990	1.75	0.58432	D	0.999995	D;D;D;D;D;D;D	0.76494	0.996;0.999;0.997;0.994;0.996;0.997;0.998	P;D;P;P;P;P;D	0.66497	0.821;0.944;0.907;0.771;0.9;0.839;0.944	T	0.49234	-0.8961	9	.	.	.	-27.526	19.4238	0.94732	0.0:0.0:1.0:0.0	.	718;631;636;612;692;663;664	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	C	612;692;718;664;663;631;591;664;636;692;614	ENSP00000362045:R612C;ENSP00000377232:R692C;ENSP00000439244:R718C;ENSP00000350169:R664C;ENSP00000320374:R663C;ENSP00000445057:R591C;ENSP00000277465:R664C;ENSP00000362039:R636C;ENSP00000362029:R692C;ENSP00000398011:R614C	.	R	-	1	0	CIZ1	129971577	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.409000	0.66374	2.677000	0.91161	0.462000	0.41574	CGC		0.557	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
LAMC3	10319	broad.mit.edu	37	9	133961106	133961106	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chr9:133961106delC	ENST00000361069.4	+	25	4359	c.4226delC	c.(4225-4227)gccfs	p.A1409fs	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1409	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AAGGACAGTGCCAAGGTCAGG	0.642																																					p.A1409fs												.	.	0			c.4226delC	9						.						122.0	102.0	109.0					9																	133961106		2203	4300	6503	132950927	SO:0001589	frameshift_variant	10319	exon25			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4226delC	9.37:g.133961106delC	ENSP00000354360:p.Ala1409fs		132950927	NM_006059	B1APX9|B1APY0|Q59H72	Frame_Shift_Del	DEL	ENST00000361069.4	37	CCDS6938.1																																																																																				0.642	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
RGAG1	57529	broad.mit.edu	37	X	109695668	109695668	+	Missense_Mutation	SNP	C	C	A	rs143942191		TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:109695668C>A	ENST00000465301.2	+	3	2069	c.1823C>A	c.(1822-1824)tCt>tAt	p.S608Y	RGAG1_ENST00000540313.1_Missense_Mutation_p.S608Y	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	608								p.S608Y(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CAAATGAGATCTCTGGCCTCT	0.502																																					p.S608Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1823A	X						.						111.0	87.0	95.0					X																	109695668		2203	4300	6503	109582324	SO:0001583	missense	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1823C>A	X.37:g.109695668C>A	ENSP00000419786:p.Ser608Tyr		109582324	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	6.307	0.424674	0.11928	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.46063	0.88;0.88	4.25	4.25	0.50352	.	0.692490	0.11941	N	0.514732	T	0.25306	0.0615	N	0.08118	0	0.20074	N	0.999931	B	0.24963	0.115	B	0.27608	0.081	T	0.09487	-1.0672	9	.	.	.	-0.2909	13.543	0.61686	0.0:1.0:0.0:0.0	.	608	Q8NET4	RGAG1_HUMAN	Y	608	ENSP00000419786:S608Y;ENSP00000441452:S608Y	.	S	+	2	0	RGAG1	109582324	0.869000	0.29996	0.381000	0.26106	0.096000	0.18686	1.560000	0.36331	2.363000	0.80096	0.544000	0.68410	TCT		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
IGSF1	3547	broad.mit.edu	37	X	130410203	130410203	+	Silent	SNP	A	A	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:130410203A>G	ENST00000361420.3	-	15	2707	c.2628T>C	c.(2626-2628)acT>acC	p.T876T	IGSF1_ENST00000467244.1_5'UTR|IGSF1_ENST00000370903.3_Silent_p.T881T|IGSF1_ENST00000370910.1_Silent_p.T867T|IGSF1_ENST00000370904.1_Silent_p.T867T			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	876	Ig-like C2-type 9.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.T876T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GTGCCAGGAGAGTGGGTTTGG	0.507																																					p.T867T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2601C	X						.						46.0	47.0	47.0					X																	130410203		2203	4299	6502	130237884	SO:0001819	synonymous_variant	3547	exon14			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2628T>C	X.37:g.130410203A>G			130237884	NM_001170962	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	ENST00000361420.3	37	CCDS14629.1																																																																																				0.507	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
AFF2	2334	broad.mit.edu	37	X	147744008	147744008	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:147744008G>A	ENST00000370460.2	+	3	1239	c.760G>A	c.(760-762)Gtg>Atg	p.V254M	AFF2_ENST00000342251.3_Missense_Mutation_p.V250M|AFF2_ENST00000370457.5_Missense_Mutation_p.V250M|AFF2_ENST00000370458.1_Missense_Mutation_p.V250M	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	254					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.V254M(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GTCTCCCCTAGTGGCTTCCTC	0.473																																					p.V254M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760A	X						.						113.0	121.0	118.0					X																	147744008		2203	4300	6503	147551700	SO:0001583	missense	2334	exon3			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.760G>A	X.37:g.147744008G>A	ENSP00000359489:p.Val254Met		147551700	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372743	0.42003	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.82	2.81	0.32909	.	0.483471	0.21597	N	0.072001	T	0.54127	0.1839	L	0.34521	1.04	0.80722	D	1	P;P;P;P;P;P	0.47841	0.773;0.773;0.773;0.879;0.901;0.659	B;B;B;B;P;B	0.46585	0.23;0.23;0.23;0.387;0.521;0.215	T	0.54938	-0.8218	10	0.48119	T	0.1	.	10.6958	0.45899	0.0:0.6177:0.2724:0.1099	.	254;250;250;250;254;250	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	M	254;250;250;250	ENSP00000359489:V254M;ENSP00000359486:V250M;ENSP00000345459:V250M;ENSP00000359487:V250M	ENSP00000345459:V250M	V	+	1	0	AFF2	147551700	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	1.771000	0.38542	1.181000	0.42912	0.600000	0.82982	GTG		0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
AFF2	2334	broad.mit.edu	37	X	148039901	148039901	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:148039901A>T	ENST00000370460.2	+	12	3082	c.2603A>T	c.(2602-2604)aAg>aTg	p.K868M	AFF2_ENST00000342251.3_Missense_Mutation_p.K835M|AFF2_ENST00000370457.5_Missense_Mutation_p.K835M|AFF2_ENST00000286437.5_Missense_Mutation_p.K509M	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	868					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.K868T(1)|p.K868M(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGAGAAGAAGCAGCGCCTG	0.488																																					p.K868M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2603T	X						.						197.0	184.0	189.0					X																	148039901		2203	4300	6503	147847601	SO:0001583	missense	2334	exon12			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2603A>T	X.37:g.148039901A>T	ENSP00000359489:p.Lys868Met		147847601	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133001	0.77662	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	5.81	5.81	0.92471	.	0.367614	0.27384	N	0.019617	T	0.82222	0.4990	M	0.78049	2.395	0.45822	D	0.99869	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.79784	0.993;0.988;0.988;0.988;0.988;0.993	D	0.84076	0.0382	10	0.87932	D	0	.	8.8274	0.35063	0.9165:0.0:0.0835:0.0	.	509;833;835;829;858;868	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	M	868;835;835;509	ENSP00000359489:K868M;ENSP00000359486:K835M;ENSP00000345459:K835M;ENSP00000286437:K509M	ENSP00000286437:K509M	K	+	2	0	AFF2	147847601	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.299000	0.65716	1.949000	0.56562	0.486000	0.48141	AAG		0.488	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
MECP2	4204	broad.mit.edu	37	X	153296277	153296277	+	Silent	SNP	T	T	C			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:153296277T>C	ENST00000303391.6	-	4	1251	c.1002A>G	c.(1000-1002)aaA>aaG	p.K334K	MECP2_ENST00000460227.1_5'Flank|MECP2_ENST00000453960.2_Silent_p.K346K	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	334					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)	p.K334K(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTTCAGTCCTTTCCCGCTCT	0.627																																					p.K334K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1002G	X						.						63.0	59.0	60.0					X																	153296277		2203	4300	6503	152949471	SO:0001819	synonymous_variant	4204	exon4			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.1002A>G	X.37:g.153296277T>C			152949471	NM_004992	O15233|Q6QHH9|Q7Z384	Silent	SNP	ENST00000303391.6	37	CCDS14741.1																																																																																				0.627	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	NM_004992	
DMD	1756	broad.mit.edu	37	X	32716113	32716113	+	Silent	SNP	G	G	T			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:32716113G>T	ENST00000357033.4	-	9	1040	c.834C>A	c.(832-834)atC>atA	p.I278I	DMD_ENST00000288447.4_Silent_p.I270I|DMD_ENST00000378677.2_Silent_p.I274I	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	278					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.I273I(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GACTGACCGTGATCTGCAGAG	0.483																																					p.I278I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C834A	X						.						93.0	64.0	74.0					X																	32716113		2201	4294	6495	32626034	SO:0001819	synonymous_variant	1756	exon9			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.834C>A	X.37:g.32716113G>T			32626034	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1																																																																																				0.483	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
TMLHE	55217	broad.mit.edu	37	X	154736637	154736637	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3982-01A-02W-0995-10	TCGA-AA-3982-10A-01W-0999-10	g.chrX:154736637C>G	ENST00000334398.3	-	6	1062	c.917G>C	c.(916-918)gGa>gCa	p.G306A	TMLHE-AS1_ENST00000452506.1_RNA|TMLHE_ENST00000369439.4_Missense_Mutation_p.G306A	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	306					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)	p.G306A(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	GTGACATTCTCCAACATCTTC	0.403																																					p.G306A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G917C	X						.						144.0	137.0	139.0					X																	154736637		2203	4300	6503	154389831	SO:0001583	missense	55217	exon6			AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.917G>C	X.37:g.154736637C>G	ENSP00000335261:p.Gly306Ala		154389831	NM_001184797	A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Missense_Mutation	SNP	ENST00000334398.3	37	CCDS14768.1	.	.	.	.	.	.	.	.	.	.	C	8.484	0.860359	0.17178	.	.	ENSG00000185973	ENST00000334398;ENST00000369439	D;D	0.81821	-1.54;-1.54	4.42	4.42	0.53409	.	0.246525	0.41938	D	0.000788	T	0.68595	0.3018	L	0.43757	1.38	0.34323	D	0.686779	B;B;B	0.24721	0.11;0.012;0.012	B;B;B	0.20184	0.028;0.016;0.016	T	0.65651	-0.6116	10	0.07482	T	0.82	-16.4256	10.0803	0.42386	0.0:0.7997:0.2003:0.0	.	306;306;306	Q9NVH6-2;A8K6M9;Q9NVH6	.;.;TMLH_HUMAN	A	306	ENSP00000335261:G306A;ENSP00000358447:G306A	ENSP00000335261:G306A	G	-	2	0	TMLHE	154389831	0.999000	0.42202	1.000000	0.80357	0.649000	0.38597	3.032000	0.49736	1.951000	0.56629	0.494000	0.49563	GGA		0.403	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058817.1	NM_018196	
