#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HPSE2	60495	broad.mit.edu	37	10	100380415	100380415	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:100380415C>T	ENST00000370552.3	-	8	1208	c.1149G>A	c.(1147-1149)gtG>gtA	p.V383V	HPSE2_ENST00000404542.1_Silent_p.V271V|HPSE2_ENST00000370549.1_Silent_p.V325V|HPSE2_ENST00000370546.1_Silent_p.V383V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	383					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.V383V(2)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CTGAGGTGGTCACCACACCTT	0.463																																					p.V383V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1149A	10						.						120.0	102.0	108.0					10																	100380415		2203	4300	6503	100370405	SO:0001819	synonymous_variant	60495	exon8			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1149G>A	10.37:g.100380415C>T			100370405	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	CCDS7477.1																																																																																				0.463	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
PITRM1	10531	broad.mit.edu	37	10	3202417	3202418	+	Missense_Mutation	DNP	AG	AG	GT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:3202417_3202418AG>GT	ENST00000224949.4	-	8	930_931	c.896_897CT>AC	c.(895-897)gCT>gAC	p.A299D	PITRM1_ENST00000451104.2_Missense_Mutation_p.A267D|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000380994.1_5'Flank|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.A299D			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	299					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.A299>?(1)		breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						AGGGTGTCTGAGCTGGCACCAC	0.47																																					.												.	.	1	Complex(1)	large_intestine(1)	c.896_897AC	10						.																																			3192418	SO:0001583	missense	10531	exon8			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.896_897delinsGT	10.37:g.3202417_3202418delinsGT	ENSP00000224949:p.Ala299Asp		3192417	NM_014889	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	DNP	ENST00000224949.4	37	CCDS59208.1																																																																																				0.470	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
ITIH5	80760	broad.mit.edu	37	10	7607995	7607996	+	Missense_Mutation	DNP	AG	AG	CA	rs138089723		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:7607995_7607996AG>CA	ENST00000256861.6	-	13	2602_2603	c.2524_2525CT>TG	c.(2524-2526)CTg>TGg	p.L842W	ITIH5_ENST00000298441.6_Missense_Mutation_p.L628W|ITIH5_ENST00000446830.2_Missense_Mutation_p.L624W|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	842					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L842>?(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTTCCTACCCAGCAGTCCGTGG	0.54																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2524_2525TG	10						.																																			7648002	SO:0001583	missense	80760	exon13					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2524_2525delinsCA	10.37:g.7607995_7607996delinsCA	ENSP00000256861:p.Leu842Trp		7648001	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	DNP	ENST00000256861.6	37																																																																																					0.540	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
ANKRD30A	91074	broad.mit.edu	37	10	37455538	37455538	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:37455538C>T	ENST00000374660.1	+	19	2001	c.1902C>T	c.(1900-1902)ctC>ctT	p.L634L	ANKRD30A_ENST00000361713.1_Silent_p.L634L|ANKRD30A_ENST00000602533.1_Intron			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	571					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L634L(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AACAGAGTCTCTGTGAGACTG	0.289																																					p.L634L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1902T	10						.						2.0	2.0	2.0					10																	37455538		1193	2587	3780	37495544	SO:0001819	synonymous_variant	91074	exon19			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000374660.1:c.1902C>T	10.37:g.37455538C>T			37495544	NM_052997	Q5W025	Silent	SNP	ENST00000374660.1	37																																																																																					0.289	ANKRD30A-002	PUTATIVE	NMD_exception|basic	protein_coding	protein_coding	OTTHUMT00000047589.2	NM_052997	
FRMPD2	143162	broad.mit.edu	37	10	49446130	49446130	+	Silent	SNP	C	C	T	rs149962060		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:49446130C>T	ENST00000374201.3	-	8	1127	c.825G>A	c.(823-825)gcG>gcA	p.A275A	FRMPD2_ENST00000305531.3_Silent_p.A251A|FRMPD2_ENST00000407470.4_Silent_p.A244A	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	275					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.A275A(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GCCTCCGGCCCGCCTGCTGGT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		18818	0.0		0.001	False		,,,				2504	0.0				p.A275A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825A	10						.	C		0,4406		0,0,2203	52.0	57.0	56.0		825	-3.7	0.0	10	dbSNP_134	56	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	FRMPD2	NM_001018071.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		275/1310	49446130	2,13004	2203	4300	6503	49116136	SO:0001819	synonymous_variant	143162	exon8			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.825G>A	10.37:g.49446130C>T			49116136	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	CCDS31195.1																																																																																				0.577	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
ANK3	288	broad.mit.edu	37	10	61832212	61832212	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:61832212C>T	ENST00000280772.2	-	37	8618	c.8427G>A	c.(8425-8427)gtG>gtA	p.V2809V	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2809					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.V2809V(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTGTTTTTTCACATTATCAG	0.358																																					p.V2809V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8427A	10						.						84.0	83.0	83.0					10																	61832212		2203	4300	6503	61502218	SO:0001819	synonymous_variant	288	exon37			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8427G>A	10.37:g.61832212C>T			61502218	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																				0.358	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
OIT3	170392	broad.mit.edu	37	10	74666426	74666426	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:74666426G>A	ENST00000334011.5	+	4	835	c.617G>A	c.(616-618)tGt>tAt	p.C206Y		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	206	EGF-like; calcium-binding. {ECO:0000255}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					TCCTACCGCTGTGAGTGTGGG	0.483																																					p.C206Y	Colon(7;19 345 13446 17537)											.	.	0			c.G617A	10						.						277.0	259.0	265.0					10																	74666426		2203	4300	6503	74336432	SO:0001583	missense	170392	exon4				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.617G>A	10.37:g.74666426G>A	ENSP00000333900:p.Cys206Tyr		74336432	NM_152635	A0AVP3|Q8N1M8	Missense_Mutation	SNP	ENST00000334011.5	37	CCDS7318.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764833	0.49574	.	.	ENSG00000138315	ENST00000334011;ENST00000415725	D	0.99966	-10.09	5.76	4.86	0.63082	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.000000	0.64402	D	0.000004	D	0.99981	0.9994	H	0.98446	4.235	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.97919	1.0313	10	0.46703	T	0.11	-7.3438	14.5384	0.67976	0.0697:0.0:0.9303:0.0	.	206	Q8WWZ8	OIT3_HUMAN	Y	206	ENSP00000333900:C206Y	ENSP00000333900:C206Y	C	+	2	0	OIT3	74336432	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	8.517000	0.90555	1.435000	0.47434	0.655000	0.94253	TGT		0.483	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048596.1	NM_152635	
SFR1	119392	broad.mit.edu	37	10	105882817	105882817	+	Silent	SNP	T	T	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:105882817T>C	ENST00000369727.3	+	2	127	c.108T>C	c.(106-108)tcT>tcC	p.S36S	SFR1_ENST00000369729.3_Silent_p.S23S|SFR1_ENST00000336358.5_Silent_p.S98S|SFR1_ENST00000463224.1_3'UTR	NM_001002759.1	NP_001002759.1	Q86XK3	SFR1_HUMAN	SWI5-dependent recombination repair 1	36					double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)		p.S23S(1)									ATCCATCATCTCCCTATACAA	0.398																																					p.S36S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T108C	10						.						96.0	95.0	95.0					10																	105882817		2203	4300	6503	105872807	SO:0001819	synonymous_variant	119392	exon2			BC020892	CCDS31279.1, CCDS31280.1	10q25.1	2013-10-11	2011-08-01	2011-08-01	ENSG00000156384	ENSG00000156384			29574	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 78"", ""MEI5 recombination repair protein homolog (S. cerevisiae)"""	C10orf78, MEIR5		21252223, 21779174, 20976249	Standard	NM_145247		Approved	MEI5, bA373N18.1, FLJ41960	uc001kxu.3	Q86XK3	OTTHUMG00000019000	ENST00000369727.3:c.108T>C	10.37:g.105882817T>C			105872807	NM_001002759	A8K569|B2RTV8|Q5JT39|Q5JT40|Q8WW47	Silent	SNP	ENST00000369727.3	37	CCDS31279.1																																																																																				0.398	SFR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050191.1	NM_145247	
NRAP	4892	broad.mit.edu	37	10	115399992	115399992	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr10:115399992delC	ENST00000359988.3	-	14	1666	c.1422delG	c.(1420-1422)ttgfs	p.L474fs	NRAP_ENST00000360478.3_Frame_Shift_Del_p.L439fs|NRAP_ENST00000369360.3_Frame_Shift_Del_p.L439fs|NRAP_ENST00000369358.4_Frame_Shift_Del_p.L474fs	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TTACATCTTTCAAGGGCACCA	0.423																																					p.L474fs												.	.	0			c.1422delG	10						.						218.0	195.0	203.0					10																	115399992		2203	4300	6503	115389982	SO:0001589	frameshift_variant	4892	exon14				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1422delG	10.37:g.115399992delC	ENSP00000353078:p.Leu474fs		115389982	NM_198060		Frame_Shift_Del	DEL	ENST00000359988.3	37	CCDS7579.1																																																																																				0.423	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
ADM	133	broad.mit.edu	37	11	10327270	10327271	+	Missense_Mutation	DNP	TG	TG	CC			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	TG	TG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:10327270_10327271TG>CC	ENST00000528655.1	+	1	640_641	c.23_24TG>CC	c.(22-24)cTG>cCC	p.L8P	RP11-351I24.1_ENST00000526906.1_RNA|ADM_ENST00000530439.1_5'UTR|ADM_ENST00000278175.5_Missense_Mutation_p.L8P|ADM_ENST00000525063.1_Missense_Mutation_p.L8P|ADM_ENST00000526492.1_Missense_Mutation_p.L8P|ADM_ENST00000534464.1_5'UTR|ADM_ENST00000524948.1_Missense_Mutation_p.L8P|ADM_ENST00000528544.1_Missense_Mutation_p.L8P			P35318	ADML_HUMAN	adrenomedullin	8					aging (GO:0007568)|androgen metabolic process (GO:0008209)|blood circulation (GO:0008015)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cAMP biosynthetic process (GO:0006171)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|developmental growth (GO:0048589)|female pregnancy (GO:0007565)|G-protein coupled receptor internalization (GO:0002031)|heart development (GO:0007507)|hormone secretion (GO:0046879)|negative regulation of cell proliferation (GO:0008285)|negative regulation of vascular permeability (GO:0043116)|negative regulation of vasoconstriction (GO:0045906)|neural tube closure (GO:0001843)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of vasculogenesis (GO:2001214)|positive regulation of vasodilation (GO:0045909)|progesterone biosynthetic process (GO:0006701)|receptor internalization (GO:0031623)|regulation of the force of heart contraction (GO:0002026)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|spongiotrophoblast layer development (GO:0060712)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.L8>?(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(1)	6				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		TCCGTCGCCCTGATGTACCTGG	0.639																																					.												.	.	1	Complex(1)	large_intestine(1)	c.23_24CC	11						.																																			10283847	SO:0001583	missense	133	exon2			D14874	CCDS7801.1	11p15.4	2013-02-25			ENSG00000148926	ENSG00000148926		"""Endogenous ligands"""	259	protein-coding gene	gene with protein product		103275				7688224	Standard	NM_001124		Approved	AM	uc001mil.1	P35318	OTTHUMG00000165907	Exception_encountered	11.37:g.10327270_10327271delinsCC	ENSP00000436607:p.Leu8Pro		10283846	NM_001124	B2R793|D3DQV3|Q6FGW2	Missense_Mutation	DNP	ENST00000528655.1	37	CCDS7801.1																																																																																				0.639	ADM-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387008.1	NM_001124	
SORL1	6653	broad.mit.edu	37	11	121475028	121475029	+	Missense_Mutation	DNP	GC	GC	CA			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:121475028_121475029GC>CA	ENST00000260197.7	+	33	4775_4776	c.4646_4647GC>CA	c.(4645-4647)tGC>tCA	p.C1549S	SORL1_ENST00000527934.1_Missense_Mutation_p.C164S|SORL1_ENST00000525532.1_Missense_Mutation_p.C493S|SORL1_ENST00000534286.1_Missense_Mutation_p.C459S|SORL1_ENST00000532694.1_Missense_Mutation_p.C395S	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1549	LDL-receptor class A 11. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.C1549>?(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GAAAAGGCCTGCAGTGGTGAGT	0.663																																					.												.	.	1	Complex(1)	large_intestine(1)	c.4646_4647CA	11						.																																			120980239	SO:0001583	missense	6653	exon33			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	Exception_encountered	11.37:g.121475028_121475029delinsCA	ENSP00000260197:p.Cys1549Ser		120980238	NM_003105	B2RNX7|Q92856	Missense_Mutation	DNP	ENST00000260197.7	37	CCDS8436.1																																																																																				0.663	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
OR52B4	143496	broad.mit.edu	37	11	4388695	4388695	+	Silent	SNP	C	C	T	rs201717807		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:4388695C>T	ENST00000408920.2	-	1	921	c.831G>A	c.(829-831)ccG>ccA	p.P277P		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	277					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P277P(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTAGCCAACGGGATGTGGA	0.458																																					p.P277P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G831A	11						.						110.0	115.0	113.0					11																	4388695		2002	4168	6170	4345271	SO:0001819	synonymous_variant	143496	exon1			AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.831G>A	11.37:g.4388695C>T			4345271	NM_001005161	A6NP68|Q6IFK6	Silent	SNP	ENST00000408920.2	37	CCDS41609.1																																																																																				0.458	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
PSMC3	5702	broad.mit.edu	37	11	47440698	47440698	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:47440698C>T	ENST00000298852.3	-	11	1335	c.1178G>A	c.(1177-1179)gGg>gAg	p.G393E	PSMC3_ENST00000602866.1_Missense_Mutation_p.G377E|PSMC3_ENST00000530912.1_Missense_Mutation_p.G351E	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	393					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G393E(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCACTGGGCCCCATTGAAGTC	0.617																																					p.G393E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1178A	11						.						178.0	135.0	149.0					11																	47440698		2201	4298	6499	47397274	SO:0001583	missense	5702	exon11			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.1178G>A	11.37:g.47440698C>T	ENSP00000298852:p.Gly393Glu		47397274	NM_002804	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	ENST00000298852.3	37	CCDS7935.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.836542	0.91117	.	.	ENSG00000165916	ENST00000298852;ENST00000530912	D;D	0.95518	-3.73;-3.73	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.99039	0.9671	H	0.99919	4.95	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77004	0.989;0.955	D	0.98742	1.0717	10	0.87932	D	0	-30.9697	18.1114	0.89537	0.0:1.0:0.0:0.0	.	351;393	E9PM69;P17980	.;PRS6A_HUMAN	E	393;351	ENSP00000298852:G393E;ENSP00000433097:G351E	ENSP00000298852:G393E	G	-	2	0	PSMC3	47397274	1.000000	0.71417	0.385000	0.26158	0.916000	0.54674	7.651000	0.83577	2.495000	0.84180	0.462000	0.41574	GGG		0.617	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804	
MTA2	9219	broad.mit.edu	37	11	62363336	62363336	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:62363336C>T	ENST00000278823.2	-	13	1531	c.1142G>A	c.(1141-1143)tGg>tAg	p.W381*	MTA2_ENST00000524902.1_Nonsense_Mutation_p.W208*|MTA2_ENST00000527204.1_Nonsense_Mutation_p.W208*	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	381					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.W381*(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						AGGTGGGCCCCAGGCATACCA	0.567																																					p.W381X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1142A	11						.						67.0	66.0	66.0					11																	62363336		2202	4299	6501	62119912	SO:0001587	stop_gained	9219	exon13			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1142G>A	11.37:g.62363336C>T	ENSP00000278823:p.Trp381*		62119912	NM_004739	Q68DB1|Q9UQB5	Nonsense_Mutation	SNP	ENST00000278823.2	37	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	C	39	7.337103	0.98221	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.2549	16.6059	0.84828	0.0:1.0:0.0:0.0	.	.	.	.	X	381;208;208	.	ENSP00000278823:W381X	W	-	2	0	MTA2	62119912	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.451000	0.80668	2.778000	0.95560	0.650000	0.86243	TGG		0.567	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
CABP4	57010	broad.mit.edu	37	11	67225845	67225845	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:67225845G>A	ENST00000325656.5	+	5	732	c.655G>A	c.(655-657)Gac>Aac	p.D219N	CABP4_ENST00000438189.2_Missense_Mutation_p.D114N|CTC-1337H24.1_ENST00000602912.1_lincRNA	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	219	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			ACCTTAGTTTGACAGGGACAG	0.552																																					p.D219N												.	.	0			c.G655A	11						.						61.0	63.0	62.0					11																	67225845		2200	4295	6495	66982421	SO:0001583	missense	57010	exon5			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.655G>A	11.37:g.67225845G>A	ENSP00000324960:p.Asp219Asn		66982421	NM_145200	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	ENST00000325656.5	37	CCDS8166.1	.	.	.	.	.	.	.	.	.	.	G	33	5.243272	0.95272	.	.	ENSG00000175544	ENST00000438189;ENST00000325656	D;D	0.95821	-3.82;-3.82	4.52	4.52	0.55395	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.97748	0.9261	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.964	D	0.98503	1.0615	10	0.87932	D	0	-33.5195	16.5228	0.84321	0.0:0.0:1.0:0.0	.	219;114	P57796;P57796-2	CABP4_HUMAN;.	N	114;219	ENSP00000401555:D114N;ENSP00000324960:D219N	ENSP00000324960:D219N	D	+	1	0	CABP4	66982421	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.497000	0.90488	2.504000	0.84457	0.655000	0.94253	GAC		0.552	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397624.2		
FAT3	120114	broad.mit.edu	37	11	92087233	92087233	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:92087233G>T	ENST00000298047.6	+	1	1972	c.1955G>T	c.(1954-1956)aGa>aTa	p.R652I	FAT3_ENST00000409404.2_Missense_Mutation_p.R652I|FAT3_ENST00000541502.1_Missense_Mutation_p.R652I|FAT3_ENST00000525166.1_Missense_Mutation_p.R502I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTGCCCTCAGAATTACAGCA	0.373										TCGA Ovarian(4;0.039)																											p.R652I												.	.	0			c.G1955T	11						.						50.0	48.0	49.0					11																	92087233		1819	4084	5903	91726881	SO:0001583	missense	120114	exon1			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1955G>T	11.37:g.92087233G>T	ENSP00000298047:p.Arg652Ile		91726881	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	14.50	2.555341	0.45487	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.57	3.71	0.42584	.	.	.	.	.	T	0.21590	0.0520	N	0.13043	0.29	0.44432	D	0.997358	P	0.47604	0.898	B	0.41894	0.369	T	0.01977	-1.1236	9	0.40728	T	0.16	.	9.0035	0.36097	0.2501:0.0:0.7499:0.0	.	652	Q8TDW7-3	.	I	652;652;652;502	ENSP00000298047:R652I;ENSP00000387040:R652I;ENSP00000443786:R652I;ENSP00000432586:R502I	ENSP00000298047:R652I	R	+	2	0	FAT3	91726881	1.000000	0.71417	0.863000	0.33907	0.996000	0.88848	2.753000	0.47524	0.722000	0.32252	0.467000	0.42956	AGA		0.373	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ESAM	90952	broad.mit.edu	37	11	124626561	124626561	+	Silent	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr11:124626561C>G	ENST00000278927.5	-	3	456	c.327G>C	c.(325-327)ctG>ctC	p.L109L	ESAM_ENST00000442070.2_Intron|RP11-677M14.3_ENST00000504932.2_RNA	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	109	Ig-like V-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.L109L(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		GCCGCAGGGACAGGTTCCGGG	0.552																																					p.L109L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G327C	11						.						80.0	73.0	75.0					11																	124626561		2201	4299	6500	124131771	SO:0001819	synonymous_variant	90952	exon3			AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.327G>C	11.37:g.124626561C>G			124131771	NM_138961	B4DVN8|Q96T50	Silent	SNP	ENST00000278927.5	37	CCDS8453.1																																																																																				0.552	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
FICD	11153	broad.mit.edu	37	12	108913238	108913238	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:108913238C>T	ENST00000552695.1	+	3	1598	c.1363C>T	c.(1363-1365)Cct>Tct	p.P455S	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	455					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						GGAGACGCTTCCTGTGAAGCC	0.488																																					p.P455S												.	.	0			c.C1363T	12						.						42.0	35.0	38.0					12																	108913238		2203	4300	6503	107437368	SO:0001583	missense	11153	exon3			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.1363C>T	12.37:g.108913238C>T	ENSP00000446479:p.Pro455Ser		107437368	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633166	0.47049	.	.	ENSG00000198855	ENST00000552695	.	.	.	6.02	6.02	0.97574	.	0.147317	0.64402	D	0.000007	T	0.58538	0.2129	L	0.51422	1.61	0.80722	D	1	B	0.30851	0.297	B	0.30029	0.11	T	0.59478	-0.7447	9	0.66056	D	0.02	-10.1242	15.2786	0.73764	0.1401:0.8599:0.0:0.0	.	455	Q9BVA6	FICD_HUMAN	S	455	.	ENSP00000446479:P455S	P	+	1	0	FICD	107437368	0.964000	0.33143	0.683000	0.30040	0.978000	0.69477	3.382000	0.52463	2.865000	0.98341	0.655000	0.94253	CCT		0.488	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
TRAFD1	10906	broad.mit.edu	37	12	112585897	112585897	+	Missense_Mutation	SNP	G	G	C	rs569428779		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:112585897G>C	ENST00000257604.5	+	8	1564	c.947G>C	c.(946-948)cGt>cCt	p.R316P	Y_RNA_ENST00000363265.1_RNA|TRAFD1_ENST00000412615.2_Missense_Mutation_p.R316P	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	316					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)	p.R316P(1)		kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						AACCCTTCACGTGCCTTACCT	0.408																																					p.R316P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G947C	12						.						68.0	63.0	65.0					12																	112585897		2203	4300	6503	111070280	SO:0001583	missense	10906	exon8			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.947G>C	12.37:g.112585897G>C	ENSP00000257604:p.Arg316Pro		111070280	NM_006700	A8K5L6|B4DI89	Missense_Mutation	SNP	ENST00000257604.5	37	CCDS9160.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.376459	0.42105	.	.	ENSG00000135148	ENST00000412615;ENST00000257604;ENST00000548277	T;T	0.30981	1.51;1.51	5.94	4.11	0.48088	.	0.806142	0.12259	N	0.484865	T	0.21145	0.0509	N	0.19112	0.55	0.28601	N	0.909162	P	0.36712	0.566	B	0.36418	0.224	T	0.08659	-1.0711	10	0.45353	T	0.12	-0.18	9.9987	0.41916	0.1579:0.0:0.8421:0.0	.	316	O14545	TRAD1_HUMAN	P	316;316;110	ENSP00000396526:R316P;ENSP00000257604:R316P	ENSP00000257604:R316P	R	+	2	0	TRAFD1	111070280	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	3.705000	0.54823	0.838000	0.34948	0.650000	0.86243	CGT		0.408	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405214.1	NM_006700	
NOS1	4842	broad.mit.edu	37	12	117705862	117705863	+	Missense_Mutation	DNP	GA	GA	CT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:117705862_117705863GA>CT	ENST00000338101.4	-	10	1930_1931	c.1926_1927TC>AG	c.(1924-1929)gtTCtc>gtAGtc	p.L643V	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.L643V			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.V642>?(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AAGCTATAGAGAACCGCGATAT	0.52																																					.	Esophageal Squamous(162;1748 2599 51982 52956)											.	.	1	Complex(1)	large_intestine(1)	c.1926_1927AG	12						.																																			116190246	SO:0001583	missense	4842	exon11				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1926_1927delinsCT	12.37:g.117705862_117705863delinsCT	ENSP00000337459:p.Leu643Val		116190245	NM_000620		Missense_Mutation	DNP	ENST00000338101.4	37	CCDS55890.1																																																																																				0.520	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
RPLP0	6175	broad.mit.edu	37	12	120636760	120636760	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:120636760A>G	ENST00000551150.1	-	4	677	c.362T>C	c.(361-363)gTc>gCc	p.V121A	PXN-AS1_ENST00000538804.1_RNA|RPLP0_ENST00000550296.1_5'UTR|RPLP0_ENST00000552292.1_5'Flank|RPLP0_ENST00000546989.1_Missense_Mutation_p.V121A|PXN-AS1_ENST00000535200.1_RNA|RPLP0_ENST00000313104.5_Missense_Mutation_p.V121A|RPLP0_ENST00000392514.4_Missense_Mutation_p.V121A|RPLP0_ENST00000228306.4_Missense_Mutation_p.V121A|PXN-AS1_ENST00000542314.1_RNA|PXN-AS1_ENST00000542265.1_RNA|PXN-AS1_ENST00000539446.1_RNA			P05388	RLA0_HUMAN	ribosomal protein, large, P0	121					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.V121A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCACAGTGACTTCACATGG	0.532																																					p.V121A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T362C	12						.						38.0	36.0	36.0					12																	120636760		2203	4297	6500	119121143	SO:0001583	missense	6175	exon5			AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.362T>C	12.37:g.120636760A>G	ENSP00000449328:p.Val121Ala		119121143	NM_001002	Q3B7A4|Q9BVK4	Missense_Mutation	SNP	ENST00000551150.1	37	CCDS9193.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.07|19.07	3.755699|3.755699	0.69648|0.69648	.|.	.|.	ENSG00000089157|ENSG00000089157	ENST00000551914|ENST00000392514;ENST00000551150;ENST00000313104;ENST00000546989;ENST00000228306;ENST00000547211;ENST00000550856;ENST00000547191;ENST00000550423	.|T;T;T;T;T;T;T;T;T	.|0.48522	.|0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.78117|0.78117	0.4233|0.4233	H|H	0.96175|0.96175	3.78|3.78	0.80722|0.80722	D|D	1|1	.|D;D	.|0.63046	.|0.99;0.992	.|D;D	.|0.69824	.|0.936;0.966	D|D	0.85683|0.85683	0.1302|0.1302	6|10	0.87932|0.87932	D|D	0|0	.|.	15.3337|15.3337	0.74234|0.74234	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|121;121	.|Q3B7A4;P05388	.|.;RLA0_HUMAN	P|A	119|121;121;121;121;121;101;121;107;107	.|ENSP00000376299:V121A;ENSP00000449328:V121A;ENSP00000366471:V121A;ENSP00000449205:V121A;ENSP00000339027:V121A;ENSP00000449854:V101A;ENSP00000448046:V121A;ENSP00000450121:V107A;ENSP00000449765:V107A	ENSP00000448223:S119P|ENSP00000339027:V121A	S|V	-|-	1|2	0|0	RPLP0|RPLP0	119121143|119121143	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.249000|9.249000	0.95470|0.95470	2.030000|2.030000	0.59900|0.59900	0.533000|0.533000	0.62120|0.62120	TCA|GTC		0.532	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403448.3	NM_053275	
CD163L1	283316	broad.mit.edu	37	12	7527243	7527243	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:7527243G>A	ENST00000313599.3	-	13	3261	c.3204C>T	c.(3202-3204)agC>agT	p.S1068S	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Silent_p.S1078S|CD163L1_ENST00000396630.1_Silent_p.S1068S			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1068	SRCR 10. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.D1069fs*27(1)|p.S1068S(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CGTGGGCATCGCTCAGGTCCC	0.622											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1068S												.	.	2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	c.C3204T	12						.						72.0	64.0	67.0					12																	7527243		2203	4300	6503	7418510	SO:0001819	synonymous_variant	283316	exon13			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3204C>T	12.37:g.7527243G>A		642	7418510	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	37	CCDS8577.1																																																																																				0.622	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
SLC2A3	6515	broad.mit.edu	37	12	8083205	8083205	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:8083205C>T	ENST00000075120.7	-	5	784	c.544G>A	c.(544-546)Gag>Aag	p.E182K		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	182					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.E182K(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		GGCCATAGCTCTTCAGACCCA	0.433																																					p.E182K	Colon(96;424 1461 14416 20933 23688)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G544A	12						.						95.0	94.0	94.0					12																	8083205		2203	4300	6503	7974472	SO:0001583	missense	6515	exon5			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.544G>A	12.37:g.8083205C>T	ENSP00000075120:p.Glu182Lys		7974472	NM_006931	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	C	8.757	0.922614	0.18056	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.73681	-0.77	4.38	4.38	0.52667	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.881542	0.10079	N	0.718700	T	0.69405	0.3107	L	0.60957	1.885	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.12837	0.003;0.008	T	0.56408	-0.7984	10	0.37606	T	0.19	.	8.4103	0.32640	0.0:0.8949:0.0:0.1051	.	108;182	F5H2H8;P11169	.;GTR3_HUMAN	K	182;108	ENSP00000075120:E182K	ENSP00000075120:E182K	E	-	1	0	SLC2A3	7974472	0.000000	0.05858	0.042000	0.18584	0.420000	0.31355	-0.304000	0.08199	2.431000	0.82371	0.561000	0.74099	GAG		0.433	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
COL2A1	1280	broad.mit.edu	37	12	48369835	48369835	+	Missense_Mutation	SNP	C	C	T	rs121912891		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:48369835C>T	ENST00000380518.3	-	50	3672	c.3508G>A	c.(3508-3510)Ggt>Agt	p.G1170S	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.G1101S	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1170	Triple-helical region.		G -> S (in ANFH and in LCPD). {ECO:0000269|PubMed:15930420, ECO:0000269|PubMed:17394019}.|Missing (in SEDC).		axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G1101S(1)|p.G1170S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCAGAGGGACCGACGGGGCCA	0.632																																					p.G1101S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3301A	12	GRCh37	CM051418	COL2A1	M	rs121912891	.						87.0	88.0	88.0					12																	48369835		2203	4300	6503	46656102	SO:0001583	missense	1280	exon49			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.3508G>A	12.37:g.48369835C>T	ENSP00000369889:p.Gly1170Ser		46656102	NM_033150	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131170	0.77549	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99329	-5.75;-5.75	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.99708	0.9888	H	0.98754	4.32	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.97053	0.9765	9	0.87932	D	0	.	17.064	0.86555	0.0:1.0:0.0:0.0	.	1101;1170	P02458-1;P02458	.;CO2A1_HUMAN	S	1170;1101;1101	ENSP00000369889:G1170S;ENSP00000338213:G1101S	ENSP00000338213:G1101S	G	-	1	0	COL2A1	46656102	1.000000	0.71417	0.980000	0.43619	0.737000	0.42083	7.710000	0.84655	2.318000	0.78349	0.462000	0.41574	GGT		0.632	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
WNT10B	7480	broad.mit.edu	37	12	49360144	49360144	+	Missense_Mutation	SNP	G	G	A	rs144672721	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:49360144G>A	ENST00000301061.4	-	5	1252	c.904C>T	c.(904-906)Cgt>Tgt	p.R302C	WNT10B_ENST00000403957.1_3'UTR|WNT10B_ENST00000407467.1_3'UTR	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	302					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.R302C(1)		central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						GAGAGGCGACGGGGACGCAGA	0.647													G|||	4	0.000798722	0.0008	0.0	5008	,	,		17037	0.0		0.0	False		,,,				2504	0.0031				p.R302C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C904T	12						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	51.0	61.0	57.0		904	4.4	1.0	12	dbSNP_134	57	0,8598		0,0,4299	no	missense	WNT10B	NM_003394.3	180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	302/390	49360144	1,13003	2203	4299	6502	47646411	SO:0001583	missense	7480	exon5			X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.904C>T	12.37:g.49360144G>A	ENSP00000301061:p.Arg302Cys		47646411	NM_003394	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	ENST00000301061.4	37	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017524	0.75161	2.27E-4	0.0	ENSG00000169884	ENST00000301061	T	0.76709	-1.04	4.43	4.43	0.53597	.	0.000000	0.64402	D	0.000001	D	0.87838	0.6278	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	D	0.88511	0.3089	10	0.87932	D	0	.	6.4562	0.21930	0.0972:0.1869:0.7158:0.0	.	302	O00744	WN10B_HUMAN	C	302	ENSP00000301061:R302C	ENSP00000301061:R302C	R	-	1	0	WNT10B	47646411	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	5.527000	0.67123	2.484000	0.83849	0.561000	0.74099	CGT		0.647	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
MCRS1	10445	broad.mit.edu	37	12	49953537	49953538	+	Nonsense_Mutation	DNP	CC	CC	TT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:49953537_49953538CC>TT	ENST00000550165.1	-	12	1243_1244	c.977_978GG>AA	c.(976-978)tGG>tAA	p.W326*	MCRS1_ENST00000343810.4_Nonsense_Mutation_p.W326*|MCRS1_ENST00000547182.1_5'UTR|MCRS1_ENST00000546244.1_Nonsense_Mutation_p.W135*|MCRS1_ENST00000357123.4_Nonsense_Mutation_p.W339*			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	326					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.W339>?(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						CTAGCACCTGCCACTTATGCAG	0.619																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1016_1017AA	12						.																																			48239805	SO:0001587	stop_gained	10445	exon10			BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.977_978delinsTT	12.37:g.49953537_49953538delinsTT	ENSP00000448056:p.Trp326*		48239804	NM_001012300	O14742|O75497|Q6VN53|Q7Z372	Nonsense_Mutation	DNP	ENST00000550165.1	37	CCDS8787.1																																																																																				0.619	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337	
GALNT6	11226	broad.mit.edu	37	12	51759218	51759219	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:51759218_51759219GG>AT	ENST00000543196.2	-	4	1014_1015	c.809_810CC>AT	c.(808-810)gCC>gAT	p.A270D	GALNT6_ENST00000356317.3_Missense_Mutation_p.A270D			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	270	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A270>?(1)		endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ACTCACAGTGGGCATCCAGGAA	0.678																																					.												.	.	1	Complex(1)	large_intestine(1)	c.809_810AT	12						.																																			50045486	SO:0001583	missense	11226	exon5			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.809_810delinsAT	12.37:g.51759218_51759219delinsAT	ENSP00000444171:p.Ala270Asp		50045485	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	DNP	ENST00000543196.2	37	CCDS8813.1																																																																																				0.678	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GLS2	27165	broad.mit.edu	37	12	56872883	56872883	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:56872883G>C	ENST00000311966.4	-	4	765	c.487C>G	c.(487-489)Cat>Gat	p.H163D	GLS2_ENST00000539272.1_Intron|GLS2_ENST00000476991.1_5'Flank	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	163					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.H163D(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CGATCCACATGGCCCGTGAAC	0.512																																					p.H163D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C487G	12						.						109.0	100.0	103.0					12																	56872883		2203	4300	6503	55159150	SO:0001583	missense	27165	exon4				CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.487C>G	12.37:g.56872883G>C	ENSP00000310447:p.His163Asp		55159150	NM_013267	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	ENST00000311966.4	37	CCDS8921.1	.	.	.	.	.	.	.	.	.	.	G	9.412	1.080838	0.20309	.	.	ENSG00000135423	ENST00000311966	T	0.41758	0.99	4.75	4.75	0.60458	Beta-lactamase/transpeptidase-like (1);	0.305217	0.38217	N	0.001767	T	0.31796	0.0808	N	0.25485	0.75	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.05852	-1.0860	10	0.33940	T	0.23	-25.7029	15.1462	0.72653	0.0:0.0:1.0:0.0	.	163	Q9UI32	GLSL_HUMAN	D	163	ENSP00000310447:H163D	ENSP00000310447:H163D	H	-	1	0	GLS2	55159150	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.143000	0.58051	2.644000	0.89710	0.655000	0.94253	CAT		0.512	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267	
STAC3	246329	broad.mit.edu	37	12	57638346	57638346	+	Silent	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:57638346G>T	ENST00000332782.2	-	9	981	c.780C>A	c.(778-780)gcC>gcA	p.A260A	STAC3_ENST00000554578.1_Silent_p.A221A|STAC3_ENST00000546246.2_Silent_p.A74A	NM_145064.1	NP_659501.1	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	260	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)|neuromuscular synaptic transmission (GO:0007274)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)		identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.A260A(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(2)|skin(1)	18						CCTTCTCCAGGGCTTTGAACC	0.567																																					p.A260A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C780A	12						.						143.0	152.0	149.0					12																	57638346		2203	4300	6503	55924613	SO:0001819	synonymous_variant	246329	exon9			AK057013	CCDS8936.1, CCDS66405.1, CCDS66406.1	12q13.3	2014-08-12			ENSG00000185482	ENSG00000185482			28423	protein-coding gene	gene with protein product		615521				12477932	Standard	NM_001286257		Approved	MGC2793	uc009zpl.2	Q96MF2	OTTHUMG00000171271	ENST00000332782.2:c.780C>A	12.37:g.57638346G>T			55924613	NM_145064	B4DUK9|Q96HU5	Silent	SNP	ENST00000332782.2	37	CCDS8936.1																																																																																				0.567	STAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412724.2	NM_145064	
GLI1	2735	broad.mit.edu	37	12	57864797	57864797	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:57864797C>T	ENST00000228682.2	+	12	2365	c.2274C>T	c.(2272-2274)ccC>ccT	p.P758P	GLI1_ENST00000543426.1_Silent_p.P630P|GLI1_ENST00000546141.1_Silent_p.P717P	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	758					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.P758P(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CTGGTCCACCCACCAACTATG	0.612																																					p.P630P	Pancreas(157;841 1936 10503 41495 50368)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1890T	12						.						60.0	58.0	59.0					12																	57864797		2203	4300	6503	56151064	SO:0001819	synonymous_variant	2735	exon10				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2274C>T	12.37:g.57864797C>T			56151064	NM_001160045	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	ENST00000228682.2	37	CCDS8940.1																																																																																				0.612	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
EP400	57634	broad.mit.edu	37	12	132472320	132472320	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr12:132472320A>C	ENST00000333577.4	+	8	2511	c.2402A>C	c.(2401-2403)aAg>aCg	p.K801T	EP400_ENST00000389561.2_Missense_Mutation_p.K765T|EP400_ENST00000332482.4_Missense_Mutation_p.K728T|EP400_ENST00000389562.2_Missense_Mutation_p.K764T|EP400_ENST00000330386.6_Missense_Mutation_p.K765T			Q96L91	EP400_HUMAN	E1A binding protein p400	801	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CGTCTGCCAAAGCTGCAGGAG	0.602																																					p.K764T												.	.	0			c.A2291C	12						.						59.0	54.0	56.0					12																	132472320		2203	4300	6503	131038273	SO:0001583	missense	57634	exon7			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2402A>C	12.37:g.132472320A>C	ENSP00000333602:p.Lys801Thr		131038273	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	A	11.75	1.732014	0.30684	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.92752	-3.08;-3.06;-3.07;-3.1;-3.06	5.3	4.15	0.48705	.	0.045405	0.85682	D	0.000000	D	0.95544	0.8552	M	0.85462	2.755	0.36590	D	0.87403	D;D;D;D;D	0.89917	0.998;0.996;0.998;1.0;0.999	D;P;D;D;D	0.91635	0.943;0.9;0.943;0.999;0.935	D	0.96176	0.9127	10	0.72032	D	0.01	.	8.4734	0.32999	0.849:0.0:0.151:0.0	.	765;765;764;801;728	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	T	728;801;765;764;728;765;801;765;765	ENSP00000333602:K801T;ENSP00000374212:K765T;ENSP00000374213:K764T;ENSP00000331737:K728T;ENSP00000330620:K765T	ENSP00000330620:K765T	K	+	2	0	EP400	131038273	1.000000	0.71417	0.725000	0.30721	0.800000	0.45204	5.378000	0.66190	0.951000	0.37770	0.460000	0.39030	AAG		0.602	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
RASL11A	387496	broad.mit.edu	37	13	27847612	27847612	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr13:27847612C>A	ENST00000241463.4	+	4	1328	c.710C>A	c.(709-711)gCc>gAc	p.A237D		NM_206827.1	NP_996563.1			RAS-like, family 11, member A									p.A237D(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	10		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0173)|GBM - Glioblastoma multiforme(144;0.0557)|OV - Ovarian serous cystadenocarcinoma(117;0.152)|Epithelial(112;0.164)		AAAGTCAAAGCCCCCTCTGCA	0.517																																					p.A237D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C710A	13						.						37.0	37.0	37.0					13																	27847612		2203	4300	6503	26745612	SO:0001583	missense	387496	exon4			AY439004	CCDS9321.1	13q12.2	2014-05-09			ENSG00000122035	ENSG00000122035			23802	protein-coding gene	gene with protein product		612403				15033445	Standard	NM_206827		Approved		uc001urd.1	Q6T310	OTTHUMG00000016627	ENST00000241463.4:c.710C>A	13.37:g.27847612C>A	ENSP00000241463:p.Ala237Asp		26745612	NM_206827		Missense_Mutation	SNP	ENST00000241463.4	37	CCDS9321.1	.	.	.	.	.	.	.	.	.	.	C	9.777	1.174154	0.21704	.	.	ENSG00000122035	ENST00000241463	T	0.71579	-0.58	5.22	2.4	0.29515	.	0.311137	0.36200	N	0.002728	T	0.64627	0.2615	L	0.43152	1.355	0.23994	N	0.996236	P	0.37176	0.586	B	0.38803	0.282	T	0.58515	-0.7623	10	0.62326	D	0.03	.	14.6264	0.68624	0.0:0.5819:0.4181:0.0	.	237	Q6T310	RSLBA_HUMAN	D	237	ENSP00000241463:A237D	ENSP00000241463:A237D	A	+	2	0	RASL11A	26745612	0.062000	0.20869	0.001000	0.08648	0.117000	0.20001	1.222000	0.32515	0.257000	0.21650	-0.189000	0.12847	GCC		0.517	RASL11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044265.2	NM_206827	
RNF219	79596	broad.mit.edu	37	13	79219126	79219126	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr13:79219126G>A	ENST00000282003.6	-	2	137	c.79C>T	c.(79-81)Cag>Tag	p.Q27*		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	27							zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		ATGACAGGCTGACGTACCTTT	0.368																																					p.Q27X												.	.	0			c.C79T	13						.						130.0	114.0	119.0					13																	79219126		2203	4300	6503	78117127	SO:0001587	stop_gained	79596	exon2			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.79C>T	13.37:g.79219126G>A	ENSP00000282003:p.Gln27*		78117127	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Nonsense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	G	36	5.806434	0.96967	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.66	5.66	0.87406	.	0.117097	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-8.8639	19.7324	0.96188	0.0:0.0:1.0:0.0	.	.	.	.	X	27	.	ENSP00000282003:Q27X	Q	-	1	0	RNF219	78117127	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.260000	0.78391	2.663000	0.90544	0.655000	0.94253	CAG		0.368	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
FARP1	10160	broad.mit.edu	37	13	99083311	99083311	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr13:99083311C>A	ENST00000319562.6	+	18	2185	c.1920C>A	c.(1918-1920)caC>caA	p.H640Q	FARP1_ENST00000595437.1_Missense_Mutation_p.H640Q|FARP1_ENST00000376586.2_Missense_Mutation_p.H640Q	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	640	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H640Q(2)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGGCGGCTCACCTGTGGAAGC	0.577																																					p.H640Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1920A	13						.						46.0	52.0	50.0					13																	99083311		2203	4300	6503	97881312	SO:0001583	missense	10160	exon18			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1920C>A	13.37:g.99083311C>A	ENSP00000322926:p.His640Gln		97881312	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527122	0.64860	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.63255	-0.03;-0.03	5.42	2.74	0.32292	Dbl homology (DH) domain (5);	0.174448	0.50627	D	0.000118	T	0.68109	0.2965	M	0.66939	2.045	0.49130	D	0.999759	D;P	0.55385	0.971;0.916	P;P	0.54590	0.756;0.74	T	0.69639	-0.5091	10	0.87932	D	0	.	9.0769	0.36527	0.0:0.6808:0.0:0.3192	.	640;640	Q9Y4F1;C9JME2	FARP1_HUMAN;.	Q	640	ENSP00000365771:H640Q;ENSP00000322926:H640Q	ENSP00000322926:H640Q	H	+	3	2	FARP1	97881312	0.995000	0.38212	0.998000	0.56505	0.969000	0.65631	0.482000	0.22276	0.778000	0.33520	0.650000	0.86243	CAC		0.577	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
AHNAK2	113146	broad.mit.edu	37	14	105411713	105411713	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:105411713G>T	ENST00000333244.5	-	7	10194	c.10075C>A	c.(10075-10077)Cag>Aag	p.Q3359K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3359						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.Q3359K(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAAGGGAGCTGAATGCTGAGG	0.672																																					p.Q3359K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10075A	14						.						128.0	137.0	134.0					14																	105411713		1981	4151	6132	104482758	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10075C>A	14.37:g.105411713G>T	ENSP00000353114:p.Gln3359Lys		104482758	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	7.836	0.720943	0.15372	.	.	ENSG00000185567	ENST00000333244	T	0.01548	4.78	4.65	1.68	0.24146	.	16.400500	0.01542	N	0.019287	T	0.02727	0.0082	N	0.17474	0.49	0.09310	N	1	D	0.54047	0.964	P	0.53490	0.727	T	0.52518	-0.8565	10	0.06099	T	0.92	.	9.6703	0.40008	0.0:0.6074:0.2566:0.136	.	3359	Q8IVF2	AHNK2_HUMAN	K	3359	ENSP00000353114:Q3359K	ENSP00000353114:Q3359K	Q	-	1	0	AHNAK2	104482758	0.007000	0.16637	0.001000	0.08648	0.008000	0.06430	-1.049000	0.03514	0.055000	0.16094	0.491000	0.48974	CAG		0.672	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	broad.mit.edu	37	14	105412633	105412633	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:105412633G>A	ENST00000333244.5	-	7	9274	c.9155C>T	c.(9154-9156)cCc>cTc	p.P3052L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3052						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3052L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGCTCCCTCGGGAACGTGGCC	0.607																																					p.P3052L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9155T	14						.						107.0	113.0	111.0					14																	105412633		1935	4110	6045	104483678	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9155C>T	14.37:g.105412633G>A	ENSP00000353114:p.Pro3052Leu		104483678	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	10.47	1.358074	0.24598	.	.	ENSG00000185567	ENST00000333244	T	0.02812	4.15	4.02	0.924	0.19418	.	.	.	.	.	T	0.06416	0.0165	M	0.63428	1.95	0.09310	N	1	D	0.64830	0.994	P	0.59012	0.85	T	0.34079	-0.9843	9	0.27082	T	0.32	.	0.6399	0.00809	0.2385:0.1908:0.3755:0.1952	.	3052	Q8IVF2	AHNK2_HUMAN	L	3052	ENSP00000353114:P3052L	ENSP00000353114:P3052L	P	-	2	0	AHNAK2	104483678	0.006000	0.16342	0.002000	0.10522	0.019000	0.09904	1.598000	0.36740	0.156000	0.19299	0.485000	0.47835	CCC		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	broad.mit.edu	37	14	105414893	105414893	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:105414893G>A	ENST00000333244.5	-	7	7014	c.6895C>T	c.(6895-6897)Cgg>Tgg	p.R2299W	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2299						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.R2299R(1)|p.R2299W(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCTCCAGCCGCGCACCATCC	0.592																																					p.R2299W												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|endometrium(1)	c.C6895T	14						.						163.0	180.0	174.0					14																	105414893		2017	4186	6203	104485938	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6895C>T	14.37:g.105414893G>A	ENSP00000353114:p.Arg2299Trp		104485938	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	13.19	2.162547	0.38217	.	.	ENSG00000185567	ENST00000333244	T	0.00966	5.49	1.71	-3.42	0.04825	.	.	.	.	.	T	0.02455	0.0075	M	0.74258	2.255	0.09310	N	1	D	0.76494	0.999	P	0.61592	0.891	T	0.31641	-0.9936	9	0.54805	T	0.06	.	0.4818	0.00549	0.1976:0.149:0.2232:0.4302	.	2299	Q8IVF2	AHNK2_HUMAN	W	2299	ENSP00000353114:R2299W	ENSP00000353114:R2299W	R	-	1	2	AHNAK2	104485938	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.705000	0.05035	-0.699000	0.03677	CGG		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
SLC7A8	23428	broad.mit.edu	37	14	23635658	23635658	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:23635658C>T	ENST00000316902.7	-	2	968	c.243G>A	c.(241-243)gtG>gtA	p.V81V	SLC7A8_ENST00000469263.1_Silent_p.V81V	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	81					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)	p.V81V(1)		autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TGAAGCCCGTCACAATCCAGA	0.537																																					p.V81V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G243A	14						.						210.0	208.0	209.0					14																	23635658		2203	4300	6503	22705498	SO:0001819	synonymous_variant	23428	exon2			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.243G>A	14.37:g.23635658C>T			22705498	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Silent	SNP	ENST00000316902.7	37	CCDS9590.1																																																																																				0.537	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
SOS2	6655	broad.mit.edu	37	14	50647315	50647315	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:50647315C>A	ENST00000216373.5	-	7	1218	c.944G>T	c.(943-945)aGa>aTa	p.R315I	SOS2_ENST00000543680.1_Missense_Mutation_p.R315I|SOS2_ENST00000555794.1_5'UTR	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	315	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R315I(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					AACTGCAGGTCTGGCCATCAA	0.284																																					p.R315I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G944T	14						.						91.0	89.0	90.0					14																	50647315		2203	4300	6503	49717065	SO:0001583	missense	6655	exon7			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.944G>T	14.37:g.50647315C>A	ENSP00000216373:p.Arg315Ile		49717065	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644929	0.67358	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	D;D	0.92805	-3.11;-3.11	5.6	2.4	0.29515	Dbl homology (DH) domain (5);	0.139022	0.64402	D	0.000004	D	0.90055	0.6894	L	0.50333	1.59	0.54753	D	0.999982	P;B;B	0.40230	0.708;0.152;0.03	P;B;B	0.47705	0.555;0.091;0.043	D	0.87427	0.2386	10	0.87932	D	0	.	5.2512	0.15522	0.0:0.424:0.0:0.576	.	315;345;315	B7ZKT6;Q59G32;Q07890	.;.;SOS2_HUMAN	I	315	ENSP00000216373:R315I;ENSP00000445328:R315I	ENSP00000216373:R315I	R	-	2	0	SOS2	49717065	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.749000	0.55150	0.723000	0.32274	0.650000	0.86243	AGA		0.284	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
SPTB	6710	broad.mit.edu	37	14	65263375	65263375	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:65263375A>T	ENST00000389721.5	-	10	1273	c.1241T>A	c.(1240-1242)cTc>cAc	p.L414H	SPTB_ENST00000389720.3_Missense_Mutation_p.L414H|SPTB_ENST00000542895.1_Missense_Mutation_p.L414H|SPTB_ENST00000389722.3_Missense_Mutation_p.L414H|SPTB_ENST00000556626.1_Missense_Mutation_p.L414H	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	414					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTGCCGAATGAGCTCATTTCT	0.587																																					p.L414H												.	.	0			c.T1241A	14						.						56.0	59.0	58.0					14																	65263375		2203	4300	6503	64333128	SO:0001583	missense	6710	exon10				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1241T>A	14.37:g.65263375A>T	ENSP00000374371:p.Leu414His		64333128	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.481615	0.84747	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.87665	0.6234	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.986;0.997	D	0.90523	0.4490	10	0.87932	D	0	.	15.1534	0.72720	1.0:0.0:0.0:0.0	.	414;418	P11277;Q59FP5	SPTB1_HUMAN;.	H	418;414;414;414;414;414	ENSP00000374372:L414H;ENSP00000451752:L414H;ENSP00000374371:L414H;ENSP00000443882:L414H;ENSP00000374370:L414H	ENSP00000374370:L414H	L	-	2	0	SPTB	64333128	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	9.307000	0.96226	2.225000	0.72522	0.533000	0.62120	CTC		0.587	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
RGS6	9628	broad.mit.edu	37	14	72939626	72939626	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:72939626C>G	ENST00000553530.1	+	9	790	c.583C>G	c.(583-585)Caa>Gaa	p.Q195E	RGS6_ENST00000355512.6_Missense_Mutation_p.Q195E|RGS6_ENST00000343854.6_Missense_Mutation_p.Q195E|RGS6_ENST00000553525.1_Missense_Mutation_p.Q195E|RGS6_ENST00000554782.1_Missense_Mutation_p.Q56E|RGS6_ENST00000402788.2_Missense_Mutation_p.Q195E|RGS6_ENST00000555571.1_Missense_Mutation_p.Q195E|RGS6_ENST00000434263.2_Missense_Mutation_p.Q126E|RGS6_ENST00000404301.2_Missense_Mutation_p.Q195E|RGS6_ENST00000407322.4_Missense_Mutation_p.Q195E|RGS6_ENST00000406236.4_Missense_Mutation_p.Q195E|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000556437.1_Missense_Mutation_p.Q195E	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	195					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TTTGGATAGTCAAGAACGAGC	0.363																																					p.Q195E	Ovarian(143;1926 2468 21071 48641)											.	.	0			c.C583G	14						.						141.0	159.0	153.0					14																	72939626		2203	4300	6503	72009379	SO:0001583	missense	9628	exon9			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.583C>G	14.37:g.72939626C>G	ENSP00000452331:p.Gln195Glu		72009379	NM_004296	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707527	0.89018	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.49139	0.96;0.84;0.84;0.96;0.85;0.97;0.99;0.98;0.84;0.79;0.94;1.11	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.73055	0.3538	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.65815	0.989;0.985;0.989;0.995	D;D;D;D	0.74348	0.983;0.918;0.983;0.935	T	0.75975	-0.3128	10	0.87932	D	0	-12.8305	19.6166	0.95636	0.0:1.0:0.0:0.0	.	126;195;200;195	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	E	195;195;195;195;195;195;195;195;195;195;167;126;56;56	ENSP00000451030:Q195E;ENSP00000450936:Q195E;ENSP00000452331:Q195E;ENSP00000451855:Q195E;ENSP00000347699:Q195E;ENSP00000385243:Q195E;ENSP00000384218:Q195E;ENSP00000384612:Q195E;ENSP00000383953:Q195E;ENSP00000341199:Q195E;ENSP00000412144:Q126E;ENSP00000451912:Q56E	ENSP00000341199:Q195E	Q	+	1	0	RGS6	72009379	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.137000	0.77295	2.735000	0.93741	0.650000	0.86243	CAA		0.363	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
NGB	58157	broad.mit.edu	37	14	77734887	77734888	+	Missense_Mutation	DNP	GT	GT	CC			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:77734887_77734888GT>CC	ENST00000298352.4	-	3	616_617	c.242_243AC>GG	c.(241-243)gAC>gGG	p.D81G	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	81	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.D81>?(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		GTGAGGACAGGTCTTCCACATT	0.579																																					.												.	.	1	Complex(1)	large_intestine(1)	c.242_243GG	14						.																																			76804641	SO:0001583	missense	58157	exon3			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.242_243delinsCC	14.37:g.77734887_77734888delinsCC	ENSP00000298352:p.Asp81Gly		76804640	NM_021257		Missense_Mutation	DNP	ENST00000298352.4	37	CCDS9856.1																																																																																				0.579	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1	NM_021257	
AHNAK2	113146	broad.mit.edu	37	14	105418939	105418939	+	Missense_Mutation	SNP	G	G	A	rs137934113	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr14:105418939G>A	ENST00000333244.5	-	7	2968	c.2849C>T	c.(2848-2850)gCg>gTg	p.A950V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	950						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A950V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCACTTCCGCCTTGGGGCC	0.617													.|||	4	0.000798722	0.003	0.0	5008	,	,		17546	0.0		0.0	False		,,,				2504	0.0				p.A950V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2849T	14						.						138.0	161.0	154.0					14																	105418939		1915	4109	6024	104489984	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2849C>T	14.37:g.105418939G>A	ENSP00000353114:p.Ala950Val		104489984	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	g	1.747	-0.490242	0.04322	.	.	ENSG00000185567	ENST00000333244	T	0.00902	5.56	2.43	-4.87	0.03123	.	.	.	.	.	T	0.00412	0.0013	N	0.05574	-0.02	0.09310	N	1	B	0.27068	0.167	B	0.33392	0.163	T	0.45542	-0.9254	9	0.10111	T	0.7	-1.06	5.6826	0.17784	0.4409:0.2058:0.3532:0.0	.	950	Q8IVF2	AHNK2_HUMAN	V	950	ENSP00000353114:A950V	ENSP00000353114:A950V	A	-	2	0	AHNAK2	104489984	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.938000	0.00684	-0.896000	0.03915	-1.797000	0.00622	GCG		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
POTEB2	100287399	broad.mit.edu	37	15	21071578	21071578	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:21071578G>A	ENST00000454856.4	-	1	65	c.33C>T	c.(31-33)gcC>gcT	p.A11A		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	11								p.A11A(1)									TCACAGCAGAGGCAGCGGGCA	0.577																																					p.A11A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C33T	15						.						1.0	1.0	1.0					15																	21071578		3	5	8	19336268	SO:0001819	synonymous_variant	339010	exon1				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.33C>T	15.37:g.21071578G>A			19336268	NM_207355		Silent	SNP	ENST00000454856.4	37	CCDS59248.1																																																																																				0.577	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
LPCAT4	254531	broad.mit.edu	37	15	34657390	34657391	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:34657390_34657391CA>AG	ENST00000314891.6	-	3	473_474	c.296_297TG>CT	c.(295-297)cTG>cCT	p.L99P	LPCAT4_ENST00000562431.1_5'UTR	NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	99					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)	p.L99>?(1)		NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						GGAAAAACAGCAGGCGGCTCAG	0.629																																					.												.	.	1	Complex(1)	large_intestine(1)	c.296_297CT	15						.																																			32444683	SO:0001583	missense	254531	exon3			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.296_297delinsAG	15.37:g.34657390_34657391delinsAG	ENSP00000317300:p.Leu99Pro		32444682	NM_153613	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	DNP	ENST00000314891.6	37	CCDS32191.1																																																																																				0.629	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613	
THBS1	7057	broad.mit.edu	37	15	39882090	39882090	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:39882090G>A	ENST00000260356.5	+	13	2176	c.2011G>A	c.(2011-2013)Gac>Aac	p.D671N		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	671	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.D671N(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CCACTATAGCGACCCCATGTA	0.602																																					p.D671N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2011A	15						.						111.0	92.0	99.0					15																	39882090		2200	4297	6497	37669382	SO:0001583	missense	7057	exon13				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2011G>A	15.37:g.39882090G>A	ENSP00000260356:p.Asp671Asn		37669382	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769599	0.90020	.	.	ENSG00000137801	ENST00000260356	T	0.78246	-1.16	5.99	5.99	0.97316	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.197777	0.24991	N	0.033988	T	0.79770	0.4503	L	0.47078	1.49	0.80722	D	1	D;P	0.56746	0.977;0.538	P;B	0.50049	0.629;0.103	T	0.75241	-0.3387	10	0.26408	T	0.33	-35.0021	20.4488	0.99124	0.0:0.0:1.0:0.0	.	586;671	B4E3J7;P07996	.;TSP1_HUMAN	N	671	ENSP00000260356:D671N	ENSP00000260356:D671N	D	+	1	0	THBS1	37669382	1.000000	0.71417	0.972000	0.41901	0.983000	0.72400	9.869000	0.99810	2.843000	0.97960	0.655000	0.94253	GAC		0.602	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
SLC27A2	11001	broad.mit.edu	37	15	50497460	50497460	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:50497460A>C	ENST00000267842.5	+	4	1104	c.872A>C	c.(871-873)aAa>aCa	p.K291T	SLC27A2_ENST00000380902.4_Missense_Mutation_p.K238T|SLC27A2_ENST00000544960.1_Missense_Mutation_p.K56T	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	291					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.K291T(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		TTGCGGACTAAATTTTCAGCC	0.408																																					p.K238T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A713C	15						.						136.0	122.0	127.0					15																	50497460		2196	4295	6491	48284752	SO:0001583	missense	11001	exon3			D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.872A>C	15.37:g.50497460A>C	ENSP00000267842:p.Lys291Thr		48284752	NM_001159629	A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	ENST00000267842.5	37	CCDS10133.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243282	0.79912	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.50277	0.75;0.9;0.9	5.13	5.13	0.70059	AMP-dependent synthetase/ligase (1);	0.049854	0.85682	D	0.000000	T	0.73426	0.3585	M	0.93241	3.395	0.80722	D	1	D;P	0.53462	0.96;0.911	P;P	0.61940	0.896;0.702	T	0.80832	-0.1206	10	0.87932	D	0	.	12.9481	0.58384	1.0:0.0:0.0:0.0	.	238;291	Q6PF09;O14975	.;S27A2_HUMAN	T	238;291;56	ENSP00000370289:K238T;ENSP00000267842:K291T;ENSP00000444549:K56T	ENSP00000267842:K291T	K	+	2	0	SLC27A2	48284752	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.487000	0.60293	2.163000	0.67991	0.460000	0.39030	AAA		0.408	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	NM_003645	
FAM214A	56204	broad.mit.edu	37	15	52901670	52901670	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:52901670C>T	ENST00000261844.7	-	6	1593	c.1441G>A	c.(1441-1443)Gag>Aag	p.E481K	FAM214A_ENST00000546305.2_Missense_Mutation_p.E488K	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	481								p.E481K(1)									TCTTGCCGCTCCTGGAGTAAA	0.428																																					p.E481K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1441A	15						.						128.0	124.0	125.0					15																	52901670		1908	4125	6033	50688962	SO:0001583	missense	56204	exon6			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1441G>A	15.37:g.52901670C>T	ENSP00000261844:p.Glu481Lys		50688962	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	ENST00000261844.7	37	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567012	0.86439	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.51817	0.69;0.69	5.78	5.78	0.91487	.	0.344098	0.34110	N	0.004259	T	0.63698	0.2533	L	0.43923	1.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.62905	-0.6755	10	0.66056	D	0.02	.	18.5469	0.91050	0.0:1.0:0.0:0.0	.	488;481	F5H8G0;Q32MH5	.;K1370_HUMAN	K	481;481;480;488	ENSP00000261844:E481K;ENSP00000443598:E488K	ENSP00000261844:E481K	E	-	1	0	KIAA1370	50688962	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.617000	0.61204	2.894000	0.99253	0.655000	0.94253	GAG		0.428	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
IGDCC4	57722	broad.mit.edu	37	15	65681312	65681312	+	Silent	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:65681312G>T	ENST00000352385.2	-	15	2750	c.2541C>A	c.(2539-2541)ccC>ccA	p.P847P		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	847						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P847P(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGGTGTGGAGGGCCCTGGGG	0.632																																					p.P847P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2541A	15						.						14.0	13.0	14.0					15																	65681312		2183	4271	6454	63468365	SO:0001819	synonymous_variant	57722	exon15				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2541C>A	15.37:g.65681312G>T			63468365	NM_020962	Q9HCE4	Silent	SNP	ENST00000352385.2	37	CCDS10206.1																																																																																				0.632	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
SH2D7	646892	broad.mit.edu	37	15	78393560	78393560	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:78393560G>T	ENST00000328828.5	+	5	965	c.965G>T	c.(964-966)gGa>gTa	p.G322V	SH2D7_ENST00000409568.2_Missense_Mutation_p.G186V	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	322								p.G186V(1)		endometrium(2)|kidney(2)|lung(3)	7						GATGCCATGGGATCCCTGGGG	0.607																																					p.G322V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G965T	15						.						17.0	19.0	19.0					15																	78393560		1870	4116	5986	76180615	SO:0001583	missense	646892	exon5				CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.965G>T	15.37:g.78393560G>T	ENSP00000327846:p.Gly322Val		76180615	NM_001101404		Missense_Mutation	SNP	ENST00000328828.5	37	CCDS45315.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.973937	0.53720	.	.	ENSG00000183476	ENST00000409568;ENST00000328828	T;T	0.66099	-0.19;-0.02	4.27	4.27	0.50696	.	0.675735	0.12230	N	0.487576	T	0.68650	0.3024	L	0.29908	0.895	0.27755	N	0.944029	D	0.89917	1.0	D	0.74023	0.982	T	0.60880	-0.7175	10	0.72032	D	0.01	-10.9202	12.393	0.55368	0.0:0.0:1.0:0.0	.	322	A6NKC9	SH2D7_HUMAN	V	186;322	ENSP00000386676:G186V;ENSP00000327846:G322V	ENSP00000327846:G322V	G	+	2	0	SH2D7	76180615	0.843000	0.29541	0.062000	0.19696	0.046000	0.14306	2.649000	0.46656	2.371000	0.80710	0.655000	0.94253	GGA		0.607	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334660.2	NM_001101404	
ADAMTSL3	57188	broad.mit.edu	37	15	84651360	84651361	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr15:84651360_84651361AA>CT	ENST00000286744.5	+	21	3204_3205	c.2980_2981AA>CT	c.(2980-2982)AAg>CTg	p.K994L	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.K994L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	994						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K994>?(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGTTGTGCTCAAGCTCATTGGT	0.554																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2980_2981CT	15						.																																			82442365	SO:0001583	missense	57188	exon21			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	Exception_encountered	15.37:g.84651360_84651361delinsCT	ENSP00000286744:p.Lys994Leu		82442364	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	DNP	ENST00000286744.5	37	CCDS10326.1																																																																																				0.554	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
USP31	57478	broad.mit.edu	37	16	23080134	23080135	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:23080134_23080135CC>AT	ENST00000219689.7	-	16	3290_3291	c.3291_3292GG>AT	c.(3289-3294)aaGGag>aaATag	p.E1098*	USP31_ENST00000567975.1_Nonsense_Mutation_p.E391*	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.K1097>?(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GGGGATGACTCCTTTTTGGGTT	0.564																																					.												.	.	1	Complex(1)	large_intestine(1)	c.3291_3292AT	16						.																																			22987636	SO:0001587	stop_gained	57478	exon16			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.3291_3292delinsAT	16.37:g.23080134_23080135delinsAT	ENSP00000219689:p.Glu1098*		22987635	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Nonsense_Mutation	DNP	ENST00000219689.7	37	CCDS10607.1																																																																																				0.564	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
CACNG3	10368	broad.mit.edu	37	16	24366258	24366258	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:24366258G>A	ENST00000005284.3	+	3	1602	c.400G>A	c.(400-402)Gtc>Atc	p.V134I		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	134					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.V134I(2)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CAGACACAACGTCATTCTCAG	0.582																																					p.V134I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G400A	16						.						63.0	55.0	58.0					16																	24366258		2197	4300	6497	24273759	SO:0001583	missense	10368	exon3			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.400G>A	16.37:g.24366258G>A	ENSP00000005284:p.Val134Ile		24273759	NM_006539		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381210	0.24944	.	.	ENSG00000006116	ENST00000005284	T	0.80653	-1.4	5.41	5.41	0.78517	.	0.064498	0.64402	D	0.000010	T	0.54351	0.1853	N	0.00926	-1.1	0.54753	D	0.99998	B	0.23806	0.091	B	0.23852	0.049	T	0.61282	-0.7094	10	0.02654	T	1	-25.1551	18.9864	0.92771	0.0:0.0:1.0:0.0	.	134	O60359	CCG3_HUMAN	I	134	ENSP00000005284:V134I	ENSP00000005284:V134I	V	+	1	0	CACNG3	24273759	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.533000	0.53561	2.815000	0.96918	0.561000	0.74099	GTC		0.582	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
TMEM219	124446	broad.mit.edu	37	16	29979545	29979546	+	Missense_Mutation	DNP	AG	AG	TA			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:29979545_29979546AG>TA	ENST00000566848.1	+	3	1022_1023	c.555_556AG>TA	c.(553-558)gaAGgc>gaTAgc	p.185_186EG>DS	TMEM219_ENST00000561899.2_Missense_Mutation_p.185_186EG>DS|TMEM219_ENST00000414689.2_Missense_Mutation_p.185_186EG>DS|TMEM219_ENST00000279396.6_Missense_Mutation_p.185_186EG>DS			Q86XT9	TM219_HUMAN	transmembrane protein 219	185					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E185>?(1)		large_intestine(1)|lung(1)|prostate(2)	4						GGAGCCATGAAGGCCTTGTGCT	0.569																																					.												.	.	1	Complex(1)	large_intestine(1)	c.555_556TA	16						.																																			29887047	SO:0001583	missense	124446	exon4				CCDS42145.1	16p11.2	2008-08-08			ENSG00000149932	ENSG00000149932			25201	protein-coding gene	gene with protein product							Standard	NM_194280		Approved		uc010bzk.1	Q86XT9		Exception_encountered	16.37:g.29979545_29979546delinsTA	ENSP00000457492:p.E185_G186delinsDS		29887046	NM_194280	D5FK14|Q8WVV8	Missense_Mutation	DNP	ENST00000566848.1	37	CCDS42145.1																																																																																				0.569	TMEM219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435307.1	NM_001083613	
PRSS8	5652	broad.mit.edu	37	16	31143863	31143863	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:31143863G>A	ENST00000317508.6	-	5	855	c.592C>T	c.(592-594)Cgt>Tgt	p.R198C	RP11-388M20.2_ENST00000563605.1_RNA|PRSS8_ENST00000568261.1_Missense_Mutation_p.R144C	NM_002773.3	NP_002764.1	Q16651	PRSS8_HUMAN	protease, serine, 8	198	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of sodium ion transport (GO:0010765)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R198C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	8						CACGTCTCACGACTGATCAGA	0.592																																					p.R198C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C592T	16						.						99.0	106.0	104.0					16																	31143863		2128	4241	6369	31051364	SO:0001583	missense	5652	exon5			U33446	CCDS45469.1	16p11.2	2010-05-07	2007-02-21			ENSG00000052344		"""Serine peptidases / Serine peptidases"""	9491	protein-coding gene	gene with protein product	"""prostasin"""	600823				8838796, 7768952	Standard	NM_002773		Approved		uc002ebc.4	Q16651		ENST00000317508.6:c.592C>T	16.37:g.31143863G>A	ENSP00000319730:p.Arg198Cys		31051364	NM_002773	B4DWP2|Q9UCA3	Missense_Mutation	SNP	ENST00000317508.6	37	CCDS45469.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.593717	0.28445	.	.	ENSG00000052344	ENST00000317508;ENST00000419768	D	0.89746	-2.56	5.43	4.47	0.54385	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	D	0.000030	D	0.93979	0.8072	M	0.80616	2.505	0.19300	N	0.999972	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.967	D	0.88492	0.3076	10	0.66056	D	0.02	.	14.4217	0.67187	0.0:0.0:0.851:0.149	.	144;198	B4DWP2;Q16651	.;PRSS8_HUMAN	C	198;116	ENSP00000319730:R198C	ENSP00000319730:R198C	R	-	1	0	PRSS8	31051364	0.034000	0.19679	0.055000	0.19348	0.000000	0.00434	2.148000	0.42235	1.278000	0.44430	-0.181000	0.13052	CGT		0.592	PRSS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433536.1	NM_002773	
ABCC11	85320	broad.mit.edu	37	16	48221292	48221292	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:48221292C>T	ENST00000394747.1	-	20	3102	c.2753G>A	c.(2752-2754)cGg>cAg	p.R918Q	ABCC11_ENST00000394748.1_Missense_Mutation_p.R918Q|ABCC11_ENST00000356608.2_Missense_Mutation_p.R918Q|ABCC11_ENST00000537808.1_3'UTR|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000353782.5_Missense_Mutation_p.R918Q	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	918	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.R918Q(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GTTCAAAAGCCGGCCTATTGG	0.542																																					p.R918Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2753A	16						.						43.0	41.0	41.0					16																	48221292		2201	4300	6501	46778793	SO:0001583	missense	85320	exon21			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.2753G>A	16.37:g.48221292C>T	ENSP00000378230:p.Arg918Gln		46778793	NM_145186	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	C	35	5.505277	0.96371	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55	5.02	0.022	0.14131	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.221345	0.37857	N	0.001915	D	0.95695	0.8600	M	0.88704	2.975	0.26905	N	0.967037	P;D	0.64830	0.545;0.994	B;P	0.58520	0.039;0.84	D	0.90135	0.4209	10	0.72032	D	0.01	-0.3179	4.6118	0.12406	0.0:0.5199:0.1554:0.3247	.	918;918	Q96J66-2;Q96J66	.;ABCCB_HUMAN	Q	918	ENSP00000311326:R918Q;ENSP00000349017:R918Q;ENSP00000378231:R918Q;ENSP00000378230:R918Q	ENSP00000311326:R918Q	R	-	2	0	ABCC11	46778793	0.333000	0.24731	0.005000	0.12908	0.850000	0.48378	1.102000	0.31050	-0.155000	0.11098	0.563000	0.77884	CGG		0.542	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
GNAO1	2775	broad.mit.edu	37	16	56362585	56362586	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:56362585_56362586GA>AG	ENST00000262493.6	+	4	1192_1193	c.346_347GA>AG	c.(346-348)GAc>AGc	p.D116S	GNAO1_ENST00000262494.7_Missense_Mutation_p.D116S	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	116					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.D116>?(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				TCGGATGGAAGACACCGAGCCC	0.584																																					.												.	.	2	Complex(2)	large_intestine(2)	c.346_347AG	16						.																																			54920087	SO:0001583	missense	2775	exon4				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	Exception_encountered	16.37:g.56362585_56362586delinsAG	ENSP00000262493:p.Asp116Ser		54920086	NM_138736	P29777|Q8TD72|Q9UMV4	Missense_Mutation	DNP	ENST00000262493.6	37	CCDS10756.1																																																																																				0.584	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988	
TRADD	8717	broad.mit.edu	37	16	67190433	67190433	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:67190433G>A	ENST00000345057.4	-	2	599	c.131C>T	c.(130-132)gCt>gTt	p.A44V	TRADD_ENST00000486556.1_5'Flank|TRADD_ENST00000566104.1_5'UTR	NM_003789.3	NP_003780.1	Q15628	TRADD_HUMAN	TNFRSF1A-associated via death domain	44					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic process (GO:0043065)|positive regulation of hair follicle development (GO:0051798)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|nucleus (GO:0005634)|receptor complex (GO:0043235)	binding, bridging (GO:0060090)|death domain binding (GO:0070513)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|signal transducer activity (GO:0004871)	p.A44V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		AGCCTGCAGAGCCCTGTACAC	0.627											OREG0023872	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A44V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C131T	16						.						85.0	73.0	77.0					16																	67190433		2198	4300	6498	65747934	SO:0001583	missense	8717	exon2			L41690	CCDS10829.1	16q22	2008-07-28			ENSG00000102871	ENSG00000102871			12030	protein-coding gene	gene with protein product		603500				7758105	Standard	NM_003789		Approved	Hs.89862	uc002eri.1	Q15628	OTTHUMG00000137519	ENST00000345057.4:c.131C>T	16.37:g.67190433G>A	ENSP00000341268:p.Ala44Val	1097	65747934	NM_003789	B2RDS3|B3KQZ9|Q52NZ1	Missense_Mutation	SNP	ENST00000345057.4	37	CCDS10829.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628222	0.66901	.	.	ENSG00000102871	ENST00000345057	.	.	.	4.63	3.65	0.41850	TRADD, N-terminal (3);	0.061996	0.64402	D	0.000004	T	0.63094	0.2482	M	0.62723	1.935	0.80722	D	1	D;P	0.60160	0.987;0.621	P;B	0.57283	0.817;0.012	T	0.59156	-0.7507	9	0.27785	T	0.31	-8.3334	8.8893	0.35423	0.1055:0.0:0.8945:0.0	.	44;44	B4DWM0;Q15628	.;TRADD_HUMAN	V	44	.	ENSP00000341268:A44V	A	-	2	0	TRADD	65747934	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.366000	0.44204	2.422000	0.82143	0.462000	0.41574	GCT		0.627	TRADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268841.2		
VPS9D1	9605	broad.mit.edu	37	16	89783152	89783152	+	Missense_Mutation	SNP	G	G	T	rs573886338		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr16:89783152G>T	ENST00000389386.3	-	3	378	c.254C>A	c.(253-255)aCg>aAg	p.T85K	VPS9D1-AS1_ENST00000562866.1_RNA|VPS9D1-AS1_ENST00000562298.1_RNA|VPS9D1_ENST00000561976.1_Missense_Mutation_p.T15K	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	85					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										CTTGGCGGCCGTCGACTGGGC	0.647																																					p.T85K												.	.	0			c.C254A	16						.						22.0	27.0	26.0					16																	89783152		1929	4115	6044	88310653	SO:0001583	missense	9605	exon3			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.254C>A	16.37:g.89783152G>T	ENSP00000374037:p.Thr85Lys		88310653	NM_004913		Missense_Mutation	SNP	ENST00000389386.3	37	CCDS42220.1	.	.	.	.	.	.	.	.	.	.	g	13.71	2.318461	0.40996	.	.	ENSG00000075399	ENST00000389386;ENST00000261625	.	.	.	5.21	5.21	0.72293	.	0.229268	0.45606	D	0.000343	T	0.62208	0.2409	M	0.64997	1.995	0.20074	N	0.999939	D	0.89917	1.0	D	0.65010	0.931	T	0.57505	-0.7800	9	0.72032	D	0.01	-6.0327	11.8635	0.52480	0.0852:0.0:0.9148:0.0	.	85	Q9Y2B5	CP007_HUMAN	K	85;116	.	ENSP00000261625:T116K	T	-	2	0	C16orf7	88310653	1.000000	0.71417	0.080000	0.20451	0.161000	0.22273	3.250000	0.51445	2.428000	0.82296	0.479000	0.44913	ACG		0.647	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422508.1	NM_004913	
SERPINF1	5176	broad.mit.edu	37	17	1680698	1680699	+	Missense_Mutation	DNP	CC	CC	GA			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:1680698_1680699CC>GA	ENST00000254722.4	+	8	1378_1379	c.1215_1216CC>GA	c.(1213-1218)gcCCtt>gcGAtt	p.L406I		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	406					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A405>?(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						ACACAGGGGCCCTTCTCTTCAT	0.55																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1215_1216GA	17						.																																			1627449	SO:0001583	missense	5176	exon8			M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	Exception_encountered	17.37:g.1680698_1680699delinsGA	ENSP00000254722:p.Leu406Ile		1627448	NM_002615	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	DNP	ENST00000254722.4	37	CCDS11012.1																																																																																				0.550	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
MAPK7	5598	broad.mit.edu	37	17	19284498	19284498	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:19284498C>T	ENST00000308406.5	+	4	1362	c.976C>T	c.(976-978)Cgc>Tgc	p.R326C	MAPK7_ENST00000395604.3_Missense_Mutation_p.R326C|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395602.4_Missense_Mutation_p.R326C|MAPK7_ENST00000299612.7_Missense_Mutation_p.R187C|MAPK7_ENST00000571657.1_Intron	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	326	Necessary for oligomerization. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.R326C(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					ACTGCTGGGTCGCATGCTGCG	0.627																																					p.R326C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C976T	17						.						53.0	54.0	54.0					17																	19284498		2203	4300	6503	19225091	SO:0001583	missense	5598	exon4			U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.976C>T	17.37:g.19284498C>T	ENSP00000311005:p.Arg326Cys		19225091	NM_139033	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823713	0.32237	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.04	-0.00745	0.14009	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.495923	0.22448	N	0.059927	T	0.59018	0.2163	M	0.74881	2.28	0.26499	N	0.974792	B	0.12630	0.006	B	0.06405	0.002	T	0.56202	-0.8018	10	0.87932	D	0	-4.9273	4.6065	0.12380	0.4183:0.3987:0.0:0.1831	.	326	Q13164	MK07_HUMAN	C	326;187;326;326	ENSP00000311005:R326C;ENSP00000299612:R187C;ENSP00000378968:R326C;ENSP00000378966:R326C	ENSP00000299612:R187C	R	+	1	0	MAPK7	19225091	0.148000	0.22702	0.781000	0.31783	0.977000	0.68977	0.523000	0.22925	0.134000	0.18681	0.561000	0.74099	CGC		0.627	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
GAS2L2	246176	broad.mit.edu	37	17	34074210	34074210	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:34074210G>T	ENST00000254466.6	-	5	937	c.910C>A	c.(910-912)Cag>Aag	p.Q304K	GAS2L2_ENST00000587565.1_Missense_Mutation_p.Q288K	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	304					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.Q304K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGCTGGGTCTGTGAGGGTCCA	0.602																																					p.Q304K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910A	17						.						136.0	141.0	140.0					17																	34074210		2203	4300	6503	31098323	SO:0001583	missense	246176	exon5			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.910C>A	17.37:g.34074210G>T	ENSP00000254466:p.Gln304Lys		31098323	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331613	0.24167	.	.	ENSG00000132139	ENST00000254466	T	0.16196	2.36	4.83	3.86	0.44501	.	0.258978	0.29822	N	0.011120	T	0.14098	0.0341	L	0.41710	1.295	0.09310	N	0.999999	B	0.09022	0.002	B	0.08055	0.003	T	0.17198	-1.0377	10	0.25751	T	0.34	-4.6635	11.6089	0.51047	0.0:0.0:0.8215:0.1785	.	304	Q8NHY3	GA2L2_HUMAN	K	304	ENSP00000254466:Q304K	ENSP00000254466:Q304K	Q	-	1	0	GAS2L2	31098323	0.898000	0.30612	0.012000	0.15200	0.548000	0.35241	1.964000	0.40462	1.251000	0.43983	0.561000	0.74099	CAG		0.602	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
FAM64A	54478	broad.mit.edu	37	17	6350861	6350861	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:6350861G>T	ENST00000250056.8	+	3	456	c.373G>T	c.(373-375)Gca>Tca	p.A125S	FAM64A_ENST00000572595.2_Missense_Mutation_p.A156S|FAM64A_ENST00000576056.1_Missense_Mutation_p.A125S|FAM64A_ENST00000572447.1_Missense_Mutation_p.A125S|FAM64A_ENST00000571373.1_Missense_Mutation_p.A125S|FAM64A_ENST00000570337.2_Missense_Mutation_p.A125S	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	125					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.A125S(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		GAAGAGAGGAGCACAGAAGGG	0.622																																					p.A125S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373T	17						.						63.0	71.0	68.0					17																	6350861		2203	4300	6503	6291585	SO:0001583	missense	54478	exon3				CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.373G>T	17.37:g.6350861G>T	ENSP00000250056:p.Ala125Ser		6291585	NM_019013	Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	ENST00000250056.8	37	CCDS56016.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438204	0.25900	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.56275	0.47	4.58	1.44	0.22558	.	1.205350	0.05906	N	0.630892	T	0.44767	0.1309	L	0.45137	1.4	0.09310	N	1	P;B	0.38300	0.626;0.229	B;B	0.40782	0.34;0.117	T	0.29366	-1.0014	10	0.22706	T	0.39	0.0761	4.7928	0.13257	0.1966:0.1778:0.6256:0.0	.	125;125	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	S	125	ENSP00000250056:A125S	ENSP00000250056:A125S	A	+	1	0	FAM64A	6291585	0.270000	0.24152	0.004000	0.12327	0.298000	0.27526	0.942000	0.29017	0.267000	0.21916	0.563000	0.77884	GCA		0.622	FAM64A-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439156.1	NM_019013	
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				p.R273H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1 	.	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	c.G818A	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	.						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		7517845	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7689992	7689992	+	Silent	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:7689992G>C	ENST00000572933.1	+	41	7913	c.6453G>C	c.(6451-6453)cgG>cgC	p.R2151R	DNAH2_ENST00000389173.2_Silent_p.R2151R			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2151	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2151R(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTGTCATGCGGACGGCATGTG	0.552																																					p.R2151R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6453C	17						.						95.0	85.0	88.0					17																	7689992		2203	4300	6503	7630717	SO:0001819	synonymous_variant	146754	exon40			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6453G>C	17.37:g.7689992G>C			7630717	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
HEATR9	256957	broad.mit.edu	37	17	34192300	34192301	+	Missense_Mutation	DNP	TA	TA	GT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	TA	TA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr17:34192300_34192301TA>GT	ENST00000311880.2	-	3	386_387	c.238_239TA>AC	c.(238-240)TAc>ACc	p.Y80T	C17orf66_ENST00000592980.1_Missense_Mutation_p.Y80T|C17orf66_ENST00000587585.1_5'UTR	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		80					hematopoietic progenitor cell differentiation (GO:0002244)			p.Y80>?(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCAGTGCGTGTAGATCTCAGGT	0.52																																					.												.	.	1	Complex(1)	large_intestine(1)	c.238_239AC	17						.																																			31216414	SO:0001583	missense	256957	exon3																														ENST00000311880.2:c.238_239delinsGT	17.37:g.34192300_34192301delinsGT	ENSP00000309560:p.Tyr80Thr		31216413	NM_152781	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Missense_Mutation	DNP	ENST00000311880.2	37	CCDS11299.1																																																																																				0.520	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
ROCK1	6093	broad.mit.edu	37	18	18608741	18608741	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr18:18608741G>A	ENST00000399799.2	-	10	2147	c.1207C>T	c.(1207-1209)Cgt>Tgt	p.R403C		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	403	AGC-kinase C-terminal.|Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R403C(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ACTTACCTACGATTGCTATAA	0.303																																					p.R403C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1207T	18						.						105.0	102.0	103.0					18																	18608741		2203	4300	6503	16862739	SO:0001583	missense	6093	exon10				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1207C>T	18.37:g.18608741G>A	ENSP00000382697:p.Arg403Cys		16862739	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975051	0.74360	.	.	ENSG00000067900	ENST00000399799	T	0.25414	1.8	5.67	4.8	0.61643	AGC-kinase, C-terminal (1);	0.235420	0.42964	N	0.000629	T	0.23133	0.0559	N	0.17082	0.46	0.58432	D	0.999994	D	0.65815	0.995	P	0.49799	0.622	T	0.02417	-1.1162	10	0.38643	T	0.18	.	13.747	0.62881	0.0:0.0:0.7202:0.2798	.	403	Q13464	ROCK1_HUMAN	C	403	ENSP00000382697:R403C	ENSP00000382697:R403C	R	-	1	0	ROCK1	16862739	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.465000	0.53064	1.374000	0.46228	0.655000	0.94253	CGT		0.303	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
ESCO1	114799	broad.mit.edu	37	18	19112576	19112576	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr18:19112576C>T	ENST00000269214.5	-	11	3170	c.2233G>A	c.(2233-2235)Gaa>Aaa	p.E745K		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	745					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						ACTTTTTCTTCTTCTGACCTG	0.393																																					p.E745K												.	.	0			c.G2233A	18						.						144.0	137.0	140.0					18																	19112576		2203	4300	6503	17366574	SO:0001583	missense	114799	exon11			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2233G>A	18.37:g.19112576C>T	ENSP00000269214:p.Glu745Lys		17366574	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.713621	0.48517	.	.	ENSG00000141446	ENST00000269214	T	0.58358	0.34	5.73	4.75	0.60458	.	0.290468	0.36066	N	0.002808	T	0.18841	0.0452	N	0.02539	-0.55	0.40082	D	0.976142	B	0.24533	0.105	B	0.18263	0.021	T	0.31779	-0.9931	10	0.07325	T	0.83	-25.1278	3.7708	0.08640	0.0:0.666:0.0:0.334	.	745	Q5FWF5	ESCO1_HUMAN	K	745	ENSP00000269214:E745K	ENSP00000269214:E745K	E	-	1	0	ESCO1	17366574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.750000	0.55157	2.709000	0.92574	0.655000	0.94253	GAA		0.393	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
SMAD4	4089	broad.mit.edu	37	18	48604717	48604717	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr18:48604717C>G	ENST00000342988.3	+	12	2077	c.1539C>G	c.(1537-1539)taC>taG	p.Y513*	SMAD4_ENST00000588745.1_Nonsense_Mutation_p.Y417*|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.Y513*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	513	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.Y513*(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GACCGGATTACCCAAGACAGA	0.488																																					p.Y513X												.	.	39	Whole gene deletion(36)|Unknown(2)|Substitution - Nonsense(1)	pancreas(26)|large_intestine(4)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.C1539G	18						.						106.0	99.0	101.0					18																	48604717		2203	4300	6503	46858715	SO:0001587	stop_gained	4089	exon12			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1539C>G	18.37:g.48604717C>G	ENSP00000341551:p.Tyr513*		46858715	NM_005359	A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	41	8.689047	0.98916	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.08	4.32	0.51571	.	0.055871	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7619	0.40537	0.0:0.7792:0.0:0.2208	.	.	.	.	X	513	.	ENSP00000341551:Y513X	Y	+	3	2	SMAD4	46858715	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.048000	0.41278	0.915000	0.36847	0.655000	0.94253	TAC		0.488	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
GNA15	2769	broad.mit.edu	37	19	3155864	3155865	+	Missense_Mutation	DNP	AT	AT	CC			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AT	AT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:3155864_3155865AT>CC	ENST00000262958.3	+	5	916_917	c.658_659AT>CC	c.(658-660)ATc>CCc	p.I220P	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	220					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.I220>?(1)		large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		TAAGAAATGGATCCATTGTTTC	0.594																																					.												.	.	1	Complex(1)	large_intestine(1)	c.658_659CC	19						.																																			3106865	SO:0001583	missense	2769	exon5				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		Exception_encountered	19.37:g.3155864_3155865delinsCC	ENSP00000262958:p.Ile220Pro		3106864	NM_002068	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	DNP	ENST00000262958.3	37	CCDS12104.1																																																																																				0.594	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068	
FFAR2	2867	broad.mit.edu	37	19	35940951	35940952	+	Missense_Mutation	DNP	CT	CT	GG			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:35940951_35940952CT>GG	ENST00000599180.2	+	2	415_416	c.335_336CT>GG	c.(334-336)gCT>gGG	p.A112G	FFAR2_ENST00000601590.1_Intron|FFAR2_ENST00000246549.2_Missense_Mutation_p.A112G			O15552	FFAR2_HUMAN	free fatty acid receptor 2	112					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.A112>?(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGGGAGTGGCTTTCCCCGTGC	0.589																																					.	GBM(40;139 809 9833 23358 48736)											.	.	1	Complex(1)	large_intestine(1)	c.335_336GG	19						.																																			40632792	SO:0001583	missense	2867	exon1			AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		Exception_encountered	19.37:g.35940951_35940952delinsGG	ENSP00000473159:p.Ala112Gly		40632791	NM_005306	B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	Missense_Mutation	DNP	ENST00000599180.2	37	CCDS12461.1																																																																																				0.589	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	NM_005306	
ZNF781	163115	broad.mit.edu	37	19	38160094	38160094	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:38160094C>T	ENST00000590008.1	-	5	1808	c.956G>A	c.(955-957)aGa>aAa	p.R319K	ZNF781_ENST00000593040.1_5'Flank|ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000358582.4_Missense_Mutation_p.R319K			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R319K(1)		NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						TGAAGGCCTTCTTGCATTACT	0.383																																					p.R319K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G956A	19						.						153.0	147.0	149.0					19																	38160094		2203	4300	6503	42851934	SO:0001583	missense	163115	exon4			AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.956G>A	19.37:g.38160094C>T	ENSP00000466370:p.Arg319Lys		42851934	NM_152605	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	37	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	C	0.468	-0.885684	0.02511	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.05258	3.47	2.32	-1.36	0.09085	.	.	.	.	.	T	0.02342	0.0072	N	0.05230	-0.09	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.46442	-0.9191	9	0.02654	T	1	0.03	7.4553	0.27264	0.0:0.6162:0.0:0.3838	.	319	Q8N8C0	ZN781_HUMAN	K	319	ENSP00000351391:R319K	ENSP00000351391:R319K	R	-	2	0	ZNF781	42851934	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-0.577000	0.05847	-0.095000	0.12351	0.543000	0.68304	AGA		0.383	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
ZC3H4	23211	broad.mit.edu	37	19	47589744	47589744	+	Missense_Mutation	SNP	G	G	C	rs368184376		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:47589744G>C	ENST00000253048.5	-	6	804	c.767C>G	c.(766-768)tCg>tGg	p.S256W	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	256	Gly-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S256W(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GCGGCCTCGCGATCCTCCACG	0.657																																					p.S256W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C767G	19						.						46.0	53.0	51.0					19																	47589744		1969	4129	6098	52281584	SO:0001583	missense	23211	exon6			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.767C>G	19.37:g.47589744G>C	ENSP00000253048:p.Ser256Trp		52281584	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375844	0.42105	.	.	ENSG00000130749	ENST00000253048	T	0.18960	2.18	5.12	5.12	0.69794	.	0.695783	0.11651	U	0.542833	T	0.12603	0.0306	N	0.08118	0	0.21105	N	0.999786	D	0.57899	0.981	P	0.44811	0.461	T	0.05632	-1.0873	10	0.37606	T	0.19	.	8.2393	0.31650	0.1715:0.0:0.8285:0.0	.	256	Q9UPT8	ZC3H4_HUMAN	W	256	ENSP00000253048:S256W	ENSP00000253048:S256W	S	-	2	0	ZC3H4	52281584	0.998000	0.40836	0.914000	0.36105	0.992000	0.81027	3.684000	0.54671	2.540000	0.85666	0.655000	0.94253	TCG		0.657	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
FUT1	2523	broad.mit.edu	37	19	49253951	49253951	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:49253951C>T	ENST00000310160.3	-	4	1562	c.588G>A	c.(586-588)caG>caA	p.Q196Q	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	196					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)	p.Q196Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CCAGCACACTCTGCGCCTCTT	0.642																																					p.Q196Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G588A	19						.						100.0	102.0	101.0					19																	49253951		2202	4298	6500	53945763	SO:0001819	synonymous_variant	2523	exon4				CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.588G>A	19.37:g.49253951C>T			53945763	NM_000148	O14505|O14506|O14507	Silent	SNP	ENST00000310160.3	37	CCDS12733.1																																																																																				0.642	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148	
SYT3	84258	broad.mit.edu	37	19	51135808	51135808	+	Missense_Mutation	SNP	C	C	A	rs193002389		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:51135808C>A	ENST00000338916.4	-	2	1042	c.409G>T	c.(409-411)Gcc>Tcc	p.A137S	SYT3_ENST00000593901.1_Missense_Mutation_p.A137S|SYT3_ENST00000544769.1_Missense_Mutation_p.A137S|SYT3_ENST00000600079.1_Missense_Mutation_p.A137S	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	137					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A137S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GGATGGTGGGCGGCATGGGCA	0.687																																					p.A137S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G409T	19						.						12.0	13.0	13.0					19																	51135808		2196	4292	6488	55827620	SO:0001583	missense	84258	exon2			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.409G>T	19.37:g.51135808C>A	ENSP00000340914:p.Ala137Ser		55827620	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.434033	0.01108	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.58940	0.3;0.3	4.05	-0.466	0.12153	.	0.670329	0.13099	U	0.413950	T	0.28433	0.0703	N	0.08118	0	0.09310	N	0.999994	B	0.17038	0.02	B	0.15484	0.013	T	0.23332	-1.0191	10	0.09084	T	0.74	.	6.8988	0.24271	0.0:0.6202:0.0:0.3798	.	137	Q9BQG1	SYT3_HUMAN	S	137	ENSP00000340914:A137S;ENSP00000438883:A137S	ENSP00000340914:A137S	A	-	1	0	SYT3	55827620	0.004000	0.15560	0.099000	0.21106	0.236000	0.25371	-0.191000	0.09601	0.028000	0.15324	-0.951000	0.02657	GCC		0.687	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
SHANK1	50944	broad.mit.edu	37	19	51165522	51165522	+	Silent	SNP	G	G	A	rs547176731		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:51165522G>A	ENST00000293441.1	-	23	6204	c.6186C>T	c.(6184-6186)tcC>tcT	p.S2062S	SHANK1_ENST00000359082.3_Silent_p.S2053S|SHANK1_ENST00000391813.1_Silent_p.S1449S|SHANK1_ENST00000483981.2_5'Flank|SHANK1_ENST00000391814.1_Silent_p.S2070S|SYT3_ENST00000544769.1_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2062					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.S2062S(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CGAGCCCCCCGGATATCCCCG	0.692													g|||	1	0.000199681	0.0	0.0	5008	,	,		12739	0.0		0.0	False		,,,				2504	0.001				p.S2062S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6186T	19						.						14.0	17.0	16.0					19																	51165522		2193	4295	6488	55857334	SO:0001819	synonymous_variant	50944	exon23			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.6186C>T	19.37:g.51165522G>A			55857334	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	CCDS12799.1																																																																																				0.692	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
IGLON5	402665	broad.mit.edu	37	19	51827034	51827034	+	Missense_Mutation	SNP	G	G	A	rs527872132		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:51827034G>A	ENST00000270642.8	+	3	277	c.277G>A	c.(277-279)Gag>Aag	p.E93K		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	93	Ig-like C2-type 1.					extracellular region (GO:0005576)		p.E93K(1)		large_intestine(5)|lung(6)|prostate(1)	12						CAACACCCCCGAGGAGTTCTC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15830	0.001		0.0	False		,,,				2504	0.0				p.E93K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G277A	19						.						35.0	42.0	40.0					19																	51827034		1981	4147	6128	56518846	SO:0001583	missense	402665	exon3				CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.277G>A	19.37:g.51827034G>A	ENSP00000270642:p.Glu93Lys		56518846	NM_001101372		Missense_Mutation	SNP	ENST00000270642.8	37	CCDS46158.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692705	0.30052	.	.	ENSG00000142549	ENST00000270642	T	0.64085	-0.08	4.9	3.87	0.44632	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.578197	0.18668	N	0.134531	T	0.31949	0.0813	N	0.04355	-0.22	0.33315	D	0.566602	P	0.38420	0.63	B	0.35470	0.203	T	0.36625	-0.9740	10	0.14252	T	0.57	-21.2516	6.1987	0.20563	0.0962:0.0:0.7197:0.1841	.	93	A6NGN9	IGLO5_HUMAN	K	93	ENSP00000270642:E93K	ENSP00000270642:E93K	E	+	1	0	IGLON5	56518846	0.987000	0.35691	0.979000	0.43373	0.982000	0.71751	2.326000	0.43849	1.070000	0.40811	0.591000	0.81541	GAG		0.657	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	
VAV1	7409	broad.mit.edu	37	19	6828154	6828154	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:6828154G>T	ENST00000602142.1	+	10	1077	c.995G>T	c.(994-996)cGa>cTa	p.R332L	VAV1_ENST00000596764.1_Missense_Mutation_p.R300L|VAV1_ENST00000539284.1_Missense_Mutation_p.R235L|VAV1_ENST00000304076.2_Missense_Mutation_p.R332L|VAV1_ENST00000599806.1_Missense_Mutation_p.R277L	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	332	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCTATGCAGCGAGTTCTCAAA	0.552																																					p.R332L												.	.	0			c.G995T	19						.						86.0	75.0	79.0					19																	6828154		2203	4300	6503	6779154	SO:0001583	missense	7409	exon10				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.995G>T	19.37:g.6828154G>T	ENSP00000472929:p.Arg332Leu		6779154	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847959	0.71603	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;D	0.87966	-0.3;-2.32	4.5	4.5	0.54988	Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000001	D	0.95338	0.8487	H	0.96048	3.76	0.80722	D	1	P;D;D;D	0.71674	0.784;0.982;0.994;0.998	P;P;D;D	0.73380	0.518;0.86;0.98;0.979	D	0.96788	0.9580	10	0.87932	D	0	.	14.7102	0.69225	0.0:0.0:1.0:0.0	.	235;332;277;332	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	L	332;235	ENSP00000302269:R332L;ENSP00000443242:R235L	ENSP00000302269:R332L	R	+	2	0	VAV1	6779154	1.000000	0.71417	0.980000	0.43619	0.390000	0.30446	9.064000	0.93933	2.076000	0.62316	0.462000	0.41574	CGA		0.552	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
ZNF568	374900	broad.mit.edu	37	19	37440502	37440502	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	-	G	-	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:37440502delG	ENST00000333987.7	+	7	953	c.447delG	c.(445-447)aagfs	p.K149fs	ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000415168.1_Frame_Shift_Del_p.K85fs	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTGATAAAGGAAAAAGTCA	0.358																																					p.K149fs												.	.	0			c.447delG	19						.						67.0	61.0	63.0					19																	37440502		1810	4081	5891	42132342	SO:0001589	frameshift_variant	374900	exon7			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.447delG	19.37:g.37440502delG	ENSP00000334685:p.Lys149fs		42132342	NM_198539	B4DS92|E7ER33|Q6N060|Q8NA64	Frame_Shift_Del	DEL	ENST00000333987.7	37	CCDS42558.1																																																																																				0.358	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
NLRP8	126205	broad.mit.edu	37	19	56466980	56466980	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr19:56466980A>G	ENST00000291971.3	+	3	1627	c.1556A>G	c.(1555-1557)tAt>tGt	p.Y519C	NLRP8_ENST00000590542.1_Missense_Mutation_p.Y519C	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	519	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GCCTTGTTTTATGTTCTCTGT	0.448																																					p.Y519C												.	.	0			c.A1556G	19						.						176.0	173.0	174.0					19																	56466980		2203	4300	6503	61158792	SO:0001583	missense	126205	exon3			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1556A>G	19.37:g.56466980A>G	ENSP00000291971:p.Tyr519Cys		61158792	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	A	14.13	2.444839	0.43429	.	.	ENSG00000179709	ENST00000291971	D	0.88586	-2.4	2.04	0.968	0.19680	.	.	.	.	.	D	0.90717	0.7087	L	0.56280	1.765	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.976;0.998	T	0.79650	-0.1715	9	0.87932	D	0	.	4.1707	0.10327	0.6914:0.0:0.0:0.3086	.	519;519	Q86W28-2;Q86W28	.;NALP8_HUMAN	C	519	ENSP00000291971:Y519C	ENSP00000291971:Y519C	Y	+	2	0	NLRP8	61158792	0.051000	0.20477	0.000000	0.03702	0.564000	0.35744	2.310000	0.43708	0.216000	0.20781	0.421000	0.28195	TAT		0.448	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
CELSR2	1952	broad.mit.edu	37	1	109813841	109813841	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:109813841G>A	ENST00000271332.3	+	26	7660	c.7599G>A	c.(7597-7599)atG>atA	p.M2533I	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2533					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTGCCTAGATGAGTGTCTTCC	0.627																																					p.M2533I	NSCLC(158;1285 2011 34800 34852 42084)											.	.	0			c.G7599A	1						.						95.0	106.0	103.0					1																	109813841		2203	4300	6503	109615364	SO:0001583	missense	1952	exon26			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7599G>A	1.37:g.109813841G>A	ENSP00000271332:p.Met2533Ile		109615364	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	6.434	0.448290	0.12223	.	.	ENSG00000143126	ENST00000271332	T	0.37058	1.22	5.22	5.22	0.72569	GPCR, family 2-like (1);	.	.	.	.	T	0.03434	0.0099	N	0.01473	-0.845	0.44643	D	0.997628	B	0.12013	0.005	B	0.15484	0.013	T	0.45673	-0.9245	9	0.02654	T	1	.	5.567	0.17177	0.0766:0.1404:0.6377:0.1454	.	2533	Q9HCU4	CELR2_HUMAN	I	2533	ENSP00000271332:M2533I	ENSP00000271332:M2533I	M	+	3	0	CELSR2	109615364	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.607000	0.46300	2.434000	0.82447	0.561000	0.74099	ATG		0.627	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
PTGFRN	5738	broad.mit.edu	37	1	117492009	117492009	+	Missense_Mutation	SNP	C	C	T	rs201175251		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:117492009C>T	ENST00000393203.2	+	4	1175	c.1028C>T	c.(1027-1029)tCg>tTg	p.S343L		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	343	Ig-like C2-type 3.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.S343L(2)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GTGCACAGCTCGCCTCATGTT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19553	0.0		0.0	False		,,,				2504	0.001				p.S343L												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1028T	1						.	C	LEU/SER	2,4404	4.2+/-10.8	0,2,2201	119.0	97.0	105.0		1028	3.7	0.9	1		105	0,8600		0,0,4300	yes	missense	PTGFRN	NM_020440.2	145	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	343/880	117492009	2,13004	2203	4300	6503	117293532	SO:0001583	missense	5738	exon4			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1028C>T	1.37:g.117492009C>T	ENSP00000376899:p.Ser343Leu		117293532	NM_020440	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908956	0.33721	4.54E-4	0.0	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.65916	-0.18	5.57	3.71	0.42584	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.391477	0.26662	N	0.023155	T	0.22975	0.0555	N	0.17082	0.46	0.33487	D	0.588261	B	0.26975	0.165	B	0.22601	0.04	T	0.05649	-1.0872	10	0.33940	T	0.23	-14.8148	7.5858	0.27991	0.0:0.8136:0.0:0.1864	.	343	Q9P2B2	FPRP_HUMAN	L	343;202	ENSP00000376899:S343L	ENSP00000376899:S343L	S	+	2	0	PTGFRN	117293532	0.947000	0.32204	0.871000	0.34182	0.483000	0.33249	1.915000	0.39976	1.359000	0.45940	0.561000	0.74099	TCG		0.572	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
WDR3	10885	broad.mit.edu	37	1	118488749	118488749	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:118488749G>T	ENST00000349139.5	+	12	1416	c.1369G>T	c.(1369-1371)Gca>Tca	p.A457S		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	457						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A457S(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		CTGTGAATATGCACTTTGCTC	0.378																																					p.A457S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1369T	1						.						156.0	149.0	151.0					1																	118488749		2203	4300	6503	118290272	SO:0001583	missense	10885	exon12			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.1369G>T	1.37:g.118488749G>T	ENSP00000308179:p.Ala457Ser		118290272	NM_006784		Missense_Mutation	SNP	ENST00000349139.5	37	CCDS898.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662403	0.67700	.	.	ENSG00000065183	ENST00000349139	T	0.55930	0.49	5.61	5.61	0.85477	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.094180	0.64402	D	0.000001	T	0.44180	0.1281	M	0.78916	2.43	0.80722	D	1	B	0.18968	0.032	B	0.24155	0.051	T	0.47381	-0.9122	10	0.15066	T	0.55	-11.2815	20.0016	0.97412	0.0:0.0:1.0:0.0	.	457	Q9UNX4	WDR3_HUMAN	S	457	ENSP00000308179:A457S	ENSP00000308179:A457S	A	+	1	0	WDR3	118290272	1.000000	0.71417	0.979000	0.43373	0.998000	0.95712	9.174000	0.94824	2.802000	0.96397	0.655000	0.94253	GCA		0.378	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
TCHH	7062	broad.mit.edu	37	1	152084377	152084377	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:152084377T>C	ENST00000368804.1	-	2	1315	c.1316A>G	c.(1315-1317)gAg>gGg	p.E439G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	439	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.E439G(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cctctcctgctcgtgcttctg	0.697																																					p.E439G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1316G	1						.						39.0	42.0	41.0					1																	152084377		2059	4189	6248	150351001	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1316A>G	1.37:g.152084377T>C	ENSP00000357794:p.Glu439Gly		150351001	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	t	11.68	1.711652	0.30322	.	.	ENSG00000159450	ENST00000368804	T	0.05139	3.49	1.33	1.33	0.21861	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.19575	N	0.999967	P	0.41232	0.743	B	0.23150	0.044	T	0.47724	-0.9095	9	0.30078	T	0.28	.	6.7113	0.23278	0.0:0.0:0.0:1.0	.	439	Q07283	TRHY_HUMAN	G	439	ENSP00000357794:E439G	ENSP00000357794:E439G	E	-	2	0	TCHH	150351001	0.000000	0.05858	0.006000	0.13384	0.491000	0.33493	-0.889000	0.04144	0.676000	0.31285	0.000000	0.15137	GAG		0.697	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
OR6K6	128371	broad.mit.edu	37	1	158724980	158724980	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:158724980C>A	ENST00000368144.2	+	1	471	c.375C>A	c.(373-375)tgC>tgA	p.C125*		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TGGCTGGCTGCCTCCTGCAGA	0.507																																					p.C125X												.	.	0			c.C375A	1						.						82.0	80.0	81.0					1																	158724980		2203	4300	6503	156991604	SO:0001587	stop_gained	128371	exon1			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.375C>A	1.37:g.158724980C>A	ENSP00000357126:p.Cys125*		156991604	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Nonsense_Mutation	SNP	ENST00000368144.2	37	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728231	0.48833	.	.	ENSG00000180433	ENST00000368144	.	.	.	5.48	4.57	0.56435	.	0.000000	0.48286	D	0.000191	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4997	10.1738	0.42927	0.0:0.8412:0.0:0.1588	.	.	.	.	X	125	.	ENSP00000357126:C125X	C	+	3	2	OR6K6	156991604	0.000000	0.05858	0.998000	0.56505	0.131000	0.20780	-1.535000	0.02210	1.552000	0.49463	-0.140000	0.14226	TGC		0.507	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
FCRLB	127943	broad.mit.edu	37	1	161697121	161697121	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:161697121G>T	ENST00000367948.2	+	8	1165	c.950G>T	c.(949-951)aGa>aTa	p.R317I	FCRLB_ENST00000392158.1_Missense_Mutation_p.R317I|FCRLB_ENST00000336830.5_3'UTR|FCRLB_ENST00000367945.1_Nonsense_Mutation_p.E262*|FCRLB_ENST00000367946.3_Nonsense_Mutation_p.E269*|FCRLB_ENST00000495397.1_3'UTR|FCRLB_ENST00000367944.3_3'UTR			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	317					negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)		p.R317I(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CTTTCCTTCAGAAAGCCCCCG	0.677																																					p.R317I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G950T	1						.						20.0	22.0	21.0					1																	161697121		2203	4299	6502	159963745	SO:0001583	missense	127943	exon6			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.950G>T	1.37:g.161697121G>T	ENSP00000356925:p.Arg317Ile		159963745	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Nonsense_Mutation	SNP	ENST00000367948.2	37	CCDS30927.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.086553|4.086553	0.76642|0.76642	.|.	.|.	ENSG00000162746|ENSG00000162746	ENST00000367946;ENST00000367945|ENST00000367948;ENST00000392158	.|D;D	.|0.96967	.|-4.19;-4.19	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	.|0.000000	.|0.44483	.|D	.|0.000452	.|D	.|0.96602	.|0.8891	L|L	0.56769|0.56769	1.78|1.78	0.41596|0.41596	D|D	0.988823|0.988823	.|D	.|0.71674	.|0.998	.|D	.|0.76071	.|0.987	.|D	.|0.96392	.|0.9290	.|10	0.72032|0.51188	D|T	0.01|0.08	.|.	12.0514|12.0514	0.53509|0.53509	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|317	.|Q6BAA4	.|FCRLB_HUMAN	X|I	269;262|317	.|ENSP00000356925:R317I;ENSP00000375999:R317I	ENSP00000356922:E262X|ENSP00000356925:R317I	E|R	+|+	1|2	0|0	FCRLB|FCRLB	159963745|159963745	0.999000|0.999000	0.42202|0.42202	0.326000|0.326000	0.25389|0.25389	0.500000|0.500000	0.33767|0.33767	4.051000|4.051000	0.57412|0.57412	2.195000|2.195000	0.70347|0.70347	0.455000|0.455000	0.32223|0.32223	GAA|AGA		0.677	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
CENPL	91687	broad.mit.edu	37	1	173772324	173772324	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:173772324G>A	ENST00000345664.6	-	4	953	c.740C>T	c.(739-741)cCt>cTt	p.P247L	CENPL_ENST00000367710.3_Missense_Mutation_p.P247L|CENPL_ENST00000356198.2_Missense_Mutation_p.P293L	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	247					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.P247L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						CAGACTTTGAGGGCTACAGGG	0.453																																					p.P293L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C878T	1						.						98.0	99.0	98.0					1																	173772324		2203	4300	6503	172038947	SO:0001583	missense	91687	exon6			BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.740C>T	1.37:g.173772324G>A	ENSP00000323543:p.Pro247Leu		172038947	NM_001127181	Q5TEL5|Q96ND4	Missense_Mutation	SNP	ENST00000345664.6	37	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266826	0.80469	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.47528	1.45;0.84;0.84	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.57460	0.2055	L	0.57536	1.79	0.80722	D	1	D;D	0.64830	0.993;0.994	P;D	0.65233	0.89;0.933	T	0.59825	-0.7381	10	0.59425	D	0.04	-9.2302	17.633	0.88114	0.0:0.0:1.0:0.0	.	293;247	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	L	293;247;247	ENSP00000348527:P293L;ENSP00000323543:P247L;ENSP00000356683:P247L	ENSP00000323543:P247L	P	-	2	0	CENPL	172038947	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.799000	0.91895	2.456000	0.83038	0.655000	0.94253	CCT		0.453	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319	
PRELP	5549	broad.mit.edu	37	1	203455841	203455841	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:203455841C>T	ENST00000343110.2	+	3	1108	c.981C>T	c.(979-981)aaC>aaT	p.N327N		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	327					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.N327N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			TAGAAATCAACGGAACCCAGA	0.562																																					p.N327N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C981T	1						.						86.0	84.0	85.0					1																	203455841		2203	4300	6503	201722464	SO:0001819	synonymous_variant	5549	exon3			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.981C>T	1.37:g.203455841C>T			201722464	NM_002725	Q6FG38	Silent	SNP	ENST00000343110.2	37	CCDS1438.1																																																																																				0.562	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
AVPR1B	553	broad.mit.edu	37	1	206224826	206224826	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:206224826C>T	ENST00000367126.4	+	1	851	c.386C>T	c.(385-387)aCg>aTg	p.T129M	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	129					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.T129M(2)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CTGGCCATGACGCTGGACCGC	0.657																																					p.T129M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C386T	1						.						61.0	57.0	58.0					1																	206224826		2203	4300	6503	204391449	SO:0001583	missense	553	exon1			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.386C>T	1.37:g.206224826C>T	ENSP00000356094:p.Thr129Met		204391449	NM_000707	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970759	0.74246	.	.	ENSG00000198049	ENST00000367126	T	0.73152	-0.72	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.87849	0.6281	M	0.91038	3.17	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	D	0.90204	0.4259	10	0.87932	D	0	-16.4432	18.5451	0.91043	0.0:1.0:0.0:0.0	.	129	P47901	V1BR_HUMAN	M	129	ENSP00000356094:T129M	ENSP00000356094:T129M	T	+	2	0	AVPR1B	204391449	1.000000	0.71417	0.962000	0.40283	0.998000	0.95712	5.885000	0.69736	2.704000	0.92352	0.514000	0.50259	ACG		0.657	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707	
TMEM206	55248	broad.mit.edu	37	1	212558649	212558649	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:212558649G>A	ENST00000261455.4	-	4	599	c.462C>T	c.(460-462)atC>atT	p.I154I	TMEM206_ENST00000471937.1_5'UTR|TMEM206_ENST00000535273.1_Silent_p.I215I	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	154						cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.I154I(2)		breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CCGTGTAGTTGATCCTCTGGG	0.577																																					p.I215I												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C645T	1						.						144.0	135.0	138.0					1																	212558649		2203	4300	6503	210625272	SO:0001819	synonymous_variant	55248	exon5			AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.462C>T	1.37:g.212558649G>A			210625272	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Silent	SNP	ENST00000261455.4	37	CCDS1504.1																																																																																				0.577	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
KCNK2	3776	broad.mit.edu	37	1	215259781	215259781	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:215259781G>A	ENST00000444842.2	+	2	267	c.117G>A	c.(115-117)acG>acA	p.T39T	KCNK2_ENST00000391895.2_Silent_p.T35T|KCNK2_ENST00000391894.2_Silent_p.T24T	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	39					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.T24T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CGTTTTCCACGAAACCCACAG	0.507																																					p.T35T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G105A	1						.						73.0	70.0	71.0					1																	215259781		2203	4300	6503	213326404	SO:0001819	synonymous_variant	3776	exon2			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.117G>A	1.37:g.215259781G>A			213326404	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	ENST00000444842.2	37	CCDS41467.1																																																																																				0.507	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
C1orf198	84886	broad.mit.edu	37	1	230979639	230979639	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:230979639G>A	ENST00000366663.5	-	3	528	c.388C>T	c.(388-390)Cag>Tag	p.Q130*	C1orf198_ENST00000470540.1_Nonsense_Mutation_p.Q92*|C1orf198_ENST00000523410.1_5'UTR|C1orf198_ENST00000427697.2_Intron	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	130						cytoplasm (GO:0005737)		p.Q130*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				AACTCCATCTGACTCTAGGGT	0.572																																					p.Q92X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C274T	1						.						74.0	84.0	80.0					1																	230979639		2172	4239	6411	229046262	SO:0001587	stop_gained	84886	exon5			BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.388C>T	1.37:g.230979639G>A	ENSP00000355623:p.Gln130*		229046262	NM_001136494	A8K8R8|B3KTW1|G5EA08	Nonsense_Mutation	SNP	ENST00000366663.5	37	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243126	0.79912	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000522201	.	.	.	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.0636	16.9316	0.86191	0.0:0.0:1.0:0.0	.	.	.	.	X	130;92;87	.	ENSP00000355623:Q130X	Q	-	1	0	C1orf198	229046262	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	7.551000	0.82182	2.212000	0.71576	0.462000	0.41574	CAG		0.572	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800	
HEATR1	55127	broad.mit.edu	37	1	236754206	236754206	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:236754206G>T	ENST00000366582.3	-	12	1585	c.1471C>A	c.(1471-1473)Ctt>Att	p.L491I	HEATR1_ENST00000366581.2_Missense_Mutation_p.L491I	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	491					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L491I(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAGGAGCAAGTGGATGATTC	0.333																																					p.L491I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1471A	1						.						75.0	74.0	74.0					1																	236754206		2203	4300	6503	234820829	SO:0001583	missense	55127	exon12			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1471C>A	1.37:g.236754206G>T	ENSP00000355541:p.Leu491Ile		234820829	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352206	0.82132	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.65732	-0.12;-0.17	5.74	3.84	0.44239	Armadillo-like helical (1);Armadillo-type fold (1);	0.142256	0.48767	D	0.000175	T	0.64405	0.2595	M	0.70595	2.14	0.80722	D	1	P	0.50528	0.936	P	0.46419	0.516	T	0.66452	-0.5920	10	0.40728	T	0.16	.	12.9654	0.58481	0.1177:0.0:0.8823:0.0	.	491	Q9H583	HEAT1_HUMAN	I	491	ENSP00000355541:L491I;ENSP00000355540:L491I	ENSP00000355540:L491I	L	-	1	0	HEATR1	234820829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.909000	0.69923	2.711000	0.92665	0.591000	0.81541	CTT		0.333	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
WRAP73	49856	broad.mit.edu	37	1	3548852	3548852	+	Missense_Mutation	SNP	C	C	G	rs186050737		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:3548852C>G	ENST00000270708.7	-	10	1046	c.973G>C	c.(973-975)Gac>Cac	p.D325H	WRAP73_ENST00000378322.3_Missense_Mutation_p.D325H	NM_017818.3	NP_060288.3	Q9P2S5	WRP73_HUMAN	WD repeat containing, antisense to TP73	325						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.D325H(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)	12						TTTGCTCTGTCGGTAACAGGT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		22048	0.001		0.0	False		,,,				2504	0.0				p.D325H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G973C	1						.						259.0	214.0	229.0					1																	3548852		2203	4300	6503	3538712	SO:0001583	missense	49856	exon10			AB034912, EF494669	CCDS48.1	1p36.3	2013-05-21	2011-04-13	2011-04-13	ENSG00000116213	ENSG00000116213		"""WD repeat domain containing"""	12759	protein-coding gene	gene with protein product		606040	"""WD repeat domain 8"""	WDR8			Standard	NM_017818		Approved		uc001ako.3	Q9P2S5	OTTHUMG00000000612	ENST00000270708.7:c.973G>C	1.37:g.3548852C>G	ENSP00000270708:p.Asp325His		3538712	NM_017818	Q5T0D6|Q9BUH7|Q9NTK7|Q9NX56	Missense_Mutation	SNP	ENST00000270708.7	37	CCDS48.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.72	3.201582	0.58234	.	.	ENSG00000116213	ENST00000270708;ENST00000378322;ENST00000424367	T;T;T	0.56444	0.46;0.46;0.46	5.35	5.35	0.76521	WD40 repeat-like-containing domain (1);	0.090297	0.85682	D	0.000000	T	0.75162	0.3812	M	0.84683	2.71	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.68353	0.906;0.957	T	0.77153	-0.2692	10	0.45353	T	0.12	-47.5495	18.0447	0.89328	0.0:1.0:0.0:0.0	.	325;280	Q9P2S5;Q5T0D5	WRP73_HUMAN;.	H	325;325;280	ENSP00000270708:D325H;ENSP00000367573:D325H;ENSP00000416192:D280H	ENSP00000270708:D325H	D	-	1	0	WRAP73	3538712	1.000000	0.71417	0.474000	0.27266	0.062000	0.15995	6.835000	0.75344	2.503000	0.84419	0.655000	0.94253	GAC		0.517	WRAP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001470.1		
ESPN	83715	broad.mit.edu	37	1	6504669	6504669	+	Silent	SNP	T	T	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:6504669T>C	ENST00000377828.1	+	6	1287	c.1119T>C	c.(1117-1119)ccT>ccC	p.P373P	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	373					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)	p.P373P(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TCAGCTCGCCTACCAGCACCC	0.612																																					p.P373P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1119C	1						.						134.0	98.0	110.0					1																	6504669		2203	4300	6503	6427256	SO:0001819	synonymous_variant	83715	exon6			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1119T>C	1.37:g.6504669T>C			6427256	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Silent	SNP	ENST00000377828.1	37	CCDS70.1																																																																																				0.612	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
NIPAL3	57185	broad.mit.edu	37	1	24779984	24779984	+	Silent	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:24779984G>T	ENST00000374399.4	+	7	995	c.627G>T	c.(625-627)gtG>gtT	p.V209V	NIPAL3_ENST00000358028.4_Silent_p.V209V|NIPAL3_ENST00000003912.3_Silent_p.V127V|NIPAL3_ENST00000339255.2_Silent_p.V209V|NIPAL3_ENST00000428131.1_Silent_p.V209V	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	209						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)	p.V209V(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						TTCTCTTGGTGGCGTTACTTG	0.483																																					p.V209V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G627T	1						.						140.0	115.0	124.0					1																	24779984		2203	4300	6503	24652571	SO:0001819	synonymous_variant	57185	exon7			BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.627G>T	1.37:g.24779984G>T			24652571	NM_020448	A2A298|Q6MZT9|Q9BVE6	Silent	SNP	ENST00000374399.4	37	CCDS30631.1																																																																																				0.483	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448	
ERMAP	114625	broad.mit.edu	37	1	43300734	43300735	+	Missense_Mutation	DNP	CT	CT	AA	rs149629031		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:43300734_43300735CT>AA	ENST00000372517.2	+	5	703_704	c.459_460CT>AA	c.(457-462)ccCTca>ccAAca	p.S154T	RP11-342M1.3_ENST00000416809.2_RNA|ERMAP_ENST00000487556.1_3'UTR|RP11-342M1.3_ENST00000414798.1_RNA|ERMAP_ENST00000328249.3_Missense_Mutation_p.S64T|ERMAP_ENST00000372514.3_Missense_Mutation_p.S154T	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	154			Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P153>?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTCTCTCCCCCTCAGCAGTGGC	0.525																																					.												.	.	1	Complex(1)	large_intestine(1)	c.459_460AA	1						.																																			43073322	SO:0001583	missense	114625	exon5			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	Exception_encountered	1.37:g.43300734_43300735delinsAA	ENSP00000361595:p.Ser154Thr		43073321	NM_001017922	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	DNP	ENST00000372517.2	37	CCDS475.1																																																																																				0.525	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	NM_018538	
LRP8	7804	broad.mit.edu	37	1	53737011	53737011	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:53737011G>T	ENST00000306052.6	-	7	1115	c.1014C>A	c.(1012-1014)aaC>aaA	p.N338K	RP4-784A16.1_ENST00000432653.1_RNA|LRP8_ENST00000371454.2_Missense_Mutation_p.N338K|LRP8_ENST00000347547.2_Missense_Mutation_p.N168K|LRP8_ENST00000465675.1_5'UTR|LRP8_ENST00000354412.3_Missense_Mutation_p.N209K	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	338	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						GCAGACACTCGTTCAGCCCTG	0.612																																					p.N209K												.	.	0			c.C627A	1						.						63.0	60.0	61.0					1																	53737011		2203	4300	6503	53509599	SO:0001583	missense	7804	exon6			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1014C>A	1.37:g.53737011G>T	ENSP00000303634:p.Asn338Lys		53509599	NM_017522	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.28|12.28	1.890470|1.890470	0.33348|0.33348	.|.	.|.	ENSG00000157193|ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547|ENST00000475501	D;D;D;D|.	0.96716|.	-4.1;-4.1;-4.1;-2.97|.	5.14|5.14	-2.39|-2.39	0.06602|0.06602	Growth factor, receptor (1);Epidermal growth factor-like, type 3 (1);|.	.|.	.|.	.|.	.|.	D|D	0.83478|0.83478	0.5263|0.5263	H|H	0.95079|0.95079	3.62|3.62	0.58432|0.58432	D|D	0.999993|0.999993	D;D;D;D|.	0.89917|.	1.0;0.987;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.965;0.984;0.988|.	D|D	0.85273|0.85273	0.1057|0.1057	9|5	0.87932|.	D|.	0|.	.|.	12.7706|12.7706	0.57419|0.57419	0.5528:0.0:0.4472:0.0|0.5528:0.0:0.4472:0.0	.|.	209;168;338;338|.	Q14114-2;Q14114-4;Q14114-3;Q14114|.	.;.;.;LRP8_HUMAN|.	K|K	338;338;209;168|27	ENSP00000303634:N338K;ENSP00000360509:N338K;ENSP00000346391:N209K;ENSP00000334522:N168K|.	ENSP00000303634:N338K|.	N|T	-|-	3|2	2|0	LRP8|LRP8	53509599|53509599	0.046000|0.046000	0.20272|0.20272	0.952000|0.952000	0.39060|0.39060	0.017000|0.017000	0.09413|0.09413	-0.493000|-0.493000	0.06459|0.06459	-0.695000|-0.695000	0.05105|0.05105	-0.254000|-0.254000	0.11334|0.11334	AAC|ACG		0.612	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
C8B	732	broad.mit.edu	37	1	57409430	57409430	+	Missense_Mutation	SNP	C	C	G	rs369339023		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:57409430C>G	ENST00000371237.4	-	8	1239	c.1173G>C	c.(1171-1173)gaG>gaC	p.E391D	C8B_ENST00000535057.1_Missense_Mutation_p.E329D|C8B_ENST00000543257.1_Missense_Mutation_p.E339D	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	391	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.E391D(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TGACGTAGACCTCTTCAATGG	0.408																																					p.E391D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1173C	1						.	C	ASP/GLU	0,4406		0,0,2203	234.0	202.0	213.0		1173	-9.2	0.0	1		213	1,8599	1.2+/-3.3	0,1,4299	no	missense	C8B	NM_000066.2	45	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	benign	391/592	57409430	1,13005	2203	4300	6503	57182018	SO:0001583	missense	732	exon8			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1173G>C	1.37:g.57409430C>G	ENSP00000360281:p.Glu391Asp		57182018	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	C	2.123	-0.400861	0.04865	0.0	1.16E-4	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.27256	1.85;1.85;1.68	4.59	-9.19	0.00685	Membrane attack complex component/perforin (MACPF) domain (3);	1.724340	0.02868	N	0.131222	T	0.13586	0.0329	L	0.36672	1.1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.24941	-1.0146	10	0.12430	T	0.62	13.1311	2.0427	0.03553	0.4275:0.0784:0.2132:0.2809	.	339;329;391	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	D	391;339;329	ENSP00000360281:E391D;ENSP00000442548:E339D;ENSP00000440113:E329D	ENSP00000360281:E391D	E	-	3	2	C8B	57182018	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-5.546000	0.00114	-3.569000	0.00139	-1.014000	0.02459	GAG		0.408	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
WLS	79971	broad.mit.edu	37	1	68616019	68616019	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:68616019A>G	ENST00000262348.4	-	6	1077	c.824T>C	c.(823-825)aTt>aCt	p.I275T	GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000491811.1_5'UTR|WLS_ENST00000370976.3_Missense_Mutation_p.I184T|WLS_ENST00000354777.2_Missense_Mutation_p.I273T|WLS_ENST00000540432.1_Missense_Mutation_p.I275T	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	275					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)	p.I273T(1)|p.I275T(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						GGTCATGGAAATCCCAAGGGC	0.438																																					p.I184T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T551C	1						.						103.0	99.0	100.0					1																	68616019		2203	4300	6503	68388607	SO:0001583	missense	79971	exon5			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.824T>C	1.37:g.68616019A>G	ENSP00000262348:p.Ile275Thr		68388607	NM_001193334	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	ENST00000262348.4	37	CCDS642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.08|18.08	3.543196|3.543196	0.65198|0.65198	.|.	.|.	ENSG00000116729|ENSG00000116729	ENST00000534713|ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976	.|T;T;T;T	.|0.42900	.|0.96;0.96;0.96;0.96	5.24|5.24	4.08|4.08	0.47627|0.47627	.|.	.|0.149732	.|0.64402	.|D	.|0.000014	T|T	0.30417|0.30417	0.0764|0.0764	L|L	0.42245|0.42245	1.32|1.32	0.53688|0.53688	D|D	0.999973|0.999973	.|P;P;P;P	.|0.44521	.|0.835;0.837;0.801;0.835	.|P;P;B;P	.|0.50791	.|0.65;0.516;0.412;0.65	T|T	0.04078|0.04078	-1.0979|-1.0979	5|10	.|0.35671	.|T	.|0.21	-35.0287|-35.0287	11.2643|11.2643	0.49101|0.49101	0.863:0.0:0.0:0.137|0.863:0.0:0.0:0.137	.|.	.|275;184;275;273	.|F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2	.|.;.;WLS_HUMAN;.	L|T	178|275;273;275;184	.|ENSP00000446112:I275T;ENSP00000346829:I273T;ENSP00000262348:I275T;ENSP00000360015:I184T	.|ENSP00000262348:I275T	F|I	-|-	1|2	0|0	WLS|WLS	68388607|68388607	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.894000|0.894000	0.52154|0.52154	8.730000|8.730000	0.91510|0.91510	0.801000|0.801000	0.34066|0.34066	0.460000|0.460000	0.39030|0.39030	TTT|ATT		0.438	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	NM_024911	
RYR2	6262	broad.mit.edu	37	1	237880546	237880546	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr1:237880546C>T	ENST00000366574.2	+	72	10689	c.10372C>T	c.(10372-10374)Cgg>Tgg	p.R3458W	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.R3442W|RYR2_ENST00000360064.6_Missense_Mutation_p.R3456W	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3458					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAAGGAGATCGGTATTCCAT	0.493																																					p.R3458W												.	.	0			c.C10372T	1						.						88.0	91.0	90.0					1																	237880546		1917	4112	6029	235947169	SO:0001583	missense	6262	exon72			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10372C>T	1.37:g.237880546C>T	ENSP00000355533:p.Arg3458Trp		235947169	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.836716	0.71373	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97089	-4.24;-4.21;-4.24	5.34	5.34	0.76211	.	0.000000	0.53938	D	0.000055	D	0.97980	0.9335	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.67382	0.951	D	0.98393	1.0564	10	0.66056	D	0.02	-11.6096	15.7835	0.78281	0.1365:0.8635:0.0:0.0	.	3458	Q92736	RYR2_HUMAN	W	3458;3456;3442;413	ENSP00000355533:R3458W;ENSP00000353174:R3456W;ENSP00000443798:R3442W	ENSP00000353174:R3456W	R	+	1	2	RYR2	235947169	0.208000	0.23494	0.994000	0.49952	0.980000	0.70556	0.837000	0.27558	2.667000	0.90743	0.655000	0.94253	CGG		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
EMILIN3	90187	broad.mit.edu	37	20	39990828	39990829	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:39990828_39990829insC	ENST00000332312.3	-	4	1572_1573	c.1380_1381insG	c.(1378-1383)gggtggfs	p.W461fs		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	461						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)		p.W461fs*31(1)		biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CCCACTCCCCACCCCCCCATGT	0.639																																					p.W461fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1381_1382insG	20						.																																			39424243	SO:0001589	frameshift_variant	90187	exon4			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1381dupG	20.37:g.39990835_39990835dupC	ENSP00000332806:p.Trp461fs		39424242	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Frame_Shift_Ins	INS	ENST00000332312.3	37	CCDS13316.1																																																																																				0.639	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
PTPRA	5786	broad.mit.edu	37	20	3007783	3007783	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:3007783G>A	ENST00000216877.6	+	18	2098	c.1698G>A	c.(1696-1698)gtG>gtA	p.V566V	PTPRA_ENST00000356147.3_Silent_p.V566V|PTPRA_ENST00000318266.5_Silent_p.V566V|PTPRA_ENST00000380393.3_Silent_p.V575V|PTPRA_ENST00000358719.4_Silent_p.V431V|PTPRA_ENST00000399903.2_Silent_p.V575V|PTPRA_ENST00000425918.2_Silent_p.V586V	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	575	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V575V(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TCAACAGAGTGATCATTCCAG	0.502																																					p.V566V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1698A	20						.						205.0	187.0	193.0					20																	3007783		2203	4300	6503	2955783	SO:0001819	synonymous_variant	5786	exon18				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1698G>A	20.37:g.3007783G>A			2955783	NM_080840	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	CCDS13039.1																																																																																				0.502	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
NXT1	29107	broad.mit.edu	37	20	23334952	23334952	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:23334952C>T	ENST00000254998.2	+	2	661	c.274C>T	c.(274-276)Ctt>Ttt	p.L92F	RP3-322G13.5_ENST00000442440.1_RNA|RP3-322G13.5_ENST00000452395.1_RNA|RP3-322G13.5_ENST00000444981.1_RNA|AL096677.1_ENST00000596205.1_5'Flank|RP3-322G13.7_ENST00000442884.1_RNA	NM_013248.2	NP_037380.1	Q9UKK6	NXT1_HUMAN	nuclear transport factor 2-like export factor 1	92	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				protein export from nucleus (GO:0006611)|RNA export from nucleus (GO:0006405)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)		p.L92F(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GACCACGGTCCTTGTTGTCAT	0.512																																					p.L92F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C274T	20						.						121.0	110.0	114.0					20																	23334952		2203	4300	6503	23282952	SO:0001583	missense	29107	exon2			AF156957	CCDS13150.1	20p12-p11.2	2014-05-12	2014-05-12		ENSG00000132661	ENSG00000132661			15913	protein-coding gene	gene with protein product		605811	"""NTX2-like export factor1"", ""NTF2-like export factor 1"""			10567585, 11259602	Standard	NM_013248		Approved	P15, MTR2	uc002wsx.1	Q9UKK6	OTTHUMG00000032059	ENST00000254998.2:c.274C>T	20.37:g.23334952C>T	ENSP00000254998:p.Leu92Phe		23282952	NM_013248		Missense_Mutation	SNP	ENST00000254998.2	37	CCDS13150.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.207758	0.79240	.	.	ENSG00000132661	ENST00000254998	.	.	.	5.07	5.07	0.68467	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.000000	0.85682	D	0.000000	T	0.80518	0.4638	M	0.83692	2.655	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.82587	-0.0383	9	0.66056	D	0.02	.	16.3476	0.83150	0.0:1.0:0.0:0.0	.	92	Q9UKK6	NXT1_HUMAN	F	92	.	ENSP00000254998:L92F	L	+	1	0	NXT1	23282952	1.000000	0.71417	0.981000	0.43875	0.950000	0.60333	4.476000	0.60216	2.809000	0.96659	0.655000	0.94253	CTT		0.512	NXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078313.2	NM_013248	
BPIFA1	51297	broad.mit.edu	37	20	31825987	31825987	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:31825987C>T	ENST00000354297.4	+	3	358	c.287C>T	c.(286-288)aCg>aTg	p.T96M	BPIFA1_ENST00000375422.2_Missense_Mutation_p.T96M|BPIFA1_ENST00000375413.4_Missense_Mutation_p.T96M	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	96					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.T96M(1)									GGAAAAGTGACGTCAGTGATT	0.537																																					p.T96M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C287T	20						.						86.0	79.0	81.0					20																	31825987		2203	4300	6503	31289648	SO:0001583	missense	51297	exon3			AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.287C>T	20.37:g.31825987C>T	ENSP00000346251:p.Thr96Met		31289648	NM_016583	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	ENST00000354297.4	37	CCDS13217.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544359	0.27563	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.12361	2.69;2.69;2.69	5.34	2.28	0.28536	.	0.503596	0.20012	N	0.101084	T	0.18882	0.0453	L	0.51422	1.61	0.09310	N	1	D	0.64830	0.994	P	0.55667	0.781	T	0.04870	-1.0921	10	0.40728	T	0.16	-1.3225	5.0252	0.14381	0.1666:0.657:0.0:0.1764	.	96	Q9NP55	BPIA1_HUMAN	M	96;96;96;82	ENSP00000364571:T96M;ENSP00000346251:T96M;ENSP00000364562:T96M	ENSP00000346251:T96M	T	+	2	0	BPIFA1	31289648	0.001000	0.12720	0.204000	0.23530	0.008000	0.06430	-0.057000	0.11768	0.808000	0.34231	0.655000	0.94253	ACG		0.537	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
CEP250	11190	broad.mit.edu	37	20	34063455	34063455	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:34063455C>T	ENST00000397527.1	+	15	2420	c.1700C>T	c.(1699-1701)aCc>aTc	p.T567I	RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Missense_Mutation_p.T567I	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	567	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			ACGGAAGTGACCGCAGCGCTG	0.557																																					p.T567I												.	.	0			c.C1700T	20						.						142.0	132.0	136.0					20																	34063455		2203	4300	6503	33526869	SO:0001583	missense	11190	exon15			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.1700C>T	20.37:g.34063455C>T	ENSP00000380661:p.Thr567Ile		33526869	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914457	0.72983	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000425934	T;T;T	0.23552	2.88;2.91;1.9	5.23	5.23	0.72850	.	0.400048	0.21129	N	0.079699	T	0.25005	0.0607	L	0.36672	1.1	0.26404	N	0.976372	P	0.43662	0.814	B	0.41813	0.367	T	0.10268	-1.0637	10	0.39692	T	0.17	.	16.0935	0.81106	0.0:1.0:0.0:0.0	.	567	Q9BV73	CP250_HUMAN	I	567;567;566	ENSP00000380661:T567I;ENSP00000341541:T567I;ENSP00000413827:T566I	ENSP00000341541:T567I	T	+	2	0	CEP250	33526869	0.823000	0.29233	0.977000	0.42913	0.983000	0.72400	1.535000	0.36061	2.716000	0.92895	0.563000	0.77884	ACC		0.557	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
RSPO4	343637	broad.mit.edu	37	20	947863	947864	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:947863_947864GG>TA	ENST00000217260.4	-	3	458_459	c.362_363CC>TA	c.(361-363)aCC>aTA	p.T121I	RSPO4_ENST00000400634.2_Missense_Mutation_p.T121I	NM_001029871.3	NP_001025042.2	Q2I0M5	RSPO4_HUMAN	R-spondin 4	121					Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	heparin binding (GO:0008201)	p.T121>?(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						CCGGCGGGCAGGTGGGCAGACA	0.634																																					.												.	.	1	Complex(1)	large_intestine(1)	c.362_363TA	20						.																																			895864	SO:0001583	missense	343637	exon3			AK122609	CCDS42845.1, CCDS42846.1	20p13	2014-01-30	2011-06-29	2005-08-08	ENSG00000101282	ENSG00000101282		"""Endogenous ligands"""	16175	protein-coding gene	gene with protein product		610573	"""chromosome 20 open reading frame 182"", ""R-spondin family, member 4"""	C20orf182		15469841	Standard	NM_001029871		Approved	dJ824F16.3	uc002wej.3	Q2I0M5	OTTHUMG00000031651	ENST00000217260.4:c.362_363delinsTA	20.37:g.947863_947864delinsTA	ENSP00000217260:p.Thr121Ile		895863	NM_001029871	A2A2I6|Q9UGB2	Missense_Mutation	DNP	ENST00000217260.4	37	CCDS42846.1																																																																																				0.634	RSPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077492.3	XM_297816	
PIGT	51604	broad.mit.edu	37	20	44045253	44045253	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr20:44045253G>A	ENST00000279036.6	+	2	364	c.284G>A	c.(283-285)aGg>aAg	p.R95K	PIGT_ENST00000341555.5_Intron|PIGT_ENST00000372689.5_Missense_Mutation_p.R95K|PIGT_ENST00000545755.1_Intron|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000543458.2_Missense_Mutation_p.R95K|PIGT_ENST00000535404.1_5'UTR	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	95					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.R95K(1)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				GGCTTTTGGAGGACCCGATAC	0.577																																					p.R95K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	20						.						43.0	42.0	42.0					20																	44045253		2203	4300	6503	43478667	SO:0001583	missense	51604	exon2				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.284G>A	20.37:g.44045253G>A	ENSP00000279036:p.Arg95Lys		43478667	NM_015937	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	ENST00000279036.6	37	CCDS13353.1	.	.	.	.	.	.	.	.	.	.	G	37	5.987450	0.97173	.	.	ENSG00000124155	ENST00000543458;ENST00000372689;ENST00000279036	T;T;T	0.40476	1.03;1.03;1.03	5.94	5.94	0.96194	.	0.046057	0.85682	D	0.000000	T	0.60830	0.2299	M	0.79805	2.47	0.80722	D	1	P;P;D	0.56746	0.946;0.804;0.977	P;P;P	0.55222	0.669;0.771;0.589	T	0.55879	-0.8071	10	0.20519	T	0.43	-29.5132	19.3434	0.94355	0.0:0.0:1.0:0.0	.	95;95;95	B7Z3N1;B7Z7C5;Q969N2	.;.;PIGT_HUMAN	K	95	ENSP00000441577:R95K;ENSP00000361774:R95K;ENSP00000279036:R95K	ENSP00000279036:R95K	R	+	2	0	PIGT	43478667	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.597000	0.82733	2.812000	0.96745	0.557000	0.71058	AGG		0.577	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937	
DSCR3	10311	broad.mit.edu	37	21	38604720	38604720	+	Silent	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr21:38604720C>G	ENST00000309117.6	-	5	702	c.465G>C	c.(463-465)gtG>gtC	p.V155V	AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000288304.5_Silent_p.V113V|DSCR3_ENST00000476950.1_Silent_p.V128V|DSCR3_ENST00000399001.1_Silent_p.V30V|DSCR3_ENST00000398998.1_Silent_p.V107V|DSCR3_ENST00000539844.1_Silent_p.V78V|DSCR3_ENST00000399000.3_5'UTR	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	155						nucleus (GO:0005634)		p.V155V(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						TCGTGAAGTCCACGGGACTGG	0.512																																					p.V155V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G465C	21						.						94.0	81.0	85.0					21																	38604720		2203	4300	6503	37526590	SO:0001819	synonymous_variant	10311	exon5			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.465G>C	21.37:g.38604720C>G			37526590	NM_006052	B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Silent	SNP	ENST00000309117.6	37	CCDS33553.1																																																																																				0.512	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194807.1		
COL6A2	1292	broad.mit.edu	37	21	47533970	47533970	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr21:47533970G>T	ENST00000300527.4	+	5	888	c.784G>T	c.(784-786)Ggc>Tgc	p.G262C	COL6A2_ENST00000397763.1_Missense_Mutation_p.G262C|COL6A2_ENST00000310645.5_Missense_Mutation_p.G262C|COL6A2_ENST00000357838.4_Missense_Mutation_p.G262C|COL6A2_ENST00000409416.1_Missense_Mutation_p.G262C	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	262	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TGGCCCCAAGGGCTACCGTGG	0.572																																					p.G262C												.	.	0			c.G784T	21						.						101.0	82.0	88.0					21																	47533970		2203	4300	6503	46358398	SO:0001583	missense	1292	exon5			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.784G>T	21.37:g.47533970G>T	ENSP00000300527:p.Gly262Cys		46358398	NM_001849	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094891	0.56075	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.99369	-5.78;-5.78;-5.78;-5.78;-5.78	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.991;0.999	D	0.97181	0.9851	10	0.87932	D	0	-11.8754	17.6285	0.88099	0.0:0.0:1.0:0.0	.	262;262;262	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	C	262	ENSP00000300527:G262C;ENSP00000350497:G262C;ENSP00000312529:G262C;ENSP00000387115:G262C;ENSP00000380870:G262C	ENSP00000300527:G262C	G	+	1	0	COL6A2	46358398	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	8.526000	0.90588	2.237000	0.73441	0.643000	0.83706	GGC		0.572	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
KREMEN1	83999	broad.mit.edu	37	22	29534776	29534777	+	Missense_Mutation	DNP	AA	AA	CC			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr22:29534776_29534777AA>CC	ENST00000407188.1	+	7	1123_1124	c.1123_1124AA>CC	c.(1123-1125)AAt>CCt	p.N375P	KREMEN1_ENST00000400335.4_Intron|KREMEN1_ENST00000400338.2_Missense_Mutation_p.N377P|KREMEN1_ENST00000327813.5_Missense_Mutation_p.N377P			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	375					cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.N377>?(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						CCCAGGTAGCAATTCCTGGGCG	0.564																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1129_1130CC	22						.																																			27864777	SO:0001583	missense	83999	exon7			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	Exception_encountered	22.37:g.29534776_29534777delinsCC	ENSP00000385431:p.Asn375Pro		27864776	NM_032045	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	DNP	ENST00000407188.1	37	CCDS43000.2																																																																																				0.564	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
SEC14L2	23541	broad.mit.edu	37	22	30803508	30803508	+	Missense_Mutation	SNP	C	C	G	rs201989594	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr22:30803508C>G	ENST00000312932.9	+	5	599	c.339C>G	c.(337-339)ttC>ttG	p.F113L	SEC14L2_ENST00000459728.1_3'UTR|RP4-539M6.19_ENST00000439838.1_5'Flank|SEC14L2_ENST00000403484.1_Missense_Mutation_p.F39L|SEC14L2_ENST00000402592.3_Intron|SEC14L2_ENST00000405717.3_Missense_Mutation_p.F113L	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	113	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.F113L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	GTCTGCTGTTCTCAGCCTCCA	0.552													C|||	3	0.000599042	0.0	0.0043	5008	,	,		19009	0.0		0.0	False		,,,				2504	0.0				p.F113L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C339G	22						.						160.0	142.0	148.0					22																	30803508		2203	4300	6503	29133508	SO:0001583	missense	23541	exon5			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.339C>G	22.37:g.30803508C>G	ENSP00000316203:p.Phe113Leu		29133508	NM_033382	B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Missense_Mutation	SNP	ENST00000312932.9	37	CCDS13876.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	5.879	0.346332	0.11126	.	.	ENSG00000100003	ENST00000312932;ENST00000428195;ENST00000403484;ENST00000416523;ENST00000405717;ENST00000429917	T;T;T;T;T;T	0.59772	1.78;1.78;1.78;0.24;1.78;0.24	5.19	-0.862	0.10673	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.344791	0.32175	N	0.006478	T	0.21550	0.0519	N	0.01729	-0.75	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.13629	-1.0502	10	0.08179	T	0.78	-21.6589	7.8274	0.29324	0.1104:0.3913:0.4317:0.0666	.	39;113;113	B3KRD8;O76054;O76054-4	.;S14L2_HUMAN;.	L	113;59;39;113;113;77	ENSP00000316203:F113L;ENSP00000387781:F59L;ENSP00000383993:F39L;ENSP00000400567:F113L;ENSP00000385186:F113L;ENSP00000407857:F77L	ENSP00000316203:F113L	F	+	3	2	SEC14L2	29133508	0.995000	0.38212	1.000000	0.80357	0.969000	0.65631	0.233000	0.17911	0.329000	0.23460	-0.175000	0.13238	TTC		0.552	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321018.4	NM_012429	
LIMK2	3985	broad.mit.edu	37	22	31662097	31662098	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr22:31662097_31662098CT>AG	ENST00000331728.4	+	8	1134_1135	c.1020_1021CT>AG	c.(1018-1023)ggCTtc>ggAGtc	p.F341V	LIMK2_ENST00000406516.1_Missense_Mutation_p.F263V|LIMK2_ENST00000444929.2_Missense_Mutation_p.F95V|LIMK2_ENST00000340552.4_Missense_Mutation_p.F320V|LIMK2_ENST00000333611.4_Missense_Mutation_p.F320V	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	341	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.G340>?(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TGGGGAAGGGCTTCTTTGGGCA	0.55																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1020_1021AG	22						.																																			29992098	SO:0001583	missense	3985	exon8			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	Exception_encountered	22.37:g.31662097_31662098delinsAG	ENSP00000332687:p.Phe341Val		29992097	NM_005569	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	DNP	ENST00000331728.4	37	CCDS13891.1																																																																																				0.550	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
GTSE1	51512	broad.mit.edu	37	22	46722390	46722390	+	Silent	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr22:46722390G>T	ENST00000454366.1	+	9	1775	c.1563G>T	c.(1561-1563)ctG>ctT	p.L521L		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	502					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)		p.L502L(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CACAAAGCCTGCTGAGCGCAT	0.622																																					p.L521L	GBM(153;542 1915 12487 29016 50495)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1563T	22						.						54.0	49.0	51.0					22																	46722390		2203	4300	6503	45101054	SO:0001819	synonymous_variant	51512	exon9			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1563G>T	22.37:g.46722390G>T			45101054	NM_016426	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	37	CCDS14074.2																																																																																				0.622	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
SNX17	9784	broad.mit.edu	37	2	27594194	27594195	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:27594194_27594195insG	ENST00000233575.2	+	2	344_345	c.122_123insG	c.(121-126)ctggggfs	p.LG41fs	SNX17_ENST00000543024.1_Intron|EIF2B4_ENST00000347454.4_5'Flank|EIF2B4_ENST00000451130.2_5'Flank|SNX17_ENST00000537606.1_Intron|EIF2B4_ENST00000493344.2_5'Flank|SNX17_ENST00000542478.1_5'UTR|EIF2B4_ENST00000445933.2_5'Flank	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	41	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCAGCTCCTGGGGCTGCACG	0.554																																					p.L41fs												.	.	0			c.122_123insG	2						.																																			27447699	SO:0001589	frameshift_variant	9784	exon2			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.126dupG	2.37:g.27594198_27594198dupG	ENSP00000233575:p.Leu41fs		27447698	NM_014748	B4DQM7|Q53HN7|Q6IAS3	Frame_Shift_Ins	INS	ENST00000233575.2	37	CCDS1750.1																																																																																				0.554	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215024.1	NM_014748	
ZC3H8	84524	broad.mit.edu	37	2	112994237	112994237	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:112994237G>T	ENST00000409573.2	-	4	535	c.406C>A	c.(406-408)Cac>Aac	p.H136N	ZC3H8_ENST00000272570.5_Missense_Mutation_p.H136N			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	136					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H136N(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						CCATTCTTGTGACCAGCTTTA	0.343																																					p.H136N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C406A	2						.						166.0	146.0	152.0					2																	112994237		1835	4087	5922	112710708	SO:0001583	missense	84524	exon4			AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.406C>A	2.37:g.112994237G>T	ENSP00000386488:p.His136Asn		112710708	NM_032494	Q9BZ75	Missense_Mutation	SNP	ENST00000409573.2	37	CCDS46392.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433993	0.25813	.	.	ENSG00000144161	ENST00000409573;ENST00000272570	T;T	0.18338	2.22;2.22	4.17	4.17	0.49024	.	1.204870	0.05762	N	0.605169	T	0.18718	0.0449	L	0.47716	1.5	0.09310	N	1	B	0.19583	0.037	B	0.14578	0.011	T	0.12734	-1.0536	10	0.24483	T	0.36	6.1872	11.7301	0.51732	0.0:0.0:0.8235:0.1765	.	136	Q8N5P1	ZC3H8_HUMAN	N	136	ENSP00000386488:H136N;ENSP00000272570:H136N	ENSP00000272570:H136N	H	-	1	0	ZC3H8	112710708	0.125000	0.22332	0.473000	0.27253	0.843000	0.47879	2.384000	0.44362	2.618000	0.88619	0.655000	0.94253	CAC		0.343	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330521.3	NM_032494	
RAB3GAP1	22930	broad.mit.edu	37	2	135911299	135911299	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:135911299T>A	ENST00000264158.8	+	19	2185	c.2142T>A	c.(2140-2142)gaT>gaA	p.D714E	RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.D670E|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.D714E|ZRANB3_ENST00000412849.1_Intron|RAB3GAP1_ENST00000487003.1_3'UTR	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	714					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.D714E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		AGGTGATTGATGAAAAGGGCA	0.448																																					p.D714E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2142A	2						.						118.0	123.0	121.0					2																	135911299		2203	4300	6503	135627769	SO:0001583	missense	22930	exon19			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2142T>A	2.37:g.135911299T>A	ENSP00000264158:p.Asp714Glu		135627769	NM_012233	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	37	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.591346	0.66219	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.48836	0.81;0.8;0.8	5.55	1.82	0.25136	.	0.000000	0.85682	D	0.000000	T	0.37571	0.1008	L	0.37850	1.14	0.80722	D	1	B;B	0.31931	0.347;0.19	B;B	0.38156	0.266;0.148	T	0.08027	-1.0742	10	0.28530	T	0.3	-22.6465	9.1793	0.37131	0.0:0.21:0.0:0.79	.	714;714	C9J837;Q15042	.;RB3GP_HUMAN	E	714;670;714	ENSP00000264158:D714E;ENSP00000444306:D670E;ENSP00000411418:D714E	ENSP00000264158:D714E	D	+	3	2	RAB3GAP1	135627769	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.623000	0.24447	0.368000	0.24481	0.533000	0.62120	GAT		0.448	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
UBXN4	23190	broad.mit.edu	37	2	136540413	136540413	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:136540413G>A	ENST00000272638.9	+	13	1794	c.1483G>A	c.(1483-1485)Gat>Aat	p.D495N	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	495					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D495N(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						TGATGGTGAAGATGAAAACAA	0.348																																					p.D495N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1483A	2						.						115.0	115.0	115.0					2																	136540413		1860	4101	5961	136256883	SO:0001583	missense	23190	exon13			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.1483G>A	2.37:g.136540413G>A	ENSP00000272638:p.Asp495Asn		136256883	NM_014607	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086657	0.94100	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.56941	0.43	5.48	5.48	0.80851	.	0.050718	0.85682	D	0.000000	T	0.73329	0.3573	M	0.80847	2.515	0.58432	D	0.999996	D	0.76494	0.999	D	0.69654	0.965	T	0.70310	-0.4907	10	0.25751	T	0.34	.	19.3516	0.94389	0.0:0.0:1.0:0.0	.	495	Q92575	UBXN4_HUMAN	N	495;477	ENSP00000272638:D495N	ENSP00000272638:D495N	D	+	1	0	UBXN4	136256883	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.401000	0.97294	2.557000	0.86248	0.643000	0.83706	GAT		0.348	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607	
TTN	7273	broad.mit.edu	37	2	179499924	179499924	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:179499924T>C	ENST00000591111.1	-	178	37293	c.37069A>G	c.(37069-37071)Aaa>Gaa	p.K12357E	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K5125E|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K13998E|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K11430E|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K5058E|TTN_ENST00000460472.2_Missense_Mutation_p.K4933E			Q8WZ42	TITIN_HUMAN	titin	12357					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K5125E(1)|p.K11430E(1)|p.K5058E(1)|p.K4933E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTTCAGTTTCCATTGTCCA	0.363																																					p.K4933E												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A14797G	2						.						187.0	169.0	175.0					2																	179499924		1859	4105	5964	179208169	SO:0001583	missense	7273	exon56			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37069A>G	2.37:g.179499924T>C	ENSP00000465570:p.Lys12357Glu		179208169	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	15.55	2.867759	0.51588	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.78	5.78	0.91487	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58235	0.2108	M	0.63428	1.95	0.58432	D	0.999996	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.75020	0.985;0.985;0.985;0.985	T	0.61202	-0.7110	9	0.87932	D	0	.	16.1062	0.81223	0.0:0.0:0.0:1.0	.	4933;5058;5125;12357	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	11430;4933;5125;5058;4933	ENSP00000343764:K11430E;ENSP00000434586:K4933E;ENSP00000340554:K5125E;ENSP00000352154:K5058E	ENSP00000340554:K5125E	K	-	1	0	TTN	179208169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.963000	0.87922	2.205000	0.71048	0.533000	0.62120	AAA		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179594836	179594836	+	Silent	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:179594836G>T	ENST00000591111.1	-	60	17564	c.17340C>A	c.(17338-17340)gcC>gcA	p.A5780A	TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.A6097A|TTN_ENST00000342992.6_Silent_p.A4853A|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12581	Ig-like 38.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A4853A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAAGAGAGTGGCTTTGCTGG	0.502																																					p.A4853A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C14559A	2						.						55.0	51.0	52.0					2																	179594836		1929	4136	6065	179303081	SO:0001819	synonymous_variant	7273	exon59			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17340C>A	2.37:g.179594836G>T			179303081	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
KCTD18	130535	broad.mit.edu	37	2	201355316	201355316	+	Missense_Mutation	SNP	G	G	A	rs115629407	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:201355316G>A	ENST00000359878.3	-	7	1298	c.788C>T	c.(787-789)gCg>gTg	p.A263V	KCTD18_ENST00000409157.1_Missense_Mutation_p.A263V|KCTD18_ENST00000468413.1_5'Flank	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	263					protein homooligomerization (GO:0051260)			p.A263V(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						ACTTTCGTCCGCTTCATTGAA	0.418													G|||	18	0.00359425	0.0121	0.0	5008	,	,		21040	0.002		0.0	False		,,,				2504	0.0				p.A263V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C788T	2						.	G	VAL/ALA	15,4369		0,15,2177	63.0	68.0	66.0		788	-1.2	0.0	2	dbSNP_132	66	1,8595		0,1,4297	yes	missense	KCTD18	NM_152387.2	64	0,16,6474	AA,AG,GG		0.0116,0.3422,0.1233	benign	263/427	201355316	16,12964	2192	4298	6490	201063561	SO:0001583	missense	130535	exon7			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.788C>T	2.37:g.201355316G>A	ENSP00000352941:p.Ala263Val		201063561	NM_152387	Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	ENST00000359878.3	37	CCDS2330.1	5	0.0022893772893772895	4	0.008130081300813009	0	0.0	1	0.0017482517482517483	0	0.0	G	4.491	0.091124	0.08632	0.003422	1.16E-4	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.34072	1.38;1.38	5.2	-1.23	0.09465	.	0.521574	0.18652	N	0.134972	T	0.08088	0.0202	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10941	-1.0608	10	0.42905	T	0.14	-16.4274	0.7585	0.01002	0.2343:0.2737:0.1231:0.3689	.	263	Q6PI47	KCD18_HUMAN	V	263	ENSP00000352941:A263V;ENSP00000386751:A263V	ENSP00000352941:A263V	A	-	2	0	KCTD18	201063561	0.948000	0.32251	0.001000	0.08648	0.020000	0.10135	0.676000	0.25247	-0.348000	0.08286	-1.005000	0.02491	GCG		0.418	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256188.1	NM_152387	
FN1	2335	broad.mit.edu	37	2	216274421	216274421	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:216274421C>T	ENST00000359671.1	-	15	2429	c.2164G>A	c.(2164-2166)Gtg>Atg	p.V722M	FN1_ENST00000357009.2_Missense_Mutation_p.V722M|FN1_ENST00000345488.5_Missense_Mutation_p.V722M|FN1_ENST00000357867.4_Missense_Mutation_p.V722M|FN1_ENST00000446046.1_Missense_Mutation_p.V722M|FN1_ENST00000443816.1_Missense_Mutation_p.V722M|FN1_ENST00000323926.6_Missense_Mutation_p.V722M|FN1_ENST00000432072.2_Missense_Mutation_p.V722M|FN1_ENST00000356005.4_Missense_Mutation_p.V722M|FN1_ENST00000354785.4_Missense_Mutation_p.V722M|FN1_ENST00000421182.1_Missense_Mutation_p.V722M|FN1_ENST00000336916.4_Missense_Mutation_p.V722M|FN1_ENST00000346544.3_Missense_Mutation_p.V722M			P02751	FINC_HUMAN	fibronectin 1	722	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.V722M(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GAAGTGGCCACAAGAGGAGAA	0.512																																					p.V722M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2164A	2						.						48.0	44.0	45.0					2																	216274421		2203	4300	6503	215982666	SO:0001583	missense	2335	exon15				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2164G>A	2.37:g.216274421C>T	ENSP00000352696:p.Val722Met		215982666	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	15.28	2.785618	0.49997	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.51574	0.7;2.08;2.24;0.8;2.29;1.93;2.29;1.96;2.24;1.98;1.47;0.77;1.36	5.69	5.69	0.88448	.	0.094692	0.44688	D	0.000431	T	0.56140	0.1965	N	0.17082	0.46	0.58432	D	0.999999	D;P;D;D;D;P;D;D;D;D	0.71674	0.993;0.938;0.983;0.994;0.995;0.825;0.998;0.994;0.994;0.993	D;P;P;P;P;B;D;P;P;D	0.75020	0.98;0.615;0.627;0.827;0.892;0.419;0.913;0.827;0.827;0.985	T	0.60125	-0.7324	10	0.59425	D	0.04	.	20.181	0.98201	0.0:1.0:0.0:0.0	.	722;722;722;722;722;722;722;722;722;722	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	M	722	ENSP00000394423:V722M;ENSP00000323534:V722M;ENSP00000338200:V722M;ENSP00000350534:V722M;ENSP00000346839:V722M;ENSP00000352696:V722M;ENSP00000265312:V722M;ENSP00000273049:V722M;ENSP00000349509:V722M;ENSP00000410422:V722M;ENSP00000415018:V722M;ENSP00000399538:V722M;ENSP00000348285:V722M	ENSP00000265313:V722M	V	-	1	0	FN1	215982666	0.998000	0.40836	0.969000	0.41365	0.085000	0.17905	2.504000	0.45416	2.840000	0.97914	0.655000	0.94253	GTG		0.512	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
COL4A4	1286	broad.mit.edu	37	2	227919391	227919391	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:227919391C>A	ENST00000396625.3	-	31	2986	c.2779G>T	c.(2779-2781)Gga>Tga	p.G927*	COL4A4_ENST00000329662.7_Nonsense_Mutation_p.G927*	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	927	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G927*(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCAGGACATCCCTCTGCACCA	0.527																																					p.G927X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2779T	2						.						70.0	71.0	71.0					2																	227919391		1884	4102	5986	227627635	SO:0001587	stop_gained	1286	exon31				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2779G>T	2.37:g.227919391C>A	ENSP00000379866:p.Gly927*		227627635	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Nonsense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	C	39	7.697143	0.98438	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.252	0.87045	0.0:1.0:0.0:0.0	.	.	.	.	X	927	.	ENSP00000328553:G927X	G	-	1	0	COL4A4	227627635	0.997000	0.39634	0.141000	0.22245	0.087000	0.18053	5.246000	0.65411	2.598000	0.87819	0.650000	0.86243	GGA		0.527	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
UGT1A9	54600	broad.mit.edu	37	2	234581076	234581076	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:234581076G>A	ENST00000354728.4	+	1	578	c.496G>A	c.(496-498)Gtg>Atg	p.V166M	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.V166M			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	166					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.V166M(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	CCTCCCCTCCGTGGTCTTCGC	0.443																																					p.V166M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G496A	2						.						155.0	157.0	156.0					2																	234581076		2203	4300	6503	234245815	SO:0001583	missense	54600	exon1			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.496G>A	2.37:g.234581076G>A	ENSP00000346768:p.Val166Met		234245815	NM_021027	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587151	0.28268	.	.	ENSG00000241119	ENST00000354728	T	0.66099	-0.19	3.41	3.41	0.39046	.	.	.	.	.	D	0.82637	0.5080	M	0.91920	3.255	0.25112	N	0.990708	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.984	T	0.75056	-0.3452	9	0.59425	D	0.04	.	15.414	0.74948	0.0:0.0:1.0:0.0	.	166;166	Q5DSZ5;O60656	.;UD19_HUMAN	M	166	ENSP00000346768:V166M	ENSP00000346768:V166M	V	+	1	0	UGT1A9	234245815	1.000000	0.71417	0.036000	0.18154	0.163000	0.22366	4.301000	0.59086	1.907000	0.55213	0.440000	0.28878	GTG		0.443	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
COL6A3	1293	broad.mit.edu	37	2	238258816	238258816	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:238258816C>T	ENST00000295550.4	-	28	7305	c.6853G>A	c.(6853-6855)Ggg>Agg	p.G2285R	COL6A3_ENST00000409809.1_Missense_Mutation_p.G2079R|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1678R|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2079R|COL6A3_ENST00000346358.4_Missense_Mutation_p.G2085R|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2084R	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2285	Collagen-like 4.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2285R(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCCGGTTCCCGATTCCTCCT	0.617																																					p.G1678R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5032A	2						.						91.0	81.0	84.0					2																	238258816		2203	4300	6503	237923555	SO:0001583	missense	1293	exon25			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6853G>A	2.37:g.238258816C>T	ENSP00000295550:p.Gly2285Arg		237923555	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473920	0.26423	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.97959	-4.29;-4.29;-4.63;-4.29;-4.63;-4.29	5.38	5.38	0.77491	.	0.000000	0.52532	D	0.000078	D	0.99402	0.9789	H	0.99312	4.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.98179	1.0456	10	0.87932	D	0	.	19.1613	0.93533	0.0:1.0:0.0:0.0	.	1678;1678;2079;2285	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	R	2285;2084;2079;1678;2079;2085	ENSP00000295550:G2285R;ENSP00000315609:G2084R;ENSP00000315873:G2079R;ENSP00000418285:G1678R;ENSP00000386844:G2079R;ENSP00000295546:G2085R	ENSP00000295550:G2285R	G	-	1	0	COL6A3	237923555	1.000000	0.71417	0.091000	0.20842	0.002000	0.02628	6.769000	0.74985	2.507000	0.84556	0.655000	0.94253	GGG		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
YWHAQ	10971	broad.mit.edu	37	2	9770513	9770513	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:9770513G>A	ENST00000381844.4	-	1	232	c.69C>T	c.(67-69)gcC>gcT	p.A23A	YWHAQ_ENST00000238081.3_Silent_p.A23A			P27348	1433T_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta	23					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|protein complex (GO:0043234)	protein N-terminus binding (GO:0047485)	p.A23A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		TCATGCAGGTGGCCATGTCGT	0.697																																					p.A23A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C69T	2						.						35.0	34.0	34.0					2																	9770513		2203	4300	6503	9687964	SO:0001819	synonymous_variant	10971	exon2			AF070556	CCDS1666.1	2p25.2-p25.1	2013-12-03	2013-12-03		ENSG00000134308	ENSG00000134308			12854	protein-coding gene	gene with protein product	"""protein tau"""	609009	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide"""			11080204	Standard	NM_006826		Approved	HS1, 14-3-3	uc002qzx.3	P27348	OTTHUMG00000013848	ENST00000381844.4:c.69C>T	2.37:g.9770513G>A			9687964	NM_006826	D6W4Z5|Q567U5|Q5TZU8|Q9UP48	Silent	SNP	ENST00000381844.4	37	CCDS1666.1																																																																																				0.697	YWHAQ-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039014.4	NM_006826	
C2orf16	84226	broad.mit.edu	37	2	27804733	27804733	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:27804733G>T	ENST00000408964.2	+	1	5345	c.5294G>T	c.(5293-5295)aGc>aTc	p.S1765I	ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000556601.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000416005.2_5'Flank|AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1765	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.S1765I(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TCTGAGAGAAGCCATTGCAGT	0.522																																					p.S1765I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5294T	2						.						201.0	205.0	203.0					2																	27804733		1928	4134	6062	27658237	SO:0001583	missense	84226	exon1			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5294G>T	2.37:g.27804733G>T	ENSP00000386190:p.Ser1765Ile		27658237	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.340819	0.41498	.	.	ENSG00000221843	ENST00000408964	T	0.05717	3.4	3.62	-4.72	0.03269	.	.	.	.	.	T	0.04907	0.0132	L	0.48642	1.525	0.09310	N	1	B	0.18863	0.031	B	0.22601	0.04	T	0.43669	-0.9377	9	0.45353	T	0.12	.	0.9433	0.01360	0.2489:0.3468:0.1701:0.2341	.	1765	Q68DN1	CB016_HUMAN	I	1765	ENSP00000386190:S1765I	ENSP00000386190:S1765I	S	+	2	0	C2orf16	27658237	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.481000	0.00456	-1.156000	0.02818	-0.502000	0.04539	AGC		0.522	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
C2orf71	388939	broad.mit.edu	37	2	29296845	29296845	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:29296845C>T	ENST00000331664.5	-	1	282	c.283G>A	c.(283-285)Gga>Aga	p.G95R		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	95					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)		p.G95R(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GTTTTGGTTCCTGGGATCAGT	0.493																																					p.G95R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G283A	2						.						250.0	233.0	238.0					2																	29296845		1945	4137	6082	29150349	SO:0001583	missense	388939	exon1				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.283G>A	2.37:g.29296845C>T	ENSP00000332809:p.Gly95Arg		29150349	NM_001029883		Missense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	C	2.812	-0.246848	0.05867	.	.	ENSG00000179270	ENST00000331664	T	0.17854	2.25	5.24	2.48	0.30137	.	0.802151	0.11397	N	0.568230	T	0.09598	0.0236	N	0.22421	0.69	0.09310	N	1	B	0.33583	0.418	B	0.24394	0.053	T	0.26573	-1.0099	10	0.42905	T	0.14	0.2366	6.3097	0.21159	0.0:0.6521:0.1316:0.2163	.	95	A6NGG8	CB071_HUMAN	R	95	ENSP00000332809:G95R	ENSP00000332809:G95R	G	-	1	0	C2orf71	29150349	0.267000	0.24122	0.000000	0.03702	0.046000	0.14306	2.008000	0.40893	0.233000	0.21120	-0.291000	0.09656	GGA		0.493	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
SLC3A1	6519	broad.mit.edu	37	2	44503055	44503055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:44503055C>A	ENST00000260649.6	+	1	457	c.381C>A	c.(379-381)taC>taA	p.Y127*	SLC3A1_ENST00000409387.1_Nonsense_Mutation_p.Y127*|SLC3A1_ENST00000409741.1_Nonsense_Mutation_p.Y127*|SLC3A1_ENST00000409229.3_Nonsense_Mutation_p.Y127*|SLC3A1_ENST00000410056.3_Nonsense_Mutation_p.Y127*	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	127					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)	p.Y127*(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	ACCAGATCTACCCAAGGTCTT	0.527																																					p.Y127X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C381A	2						.																																			44356559	SO:0001587	stop_gained	6519	exon1				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.381C>A	2.37:g.44503055C>A	ENSP00000260649:p.Tyr127*		44356559	NM_000341	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Nonsense_Mutation	SNP	ENST00000260649.6	37	CCDS1819.1	.	.	.	.	.	.	.	.	.	.	C	37	6.365127	0.97507	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000410056;ENST00000409741;ENST00000409229;ENST00000541289	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5929	12.2436	0.54558	0.0:0.8775:0.0:0.1225	.	.	.	.	X	127;127;63;127;127;127;127	.	ENSP00000260649:Y127X	Y	+	3	2	SLC3A1	44356559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.950000	0.29122	2.566000	0.86566	0.655000	0.94253	TAC		0.527	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341	
BCL11A	53335	broad.mit.edu	37	2	60687915	60687915	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:60687915G>A	ENST00000335712.6	-	4	2359	c.2132C>T	c.(2131-2133)tCg>tTg	p.S711L	BCL11A_ENST00000356842.4_Missense_Mutation_p.S711L|BCL11A_ENST00000358510.4_Missense_Mutation_p.S677L|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.S677L|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000537768.1_Missense_Mutation_p.S380L	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	711					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.S711L(2)		NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GCTGCGCCCCGAGATCCCTCC	0.657			T	IGH@	B-CLL																																p.S711L			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2132T	2						.						37.0	44.0	42.0					2																	60687915		2203	4299	6502	60541419	SO:0001583	missense	53335	exon4			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2132C>T	2.37:g.60687915G>A	ENSP00000338774:p.Ser711Leu		60541419	NM_022893	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526037	0.44969	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.17854	2.37;3.17;2.25;3.2;3.12	5.93	5.93	0.95920	.	0.075764	0.56097	D	0.000037	T	0.41351	0.1155	L	0.54323	1.7	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.98;0.988;1.0;1.0	D;B;P;D;D	0.87578	0.998;0.368;0.572;0.997;0.994	T	0.03695	-1.1012	10	0.59425	D	0.04	-1.2098	20.3311	0.98718	0.0:0.0:1.0:0.0	.	677;380;677;711;711	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	L	711;736;677;380;711;677	ENSP00000349300:S711L;ENSP00000438303:S677L;ENSP00000443712:S380L;ENSP00000338774:S711L;ENSP00000351307:S677L	ENSP00000338774:S711L	S	-	2	0	BCL11A	60541419	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.797000	0.96272	0.655000	0.94253	TCG		0.657	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
PER2	8864	broad.mit.edu	37	2	239164499	239164499	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr2:239164499G>C	ENST00000254657.3	-	18	2398	c.2119C>G	c.(2119-2121)Cct>Gct	p.P707A	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	707	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GCCAGGGCAGGGCCCGCCAGG	0.597																																					p.P707A												.	.	0			c.C2119G	2						.						78.0	87.0	84.0					2																	239164499		2203	4300	6503	238829238	SO:0001583	missense	8864	exon18			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2119C>G	2.37:g.239164499G>C	ENSP00000254657:p.Pro707Ala		238829238	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749039	0.49257	.	.	ENSG00000132326	ENST00000254657	T	0.13657	2.57	3.78	2.89	0.33648	.	2.715680	0.00921	N	0.002591	T	0.19208	0.0461	M	0.68728	2.09	0.30288	N	0.790626	B;P	0.46220	0.01;0.874	B;B	0.39339	0.006;0.297	T	0.26018	-1.0115	10	0.39692	T	0.17	.	7.9049	0.29757	0.122:0.0:0.878:0.0	.	707;707	B4DH14;O15055	.;PER2_HUMAN	A	707	ENSP00000254657:P707A	ENSP00000254657:P707A	P	-	1	0	PER2	238829238	0.493000	0.26035	0.438000	0.26821	0.019000	0.09904	0.129000	0.15830	0.678000	0.31325	0.650000	0.86243	CCT		0.597	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
ATP2B2	491	broad.mit.edu	37	3	10382240	10382240	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:10382240G>A	ENST00000352432.4	-	19	3135	c.3066C>T	c.(3064-3066)gtC>gtT	p.V1022V	ATP2B2_ENST00000397077.1_Silent_p.V977V|ATP2B2_ENST00000360273.2_Silent_p.V1022V|ATP2B2_ENST00000343816.4_Silent_p.V1008V|ATP2B2_ENST00000383800.4_Silent_p.V977V			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1022					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.V977V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGCCGTCAAAGACATTGCGCT	0.582																																					p.V977V	Ovarian(125;1619 1709 15675 19819 38835)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2931T	3						.						209.0	172.0	184.0					3																	10382240		2203	4300	6503	10357240	SO:0001819	synonymous_variant	491	exon17			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3066C>T	3.37:g.10382240G>A			10357240	NM_001683	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	CCDS33701.1																																																																																				0.582	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
MSL2	55167	broad.mit.edu	37	3	135871238	135871238	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:135871238G>A	ENST00000309993.2	-	2	1217	c.485C>T	c.(484-486)tCa>tTa	p.S162L	MSL2_ENST00000434835.2_Missense_Mutation_p.S88L	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	162					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						TTCTGAGGTTGAAGGTAAAGG	0.408																																					p.S162L												.	.	0			c.C485T	3						.						79.0	72.0	74.0					3																	135871238		2203	4300	6503	137353928	SO:0001583	missense	55167	exon2			AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.485C>T	3.37:g.135871238G>A	ENSP00000311827:p.Ser162Leu		137353928	NM_018133	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	37	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948702	0.34377	.	.	ENSG00000174579	ENST00000309993;ENST00000434835;ENST00000481989;ENST00000491050;ENST00000473093	.	.	.	6.03	4.25	0.50352	.	0.204155	0.32671	N	0.005787	T	0.42698	0.1214	N	0.19112	0.55	0.44366	D	0.997264	B	0.09022	0.002	B	0.08055	0.003	T	0.27434	-1.0074	9	0.59425	D	0.04	-1.9082	12.2885	0.54805	0.1366:0.0:0.8634:0.0	.	162	Q9HCI7	MSL2_HUMAN	L	162;88;88;88;88	.	ENSP00000311827:S162L	S	-	2	0	MSL2	137353928	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.586000	0.74067	0.883000	0.36040	0.655000	0.94253	TCA		0.408	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133	
SETD5	55209	broad.mit.edu	37	3	9483902	9483902	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:9483902C>T	ENST00000406341.1	+	9	1240	c.1050C>T	c.(1048-1050)atC>atT	p.I350I	SETD5_ENST00000402466.1_Silent_p.I252I|SETD5_ENST00000302463.6_Silent_p.I252I|SETD5_ENST00000402198.1_Silent_p.I350I|SETD5_ENST00000407969.1_Silent_p.I369I			Q9C0A6	SETD5_HUMAN	SET domain containing 5	350	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.							p.I252I(1)|p.I350I(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CTCGGTTCATCAGAAGATCAT	0.428																																					p.I350I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1050T	3						.						130.0	119.0	123.0					3																	9483902		1914	4138	6052	9458902	SO:0001819	synonymous_variant	55209	exon10			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.1050C>T	3.37:g.9483902C>T			9458902	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	C	9.974	1.226276	0.22542	.	.	ENSG00000168137	ENST00000399686	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.7966	8.6762	0.34181	0.1516:0.7728:0.0:0.0756	.	.	.	.	X	18	.	.	Q	+	1	0	SETD5	9458902	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.959000	0.40412	2.585000	0.87301	0.655000	0.94253	CAG		0.428	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
EMC3	55831	broad.mit.edu	37	3	10005795	10005795	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:10005795G>A	ENST00000245046.2	-	8	1202	c.744C>T	c.(742-744)ttC>ttT	p.F248F	RP11-1020A11.2_ENST00000602436.1_RNA	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	248						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.F248F(2)									ACATGCCTTCGAAGTGGAGGT	0.463																																					p.F248F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C744T	3						.						138.0	130.0	133.0					3																	10005795		2203	4300	6503	9980795	SO:0001819	synonymous_variant	55831	exon8			AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.744C>T	3.37:g.10005795G>A			9980795	NM_018447	B2R4Z9|Q53GH8|Q6ZMC2	Silent	SNP	ENST00000245046.2	37	CCDS2594.1																																																																																				0.463	EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250532.1	NM_018447	
XYLB	9942	broad.mit.edu	37	3	38438610	38438610	+	Silent	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:38438610C>G	ENST00000207870.3	+	17	1488	c.1398C>G	c.(1396-1398)gcC>gcG	p.A466A	XYLB_ENST00000542835.1_Silent_p.A329A|XYLB_ENST00000472721.1_3'UTR	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	466					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)	p.A466A(1)		endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TAGACACTGCCAACTCGGCCT	0.532																																					p.A466A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398G	3						.						202.0	179.0	187.0					3																	38438610		2203	4300	6503	38413614	SO:0001819	synonymous_variant	9942	exon17			AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.1398C>G	3.37:g.38438610C>G			38413614	NM_005108	B2RAW4|B4DDT2|B9EH64	Silent	SNP	ENST00000207870.3	37	CCDS2678.1																																																																																				0.532	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	
SCN11A	11280	broad.mit.edu	37	3	38888269	38888269	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:38888269G>A	ENST00000302328.3	-	26	5490	c.5292C>T	c.(5290-5292)aaC>aaT	p.N1764N	SCN11A_ENST00000450244.1_Silent_p.N1764N|SCN11A_ENST00000456224.3_Silent_p.N1726N	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1764					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.N1764N(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATGAGGCCCGTTTTCCAAGT	0.507																																					p.N1764N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5292T	3						.						217.0	193.0	201.0					3																	38888269		2203	4300	6503	38863273	SO:0001819	synonymous_variant	11280	exon26			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5292C>T	3.37:g.38888269G>A			38863273	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																				0.507	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
CCDC13	152206	broad.mit.edu	37	3	42750551	42750551	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:42750551C>T	ENST00000310232.6	-	16	2152	c.2069G>A	c.(2068-2070)cGg>cAg	p.R690Q	HHATL-AS1_ENST00000600839.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	690										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ATGGTACATCCGGAAGTCCTC	0.597																																					p.R690Q												.	.	0			c.G2069A	3						.						103.0	91.0	95.0					3																	42750551		2203	4300	6503	42725555	SO:0001583	missense	152206	exon16			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.2069G>A	3.37:g.42750551C>T	ENSP00000309836:p.Arg690Gln		42725555	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822274	0.32237	.	.	ENSG00000244607	ENST00000310232	T	0.24908	1.83	4.58	2.74	0.32292	.	0.290655	0.27043	N	0.021214	T	0.26304	0.0642	L	0.46157	1.445	0.20307	N	0.999913	D	0.56746	0.977	P	0.49140	0.601	T	0.05599	-1.0875	10	0.41790	T	0.15	.	7.8012	0.29176	0.0:0.6665:0.0:0.3335	.	690	Q8IYE1	CCD13_HUMAN	Q	690	ENSP00000309836:R690Q	ENSP00000309836:R690Q	R	-	2	0	CCDC13	42725555	0.395000	0.25254	0.923000	0.36655	0.952000	0.60782	0.680000	0.25306	1.148000	0.42385	0.563000	0.77884	CGG		0.597	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
FAM131A	131408	broad.mit.edu	37	3	184059911	184059911	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr3:184059911G>C	ENST00000310585.4	+	1	1654	c.290G>C	c.(289-291)cGa>cCa	p.R97P	FAM131A_ENST00000418281.1_Missense_Mutation_p.R5P|FAM131A_ENST00000453072.1_Missense_Mutation_p.R43P|FAM131A_ENST00000450976.1_Missense_Mutation_p.R43P|EIF2B5_ENST00000444495.1_Intron|FAM131A_ENST00000340957.5_Missense_Mutation_p.R43P|FAM131A_ENST00000383847.2_Missense_Mutation_p.R128P			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	97						extracellular region (GO:0005576)		p.R97P(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCCAGGGCCGAGTGGCTCAC	0.602																																					p.R43P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128C	3						.						133.0	128.0	130.0					3																	184059911		2203	4300	6503	185542605	SO:0001583	missense	131408	exon4			BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.290G>C	3.37:g.184059911G>C	ENSP00000310135:p.Arg97Pro		185542605	NM_001171093	D3DNT6|G5E9B1|Q8TA84	Missense_Mutation	SNP	ENST00000310585.4	37		.	.	.	.	.	.	.	.	.	.	g	32	5.106157	0.94292	.	.	ENSG00000175182	ENST00000450976;ENST00000418281;ENST00000340957;ENST00000433578;ENST00000418768;ENST00000383847;ENST00000453072;ENST00000310585	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.64983	0.2648	M	0.69358	2.11	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.67142	-0.5745	10	0.87932	D	0	-16.5193	18.2786	0.90091	0.0:0.0:1.0:0.0	.	97;128;5	Q6UXB0;G5E9B1;C9JPT9	F131A_HUMAN;.;.	P	43;5;43;43;43;128;43;97	ENSP00000388551:R43P;ENSP00000414050:R5P;ENSP00000340974:R43P;ENSP00000399875:R43P;ENSP00000414913:R43P;ENSP00000373360:R128P;ENSP00000390588:R43P;ENSP00000310135:R97P	ENSP00000310135:R97P	R	+	2	0	FAM131A	185542605	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.296000	0.96104	2.590000	0.87494	0.655000	0.94253	CGA		0.602	FAM131A-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343462.1	NM_144635	
SEC24D	9871	broad.mit.edu	37	4	119666131	119666131	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:119666131C>T	ENST00000280551.6	-	14	2030	c.1792G>A	c.(1792-1794)Gac>Aac	p.D598N	SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000419654.2_Missense_Mutation_p.D154N|SEC24D_ENST00000379735.5_Missense_Mutation_p.D599N|SEC24D_ENST00000429811.2_Missense_Mutation_p.D154N|SEC24D_ENST00000511481.1_Missense_Mutation_p.D229N			O94855	SC24D_HUMAN	SEC24 family member D	598					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.D598N(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						AGTTTTTTGTCATCTCTGTTT	0.383																																					p.D598N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1792A	4						.						133.0	137.0	136.0					4																	119666131		2203	4300	6503	119885579	SO:0001583	missense	9871	exon14			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1792G>A	4.37:g.119666131C>T	ENSP00000280551:p.Asp598Asn		119885579	NM_014822	Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	37	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	C	36	5.865682	0.97043	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000429811;ENST00000511481;ENST00000419654	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	5.59	5.59	0.84812	Sec23/Sec24, trunk domain (1);	0.040777	0.85682	D	0.000000	D	0.85843	0.5791	M	0.76838	2.35	0.80722	D	1	B;D	0.56287	0.302;0.975	B;P	0.61003	0.174;0.882	D	0.87113	0.2186	10	0.87932	D	0	-21.6944	19.5785	0.95455	0.0:1.0:0.0:0.0	.	599;598	O94855-2;O94855	.;SC24D_HUMAN	N	598;599;154;229;154	ENSP00000280551:D598N;ENSP00000369059:D599N;ENSP00000409775:D154N;ENSP00000425491:D229N;ENSP00000388324:D154N	ENSP00000280551:D598N	D	-	1	0	SEC24D	119885579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.905000	0.69893	2.615000	0.88500	0.655000	0.94253	GAC		0.383	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4		
FAT4	79633	broad.mit.edu	37	4	126373564	126373564	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:126373564T>C	ENST00000394329.3	+	9	11406	c.11393T>C	c.(11392-11394)gTg>gCg	p.V3798A	FAT4_ENST00000335110.5_Missense_Mutation_p.V2096A	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3798					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3798A(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGAGTAAAGGTGGAATCTGTG	0.488																																					p.V3798A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T11393C	4						.						77.0	74.0	75.0					4																	126373564		2203	4300	6503	126593014	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11393T>C	4.37:g.126373564T>C	ENSP00000377862:p.Val3798Ala		126593014	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	13.66	2.303749	0.40795	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.77620	-0.95;-1.11	5.66	5.66	0.87406	.	0.271361	0.18931	U	0.127220	T	0.60971	0.2310	N	0.08118	0	0.25392	N	0.988514	P;P;P	0.37663	0.604;0.469;0.604	B;B;B	0.33454	0.164;0.079;0.164	T	0.60855	-0.7180	10	0.56958	D	0.05	.	15.8895	0.79286	0.0:0.0:0.0:1.0	.	2096;3798;3798	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	A	3798;2096	ENSP00000377862:V3798A;ENSP00000335169:V2096A	ENSP00000335169:V2096A	V	+	2	0	FAT4	126593014	1.000000	0.71417	0.008000	0.14137	0.954000	0.61252	7.748000	0.85085	2.153000	0.67306	0.459000	0.35465	GTG		0.488	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
SPATA18	132671	broad.mit.edu	37	4	52943076	52943076	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:52943076C>T	ENST00000295213.4	+	7	1264	c.890C>T	c.(889-891)gCg>gTg	p.A297V	SPATA18_ENST00000419395.2_Missense_Mutation_p.A265V	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	297	Ser-rich.				cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.A297V(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TCCAATGTGGCGCGCAAGGCT	0.662																																					p.A297V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C890T	4						.						65.0	51.0	56.0					4																	52943076		2203	4300	6503	52637833	SO:0001583	missense	132671	exon7			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.890C>T	4.37:g.52943076C>T	ENSP00000295213:p.Ala297Val		52637833	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	C	8.550	0.875410	0.17395	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.58358	0.34;4.2	4.09	3.24	0.37175	.	0.172910	0.52532	D	0.000069	T	0.46639	0.1403	L	0.29908	0.895	0.34720	D	0.728647	P;P;P	0.51240	0.943;0.943;0.912	P;P;B	0.49192	0.602;0.479;0.285	T	0.57625	-0.7779	10	0.34782	T	0.22	-14.5972	12.2693	0.54697	0.0:0.8266:0.1734:0.0	.	265;297;297	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	V	297;265	ENSP00000295213:A297V;ENSP00000415309:A265V	ENSP00000295213:A297V	A	+	2	0	SPATA18	52637833	1.000000	0.71417	0.924000	0.36721	0.025000	0.11179	4.711000	0.61881	0.997000	0.38969	-0.467000	0.05162	GCG		0.662	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
BTC	685	broad.mit.edu	37	4	75673351	75673351	+	Missense_Mutation	SNP	C	C	T	rs144483811	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:75673351C>T	ENST00000395743.3	-	5	797	c.437G>A	c.(436-438)cGg>cAg	p.R146Q		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	146	Arg/Lys-rich (basic).				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)	p.R146Q(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			ACGACGTTTCCGAAGAGGGCT	0.353																																					p.R146Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	4						.	C	GLN/ARG	1,4403	2.1+/-5.4	0,1,2201	80.0	82.0	82.0		437	2.2	0.2	4	dbSNP_134	82	3,8593	2.2+/-6.3	0,3,4295	yes	missense	BTC	NM_001729.2	43	0,4,6496	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	146/179	75673351	4,12996	2202	4298	6500	75892375	SO:0001583	missense	685	exon5			S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.437G>A	4.37:g.75673351C>T	ENSP00000379092:p.Arg146Gln		75892375	NM_001729	Q96F48	Missense_Mutation	SNP	ENST00000395743.3	37	CCDS3566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.987|4.987	0.183316|0.183316	0.09495|0.09495	2.27E-4|2.27E-4	3.49E-4|3.49E-4	ENSG00000174808|ENSG00000174808	ENST00000512743|ENST00000395743	.|T	.|0.31510	.|1.49	4.84|4.84	2.16|2.16	0.27623|0.27623	.|.	.|0.664352	.|0.14791	.|N	.|0.298195	T|T	0.18718|0.18718	0.0449|0.0449	L|L	0.32530|0.32530	0.975|0.975	0.23287|0.23287	N|N	0.997972|0.997972	.|B	.|0.28128	.|0.201	.|B	.|0.17433	.|0.018	T|T	0.18555|0.18555	-1.0333|-1.0333	5|10	.|0.23891	.|T	.|0.37	-6.0753|-6.0753	7.0745|7.0745	0.25197|0.25197	0.0:0.7057:0.0:0.2943|0.0:0.7057:0.0:0.2943	.|.	.|146	.|P35070	.|BTC_HUMAN	R|Q	76|146	.|ENSP00000379092:R146Q	.|ENSP00000379092:R146Q	G|R	-|-	1|2	0|0	BTC|BTC	75892375|75892375	0.764000|0.764000	0.28473|0.28473	0.168000|0.168000	0.22838|0.22838	0.160000|0.160000	0.22226|0.22226	-0.134000|-0.134000	0.10436|0.10436	0.307000|0.307000	0.22880|0.22880	-0.140000|-0.140000	0.14226|0.14226	GGA|CGG		0.353	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1		
UNC5C	8633	broad.mit.edu	37	4	96171709	96171709	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:96171709G>T	ENST00000453304.1	-	5	1052	c.704C>A	c.(703-705)gCa>gAa	p.A235E	UNC5C_ENST00000504962.1_Missense_Mutation_p.A235E|UNC5C_ENST00000506749.1_Missense_Mutation_p.A235E	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	235	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.A235E(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GGTGTAATTTGCAGTATCAGA	0.403																																					p.A235E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704A	4						.						183.0	177.0	179.0					4																	96171709		2203	4300	6503	96390732	SO:0001583	missense	8633	exon5			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.704C>A	4.37:g.96171709G>T	ENSP00000406022:p.Ala235Glu		96390732	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689004	0.88735	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749;ENST00000504962	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	4.73	4.73	0.59995	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86218	0.5880	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.87578	0.995;0.998;0.995	D	0.89669	0.3882	10	0.87932	D	0	.	18.254	0.90014	0.0:0.0:1.0:0.0	.	235;235;235	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	E	235;194;235;235;235	ENSP00000406022:A235E;ENSP00000426924:A235E;ENSP00000426153:A235E;ENSP00000425117:A235E	ENSP00000328673:A194E	A	-	2	0	UNC5C	96390732	1.000000	0.71417	0.461000	0.27105	0.945000	0.59286	9.601000	0.98297	2.611000	0.88343	0.655000	0.94253	GCA		0.403	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
GUCY1A3	2982	broad.mit.edu	37	4	156634283	156634283	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr4:156634283G>A	ENST00000296518.7	+	7	1329	c.1120G>A	c.(1120-1122)Gtt>Att	p.V374I	GUCY1A3_ENST00000511507.1_Missense_Mutation_p.V374I|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.V374I|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.V116I|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.V374I|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.V374I|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.V374I			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	374					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.V374I(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GATCTACATTGTTGAATCCAG	0.413																																					p.V374I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1120A	4						.						77.0	74.0	75.0					4																	156634283		2203	4300	6503	156853733	SO:0001583	missense	2982	exon7				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1120G>A	4.37:g.156634283G>A	ENSP00000296518:p.Val374Ile		156853733	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372814	0.24857	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34	6.03	2.7	0.31948	Haem NO binding associated (1);	0.592827	0.15894	N	0.239407	T	0.68787	0.3039	N	0.08118	0	0.18873	N	0.999985	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.57458	-0.7808	10	0.52906	T	0.07	.	0.3777	0.00390	0.3205:0.1222:0.2534:0.3038	.	374;374	B3KU69;Q02108	.;GCYA3_HUMAN	I	374;374;374;374;116;374;374	ENSP00000424361:V374I;ENSP00000421493:V374I;ENSP00000426968:V374I;ENSP00000412201:V374I;ENSP00000377418:V116I;ENSP00000296518:V374I;ENSP00000426040:V374I	ENSP00000296518:V374I	V	+	1	0	GUCY1A3	156853733	0.002000	0.14202	0.795000	0.32087	0.995000	0.86356	0.041000	0.13927	0.726000	0.32339	0.655000	0.94253	GTT		0.413	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
TERT	7015	broad.mit.edu	37	5	1278865	1278865	+	Missense_Mutation	SNP	G	G	A	rs149566858		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:1278865G>A	ENST00000310581.5	-	6	2234	c.2177C>T	c.(2176-2178)aCg>aTg	p.T726M	TERT_ENST00000296820.5_Missense_Mutation_p.T726M|TERT_ENST00000334602.6_Missense_Mutation_p.T726M|TERT_ENST00000508104.2_Missense_Mutation_p.T726M	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	726	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.		T -> M (in AA susceptibility; very severe; no effect on telomerase catalytic activity but shortened telomeres). {ECO:0000269|PubMed:16627250}.		DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)	p.T714M(1)|p.T726M(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GATGACCTCCGTGAGCCTGTC	0.622									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.T726M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2177T	5	GRCh37	CM066607	TERT	M	rs149566858	.	G	MET/THR,MET/THR	0,4406		0,0,2203	274.0	246.0	255.0		2177,2177	-8.4	0.0	5	dbSNP_134	255	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	TERT	NM_001193376.1,NM_198253.2	81,81	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	possibly-damaging,possibly-damaging	726/1070,726/1133	1278865	4,13002	2203	4300	6503	1331865	SO:0001583	missense	7015	exon6	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2177C>T	5.37:g.1278865G>A	ENSP00000309572:p.Thr726Met		1331865	NM_198253	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	De_novo_Start_OutOfFrame	SNP	ENST00000310581.5	37	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	G	9.246	1.039419	0.19669	0.0	4.65E-4	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.97752	-4.52;-3.92;-4.52;-3.92	4.63	-8.37	0.00976	Reverse transcriptase (2);	0.868266	0.10115	N	0.714218	D	0.86838	0.6029	N	0.02539	-0.55	0.09310	A	9.4227e-12	P;B;P	0.49862	0.929;0.418;0.883	B;B;B	0.35550	0.205;0.051;0.101	D	0.85068	0.0938	9	0.41790	T	0.15	-24.7794	8.6436	0.33991	0.7315:0.0:0.0875:0.181	.	726;726;714	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	M	726	ENSP00000309572:T726M;ENSP00000296820:T726M;ENSP00000334346:T726M;ENSP00000426042:T726M	ENSP00000296820:T726M	T	-	2	0	TERT	1331865	0.000000	0.05858	0.001000	0.08648	0.490000	0.33462	-0.113000	0.10774	-2.092000	0.00857	-0.258000	0.10820	ACG		0.622	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
EFNA5	1946	broad.mit.edu	37	5	106716975	106716975	+	Missense_Mutation	SNP	G	G	A	rs201008479	byFrequency	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:106716975G>A	ENST00000333274.6	-	5	949	c.668C>T	c.(667-669)gCg>gTg	p.A223V	EFNA5_ENST00000509503.1_Missense_Mutation_p.A196V|EFNA5_ENST00000510359.1_5'UTR	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	223					axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)	p.A223V(1)		large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		CAAAAGCATCGCCAGGAGGAA	0.527													G|||	6	0.00119808	0.0	0.0	5008	,	,		15215	0.006		0.0	False		,,,				2504	0.0				p.A223V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C668T	5						.	G	VAL/ALA	1,4403	2.1+/-5.4	0,1,2201	180.0	165.0	170.0		668	5.8	1.0	5		170	0,8600		0,0,4300	yes	missense	EFNA5	NM_001962.2	64	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	223/229	106716975	1,13003	2202	4300	6502	106744874	SO:0001583	missense	1946	exon5			U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.668C>T	5.37:g.106716975G>A	ENSP00000328777:p.Ala223Val		106744874	NM_001962		Missense_Mutation	SNP	ENST00000333274.6	37	CCDS4097.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	9.456	1.091906	0.20471	2.27E-4	0.0	ENSG00000184349	ENST00000333274;ENST00000509503	D;D	0.96396	-4.0;-3.82	5.85	5.85	0.93711	.	0.219310	0.45606	D	0.000354	D	0.87176	0.6112	N	0.14661	0.345	0.80722	D	1	P	0.50943	0.94	B	0.37480	0.251	D	0.88586	0.3140	10	0.02654	T	1	-12.5109	20.1577	0.98120	0.0:0.0:1.0:0.0	.	223	P52803	EFNA5_HUMAN	V	223;196	ENSP00000328777:A223V;ENSP00000426989:A196V	ENSP00000328777:A223V	A	-	2	0	EFNA5	106744874	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.489000	0.73641	2.767000	0.95098	0.655000	0.94253	GCG		0.527	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250652.1	NM_001962	
FBXL7	23194	broad.mit.edu	37	5	15936659	15936659	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:15936659G>A	ENST00000504595.1	+	4	1321	c.840G>A	c.(838-840)acG>acA	p.T280T	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000329673.7_Silent_p.T268T|FBXL7_ENST00000510662.1_Silent_p.T233T	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	280					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.T280T(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TGGACATGACGGACTGCTTCG	0.612																																					p.T280T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G840A	5						.						71.0	73.0	72.0					5																	15936659		2182	4288	6470	15989659	SO:0001819	synonymous_variant	23194	exon4			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.840G>A	5.37:g.15936659G>A			15989659	NM_012304	B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	37	CCDS54833.1																																																																																				0.612	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
FAM13B	51306	broad.mit.edu	37	5	137354113	137354113	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:137354113A>G	ENST00000033079.3	-	4	699	c.248T>C	c.(247-249)gTg>gCg	p.V83A	FAM13B_ENST00000420893.2_Missense_Mutation_p.V83A|FAM13B_ENST00000425075.2_5'UTR	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	83	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.V83A(1)		endometrium(4)|kidney(2)|lung(5)	11						AACCAAATCCACCTCTTCTCC	0.443																																					p.V83A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T248C	5						.						159.0	142.0	148.0					5																	137354113		2203	4300	6503	137382012	SO:0001583	missense	51306	exon4			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.248T>C	5.37:g.137354113A>G	ENSP00000033079:p.Val83Ala		137382012	NM_016603	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542167	0.85917	.	.	ENSG00000031003	ENST00000033079;ENST00000420893;ENST00000514310;ENST00000502471;ENST00000509596	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.91	5.91	0.95273	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.59865	0.2225	L	0.60957	1.885	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.79108	0.99;0.992	T	0.54159	-0.8335	10	0.22706	T	0.39	-7.217	16.3436	0.83110	1.0:0.0:0.0:0.0	.	83;83	Q9NYF5-2;Q9NYF5	.;FA13B_HUMAN	A	83	ENSP00000033079:V83A;ENSP00000388521:V83A;ENSP00000425326:V83A;ENSP00000424785:V83A;ENSP00000422311:V83A	ENSP00000033079:V83A	V	-	2	0	FAM13B	137382012	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.904000	0.92590	2.269000	0.75478	0.533000	0.62120	GTG		0.443	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
C5orf42	65250	broad.mit.edu	37	5	37170224	37170224	+	Silent	SNP	G	G	A	rs376290394		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:37170224G>A	ENST00000508244.1	-	32	6474	c.6381C>T	c.(6379-6381)aaC>aaT	p.N2127N	C5orf42_ENST00000425232.2_Silent_p.N2127N|C5orf42_ENST00000274258.7_Silent_p.N1007N			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2127						integral component of membrane (GO:0016021)		p.N2127N(1)|p.N1007N(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GCTCTCTGGCGTTCTCTCCCA	0.408																																					p.N2127N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C6381T	5						.	G		1,4405	2.1+/-5.4	0,1,2202	193.0	192.0	192.0		6381	0.7	0.0	5		192	0,8600		0,0,4300	no	coding-synonymous	C5orf42	NM_023073.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		2127/3198	37170224	1,13005	2203	4300	6503	37205981	SO:0001819	synonymous_variant	65250	exon33				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6381C>T	5.37:g.37170224G>A			37205981	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	37	CCDS34146.2																																																																																				0.408	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
STC2	8614	broad.mit.edu	37	5	172745085	172745085	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr5:172745085C>T	ENST00000265087.4	-	4	1983	c.674G>A	c.(673-675)cGc>cAc	p.R225H	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	225					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.R225H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTGGGGCTGGCGCTCGGGGGG	0.657																																					p.R225H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G674A	5						.						44.0	49.0	47.0					5																	172745085		2203	4300	6503	172677691	SO:0001583	missense	8614	exon4			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.674G>A	5.37:g.172745085C>T	ENSP00000265087:p.Arg225His		172677691	NM_003714		Missense_Mutation	SNP	ENST00000265087.4	37	CCDS4388.1	.	.	.	.	.	.	.	.	.	.	C	7.648	0.682207	0.14907	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.19	-1.57	0.08506	.	0.677681	0.13963	N	0.350692	T	0.21468	0.0517	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.11891	-1.0569	9	0.36615	T	0.2	-10.057	8.8719	0.35320	0.0:0.2255:0.1173:0.6572	.	225	O76061	STC2_HUMAN	H	225	.	ENSP00000265087:R225H	R	-	2	0	STC2	172677691	0.035000	0.19736	0.193000	0.23327	0.195000	0.23768	-0.908000	0.04063	-0.766000	0.04639	0.650000	0.86243	CGC		0.657	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
BTN2A3P	54718	broad.mit.edu	37	6	26431012	26431012	+	RNA	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:26431012C>T	ENST00000466808.2	+	0	1447							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P310P(1)									CTGGTCATCCCTATCTCTTCG	0.537																																					.												.	.	1	Substitution - coding silent(1)	large_intestine(1)	.	6						.						69.0	62.0	64.0					6																	26431012		2203	4300	6503	26538991			54718	.			AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26431012C>T			26538991	.	A6NEF4	Silent	SNP	ENST00000466808.2	37																																																																																					0.537	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
HIST1H2AM	8336	broad.mit.edu	37	6	27860756	27860756	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:27860756A>G	ENST00000359611.2	-	1	207	c.172T>C	c.(172-174)Tac>Cac	p.Y58H	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	58						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.Y58H(1)|p.Y58N(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						GCAGTTAGGTACTCCAGCACC	0.657																																					p.Y58H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.T172C	6						.						59.0	66.0	64.0					6																	27860756		2202	4300	6502	27968735	SO:0001583	missense	8336	exon1			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.172T>C	6.37:g.27860756A>G	ENSP00000352627:p.Tyr58His		27968735	NM_003514	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359611.2	37	CCDS4639.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845184	0.71603	.	.	ENSG00000233224	ENST00000359611	T	0.70399	-0.48	4.06	4.06	0.47325	.	0.000000	0.28360	U	0.015628	D	0.85375	0.5682	H	0.96943	3.91	0.33124	D	0.542202	.	.	.	.	.	.	D	0.88422	0.3029	8	0.87932	D	0	.	12.8166	0.57669	1.0:0.0:0.0:0.0	.	.	.	.	H	58	ENSP00000352627:Y58H	ENSP00000352627:Y58H	Y	-	1	0	HIST1H2AM	27968735	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.704000	0.91351	2.058000	0.61347	0.533000	0.62120	TAC		0.657	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514	
VPS52	6293	broad.mit.edu	37	6	33238009	33238009	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:33238009T>A	ENST00000445902.2	-	2	360	c.142A>T	c.(142-144)Act>Tct	p.T48S	VPS52_ENST00000436044.2_5'UTR|RPS18_ENST00000439602.2_5'Flank|VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000478934.1_5'UTR|RPS18_ENST00000474973.1_5'Flank	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	48					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.T48S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TCATCAGAAGTGATATCCAAC	0.517																																					p.T48S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A142T	6						.						132.0	134.0	133.0					6																	33238009		2203	4300	6503	33345987	SO:0001583	missense	6293	exon2			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.142A>T	6.37:g.33238009T>A	ENSP00000409952:p.Thr48Ser		33345987	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	.	.	.	.	.	.	.	.	.	.	T	10.94	1.494229	0.26774	.	.	ENSG00000223501	ENST00000445902;ENST00000418054	.	.	.	5.42	4.25	0.50352	.	0.057957	0.64402	N	0.000003	T	0.25382	0.0617	L	0.40543	1.245	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.09773	-1.0659	9	0.18710	T	0.47	-20.494	8.3523	0.32310	0.1864:0.0:0.0:0.8136	.	48	Q8N1B4	VPS52_HUMAN	S	48;26	.	ENSP00000414785:T26S	T	-	1	0	VPS52	33345987	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	3.616000	0.54174	1.047000	0.40274	0.472000	0.43445	ACT		0.517	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
SLC26A8	116369	broad.mit.edu	37	6	35965610	35965610	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:35965610C>T	ENST00000490799.1	-	5	885	c.532G>A	c.(532-534)Gtc>Atc	p.V178I	SLC26A8_ENST00000355574.2_Missense_Mutation_p.V178I|SLC26A8_ENST00000394602.2_Missense_Mutation_p.V178I	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.V178I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TCATTCTTGACGAAAGATCCC	0.468																																					p.V178I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G532A	6						.						123.0	109.0	114.0					6																	35965610		2203	4300	6503	36073588	SO:0001583	missense	116369	exon5			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.532G>A	6.37:g.35965610C>T	ENSP00000417638:p.Val178Ile		36073588	NM_052961		Missense_Mutation	SNP	ENST00000490799.1	37	CCDS4813.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.998141	0.00435	.	.	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574	D;D;D	0.95069	-3.23;-3.6;-3.23	5.82	-11.6	0.00059	.	1.297670	0.04913	N	0.453580	T	0.60209	0.2251	N	0.02011	-0.69	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.04013	0.001;0.001	T	0.60622	-0.7227	10	0.09338	T	0.73	.	12.6602	0.56809	0.0:0.4226:0.3871:0.1903	.	178;178	Q96RN1;Q96RN1-2	S26A8_HUMAN;.	I	178	ENSP00000417638:V178I;ENSP00000378100:V178I;ENSP00000347778:V178I	ENSP00000347778:V178I	V	-	1	0	SLC26A8	36073588	0.572000	0.26668	0.002000	0.10522	0.000000	0.00434	-1.027000	0.03592	-3.630000	0.00129	-2.993000	0.00078	GTC		0.468	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
DST	667	broad.mit.edu	37	6	56492025	56492025	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:56492025C>T	ENST00000361203.3	-	30	4073	c.4066G>A	c.(4066-4068)Gaa>Aaa	p.E1356K	DST_ENST00000370765.6_Missense_Mutation_p.E1030K|DST_ENST00000312431.6_Missense_Mutation_p.E1356K|DST_ENST00000370769.4_Missense_Mutation_p.E1356K|DST_ENST00000370788.2_Missense_Mutation_p.E1356K|DST_ENST00000370754.5_Missense_Mutation_p.E1534K|DST_ENST00000421834.2_Missense_Mutation_p.E1356K|DST_ENST00000518935.1_Missense_Mutation_p.E1030K|DST_ENST00000244364.6_Missense_Mutation_p.E1030K|DST_ENST00000446842.2_Missense_Mutation_p.E1030K			Q03001	DYST_HUMAN	dystonin	1356					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAGTACTGTTCTGCATATTTT	0.333																																					p.E1030K												.	.	0			c.G3088A	6						.						204.0	183.0	190.0					6																	56492025		2203	4300	6503	56599984	SO:0001583	missense	667	exon20			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4066G>A	6.37:g.56492025C>T	ENSP00000354508:p.Glu1356Lys		56599984	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	18.41	3.617327	0.66672	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.33	5.33	0.75918	.	0.000000	0.52532	D	0.000065	T	0.20700	0.0498	N	0.25144	0.715	0.27863	N	0.940314	B;D;B;B;P;P;B;P	0.60575	0.096;0.988;0.214;0.22;0.494;0.47;0.096;0.537	B;P;B;B;B;P;B;B	0.52343	0.021;0.696;0.031;0.074;0.316;0.646;0.021;0.219	T	0.02121	-1.1210	9	0.02654	T	1	.	19.3834	0.94546	0.0:1.0:0.0:0.0	.	1356;1356;1534;1030;1030;1030;1356;1030	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	K	1030;1534;1356;1356;1030;1356;1356;1356;1030;1396;1030;1030	ENSP00000244364:E1030K;ENSP00000359790:E1534K;ENSP00000359805:E1356K;ENSP00000400883:E1356K;ENSP00000393645:E1030K;ENSP00000307959:E1356K;ENSP00000359824:E1356K;ENSP00000354508:E1356K;ENSP00000404924:E1030K;ENSP00000431030:E1396K;ENSP00000359801:E1030K;ENSP00000431003:E1030K	ENSP00000244364:E1030K	E	-	1	0	DST	56599984	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.021000	0.57196	2.658000	0.90341	0.650000	0.86243	GAA		0.333	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
TCP10	6953	broad.mit.edu	37	6	167786724	167786724	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr6:167786724G>A	ENST00000397829.4	-	8	1081	c.914C>T	c.(913-915)tCc>tTc	p.S305F	TCP10_ENST00000366827.2_Intron	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	332						cytosol (GO:0005829)		p.S305F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		CGGGAAACCGGACCGCCGGCA	0.552																																					p.S305F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C914T	6						.						111.0	111.0	111.0					6																	167786724		1860	4098	5958	167706714	SO:0001583	missense	6953	exon8			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.914C>T	6.37:g.167786724G>A	ENSP00000380929:p.Ser305Phe		167706714	NM_004610	Q5JR60|Q6P4F4	Missense_Mutation	SNP	ENST00000397829.4	37	CCDS43527.1	.	.	.	.	.	.	.	.	.	.	g	4.544	0.100917	0.08731	.	.	ENSG00000203690	ENST00000397829	T	0.24908	1.83	1.83	-3.66	0.04489	.	.	.	.	.	T	0.02848	0.0085	N	0.08118	0	0.09310	N	0.999999	B	0.15719	0.014	B	0.06405	0.002	T	0.39143	-0.9628	9	0.72032	D	0.01	.	2.7736	0.05341	0.4347:0.0:0.2087:0.3566	.	332	Q12799	TCP10_HUMAN	F	305	ENSP00000380929:S305F	ENSP00000380929:S305F	S	-	2	0	TCP10	167706714	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.495000	0.06443	-1.720000	0.01380	-0.362000	0.07510	TCC		0.552	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	
ZAN	7455	broad.mit.edu	37	7	100388641	100388642	+	RNA	DNP	AT	AT	GG			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AT	AT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:100388641_100388642AT>GG	ENST00000348028.3	+	0	7599_7600				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M2478>?(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CAAGAATGACATGATGCTGCCC	0.609																																					.												.	.	2	Complex(2)	large_intestine(2)	c.7434_7435GG	7						.																																			100226578			7455	exon40			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037	Exception_encountered	7.37:g.100388641_100388642delinsGG			100226577	NM_173059	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	DNP	ENST00000348028.3	37																																																																																					0.609	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
KMT2E	55904	broad.mit.edu	37	7	104748223	104748223	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:104748223C>T	ENST00000311117.3	+	22	3864	c.3319C>T	c.(3319-3321)Ctg>Ttg	p.L1107L	CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Silent_p.L1107L|KMT2E_ENST00000257745.4_Silent_p.L1107L|SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000334914.7_Silent_p.L162L	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1107					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L1107L(1)									GTCAAAGTGCCTGATGCAGGA	0.463																																					p.L1107L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3319T	7						.						95.0	92.0	93.0					7																	104748223		2203	4300	6503	104535459	SO:0001819	synonymous_variant	55904	exon22			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3319C>T	7.37:g.104748223C>T			104535459	NM_182931	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	37	CCDS34723.1																																																																																				0.463	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
FAM180A	389558	broad.mit.edu	37	7	135418802	135418802	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:135418802C>A	ENST00000338588.3	-	3	708	c.443G>T	c.(442-444)tGg>tTg	p.W148L	FAM180A_ENST00000435869.1_Intron|FAM180A_ENST00000415751.1_Missense_Mutation_p.W148L	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	148						extracellular region (GO:0005576)		p.W148L(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						GGACTGCGCCCAGATGTCCTT	0.607																																					p.W148L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G443T	7						.						102.0	87.0	92.0					7																	135418802		2203	4300	6503	135069342	SO:0001583	missense	389558	exon3			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.443G>T	7.37:g.135418802C>A	ENSP00000342336:p.Trp148Leu		135069342	NM_205855	B2RP85	Missense_Mutation	SNP	ENST00000338588.3	37	CCDS5841.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952733	0.92660	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.59772	0.24;0.24	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75932	0.3917	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.77846	-0.2436	10	0.87932	D	0	-16.3696	17.225	0.86967	0.0:1.0:0.0:0.0	.	148	Q6UWF9	F180A_HUMAN	L	148	ENSP00000342336:W148L;ENSP00000395467:W148L	ENSP00000342336:W148L	W	-	2	0	FAM180A	135069342	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.736000	0.74811	2.677000	0.91161	0.561000	0.74099	TGG		0.607	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2	NM_205855	
TBXAS1	6916	broad.mit.edu	37	7	139657535	139657535	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:139657535C>G	ENST00000336425.5	+	12	1180	c.791C>G	c.(790-792)gCc>gGc	p.A264G	TBXAS1_ENST00000263552.6_Missense_Mutation_p.A265G|TBXAS1_ENST00000414508.2_Missense_Mutation_p.A265G|TBXAS1_ENST00000458722.1_Missense_Mutation_p.A310G|TBXAS1_ENST00000411653.1_Missense_Mutation_p.A264G|TBXAS1_ENST00000448866.1_Missense_Mutation_p.A264G|TBXAS1_ENST00000436047.2_Missense_Mutation_p.A265G|TBXAS1_ENST00000425687.1_Missense_Mutation_p.A197G|TBXAS1_ENST00000416849.2_Missense_Mutation_p.A311G|TBXAS1_ENST00000462275.1_3'UTR			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	264					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	AATGTGATTGCCTTGCGGGAC	0.458																																					p.A265G												.	.	0			c.C794G	7						.						82.0	79.0	80.0					7																	139657535		2203	4300	6503	139304004	SO:0001583	missense	6916	exon8			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.791C>G	7.37:g.139657535C>G	ENSP00000338087:p.Ala264Gly		139304004	NM_001061	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000336425.5	37		.	.	.	.	.	.	.	.	.	.	C	16.45	3.127457	0.56721	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.09	5.09	0.68999	.	0.403240	0.29515	N	0.011934	T	0.64023	0.2561	L	0.29908	0.895	0.80722	D	1	P;P;P;P;B;P;P	0.45634	0.775;0.863;0.741;0.858;0.195;0.607;0.607	P;P;P;P;B;B;B	0.52386	0.665;0.697;0.568;0.532;0.318;0.395;0.395	T	0.59091	-0.7519	10	0.25751	T	0.34	.	12.479	0.55831	0.0:0.9203:0.0:0.0797	.	245;311;216;197;265;265;264	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	G	197;265;264;311;265;265;264;310;264	ENSP00000388736:A197G;ENSP00000263552:A265G;ENSP00000338087:A264G;ENSP00000389414:A311G;ENSP00000392361:A265G;ENSP00000392702:A265G;ENSP00000402536:A264G;ENSP00000411274:A310G;ENSP00000411326:A264G	ENSP00000263552:A265G	A	+	2	0	TBXAS1	139304004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.007000	0.40883	2.537000	0.85549	0.655000	0.94253	GCC		0.458	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1		
RNF216	54476	broad.mit.edu	37	7	5752430	5752430	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:5752430A>G	ENST00000425013.2	-	12	1951	c.1727T>C	c.(1726-1728)gTg>gCg	p.V576A	RNF216_ENST00000389902.3_Missense_Mutation_p.V633A	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	576					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		CTGGGGGAGCACCTTCTCCAG	0.527																																					p.V576A												.	.	0			c.T1727C	7						.						53.0	48.0	50.0					7																	5752430		2203	4300	6503	5718956	SO:0001583	missense	54476	exon12			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1727T>C	7.37:g.5752430A>G	ENSP00000404602:p.Val576Ala		5718956	NM_207116	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.932567	0.73442	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.37915	1.17;1.17	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.43456	0.1248	N	0.17379	0.485	0.58432	D	0.999997	B;D	0.89917	0.34;1.0	B;D	0.83275	0.159;0.996	T	0.33445	-0.9868	10	0.25751	T	0.34	-15.3119	15.3587	0.74453	1.0:0.0:0.0:0.0	.	576;633	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	A	576;633;388	ENSP00000404602:V576A;ENSP00000374552:V633A	ENSP00000374552:V633A	V	-	2	0	RNF216	5718956	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.368000	0.90115	2.216000	0.71823	0.528000	0.53228	GTG		0.527	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
URGCP	55665	broad.mit.edu	37	7	43918513	43918514	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:43918513_43918514GG>AT	ENST00000453200.1	-	6	1041_1042	c.548_549CC>AT	c.(547-549)cCC>cAT	p.P183H	URGCP_ENST00000336086.6_Missense_Mutation_p.P140H|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Missense_Mutation_p.P140H|URGCP_ENST00000447717.3_Missense_Mutation_p.P140H|URGCP_ENST00000402306.3_Missense_Mutation_p.P174H|URGCP_ENST00000223341.7_Missense_Mutation_p.P140H|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	183					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.P140>?(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGGTCTAAGGGGTTCACTGG	0.525																																					.												.	.	1	Complex(1)	large_intestine(1)	c.419_420AT	7						.																																			43885039	SO:0001583	missense	55665	exon6				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.548_549delinsAT	7.37:g.43918513_43918514delinsAT	ENSP00000396918:p.Pro183His		43885038	NM_001077664	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	DNP	ENST00000453200.1	37	CCDS47578.1																																																																																				0.525	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
GRM3	2913	broad.mit.edu	37	7	86415724	86415724	+	Missense_Mutation	SNP	C	C	T	rs372311811		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:86415724C>T	ENST00000361669.2	+	3	1715	c.616C>T	c.(616-618)Cgc>Tgc	p.R206C	AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.R204C|GRM3_ENST00000439827.1_Missense_Mutation_p.R206C|GRM3_ENST00000536043.1_Missense_Mutation_p.R78C|GRM3_ENST00000546348.1_Intron|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	206					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R206C(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGAGATCTTGCGCTTCTTCAA	0.577																																					p.R206C	GBM(52;969 1098 3139 52280)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C616T	7						.	C	CYS/ARG	0,4406		0,0,2203	98.0	86.0	90.0		616	5.7	1.0	7		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRM3	NM_000840.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	206/880	86415724	1,13005	2203	4300	6503	86253660	SO:0001583	missense	2913	exon3				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.616C>T	7.37:g.86415724C>T	ENSP00000355316:p.Arg206Cys		86253660	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925517	0.73213	0.0	1.16E-4	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79	5.72	5.72	0.89469	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91885	0.7431	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;P;D	0.66716	0.911;0.9;0.946	D	0.93000	0.6422	10	0.87932	D	0	.	13.7862	0.63110	0.1531:0.8468:0.0:0.0	.	78;206;206	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	C	206;78;78;206;204	ENSP00000355316:R206C;ENSP00000405427:R78C;ENSP00000441407:R78C;ENSP00000398767:R206C;ENSP00000378209:R204C	ENSP00000355316:R206C	R	+	1	0	GRM3	86253660	0.997000	0.39634	1.000000	0.80357	0.952000	0.60782	1.870000	0.39529	2.711000	0.92665	0.655000	0.94253	CGC		0.577	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
PPP1R9A	55607	broad.mit.edu	37	7	94540377	94540378	+	Missense_Mutation	DNP	AA	AA	GC			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	AA	AA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:94540377_94540378AA>GC	ENST00000433881.1	+	2	1484_1485	c.952_953AA>GC	c.(952-954)AAa>GCa	p.K318A	PPP1R9A_ENST00000340694.4_Missense_Mutation_p.K318A|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.K318A|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.K318A|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.K318A|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.K318A			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	318					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.K318>?(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			CAGCATTGACAAAGATGGTCCT	0.46										HNSCC(28;0.073)																											.												.	.	1	Complex(1)	large_intestine(1)	c.952_953GC	7						.																																			94378314	SO:0001583	missense	55607	exon1			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	Exception_encountered	7.37:g.94540377_94540378delinsGC	ENSP00000398870:p.Lys318Ala		94378313	NM_001166163	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	DNP	ENST00000433881.1	37	CCDS34683.1																																																																																				0.460	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0 	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu		140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
ATAD2	29028	broad.mit.edu	37	8	124368702	124368702	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr8:124368702G>A	ENST00000287394.5	-	13	1680	c.1573C>T	c.(1573-1575)Cca>Tca	p.P525S	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	525					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P525S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ATAATTGATGGGCGCATCTGA	0.393																																					p.P525S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1573T	8						.						72.0	60.0	64.0					8																	124368702		2203	4300	6503	124437883	SO:0001583	missense	29028	exon13			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1573C>T	8.37:g.124368702G>A	ENSP00000287394:p.Pro525Ser		124437883	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113754	0.94339	.	.	ENSG00000156802	ENST00000287394	D	0.96396	-4.0	5.14	5.14	0.70334	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.096031	0.64402	D	0.000001	D	0.98143	0.9387	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.97110	1.0;0.989	D	0.99053	1.0828	10	0.87932	D	0	-7.6721	18.9523	0.92645	0.0:0.0:1.0:0.0	.	355;525	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	S	525	ENSP00000287394:P525S	ENSP00000287394:P525S	P	-	1	0	ATAD2	124437883	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.813000	0.99286	2.549000	0.85964	0.467000	0.42956	CCA		0.393	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
CSMD1	64478	broad.mit.edu	37	8	3432529	3432529	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr8:3432529G>T	ENST00000520002.1	-	11	1840	c.1285C>A	c.(1285-1287)Ccg>Acg	p.P429T	CSMD1_ENST00000602557.1_Missense_Mutation_p.P429T|CSMD1_ENST00000537824.1_Missense_Mutation_p.P428T|CSMD1_ENST00000602723.1_Missense_Mutation_p.P429T|CSMD1_ENST00000400186.3_Missense_Mutation_p.P429T|CSMD1_ENST00000542608.1_Missense_Mutation_p.P428T|CSMD1_ENST00000539096.1_Missense_Mutation_p.P428T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	429	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACTGAACCGGATAATTAGGG	0.507																																					p.P428T												.	.	0			c.C1282A	8						.						82.0	92.0	89.0					8																	3432529		2038	4209	6247	3419937	SO:0001583	missense	64478	exon10					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1285C>A	8.37:g.3432529G>T	ENSP00000430733:p.Pro429Thr		3419937	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	17.21	3.330709	0.60853	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.06	5.06	0.68205	.	.	.	.	.	T	0.77811	0.4186	H	0.95745	3.715	0.58432	D	0.999994	D	0.64830	0.994	D	0.76575	0.988	T	0.83037	-0.0159	9	0.41790	T	0.15	.	17.2099	0.86928	0.0:0.0:1.0:0.0	.	429	E5RIG2	.	T	429;429;291;428;428;428	ENSP00000383047:P429T;ENSP00000430733:P429T;ENSP00000441462:P428T;ENSP00000446243:P428T;ENSP00000441675:P428T	ENSP00000320445:P291T	P	-	1	0	CSMD1	3419937	1.000000	0.71417	0.821000	0.32701	0.051000	0.14879	9.176000	0.94839	2.343000	0.79666	0.655000	0.94253	CCG		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
UNC5D	137970	broad.mit.edu	37	8	35542265	35542265	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr8:35542265C>T	ENST00000404895.2	+	6	1245	c.917C>T	c.(916-918)cCt>cTt	p.P306L	UNC5D_ENST00000416672.1_Missense_Mutation_p.P306L|UNC5D_ENST00000453357.2_Missense_Mutation_p.P301L|UNC5D_ENST00000420357.1_Intron|UNC5D_ENST00000287272.2_Intron	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	306	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TCTCTTTGTCCTGGTGAGATA	0.463																																					p.P306L												.	.	0			c.C917T	8						.						150.0	134.0	139.0					8																	35542265		2203	4300	6503	35661807	SO:0001583	missense	137970	exon6			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.917C>T	8.37:g.35542265C>T	ENSP00000385143:p.Pro306Leu		35661807	NM_080872	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.960737	0.92791	.	.	ENSG00000156687	ENST00000404895;ENST00000416672;ENST00000453357	T;T;T	0.65178	-0.12;-0.13;-0.14	5.39	5.39	0.77823	.	0.048955	0.85682	D	0.000000	D	0.85557	0.5724	H	0.96970	3.915	0.80722	D	1	P;D;D	0.69078	0.936;0.997;0.994	P;P;P	0.61592	0.727;0.884;0.891	D	0.90275	0.4310	10	0.87932	D	0	-13.858	19.5354	0.95251	0.0:1.0:0.0:0.0	.	306;301;306	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	L	306;306;301	ENSP00000385143:P306L;ENSP00000412652:P306L;ENSP00000394303:P301L	ENSP00000385143:P306L	P	+	2	0	UNC5D	35661807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.709000	0.92574	0.655000	0.94253	CCT		0.463	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
DECR1	1666	broad.mit.edu	37	8	91055027	91055027	+	Splice_Site	SNP	A	A	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr8:91055027A>C	ENST00000220764.2	+	7	825	c.737A>C	c.(736-738)aAa>aCa	p.K246T	DECR1_ENST00000522161.1_Splice_Site_p.K237T	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	246					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.K246T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			ATAAAAACCAAAGTAAGTTGT	0.338																																					p.K246T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A737C	8						.						159.0	152.0	155.0					8																	91055027		2203	4300	6503	91124203	SO:0001630	splice_region_variant	1666	exon7			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.738+1A>C	8.37:g.91055027A>C			91124203	NM_001359	B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	ENST00000220764.2	37	CCDS6250.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763756	0.49574	.	.	ENSG00000104325	ENST00000220764;ENST00000522161	T;T	0.22134	1.97;1.97	5.24	5.24	0.73138	NAD(P)-binding domain (1);	0.044737	0.85682	D	0.000000	T	0.32941	0.0846	N	0.26042	0.785	0.80722	D	1	D;B	0.76494	0.999;0.06	D;B	0.76575	0.988;0.224	T	0.04723	-1.0931	10	0.35671	T	0.21	.	15.4185	0.74991	1.0:0.0:0.0:0.0	.	237;246	B7Z6B8;Q16698	.;DECR_HUMAN	T	246;237	ENSP00000220764:K246T;ENSP00000429779:K237T	ENSP00000220764:K246T	K	+	2	0	DECR1	91124203	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.733000	0.91539	2.109000	0.64355	0.528000	0.53228	AAA		0.338	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375822.1		Missense_Mutation
FAM49B	51571	broad.mit.edu	37	8	130866569	130866569	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr8:130866569C>T	ENST00000519824.2	-	7	732	c.459G>A	c.(457-459)caG>caA	p.Q153Q	FAM49B_ENST00000517654.1_Silent_p.Q153Q|FAM49B_ENST00000519110.1_Silent_p.Q153Q|FAM49B_ENST00000523509.1_Silent_p.Q153Q|FAM49B_ENST00000518879.1_5'Flank|FAM49B_ENST00000522941.1_Silent_p.Q7Q|FAM49B_ENST00000401979.2_Silent_p.Q153Q|FAM49B_ENST00000522250.1_Silent_p.Q7Q|FAM49B_ENST00000519540.1_Silent_p.Q153Q|FAM49B_ENST00000522746.1_Silent_p.Q153Q	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	153						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)		p.Q153Q(1)		kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			TGAAATCATTCTGTATGGCAG	0.308																																					p.Q153Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G459A	8						.						124.0	111.0	116.0					8																	130866569		2203	4299	6502	130935751	SO:0001819	synonymous_variant	51571	exon10			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.459G>A	8.37:g.130866569C>T			130935751	NM_016623	Q96AZ5|Q9NW21|Q9NZE7	Silent	SNP	ENST00000519824.2	37	CCDS6361.1																																																																																				0.308	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380390.2	NM_016623	
ZER1	10444	broad.mit.edu	37	9	131513478	131513478	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:131513478T>G	ENST00000291900.2	-	7	1514	c.1108A>C	c.(1108-1110)Atc>Ctc	p.I370L	snoU13_ENST00000459043.1_RNA|ZER1_ENST00000494461.1_5'Flank	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	370					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						CGCGAGGTGATCTCAGGCCGG	0.602																																					p.I370L												.	.	0			c.A1108C	9						.						92.0	75.0	81.0					9																	131513478		2203	4300	6503	130553299	SO:0001583	missense	10444	exon7			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1108A>C	9.37:g.131513478T>G	ENSP00000291900:p.Ile370Leu		130553299	NM_006336	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	T	3.634	-0.074850	0.07184	.	.	ENSG00000160445	ENST00000291900	T	0.05139	3.49	5.01	3.88	0.44766	Armadillo-like helical (1);Armadillo-type fold (1);	0.361861	0.29737	N	0.011331	T	0.02012	0.0063	N	0.01576	-0.805	0.48901	D	0.999722	B	0.02656	0.0	B	0.04013	0.001	T	0.39143	-0.9628	10	0.02654	T	1	-27.5693	9.7708	0.40589	0.0:0.0816:0.0:0.9184	.	370	Q7Z7L7	ZER1_HUMAN	L	370	ENSP00000291900:I370L	ENSP00000291900:I370L	I	-	1	0	ZER1	130553299	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	3.334000	0.52097	0.792000	0.33850	0.248000	0.18094	ATC		0.602	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
RANBP6	26953	broad.mit.edu	37	9	6014639	6014639	+	Silent	SNP	T	T	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:6014639T>G	ENST00000259569.5	-	1	979	c.969A>C	c.(967-969)ctA>ctC	p.L323L	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	323					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L323L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CATCATCTTGTAGATCAACCA	0.408																																					p.L323L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A969C	9						.						80.0	75.0	77.0					9																	6014639		2203	4300	6503	6004639	SO:0001819	synonymous_variant	26953	exon1			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.969A>C	9.37:g.6014639T>G			6004639	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Silent	SNP	ENST00000259569.5	37	CCDS6467.1																																																																																				0.408	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
PIGO	84720	broad.mit.edu	37	9	35091445	35091445	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:35091445C>T	ENST00000378617.3	-	7	2833	c.2439G>A	c.(2437-2439)gaG>gaA	p.E813E	PIGO_ENST00000341666.3_Silent_p.E813E|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	813					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.E813E(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATTTGGTCCTCTCTAACCGGC	0.567																																					p.E813E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2439A	9						.						81.0	75.0	77.0					9																	35091445		2203	4300	6503	35081445	SO:0001819	synonymous_variant	84720	exon7			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2439G>A	9.37:g.35091445C>T			35081445	NM_032634	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	CCDS6575.1																																																																																				0.567	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
PIGO	84720	broad.mit.edu	37	9	35091595	35091595	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:35091595C>T	ENST00000378617.3	-	7	2683	c.2289G>A	c.(2287-2289)gtG>gtA	p.V763V	PIGO_ENST00000341666.3_Silent_p.V763V|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	763					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.V763V(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CCAGCACTGTCACAGGCTTCC	0.642																																					p.V763V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2289A	9						.						39.0	43.0	42.0					9																	35091595		2203	4298	6501	35081595	SO:0001819	synonymous_variant	84720	exon7			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2289G>A	9.37:g.35091595C>T			35081595	NM_032634	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	CCDS6575.1																																																																																				0.642	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
ANKRD20A2	441430	broad.mit.edu	37	9	42368445	42368445	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:42368445G>T	ENST00000377601.2	+	1	143	c.31G>T	c.(31-33)Ggc>Tgc	p.G11C	RP11-216M21.7_ENST00000450520.1_RNA	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	11								p.G11C(1)		large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						GAGCCGCAGGGGCCAGACGGC	0.592																																					p.G11C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G31T	9						.						1.0	1.0	1.0					9																	42368445		508	1079	1587	42358441	SO:0001583	missense	441425	exon1				CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.31G>T	9.37:g.42368445G>T	ENSP00000366826:p.Gly11Cys		42358441	NM_001012419		Missense_Mutation	SNP	ENST00000377601.2	37	CCDS35028.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.552409	0.27739	.	.	ENSG00000183148	ENST00000377601	T	0.39997	1.05	1.05	1.05	0.20165	.	.	.	.	.	T	0.56746	0.2006	M	0.71036	2.16	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.79784	0.993;0.91	T	0.37056	-0.9722	9	0.56958	D	0.05	.	5.5822	0.17256	0.0:0.0:1.0:0.0	.	11;11	Q5CZ79;Q5SQ80	AN20B_HUMAN;A20A2_HUMAN	C	11	ENSP00000366826:G11C	ENSP00000366826:G11C	G	+	1	0	ANKRD20A2	42358441	0.010000	0.17322	0.024000	0.17045	0.117000	0.20001	0.144000	0.16135	0.894000	0.36317	0.064000	0.15345	GGC		0.592	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129794.1	NM_001012421	
SPATA31E1	286234	broad.mit.edu	37	9	90503027	90503027	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:90503027A>T	ENST00000325643.5	+	4	3691	c.3625A>T	c.(3625-3627)Agg>Tgg	p.R1209W		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1209					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGCCCACAGGAGGCCCAGAAC	0.637																																					p.R1209W												.	.	0			c.A3625T	9						.						13.0	12.0	12.0					9																	90503027		2193	4283	6476	89692847	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3625A>T	9.37:g.90503027A>T	ENSP00000322640:p.Arg1209Trp		89692847	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	a	13.43	2.233903	0.39498	.	.	ENSG00000177992	ENST00000325643	T	0.03889	3.77	2.41	1.26	0.21427	.	1.026370	0.07750	N	0.948351	T	0.12902	0.0313	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.27971	-1.0058	10	0.87932	D	0	.	4.1998	0.10460	0.8287:0.0:0.1713:0.0	.	1209	Q6ZUB1	CI079_HUMAN	W	1209	ENSP00000322640:R1209W	ENSP00000322640:R1209W	R	+	1	2	C9orf79	89692847	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	1.403000	0.34612	0.368000	0.24481	0.533000	0.62120	AGG		0.637	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
ROR2	4920	broad.mit.edu	37	9	94486154	94486154	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:94486154G>A	ENST00000375708.3	-	9	2820	c.2622C>T	c.(2620-2622)gtC>gtT	p.V874V	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Intron	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	874	Ser/Thr-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.V874V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGGCCGTGGTGACGTAGCCTG	0.637																																					p.V874V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2622T	9						.						93.0	90.0	91.0					9																	94486154		2203	4300	6503	93525975	SO:0001819	synonymous_variant	4920	exon9			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2622C>T	9.37:g.94486154G>A			93525975	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	37	CCDS6691.1																																																																																				0.637	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
ZNF367	195828	broad.mit.edu	37	9	99154789	99154789	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:99154789G>A	ENST00000375256.4	-	4	1017	c.721C>T	c.(721-723)Cgc>Tgc	p.R241C		NM_153695.3	NP_710162.1	Q7RTV3	ZN367_HUMAN	zinc finger protein 367	241					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R241C(1)		cervix(1)|endometrium(4)|large_intestine(3)|lung(3)|prostate(1)	12		Acute lymphoblastic leukemia(62;0.0167)				GGACAGTGGCGGTTTGCATGG	0.552																																					p.R241C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C721T	9						.						164.0	142.0	149.0					9																	99154789		2203	4300	6503	98194610	SO:0001583	missense	195828	exon4			AK091289	CCDS6718.1	9q22	2008-05-02			ENSG00000165244	ENSG00000165244		"""Zinc fingers, C2H2-type"""	18320	protein-coding gene	gene with protein product		610160					Standard	NM_153695		Approved	FLJ33970	uc004awf.3	Q7RTV3	OTTHUMG00000020295	ENST00000375256.4:c.721C>T	9.37:g.99154789G>A	ENSP00000364405:p.Arg241Cys		98194610	NM_153695	Q6Q7C8	Missense_Mutation	SNP	ENST00000375256.4	37	CCDS6718.1	.	.	.	.	.	.	.	.	.	.	G	32	5.148931	0.94645	.	.	ENSG00000165244	ENST00000375256	T	0.07908	3.15	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.00395	-1.1766	10	0.54805	T	0.06	-16.6508	19.3294	0.94280	0.0:0.0:1.0:0.0	.	241;241	Q7RTV3-2;Q7RTV3	.;ZN367_HUMAN	C	241	ENSP00000364405:R241C	ENSP00000364405:R241C	R	-	1	0	ZNF367	98194610	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.954000	0.93051	2.804000	0.96469	0.462000	0.41574	CGC		0.552	ZNF367-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053266.1		
TMOD1	7111	broad.mit.edu	37	9	100315626	100315626	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:100315626C>T	ENST00000259365.4	+	4	554	c.341C>T	c.(340-342)cCg>cTg	p.P114L	TMOD1_ENST00000395211.2_Missense_Mutation_p.P114L|TMOD1_ENST00000375175.1_5'Flank	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	114	Tropomyosin-binding. {ECO:0000255}.				adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)		p.P114L(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		ACGCTGGAACCGGAGCTGGAG	0.537																																					p.P114L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C341T	9						.						121.0	108.0	112.0					9																	100315626		2203	4300	6503	99355447	SO:0001583	missense	7111	exon4				CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.341C>T	9.37:g.100315626C>T	ENSP00000259365:p.Pro114Leu		99355447	NM_001166116	B2RB77|Q5T7W3|Q9BUF1	Missense_Mutation	SNP	ENST00000259365.4	37	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	C	32	5.131915	0.94473	.	.	ENSG00000136842	ENST00000395211;ENST00000259365	T;T	0.41758	0.99;0.99	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74127	-0.3765	10	0.87932	D	0	-13.5311	18.6707	0.91510	0.0:1.0:0.0:0.0	.	114	P28289	TMOD1_HUMAN	L	114	ENSP00000378637:P114L;ENSP00000259365:P114L	ENSP00000259365:P114L	P	+	2	0	TMOD1	99355447	1.000000	0.71417	0.965000	0.40720	0.914000	0.54420	7.712000	0.84684	2.582000	0.87167	0.655000	0.94253	CCG		0.537	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2	NM_003275	
STKLD1	169436	broad.mit.edu	37	9	136259497	136259498	+	Missense_Mutation	DNP	CT	CT	TA			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chr9:136259497_136259498CT>TA	ENST00000371957.3	+	8	770_771	c.663_664CT>TA	c.(661-666)ggCTgc>ggTAgc	p.C222S	C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		222	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.G221>?(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGTCCCTGGGCTGCATCATTCT	0.589																																					.												.	.	1	Complex(1)	large_intestine(1)	c.663_664TA	9						.																																			135249319	SO:0001583	missense	169436	exon8																														Exception_encountered	9.37:g.136259497_136259498delinsTA	ENSP00000361025:p.Cys222Ser		135249318	NM_153710	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	DNP	ENST00000371957.3	37	CCDS35169.1																																																																																				0.589	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
SLC25A53	401612	broad.mit.edu	37	X	103349267	103349267	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:103349267G>A	ENST00000357421.4	-	2	854	c.674C>T	c.(673-675)aCc>aTc	p.T225I		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	225					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.T225I(1)									AACTAGGCAGGTGATTGTTCC	0.522																																					p.T225I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C674T	X						.						71.0	67.0	68.0					X																	103349267		2203	4300	6503	103235923	SO:0001583	missense	401612	exon2				CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.674C>T	X.37:g.103349267G>A	ENSP00000361681:p.Thr225Ile		103235923	NM_001012755	B2RTT9	Missense_Mutation	SNP	ENST00000357421.4	37	CCDS35363.1	.	.	.	.	.	.	.	.	.	.	g	7.510	0.654571	0.14580	.	.	ENSG00000176274	ENST00000357421	T	0.79749	-1.3	4.18	3.31	0.37934	Mitochondrial carrier domain (2);	0.190898	0.44097	N	0.000486	T	0.58821	0.2149	N	0.05306	-0.075	0.36248	D	0.853733	B	0.02656	0.0	B	0.04013	0.001	T	0.55328	-0.8158	10	0.25106	T	0.35	-32.4539	9.1275	0.36824	0.113:0.0:0.887:0.0	.	225	Q5H9E4	MCAR6_HUMAN	I	225	ENSP00000361681:T225I	ENSP00000361681:T225I	T	-	2	0	MCART6	103235923	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.764000	0.47613	0.899000	0.36444	0.594000	0.82650	ACC		0.522	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057761.1	NM_001012755	
MUM1L1	139221	broad.mit.edu	37	X	105450986	105450986	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:105450986G>A	ENST00000357175.2	+	4	2210	c.1561G>A	c.(1561-1563)Gat>Aat	p.D521N	MUM1L1_ENST00000372552.1_Missense_Mutation_p.D521N|MUM1L1_ENST00000337685.2_Missense_Mutation_p.D521N	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	521						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GCATAATGAAGATGCCAGGGA	0.438																																					p.D521N												.	.	0			c.G1561A	X						.						57.0	51.0	53.0					X																	105450986		1843	4091	5934	105337642	SO:0001583	missense	139221	exon5			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1561G>A	X.37:g.105450986G>A	ENSP00000349699:p.Asp521Asn		105337642	NM_152423	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	ENST00000357175.2	37	CCDS55469.1	.	.	.	.	.	.	.	.	.	.	G	0.830	-0.745630	0.03065	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.41758	0.99;0.99;0.99	5.08	2.14	0.27477	.	0.521739	0.17483	N	0.172672	T	0.19208	0.0461	N	0.04880	-0.145	0.09310	N	1	B	0.19935	0.04	B	0.19946	0.027	T	0.18713	-1.0328	10	0.28530	T	0.3	-25.7653	6.4041	0.21654	0.3502:0.0:0.6498:0.0	.	521	Q5H9M0	MUML1_HUMAN	N	521	ENSP00000349699:D521N;ENSP00000338641:D521N;ENSP00000361632:D521N	ENSP00000338641:D521N	D	+	1	0	MUM1L1	105337642	0.999000	0.42202	0.036000	0.18154	0.006000	0.05464	1.534000	0.36051	0.177000	0.19895	0.600000	0.82982	GAT		0.438	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423	
MID2	11043	broad.mit.edu	37	X	107084275	107084275	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:107084275G>T	ENST00000262843.6	+	2	928	c.380G>T	c.(379-381)aGg>aTg	p.R127M	MID2_ENST00000443968.2_Missense_Mutation_p.R127M	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	127					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.R107M(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						AGGACTTACAGGCCCACCACT	0.532																																					p.R127M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G380T	X						.						43.0	42.0	42.0					X																	107084275		2203	4300	6503	106970931	SO:0001583	missense	11043	exon2				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.380G>T	X.37:g.107084275G>T	ENSP00000262843:p.Arg127Met		106970931	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	ENST00000262843.6	37	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682723	0.47991	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	D;D;D	0.88664	-2.41;-2.41;-2.41	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.85665	0.5749	L	0.34521	1.04	0.80722	D	1	P;B	0.51933	0.949;0.029	B;B	0.44085	0.44;0.018	D	0.86726	0.1945	10	0.51188	T	0.08	.	16.5117	0.84287	0.0:0.0:1.0:0.0	.	127;127	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	M	107;127;127	ENSP00000410730:R107M;ENSP00000262843:R127M;ENSP00000413976:R127M	ENSP00000262843:R127M	R	+	2	0	MID2	106970931	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.762000	0.68809	2.506000	0.84524	0.600000	0.82982	AGG		0.532	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
COL4A6	1288	broad.mit.edu	37	X	107403778	107403778	+	Silent	SNP	C	C	T			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:107403778C>T	ENST00000372216.4	-	43	4543	c.4443G>A	c.(4441-4443)ccG>ccA	p.P1481P	COL4A6_ENST00000334504.7_Silent_p.P1480P|COL4A6_ENST00000418180.1_5'Flank|COL4A6_ENST00000394872.2_Silent_p.P1481P|COL4A6_ENST00000545689.1_Silent_p.P1456P|COL4A6_ENST00000538570.1_Silent_p.P1423P	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1481	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P1480P(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CGATGGGACACGGGGGCACCT	0.607									Alport syndrome with Diffuse Leiomyomatosis																												p.P1480P	Melanoma(87;1895 1945 2589 7165)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4440A	X						.						144.0	112.0	123.0					X																	107403778		2203	4300	6503	107290434	SO:0001819	synonymous_variant	1288	exon43	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4443G>A	X.37:g.107403778C>T			107290434	NM_033641	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1																																																																																				0.607	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
TMEM164	84187	broad.mit.edu	37	X	109388074	109388074	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:109388074G>A	ENST00000372073.1	+	5	892	c.556G>A	c.(556-558)Gtg>Atg	p.V186M	TMEM164_ENST00000372072.3_Missense_Mutation_p.V37M|TMEM164_ENST00000372068.2_Missense_Mutation_p.V186M|TMEM164_ENST00000288381.4_Missense_Mutation_p.V147M			Q5U3C3	TM164_HUMAN	transmembrane protein 164	186						integral component of membrane (GO:0016021)		p.V147M(1)|p.V186M(1)		cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						TATGCTCTACGTGGTACCCAT	0.463																																					p.V186M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G556A	X						.						189.0	140.0	156.0					X																	109388074		2203	4300	6503	109274730	SO:0001583	missense	84187	exon5			AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.556G>A	X.37:g.109388074G>A	ENSP00000361143:p.Val186Met		109274730	NM_032227	B3KSQ8|F5H2P2	Missense_Mutation	SNP	ENST00000372073.1	37	CCDS14550.2	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803815	0.70682	.	.	ENSG00000157600	ENST00000372072;ENST00000372073;ENST00000372068;ENST00000288381;ENST00000501872	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.59	5.59	0.84812	.	0.060515	0.64402	D	0.000004	T	0.61135	0.2323	M	0.66939	2.045	0.45899	D	0.998742	D;D	0.65815	0.995;0.993	P;P	0.54210	0.745;0.698	T	0.65869	-0.6063	10	0.87932	D	0	-8.7245	9.5836	0.39504	0.0966:0.0:0.9034:0.0	.	147;186	Q9H617;Q5U3C3	.;TM164_HUMAN	M	37;186;186;147;147	ENSP00000384075:V37M;ENSP00000361143:V186M;ENSP00000361138:V186M;ENSP00000288381:V147M	ENSP00000288381:V147M	V	+	1	0	TMEM164	109274730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.118000	0.50414	2.354000	0.79902	0.600000	0.82982	GTG		0.463	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1	NM_032227	
WDR13	64743	broad.mit.edu	37	X	48463285	48463285	+	Silent	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:48463285G>C	ENST00000218056.5	+	9	1828	c.1323G>C	c.(1321-1323)gcG>gcC	p.A441A	WDR13_ENST00000376729.5_Silent_p.A441A	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	441						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A441A(2)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TGGAGCGGGCGGCCAAGGCTG	0.642																																					p.A349A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1047C	X						.						73.0	51.0	59.0					X																	48463285		2203	4300	6503	48348229	SO:0001819	synonymous_variant	64743	exon8			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.1323G>C	X.37:g.48463285G>C			48348229	NM_001166426	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Silent	SNP	ENST00000218056.5	37	CCDS14302.1																																																																																				0.642	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		
FAM104B	90736	broad.mit.edu	37	X	55170217	55170217	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:55170217C>A	ENST00000358460.4	-	4	496	c.343G>T	c.(343-345)Gtt>Ttt	p.V115F	FAM104B_ENST00000332132.4_Missense_Mutation_p.V116F|FAM104B_ENST00000478918.1_5'Flank			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	115								p.V116F(1)		endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						TAGTTTTAAACAGCTTGGTTC	0.398																																					p.V115F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G343T	X						.						138.0	115.0	123.0					X																	55170217		2203	4300	6503	55186942	SO:0001583	missense	90736	exon4			BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.343G>T	X.37:g.55170217C>A	ENSP00000364101:p.Val115Phe		55186942	NM_138362	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	9.987	1.229880	0.22542	.	.	ENSG00000182518	ENST00000358460;ENST00000332132	T;T	0.54479	0.58;0.57	1.26	-0.704	0.11256	.	0.877780	0.09003	U	0.862671	T	0.27454	0.0674	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.18967	-1.0320	10	0.87932	D	0	.	2.5673	0.04786	0.256:0.3432:0.4008:0.0	.	115;116	Q5XKR9;Q5XKR9-2	F104B_HUMAN;.	F	115;116	ENSP00000364101:V115F;ENSP00000333394:V116F	ENSP00000333394:V116F	V	-	1	0	FAM104B	55186942	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.314000	0.08092	-0.393000	0.07739	-0.384000	0.06662	GTT		0.398	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056851.1	NM_138362	
RRAGB	10325	broad.mit.edu	37	X	55784744	55784744	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:55784744G>C	ENST00000262850.7	+	11	1536	c.1093G>C	c.(1093-1095)Gat>Cat	p.D365H	RRAGB_ENST00000374941.4_Missense_Mutation_p.D337H	NM_016656.3	NP_057740.2			Ras-related GTP binding B									p.D365H(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						GGAAAGAGTGGATGGACCAAA	0.403																																					p.D365H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1093C	X						.						85.0	71.0	75.0					X																	55784744		2203	4300	6503	55801469	SO:0001583	missense	10325	exon11			X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.1093G>C	X.37:g.55784744G>C	ENSP00000262850:p.Asp365His		55801469	NM_016656		Missense_Mutation	SNP	ENST00000262850.7	37	CCDS14372.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244834	0.59103	.	.	ENSG00000083750	ENST00000374941;ENST00000262850	T	0.66638	-0.22	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.62539	0.2436	L	0.29908	0.895	0.80722	D	1	P;P	0.47910	0.799;0.902	B;P	0.48166	0.22;0.569	T	0.68221	-0.5466	10	0.72032	D	0.01	-14.8612	14.4258	0.67215	0.0:0.0:1.0:0.0	.	337;365	Q5VZM2-2;Q5VZM2	.;RRAGB_HUMAN	H	337;365	ENSP00000364077:D337H	ENSP00000262850:D365H	D	+	1	0	RRAGB	55801469	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.743000	0.91592	2.202000	0.70862	0.529000	0.55759	GAT		0.403	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056878.1	NM_016656	
AMER1	139285	broad.mit.edu	37	X	63412694	63412694	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:63412694T>G	ENST00000330258.3	-	2	745	c.473A>C	c.(472-474)aAg>aCg	p.K158T	AMER1_ENST00000374869.3_Missense_Mutation_p.K158T|AMER1_ENST00000403336.1_Missense_Mutation_p.K158T	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	158					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.K158T(2)									AGAGGGAAACTTCTCAGCCAC	0.532																																					p.K158T												.	.	69	Whole gene deletion(67)|Substitution - Missense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.A473C	X						.						41.0	41.0	41.0					X																	63412694		2203	4300	6503	63329419	SO:0001583	missense	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.473A>C	X.37:g.63412694T>G	ENSP00000329117:p.Lys158Thr		63329419	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	T	14.13	2.442702	0.43326	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.19532	2.14;2.14;2.14	4.93	1.26	0.21427	.	0.254015	0.39083	N	0.001473	T	0.32793	0.0841	M	0.67953	2.075	0.33895	D	0.637793	D	0.63880	0.993	P	0.60473	0.875	T	0.42949	-0.9421	10	0.72032	D	0.01	-7.5804	4.6094	0.12395	0.1487:0.1749:0.0:0.6764	.	158	Q5JTC6	F123B_HUMAN	T	158	ENSP00000364003:K158T;ENSP00000329117:K158T;ENSP00000384722:K158T	ENSP00000329117:K158T	K	-	2	0	FAM123B	63329419	1.000000	0.71417	0.470000	0.27216	0.495000	0.33615	2.678000	0.46900	0.280000	0.22209	0.486000	0.48141	AAG		0.532	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
MTMR8	55613	broad.mit.edu	37	X	63555988	63555988	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:63555988C>A	ENST00000374852.3	-	10	1189	c.1122G>T	c.(1120-1122)tgG>tgT	p.W374C	MTMR8_ENST00000478487.1_Intron|MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	374	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.W374C(1)|p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						CCATGGATATCCATTCCTTCT	0.338																																					p.W374C												.	.	2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(1)|large_intestine(1)	c.G1122T	X						.						100.0	89.0	93.0					X																	63555988		2203	4299	6502	63472713	SO:0001583	missense	55613	exon10			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1122G>T	X.37:g.63555988C>A	ENSP00000363985:p.Trp374Cys		63472713	NM_017677	Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.87|15.87	2.961116|2.961116	0.53400|0.53400	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000374852;ENST00000247400	.|D	.|0.98996	.|-5.31	3.14|3.14	2.27|2.27	0.28462|0.28462	.|Myotubularin phosphatase domain (1);	.|0.000000	.|0.49916	.|U	.|0.000125	D|D	0.99545|0.99545	0.9837|0.9837	H|H	0.99415|0.99415	4.555|4.555	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.98052|0.98052	1.0388|1.0388	5|10	.|0.87932	.|D	.|0	.|.	8.8025|8.8025	0.34918|0.34918	0.0:0.8786:0.0:0.1214|0.0:0.8786:0.0:0.1214	.|.	.|374	.|Q96EF0	.|MTMR8_HUMAN	Y|C	178|374;260	.|ENSP00000363985:W374C	.|ENSP00000247400:W260C	D|W	-|-	1|3	0|0	MTMR8|MTMR8	63472713|63472713	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	4.697000|4.697000	0.61782|0.61782	0.526000|0.526000	0.28541|0.28541	0.600000|0.600000	0.82982|0.82982	GAT|TGG		0.338	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677	
YIPF6	286451	broad.mit.edu	37	X	67731809	67731809	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:67731809G>A	ENST00000462683.1	+	2	920	c.176G>A	c.(175-177)cGc>cAc	p.R59H	YIPF6_ENST00000374622.2_Intron|YIPF6_ENST00000470730.1_3'UTR	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	59					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)		p.R59H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						GAATCTGTTCGCAATACCATC	0.393																																					p.R59H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G176A	X						.						133.0	115.0	121.0					X																	67731809		2203	4300	6503	67648534	SO:0001583	missense	286451	exon2			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.176G>A	X.37:g.67731809G>A	ENSP00000417573:p.Arg59His		67648534	NM_173834	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	ENST00000462683.1	37	CCDS14389.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857787	0.71834	.	.	ENSG00000181704	ENST00000462683	T	0.45668	0.89	5.66	-2.32	0.06745	.	0.567644	0.18255	N	0.146802	T	0.34454	0.0898	L	0.43152	1.355	0.80722	D	1	P	0.48016	0.904	P	0.45660	0.489	T	0.11567	-1.0582	10	0.35671	T	0.21	-15.5125	10.444	0.44483	0.5517:0.0:0.4483:0.0	.	59	Q96EC8	YIPF6_HUMAN	H	59	ENSP00000417573:R59H	ENSP00000417573:R59H	R	+	2	0	YIPF6	67648534	0.976000	0.34144	0.910000	0.35882	0.883000	0.51084	0.343000	0.19944	-0.793000	0.04475	-0.527000	0.04329	CGC		0.393	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057016.1	NM_173834	
ERCC6L	54821	broad.mit.edu	37	X	71426420	71426420	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:71426420C>A	ENST00000334463.3	-	2	2332	c.2197G>T	c.(2197-2199)Gaa>Taa	p.E733*	ERCC6L_ENST00000373657.1_Nonsense_Mutation_p.E610*|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	733					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.E733*(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AATACAGGTTCTCTTAGCCAG	0.408																																					p.E733X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2197T	X						.						90.0	83.0	86.0					X																	71426420		2203	4300	6503	71343145	SO:0001587	stop_gained	54821	exon2			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2197G>T	X.37:g.71426420C>A	ENSP00000334675:p.Glu733*		71343145	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Nonsense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	C	45	11.637620	0.99585	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	.	.	.	5.47	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-6.146	10.8645	0.46847	0.0:0.6805:0.3195:0.0	.	.	.	.	X	610;733	.	ENSP00000334675:E733X	E	-	1	0	ERCC6L	71343145	0.995000	0.38212	0.059000	0.19551	0.934000	0.57294	2.124000	0.42006	2.289000	0.77006	0.594000	0.82650	GAA		0.408	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
MAGEE1	57692	broad.mit.edu	37	X	75649927	75649927	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:75649927G>A	ENST00000361470.2	+	1	1882	c.1604G>A	c.(1603-1605)cGa>cAa	p.R535Q		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	535	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.R535Q(2)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						ATACTCAGGCGAGCAGCAGCC	0.478																																					p.R535Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1604A	X						.						42.0	40.0	40.0					X																	75649927		2203	4300	6503	75566331	SO:0001583	missense	57692	exon1			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1604G>A	X.37:g.75649927G>A	ENSP00000354912:p.Arg535Gln		75566331	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369086	0.24771	.	.	ENSG00000198934	ENST00000361470	T	0.05649	3.41	2.34	2.34	0.29019	.	.	.	.	.	T	0.15609	0.0376	L	0.46947	1.48	0.21105	N	0.999784	D	0.89917	1.0	D	0.83275	0.996	T	0.05869	-1.0859	9	0.59425	D	0.04	.	7.3601	0.26742	0.0:0.0:1.0:0.0	.	535	Q9HCI5	MAGE1_HUMAN	Q	535	ENSP00000354912:R535Q	ENSP00000354912:R535Q	R	+	2	0	MAGEE1	75566331	0.995000	0.38212	0.331000	0.25455	0.008000	0.06430	2.592000	0.46171	1.432000	0.47375	0.594000	0.82650	CGA		0.478	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
KLHL4	56062	broad.mit.edu	37	X	86887279	86887279	+	Missense_Mutation	SNP	G	G	A	rs146910003		TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:86887279G>A	ENST00000373119.4	+	7	1539	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	KLHL4_ENST00000373114.4_Missense_Mutation_p.R465H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	465						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R465H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						ATGAATGGCCGTAGGCTTCAA	0.388													G|||	1	0.000264901	0.0	0.0	3775	,	,		13420	0.001		0.0	False		,,,				2504	0.0				p.R465H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1394A	X						.	G	HIS/ARG,HIS/ARG	1,3834		0,1,1631,571	108.0	91.0	97.0		1394,1394	3.5	0.8	X	dbSNP_134	97	0,6728		0,0,2428,1872	no	missense,missense	KLHL4	NM_019117.4,NM_057162.2	29,29	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging	465/719,465/721	86887279	1,10562	2203	4300	6503	86773935	SO:0001583	missense	56062	exon7			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1394G>A	X.37:g.86887279G>A	ENSP00000362211:p.Arg465His		86773935	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165472	0.78339	2.61E-4	0.0	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.66815	-0.23;-0.23	5.32	3.55	0.40652	Galactose oxidase, beta-propeller (1);	0.059533	0.64402	N	0.000005	T	0.65365	0.2684	M	0.69358	2.11	0.58432	D	0.999997	P;D	0.55605	0.692;0.972	B;P	0.44860	0.344;0.462	T	0.66396	-0.5934	10	0.87932	D	0	.	10.0307	0.42099	0.1676:0.0:0.8324:0.0	.	465;465	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	465	ENSP00000362211:R465H;ENSP00000362206:R465H	ENSP00000362206:R465H	R	+	2	0	KLHL4	86773935	1.000000	0.71417	0.760000	0.31359	0.976000	0.68499	6.184000	0.72008	0.448000	0.26722	0.506000	0.49869	CGT		0.388	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
DCAF12L1	139170	broad.mit.edu	37	X	125685629	125685629	+	Silent	SNP	G	G	A			TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01D-01A-01W-A00E-09	TCGA-AA-A01D-10A-01W-A00E-09	g.chrX:125685629G>A	ENST00000371126.1	-	1	1205	c.963C>T	c.(961-963)taC>taT	p.Y321Y		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	321								p.Y321Y(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						AGCCCACGGCGTACACAGACA	0.597																																					p.Y321Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C963T	X						.						64.0	57.0	60.0					X																	125685629		2203	4300	6503	125513310	SO:0001819	synonymous_variant	139170	exon1			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.963C>T	X.37:g.125685629G>A			125513310	NM_178470	Q8IYK3	Silent	SNP	ENST00000371126.1	37	CCDS14610.1																																																																																				0.597	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
