#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF518A	9849	broad.mit.edu	37	10	97919832	97919833	+	RNA	INS	-	-	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:97919832_97919833insA	ENST00000534948.1	+	0	4610_4611							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I1254fs*11(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		AAAAGACTTCCAAAAAAATTTT	0.337																																					p.S1251fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.3753_3754insA	10						.																																			97909823			9849	exon6			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97919839_97919839dupA			97909822	NM_014803	A0PJI5|O15044|Q32MP4	Frame_Shift_Ins	INS	ENST00000534948.1	37																																																																																					0.337	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
CNNM1	26507	broad.mit.edu	37	10	101120678	101120678	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:101120678C>T	ENST00000356713.4	+	3	2093	c.1804C>T	c.(1804-1806)Cgg>Tgg	p.R602W	CNNM1_ENST00000446890.1_Missense_Mutation_p.R531W|CNNM1_ENST00000370528.3_Missense_Mutation_p.R531W|CNNM1_ENST00000370534.4_Missense_Mutation_p.R237W	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	602					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.R237W(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CACGGAGATGCGGGTGAAGAT	0.542																																					p.R602W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1804T	10						.						109.0	102.0	104.0					10																	101120678		2203	4300	6503	101110668	SO:0001583	missense	26507	exon3			AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1804C>T	10.37:g.101120678C>T	ENSP00000349147:p.Arg602Trp		101110668	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431371	0.83776	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	D;D;D;T	0.83506	-1.73;-1.73;-1.72;-0.72	5.74	2.08	0.27032	.	0.208107	0.47852	D	0.000215	D	0.86003	0.5829	L	0.47190	1.495	0.40500	D	0.980636	P;D;D;D	0.69078	0.899;0.997;0.989;0.996	P;D;P;P	0.63283	0.661;0.913;0.757;0.889	D	0.85804	0.1375	10	0.87932	D	0	-18.2353	13.4108	0.60942	0.5705:0.4295:0.0:0.0	.	237;602;237;602	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	W	602;531;531;237;55	ENSP00000349147:R602W;ENSP00000406492:R531W;ENSP00000359559:R531W;ENSP00000359565:R237W	ENSP00000349147:R602W	R	+	1	2	CNNM1	101110668	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	4.242000	0.58714	0.104000	0.17725	0.655000	0.94253	CGG		0.542	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
HIF1AN	55662	broad.mit.edu	37	10	102300446	102300446	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:102300446T>G	ENST00000299163.6	+	3	584	c.484T>G	c.(484-486)Ttc>Gtc	p.F162V	HIF1AN_ENST00000528044.1_3'UTR	NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	162	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.F162V(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		TGTCATGGACTTCTTAGGTTT	0.463																																					p.F162V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T484G	10						.						181.0	169.0	173.0					10																	102300446		2203	4300	6503	102290436	SO:0001583	missense	55662	exon3			AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.484T>G	10.37:g.102300446T>G	ENSP00000299163:p.Phe162Val		102290436	NM_017902	D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038156	0.93630	.	.	ENSG00000166135	ENST00000533589;ENST00000299163;ENST00000442724	T;T	0.71222	-0.55;-0.55	5.61	5.61	0.85477	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.086974	0.85682	D	0.000000	T	0.79816	0.4511	L	0.55017	1.72	0.80722	D	1	D	0.65815	0.995	D	0.69654	0.965	T	0.77156	-0.2691	10	0.28530	T	0.3	-21.2806	15.8028	0.78468	0.0:0.0:0.0:1.0	.	162	Q9NWT6	HIF1N_HUMAN	V	55;162;195	ENSP00000433360:F55V;ENSP00000299163:F162V	ENSP00000299163:F162V	F	+	1	0	HIF1AN	102290436	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	2.134000	0.65973	0.459000	0.35465	TTC		0.463	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902	
GBF1	8729	broad.mit.edu	37	10	104019856	104019856	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:104019856T>G	ENST00000369983.3	+	3	406	c.146T>G	c.(145-147)gTt>gGt	p.V49G	AL160011.1_ENST00000516180.2_RNA	NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	49					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V49G(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CTAAAGGAGGTTTTAAACAGT	0.338																																					p.V49G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T146G	10						.						180.0	172.0	175.0					10																	104019856		2203	4300	6503	104009846	SO:0001583	missense	8729	exon3			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.146T>G	10.37:g.104019856T>G	ENSP00000359000:p.Val49Gly		104009846	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774495	0.31411	.	.	ENSG00000107862	ENST00000369983	T	0.10477	2.87	5.15	5.15	0.70609	.	0.194127	0.37136	N	0.002233	T	0.12860	0.0312	L	0.49126	1.545	0.80722	D	1	P;P;B;P	0.45827	0.856;0.565;0.289;0.867	B;B;B;B	0.41619	0.332;0.146;0.043;0.361	T	0.10268	-1.0637	10	0.24483	T	0.36	-12.1179	15.2783	0.73760	0.0:0.0:0.0:1.0	.	49;49;49;49	Q149P1;Q149P0;Q92538;Q504U7	.;.;GBF1_HUMAN;.	G	49	ENSP00000359000:V49G	ENSP00000359000:V49G	V	+	2	0	GBF1	104009846	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	5.357000	0.66058	2.064000	0.61679	0.528000	0.53228	GTT		0.338	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
COL17A1	1308	broad.mit.edu	37	10	105823551	105823551	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:105823551C>T	ENST00000353479.5	-	11	1082	c.792G>A	c.(790-792)gcG>gcA	p.A264A	COL17A1_ENST00000369733.3_Silent_p.A264A|COL17A1_ENST00000393211.3_Silent_p.A264A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	264	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A264A(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTGAGCAGGACGCCATGTTGT	0.512																																					p.A264A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G792A	10						.						186.0	138.0	154.0					10																	105823551		2203	4300	6503	105813541	SO:0001819	synonymous_variant	1308	exon11			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.792G>A	10.37:g.105823551C>T			105813541	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	CCDS7554.1																																																																																				0.512	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
DCLRE1A	9937	broad.mit.edu	37	10	115602168	115602168	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:115602168T>C	ENST00000361384.2	-	6	3516	c.2599A>G	c.(2599-2601)Act>Gct	p.T867A	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.T867A	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	867					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)		p.T867A(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		GGGTTTAGAGTTACAGCCTCA	0.408								Other identified genes with known or suspected DNA repair function																													p.T867A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2599G	10						.						229.0	207.0	214.0					10																	115602168		2203	4300	6503	115592158	SO:0001583	missense	9937	exon6				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.2599A>G	10.37:g.115602168T>C	ENSP00000355185:p.Thr867Ala		115592158	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639226	0.67244	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.73152	-0.72;-0.72	5.96	5.96	0.96718	.	0.099013	0.64402	D	0.000002	T	0.64594	0.2612	L	0.28556	0.865	0.39824	D	0.97287	B	0.25904	0.137	B	0.34346	0.18	T	0.64339	-0.6431	10	0.46703	T	0.11	-21.5308	14.9988	0.71455	0.0:0.0:0.0:1.0	.	867	Q6PJP8	DCR1A_HUMAN	A	867	ENSP00000355185:T867A;ENSP00000358311:T867A	ENSP00000355185:T867A	T	-	1	0	DCLRE1A	115592158	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.787000	0.62432	2.279000	0.76181	0.533000	0.62120	ACT		0.408	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
PNLIP	5406	broad.mit.edu	37	10	118321050	118321050	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:118321050G>T	ENST00000369221.2	+	12	1264	c.1236G>T	c.(1234-1236)ttG>ttT	p.L412F		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	412	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.L412F(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	TTGGGGACTTGCAGATGGTTA	0.373																																					p.L412F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1236T	10						.						131.0	126.0	128.0					10																	118321050		2203	4300	6503	118311040	SO:0001583	missense	5406	exon12			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.1236G>T	10.37:g.118321050G>T	ENSP00000358223:p.Leu412Phe		118311040	NM_000936	Q5VSQ2	Missense_Mutation	SNP	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669171	0.29604	.	.	ENSG00000175535	ENST00000369221	T	0.72505	-0.66	5.99	2.83	0.33086	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	1.521730	0.04205	N	0.330687	D	0.82365	0.5021	M	0.83012	2.62	0.20074	N	0.999939	D	0.56035	0.974	D	0.63381	0.914	T	0.56547	-0.7961	10	0.54805	T	0.06	.	2.9799	0.05949	0.0879:0.2419:0.4316:0.2386	.	412	P16233	LIPP_HUMAN	F	412	ENSP00000358223:L412F	ENSP00000358223:L412F	L	+	3	2	PNLIP	118311040	0.902000	0.30710	0.476000	0.27291	0.100000	0.18952	1.215000	0.32431	0.829000	0.34733	0.655000	0.94253	TTG		0.373	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
FAM24A	118670	broad.mit.edu	37	10	124672354	124672354	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:124672354G>A	ENST00000368894.1	+	3	323	c.202G>A	c.(202-204)Gcc>Acc	p.A68T		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	68						extracellular region (GO:0005576)		p.A68T(1)		large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		GAACAGCCAGGCCAAAGCCAC	0.502																																					p.A68T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G202A	10						.						161.0	121.0	134.0					10																	124672354		2203	4300	6503	124662344	SO:0001583	missense	118670	exon3				CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.202G>A	10.37:g.124672354G>A	ENSP00000357889:p.Ala68Thr		124662344	NM_001029888		Missense_Mutation	SNP	ENST00000368894.1	37	CCDS31304.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526960	0.44969	.	.	ENSG00000203795	ENST00000368894	.	.	.	3.04	1.16	0.20824	.	0.827174	0.09827	N	0.750765	T	0.22589	0.0545	L	0.32530	0.975	0.09310	N	1	P	0.40332	0.713	B	0.33339	0.162	T	0.15350	-1.0440	9	0.72032	D	0.01	.	5.1871	0.15189	0.278:0.0:0.722:0.0	.	68	A6NFZ4	FA24A_HUMAN	T	68	.	ENSP00000357889:A68T	A	+	1	0	FAM24A	124662344	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.252000	0.08806	0.331000	0.23511	0.313000	0.20887	GCC		0.502	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050824.1	XM_058332	
DIP2C	22982	broad.mit.edu	37	10	327145	327145	+	Silent	SNP	C	C	A	rs375053800		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:327145C>A	ENST00000280886.6	-	36	4500	c.4413G>T	c.(4411-4413)acG>acT	p.T1471T	RNA5SP298_ENST00000364991.1_RNA	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1471						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.T1471T(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CTTACCATTCCGTAACGCTTT	0.537																																					p.T1471T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4413T	10						.						171.0	145.0	154.0					10																	327145		2203	4300	6503	317145	SO:0001819	synonymous_variant	22982	exon36			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4413G>T	10.37:g.327145C>A			317145	NM_014974	B4DPI5|Q5SS78	Silent	SNP	ENST00000280886.6	37	CCDS7054.1																																																																																				0.537	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
SFMBT2	57713	broad.mit.edu	37	10	7247880	7247880	+	Silent	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:7247880A>T	ENST00000361972.4	-	12	1431	c.1341T>A	c.(1339-1341)acT>acA	p.T447T	SFMBT2_ENST00000397167.1_Silent_p.T447T	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	447					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.T447T(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CTGGAACAGGAGTCTGCAGCC	0.443																																					p.T447T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1341A	10						.						93.0	83.0	86.0					10																	7247880		2203	4300	6503	7287886	SO:0001819	synonymous_variant	57713	exon12			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1341T>A	10.37:g.7247880A>T			7287886	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																				0.443	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
CACNB2	783	broad.mit.edu	37	10	18816590	18816590	+	Missense_Mutation	SNP	G	G	A	rs140614930		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:18816590G>A	ENST00000324631.7	+	10	1078	c.1018G>A	c.(1018-1020)Gca>Aca	p.A340T	CACNB2_ENST00000282343.8_Missense_Mutation_p.A312T|CACNB2_ENST00000396576.2_Missense_Mutation_p.A285T|CACNB2_ENST00000377315.4_Missense_Mutation_p.A292T|CACNB2_ENST00000377319.3_Missense_Mutation_p.A247T|CACNB2_ENST00000352115.6_Missense_Mutation_p.A316T|CACNB2_ENST00000377329.4_Missense_Mutation_p.A286T|CACNB2_ENST00000377328.1_Intron|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000377331.2_Missense_Mutation_p.A288T	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	340					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)	p.A285T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGTAAGCACGCAATAATAGA	0.438																																					p.A340T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1018A	10						.	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	2,4404	4.2+/-10.8	0,2,2201	139.0	131.0	134.0		853,820,874,934,862,856,904,1018,946	5.7	1.0	10	dbSNP_134	134	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense	CACNB2	NM_000724.3,NM_001167945.1,NM_201570.2,NM_201571.3,NM_201572.3,NM_201590.2,NM_201593.2,NM_201596.2,NM_201597.2	58,58,58,58,58,58,58,58,58	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	285/606,274/595,292/613,312/633,288/609,286/607,302/623,340/661,316/637	18816590	2,13004	2203	4300	6503	18856596	SO:0001583	missense	783	exon10			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.1018G>A	10.37:g.18816590G>A	ENSP00000320025:p.Ala340Thr		18856596	NM_201596	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031982	0.93575	4.54E-4	0.0	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.65	5.65	0.86999	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.046492	0.85682	D	0.000000	D	0.87815	0.6272	L	0.43701	1.375	0.80722	D	1	D;P;D;P;D;P;D;D;D;D;P;P	0.71674	0.967;0.918;0.998;0.855;0.995;0.954;0.971;0.967;0.995;0.985;0.666;0.918	P;B;D;B;P;P;P;P;P;P;B;P	0.68353	0.677;0.439;0.957;0.231;0.906;0.544;0.466;0.677;0.906;0.619;0.195;0.544	D	0.84200	0.0450	10	0.26408	T	0.33	-16.7188	20.0781	0.97751	0.0:0.0:1.0:0.0	.	254;312;292;262;286;296;247;288;312;302;316;340	B7Z1U5;Q5QJA0;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	T	340;316;312;288;285;247;286;292	ENSP00000320025:A340T;ENSP00000344474:A316T;ENSP00000282343:A312T;ENSP00000366548:A288T;ENSP00000379821:A285T;ENSP00000366536:A247T;ENSP00000366546:A286T;ENSP00000366532:A292T	ENSP00000282343:A312T	A	+	1	0	CACNB2	18856596	1.000000	0.71417	0.986000	0.45419	0.983000	0.72400	7.956000	0.87863	2.817000	0.96982	0.563000	0.77884	GCA		0.438	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
PARD3	56288	broad.mit.edu	37	10	34620076	34620076	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:34620076C>T	ENST00000374789.3	-	19	3136	c.2811G>A	c.(2809-2811)gcG>gcA	p.A937A	PARD3_ENST00000374794.3_Silent_p.A862A|PARD3_ENST00000466092.1_5'UTR|PARD3_ENST00000374773.1_Silent_p.A904A|PARD3_ENST00000544292.1_Silent_p.A650A|PARD3_ENST00000340077.5_Silent_p.A934A|PARD3_ENST00000545693.1_Silent_p.A921A|PARD3_ENST00000346874.4_Silent_p.A937A|PARD3_ENST00000545260.1_Silent_p.A847A|PARD3_ENST00000374790.3_Silent_p.A877A|PARD3_ENST00000374776.1_Silent_p.A891A|PARD3_ENST00000350537.4_Silent_p.A891A|PARD3_ENST00000374788.3_Silent_p.A934A	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	937					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A937A(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CATCATCTACCGCGGGTTTAT	0.433																																					p.A937A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2811A	10						.						105.0	95.0	99.0					10																	34620076		2203	4300	6503	34660082	SO:0001819	synonymous_variant	56288	exon19			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2811G>A	10.37:g.34620076C>T			34660082	NM_001184787	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	ENST00000374789.3	37	CCDS7178.1																																																																																				0.433	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
CHAT	1103	broad.mit.edu	37	10	50856591	50856591	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:50856591C>T	ENST00000337653.2	+	9	1473	c.1320C>T	c.(1318-1320)tgC>tgT	p.C440C	CHAT_ENST00000339797.1_Silent_p.C322C|CHAT_ENST00000395562.2_Silent_p.C358C|CHAT_ENST00000351556.3_Silent_p.C322C|CHAT_ENST00000395559.2_Silent_p.C322C|CHAT_ENST00000455728.2_Silent_p.C322C	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	440					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)	p.C440C(1)		central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GTGTGGTGTGCGAACACTCCC	0.602																																					p.C322C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C966T	10						.						124.0	75.0	92.0					10																	50856591		2203	4300	6503	50526597	SO:0001819	synonymous_variant	1103	exon9			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1320C>T	10.37:g.50856591C>T			50526597	NM_001142929	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	ENST00000337653.2	37	CCDS7232.1																																																																																				0.602	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
ANK3	288	broad.mit.edu	37	10	61956308	61956308	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:61956308C>T	ENST00000280772.2	-	15	1956	c.1765G>A	c.(1765-1767)Gca>Aca	p.A589T	ANK3_ENST00000373827.2_Missense_Mutation_p.A583T|ANK3_ENST00000503366.1_Missense_Mutation_p.A572T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	589					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A589T(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTGGAGATGCACTTTTCTGT	0.413																																					p.A589T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1765A	10						.						76.0	70.0	72.0					10																	61956308		2203	4300	6503	61626314	SO:0001583	missense	288	exon15			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1765G>A	10.37:g.61956308C>T	ENSP00000280772:p.Ala589Thr		61626314	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	36	5.694065	0.96793	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304;ENST00000536348	T;T;T	0.70869	-0.52;-0.52;-0.52	5.57	5.57	0.84162	Ankyrin repeat-containing domain (4);	0.000000	0.39274	N	0.001416	D	0.86184	0.5872	M	0.83692	2.655	0.80722	D	1	P;D;D;D;D	0.89917	0.929;0.999;1.0;1.0;1.0	P;D;D;D;D	0.97110	0.684;0.982;1.0;0.995;0.999	D	0.87630	0.2515	10	0.87932	D	0	.	19.5506	0.95315	0.0:1.0:0.0:0.0	.	572;250;133;583;589	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	T	589;583;572;551;250;250;133	ENSP00000280772:A589T;ENSP00000362933:A583T;ENSP00000425236:A572T	ENSP00000280772:A589T	A	-	1	0	ANK3	61626314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.618000	0.88619	0.563000	0.77884	GCA		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
UNC5B	219699	broad.mit.edu	37	10	73046540	73046540	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:73046540G>A	ENST00000335350.6	+	5	1063	c.647G>A	c.(646-648)cGc>cAc	p.R216H	UNC5B_ENST00000373192.4_Missense_Mutation_p.R216H	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	216	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.R216H(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CGCCAGGCCCGCCTGTCGGAC	0.597																																					p.R216H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G647A	10						.						207.0	195.0	199.0					10																	73046540		2203	4300	6503	72716546	SO:0001583	missense	219699	exon5			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.647G>A	10.37:g.73046540G>A	ENSP00000334329:p.Arg216His		72716546	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227582	0.79576	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.67698	-0.28;-0.28	5.43	4.53	0.55603	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82407	0.5030	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.85330	0.1089	10	0.87932	D	0	-34.0893	14.2307	0.65890	0.0717:0.0:0.9283:0.0	.	216;216	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	H	216	ENSP00000334329:R216H;ENSP00000362288:R216H	ENSP00000334329:R216H	R	+	2	0	UNC5B	72716546	1.000000	0.71417	0.984000	0.44739	0.372000	0.29890	9.869000	0.99810	1.312000	0.45043	0.561000	0.74099	CGC		0.597	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
PLA2G12B	84647	broad.mit.edu	37	10	74714399	74714399	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:74714399C>A	ENST00000373032.3	-	1	137	c.45G>T	c.(43-45)ggG>ggT	p.G15G		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	15					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.G15G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					CCAGGCCACCCCCAAGGCTGA	0.592																																					p.G15G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G45T	10						.						55.0	63.0	61.0					10																	74714399		2203	4300	6503	74384405	SO:0001819	synonymous_variant	84647	exon1			AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.45G>T	10.37:g.74714399C>A			74384405	NM_032562	B7ZL23|Q52LB2|Q96Q99	Silent	SNP	ENST00000373032.3	37	CCDS7319.1																																																																																				0.592	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048598.1	NM_032562	
BTAF1	9044	broad.mit.edu	37	10	93695423	93695423	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:93695423C>T	ENST00000265990.6	+	2	332	c.24C>T	c.(22-24)cgC>cgT	p.R8R		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	8					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R8R(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GGCTAGATCGCCTTTTTATTT	0.378																																					p.R8R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C24T	10						.						160.0	138.0	145.0					10																	93695423		2203	4300	6503	93685403	SO:0001819	synonymous_variant	9044	exon2			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.24C>T	10.37:g.93695423C>T			93685403	NM_003972	B4E0W6|O43578	Silent	SNP	ENST00000265990.6	37	CCDS7419.1																																																																																				0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
PDE6C	5146	broad.mit.edu	37	10	95395365	95395365	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:95395365A>T	ENST00000371447.3	+	10	1519	c.1381A>T	c.(1381-1383)Aaa>Taa	p.K461*		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	461					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.K461*(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	GAACCAAACCAAAGCCACTCC	0.368																																					p.K461X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1381T	10						.						128.0	114.0	119.0					10																	95395365		2203	4300	6503	95385355	SO:0001587	stop_gained	5146	exon10			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1381A>T	10.37:g.95395365A>T	ENSP00000360502:p.Lys461*		95385355	NM_006204	A6NCR6|Q5VY29	Nonsense_Mutation	SNP	ENST00000371447.3	37	CCDS7429.1	.	.	.	.	.	.	.	.	.	.	A	40	8.268689	0.98735	.	.	ENSG00000095464	ENST00000371447	.	.	.	5.27	5.27	0.74061	.	0.393988	0.32301	N	0.006299	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3683	0.74541	1.0:0.0:0.0:0.0	.	.	.	.	X	461	.	ENSP00000360502:K461X	K	+	1	0	PDE6C	95385355	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	5.714000	0.68422	2.206000	0.71126	0.528000	0.53228	AAA		0.368	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204	
ALDH18A1	5832	broad.mit.edu	37	10	97366665	97366665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:97366665C>T	ENST00000371224.2	-	18	2379	c.2242G>A	c.(2242-2244)Gcc>Acc	p.A748T	ALDH18A1_ENST00000371221.3_Missense_Mutation_p.A746T	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	748	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)	p.A748T(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		GGTCCCCGGGCGTGGATTCTC	0.502																																					p.A746T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2236A	10						.						148.0	148.0	148.0					10																	97366665		2203	4300	6503	97356655	SO:0001583	missense	5832	exon18			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.2242G>A	10.37:g.97366665C>T	ENSP00000360268:p.Ala748Thr		97356655	NM_001017423	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Missense_Mutation	SNP	ENST00000371224.2	37	CCDS7443.1	.	.	.	.	.	.	.	.	.	.	C	33	5.249779	0.95305	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	T;T	0.76060	-0.99;-0.99	5.37	5.37	0.77165	Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);Gamma-glutamyl phosphate reductase GPR (1);	0.000000	0.85682	D	0.000000	D	0.89760	0.6808	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70935	0.935;0.971	D	0.92443	0.5963	10	0.87932	D	0	-16.8446	16.6099	0.84880	0.0:1.0:0.0:0.0	.	748;746	P54886;P54886-2	P5CS_HUMAN;.	T	748;746	ENSP00000360268:A748T;ENSP00000360265:A746T	ENSP00000360265:A746T	A	-	1	0	ALDH18A1	97356655	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	7.376000	0.79658	2.535000	0.85469	0.561000	0.74099	GCC		0.502	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1	NM_002860	
MMS19	64210	broad.mit.edu	37	10	99225822	99225822	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:99225822G>A	ENST00000438925.2	-	17	1935	c.1600C>T	c.(1600-1602)Cgt>Tgt	p.R534C	MMS19_ENST00000327277.7_Missense_Mutation_p.R170C|MMS19_ENST00000327238.10_Missense_Mutation_p.R436C|MMS19_ENST00000355839.6_Missense_Mutation_p.R491C|MMS19_ENST00000370782.2_Missense_Mutation_p.R534C	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	534					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)	p.R534C(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		ATACCTACACGCAGCTCCTCA	0.572								Direct reversal of damage																													p.R534C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1600T	10						.						47.0	45.0	45.0					10																	99225822		2203	4300	6503	99215812	SO:0001583	missense	64210	exon17			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.1600C>T	10.37:g.99225822G>A	ENSP00000412698:p.Arg534Cys		99215812	NM_022362	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	ENST00000438925.2	37	CCDS7464.1	.	.	.	.	.	.	.	.	.	.	G	6.757	0.508526	0.12883	.	.	ENSG00000155229	ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000327277;ENST00000327253;ENST00000355839	T;T;T;T;T	0.66280	3.52;3.52;-0.2;2.5;3.39	5.49	1.11	0.20524	Armadillo-like helical (1);Armadillo-type fold (1);	0.800942	0.12733	N	0.443671	T	0.32556	0.0833	N	0.04880	-0.145	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.001	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.001	T	0.14531	-1.0469	10	0.37606	T	0.19	.	0.9666	0.01406	0.193:0.1493:0.3536:0.3042	.	555;436;491;534;491	B4DQX2;Q96T76-5;F8W9Y2;Q96T76;B4E2I3	.;.;.;MMS19_HUMAN;.	C	534;534;436;513;170;119;491	ENSP00000412698:R534C;ENSP00000359818:R534C;ENSP00000320059:R436C;ENSP00000322236:R170C;ENSP00000348097:R491C	ENSP00000320059:R436C	R	-	1	0	MMS19	99215812	0.001000	0.12720	0.034000	0.17996	0.422000	0.31414	0.501000	0.22578	-0.077000	0.12752	0.561000	0.74099	CGT		0.572	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2		
LZTS2	84445	broad.mit.edu	37	10	102762593	102762593	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:102762593delC	ENST00000370220.1	+	1	3361	c.298delC	c.(298-300)cccfs	p.P101fs	LZTS2_ENST00000370223.3_Frame_Shift_Del_p.P101fs					leucine zipper, putative tumor suppressor 2									p.S102fs*41(2)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GACAGAGTCACCCCCCAGCCC	0.612																																					p.P100fs	Esophageal Squamous(8;38 437 13604 19902 37640)											.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.298delC	10						.						48.0	51.0	50.0					10																	102762593		2203	4300	6503	102752583	SO:0001589	frameshift_variant	84445	exon2			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.298delC	10.37:g.102762593delC	ENSP00000359240:p.Pro101fs		102752583	NM_032429		Frame_Shift_Del	DEL	ENST00000370220.1	37	CCDS7507.1																																																																																				0.612	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
ACADSB	36	broad.mit.edu	37	10	124800808	124800808	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr10:124800808T>A	ENST00000358776.4	+	5	608	c.594T>A	c.(592-594)taT>taA	p.Y198*	ACADSB_ENST00000368869.4_Nonsense_Mutation_p.Y96*|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	198					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.Y198*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	AGGGAGATTATTATGTCCTCA	0.443																																					p.Y198X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T594A	10						.						144.0	139.0	141.0					10																	124800808		2203	4300	6503	124790798	SO:0001587	stop_gained	36	exon5			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.594T>A	10.37:g.124800808T>A	ENSP00000357873:p.Tyr198*		124790798	NM_001609	B4DQ51|Q5SQN6|Q96CX7	Nonsense_Mutation	SNP	ENST00000358776.4	37	CCDS7634.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.070546	0.76301	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	.	.	.	6.02	0.932	0.19466	.	0.249082	0.41938	D	0.000786	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	12.2233	0.54445	0.0:0.6418:0.0:0.3582	.	.	.	.	X	96;198	.	ENSP00000357873:Y198X	Y	+	3	2	ACADSB	124790798	0.470000	0.25854	0.040000	0.18447	0.672000	0.39443	-0.227000	0.09126	-0.067000	0.12976	0.533000	0.62120	TAT		0.443	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
MUC2	4583	broad.mit.edu	37	11	1095318	1095319	+	Frame_Shift_Ins	INS	-	-	C	rs565162399		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:1095318_1095319insC	ENST00000441003.2	+	32	6165_6166	c.6138_6139insC	c.(6139-6141)cccfs	p.P2047fs	MUC2_ENST00000333592.6_3'UTR|MUC2_ENST00000361558.6_Frame_Shift_Ins_p.P185fs	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4409					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.E2049fs*6(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCGGCACCAAGCCCCCCGAGTG	0.683																																					p.K2042fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.6126_6127insC	11						.																																			1085319	SO:0001589	frameshift_variant	4583	exon33			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6144dupC	11.37:g.1095324_1095324dupC	ENSP00000415183:p.Pro2047fs		1085318	NM_002457	Q14878	Frame_Shift_Ins	INS	ENST00000441003.2	37																																																																																					0.683	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
DDI1	414301	broad.mit.edu	37	11	103907872	103907872	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:103907872C>T	ENST00000302259.3	+	1	565	c.322C>T	c.(322-324)Cgt>Tgt	p.R108C	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	108							aspartic-type endopeptidase activity (GO:0004190)	p.R108C(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GTCCAGCTCCCGTCCACAGCA	0.667																																					p.R108C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C322T	11						.						93.0	93.0	93.0					11																	103907872		2202	4299	6501	103413082	SO:0001583	missense	414301	exon1				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.322C>T	11.37:g.103907872C>T	ENSP00000302805:p.Arg108Cys		103413082	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089316	0.55968	.	.	ENSG00000170967	ENST00000302259	T	0.25414	1.8	5.02	3.16	0.36331	.	0.791492	0.11533	N	0.554491	T	0.24812	0.0602	M	0.65975	2.015	0.19945	N	0.999942	B	0.22541	0.071	B	0.10450	0.005	T	0.24799	-1.0150	10	0.59425	D	0.04	-9.7142	4.3768	0.11274	0.1797:0.6379:0.0:0.1823	.	108	Q8WTU0	DDI1_HUMAN	C	108	ENSP00000302805:R108C	ENSP00000302805:R108C	R	+	1	0	DDI1	103413082	0.235000	0.23794	0.176000	0.23000	0.012000	0.07955	1.250000	0.32850	1.502000	0.48669	-0.126000	0.14955	CGT		0.667	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
ROBO4	54538	broad.mit.edu	37	11	124764107	124764107	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:124764107G>A	ENST00000306534.3	-	8	1793	c.1308C>T	c.(1306-1308)tgC>tgT	p.C436C	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Silent_p.C291C	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	436	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.C436C(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CTAAAAGGAGGCAGACAGGTC	0.617																																					p.C436C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1308T	11						.						71.0	62.0	65.0					11																	124764107		2201	4299	6500	124269317	SO:0001819	synonymous_variant	54538	exon8			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1308C>T	11.37:g.124764107G>A			124269317	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	CCDS8455.1																																																																																				0.617	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
SRPR	6734	broad.mit.edu	37	11	126134283	126134283	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:126134283G>A	ENST00000332118.6	-	12	1831	c.1677C>T	c.(1675-1677)gcC>gcT	p.A559A	SRPR_ENST00000532259.1_Silent_p.A531A	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	559					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.A559A(1)		endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		GCTGGTCCACGGCTTCATTGC	0.468																																					p.A531A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1593T	11						.						107.0	92.0	97.0					11																	126134283		2201	4299	6500	125639493	SO:0001819	synonymous_variant	6734	exon11			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1677C>T	11.37:g.126134283G>A			125639493	NM_001177842	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Silent	SNP	ENST00000332118.6	37	CCDS31717.1																																																																																				0.468	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386425.2	NM_003139	
OR51M1	390059	broad.mit.edu	37	11	5410837	5410837	+	Missense_Mutation	SNP	C	C	A	rs367569910		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:5410837C>A	ENST00000328611.3	+	1	231	c.209C>A	c.(208-210)cCc>cAc	p.P70H	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	70					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P70H(1)		NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGCACACACCCATGTACTAT	0.468																																					p.P70H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C209A	11						.						155.0	146.0	148.0					11																	5410837		2048	4190	6238	5367413	SO:0001583	missense	390059	exon1			BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.209C>A	11.37:g.5410837C>A	ENSP00000333196:p.Pro70His		5367413	NM_001004756	Q6IF80	Missense_Mutation	SNP	ENST00000328611.3	37	CCDS53596.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759856	0.49468	.	.	ENSG00000184698	ENST00000328611	T	0.02050	4.48	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33895	U	0.004450	T	0.27697	0.0681	H	0.99464	4.58	0.40730	D	0.982738	D	0.89917	1.0	D	0.73380	0.98	T	0.58301	-0.7660	10	0.87932	D	0	.	17.0415	0.86490	0.0:1.0:0.0:0.0	.	59	Q9H341	O51M1_HUMAN	H	70	ENSP00000333196:P70H	ENSP00000333196:P70H	P	+	2	0	OR51M1	5367413	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	7.073000	0.76784	2.599000	0.87857	0.650000	0.86243	CCC		0.468	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756	
SOX6	55553	broad.mit.edu	37	11	16071467	16071467	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:16071467C>A	ENST00000352083.6	-	11	1346	c.1269G>T	c.(1267-1269)caG>caT	p.Q423H	SOX6_ENST00000396356.3_Missense_Mutation_p.Q423H|SOX6_ENST00000527619.1_Missense_Mutation_p.Q385H|SOX6_ENST00000528429.1_Missense_Mutation_p.Q423H|SOX6_ENST00000316399.6_Missense_Mutation_p.Q423H|SOX6_ENST00000528252.1_Missense_Mutation_p.Q382H			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	423					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q423H(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GATTCAGAGGCTGTGCTGCTG	0.443																																					p.Q423H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1269T	11						.						180.0	188.0	185.0					11																	16071467		2200	4294	6494	16028043	SO:0001583	missense	55553	exon11			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1269G>T	11.37:g.16071467C>A	ENSP00000339876:p.Gln423His		16028043	NM_033326	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		.	.	.	.	.	.	.	.	.	.	C	18.28	3.589939	0.66105	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98792	-4.87;-4.92;-4.87;-5.14;-5.14;-4.92	6.01	5.1	0.69264	.	0.112950	0.64402	D	0.000004	D	0.98833	0.9606	M	0.71036	2.16	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.994	D;D;P	0.66847	0.943;0.947;0.904	D	0.99572	1.0971	10	0.62326	D	0.03	.	15.013	0.71562	0.0:0.9322:0.0:0.0678	.	423;423;385	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	H	423;423;423;382;385;423	ENSP00000324948:Q423H;ENSP00000339876:Q423H;ENSP00000379644:Q423H;ENSP00000432134:Q382H;ENSP00000434455:Q385H;ENSP00000433233:Q423H	ENSP00000324948:Q423H	Q	-	3	2	SOX6	16028043	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.733000	0.68571	1.550000	0.49438	0.650000	0.86243	CAG		0.443	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
SLC5A12	159963	broad.mit.edu	37	11	26725175	26725175	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:26725175T>G	ENST00000396005.3	-	6	1033	c.724A>C	c.(724-726)Aca>Cca	p.T242P	SLC5A12_ENST00000280467.6_Missense_Mutation_p.T242P	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	242					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.T242P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CCTCCCACTGTGATAGTCCAA	0.403																																					p.T242P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A724C	11						.						129.0	123.0	125.0					11																	26725175		2203	4299	6502	26681751	SO:0001583	missense	159963	exon6			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.724A>C	11.37:g.26725175T>G	ENSP00000379326:p.Thr242Pro		26681751	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629479	0.46944	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.88354	-2.37;-2.37;-2.37	5.51	-10.8	0.00216	.	0.845750	0.10342	N	0.686196	D	0.83857	0.5345	L	0.60067	1.865	0.09310	N	1	B;B	0.27013	0.021;0.166	B;B	0.37480	0.139;0.251	T	0.73525	-0.3955	10	0.56958	D	0.05	.	8.0958	0.30826	0.2757:0.4548:0.0:0.2694	.	242;242	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	P	242;242;54	ENSP00000379326:T242P;ENSP00000280467:T242P;ENSP00000435053:T54P	ENSP00000280467:T242P	T	-	1	0	SLC5A12	26681751	0.000000	0.05858	0.049000	0.19019	0.906000	0.53458	-0.856000	0.04290	-1.049000	0.03234	-0.672000	0.03802	ACA		0.403	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
CHST1	8534	broad.mit.edu	37	11	45672137	45672137	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:45672137G>T	ENST00000308064.2	-	4	1007	c.337C>A	c.(337-339)Cgg>Agg	p.R113R	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	113					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)	p.R113R(1)|p.R113W(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		ATGACCCGCCGGTCGGCCGGG	0.637																																					p.R113R												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C337A	11						.						34.0	45.0	41.0					11																	45672137		2199	4295	6494	45628713	SO:0001819	synonymous_variant	8534	exon4			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.337C>A	11.37:g.45672137G>T			45628713	NM_003654	D3DQP2	Silent	SNP	ENST00000308064.2	37	CCDS7913.1																																																																																				0.637	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654	
OR5D16	390144	broad.mit.edu	37	11	55606992	55606992	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:55606992C>T	ENST00000378396.1	+	1	765	c.765C>T	c.(763-765)ggC>ggT	p.G255G		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G255G(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TCTTCCATGGCACCATCCTCT	0.522																																					p.G255G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C765T	11						.						124.0	110.0	115.0					11																	55606992		2201	4296	6497	55363568	SO:0001819	synonymous_variant	390144	exon1			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.765C>T	11.37:g.55606992C>T			55363568	NM_001005496	Q6IF65|Q96RB4	Silent	SNP	ENST00000378396.1	37	CCDS31512.1																																																																																				0.522	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
OR5W2	390148	broad.mit.edu	37	11	55681819	55681819	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:55681819C>A	ENST00000344514.1	-	1	239	c.240G>T	c.(238-240)aaG>aaT	p.K80N		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K80N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTACCAGCATCTTGGGCCCAG	0.418																																					p.K80N	Melanoma(48;171 1190 15239 43886 49348)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G240T	11						.						135.0	128.0	130.0					11																	55681819		2201	4296	6497	55438395	SO:0001583	missense	390148	exon1			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.240G>T	11.37:g.55681819C>A	ENSP00000342448:p.Lys80Asn		55438395	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036957	0.35893	.	.	ENSG00000187612	ENST00000344514	T	0.01359	4.98	5.01	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.166280	0.28425	N	0.015386	T	0.04634	0.0126	M	0.67517	2.055	0.29155	N	0.878123	D	0.54397	0.966	D	0.63192	0.912	T	0.13980	-1.0489	10	0.52906	T	0.07	.	4.6888	0.12771	0.1721:0.6443:0.0:0.1836	.	80	Q8NH69	OR5W2_HUMAN	N	80	ENSP00000342448:K80N	ENSP00000342448:K80N	K	-	3	2	OR5W2	55438395	0.000000	0.05858	0.968000	0.41197	0.380000	0.30137	-2.327000	0.01113	0.513000	0.28278	0.549000	0.68633	AAG		0.418	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
GANAB	23193	broad.mit.edu	37	11	62396762	62396762	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:62396762C>T	ENST00000356638.3	-	16	1856	c.1840G>A	c.(1840-1842)Gtg>Atg	p.V614M	GANAB_ENST00000534779.1_Missense_Mutation_p.V522M|GANAB_ENST00000540933.1_Missense_Mutation_p.V517M|GANAB_ENST00000346178.4_Missense_Mutation_p.V636M	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	614					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.V614M(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CCTGTCCACACGGCTCCTGAG	0.542																																					p.V636M	Melanoma(23;1005 1074 15747 18937)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1906A	11						.						81.0	74.0	76.0					11																	62396762		2202	4299	6501	62153338	SO:0001583	missense	23193	exon17			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1840G>A	11.37:g.62396762C>T	ENSP00000349053:p.Val614Met		62153338	NM_198335	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029505	0.54790	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84	5.19	5.19	0.71726	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89938	0.6860	L	0.45285	1.41	0.80722	D	1	P;P;P;B	0.48834	0.916;0.797;0.466;0.233	P;P;B;B	0.50440	0.641;0.641;0.311;0.095	D	0.87494	0.2429	10	0.24483	T	0.36	-23.2845	16.2584	0.82528	0.0:1.0:0.0:0.0	.	500;522;614;636	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	M	636;614;522;517	ENSP00000340466:V636M;ENSP00000349053:V614M;ENSP00000435306:V522M;ENSP00000442962:V517M	ENSP00000340466:V636M	V	-	1	0	GANAB	62153338	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	5.888000	0.69758	2.711000	0.92665	0.655000	0.94253	GTG		0.542	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
PPFIA1	8500	broad.mit.edu	37	11	70172859	70172859	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:70172859A>T	ENST00000253925.7	+	7	1080	c.865A>T	c.(865-867)Acg>Tcg	p.T289S	PPFIA1_ENST00000389547.3_Missense_Mutation_p.T289S|CTA-797E19.2_ENST00000526017.1_RNA|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	289					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.T289S(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GGATCTGGACACGGCTAGAAA	0.418																																					p.T289S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A865T	11						.						144.0	146.0	145.0					11																	70172859		2200	4294	6494	69850507	SO:0001583	missense	8500	exon7			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.865A>T	11.37:g.70172859A>T	ENSP00000253925:p.Thr289Ser		69850507	NM_003626	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.883914	0.33255	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	T;T	0.74106	-0.81;-0.81	4.68	3.53	0.40419	.	0.136926	0.47455	U	0.000235	T	0.76300	0.3968	M	0.82323	2.585	0.45390	D	0.998378	B;B	0.31125	0.225;0.309	B;B	0.35859	0.212;0.142	T	0.74535	-0.3633	10	0.49607	T	0.09	.	10.942	0.47278	0.8428:0.1572:0.0:0.0	.	289;289	Q13136;Q13136-2	LIPA1_HUMAN;.	S	289	ENSP00000253925:T289S;ENSP00000374198:T289S	ENSP00000253925:T289S	T	+	1	0	PPFIA1	69850507	1.000000	0.71417	0.175000	0.22980	0.033000	0.12548	9.122000	0.94380	0.737000	0.32582	0.533000	0.62120	ACG		0.418	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
MOGAT2	80168	broad.mit.edu	37	11	75439155	75439155	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:75439155C>T	ENST00000198801.5	+	4	686	c.616C>T	c.(616-618)Cga>Tga	p.R206*	MOGAT2_ENST00000526712.1_Nonsense_Mutation_p.R124*	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	206					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.R206*(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					ACTGCGGAACCGAAAGGGCTT	0.572																																					p.R206X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C616T	11						.						47.0	41.0	43.0					11																	75439155		2200	4293	6493	75116803	SO:0001587	stop_gained	80168	exon4			AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.616C>T	11.37:g.75439155C>T	ENSP00000198801:p.Arg206*		75116803	NM_025098	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Nonsense_Mutation	SNP	ENST00000198801.5	37	CCDS8240.1	.	.	.	.	.	.	.	.	.	.	C	44	10.592299	0.99433	.	.	ENSG00000166391	ENST00000198801;ENST00000526712	.	.	.	5.93	5.02	0.67125	.	0.229211	0.45606	D	0.000345	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.961	7.7951	0.29143	0.2457:0.6773:0.0:0.077	.	.	.	.	X	206;124	.	ENSP00000198801:R206X	R	+	1	2	MOGAT2	75116803	0.999000	0.42202	0.925000	0.36789	0.784000	0.44337	3.798000	0.55522	1.517000	0.48917	0.561000	0.74099	CGA		0.572	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098	
MOGAT2	80168	broad.mit.edu	37	11	75442241	75442241	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:75442241C>T	ENST00000198801.5	+	6	985	c.915C>T	c.(913-915)caC>caT	p.H305H	MOGAT2_ENST00000526712.1_Silent_p.H223H	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	305					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.H305H(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					ACCAGCTGCACCAGCGTTATA	0.557																																					p.H305H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C915T	11						.						119.0	102.0	108.0					11																	75442241		2200	4293	6493	75119889	SO:0001819	synonymous_variant	80168	exon6			AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.915C>T	11.37:g.75442241C>T			75119889	NM_025098	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Silent	SNP	ENST00000198801.5	37	CCDS8240.1																																																																																				0.557	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098	
CCDC81	60494	broad.mit.edu	37	11	86123451	86123451	+	Missense_Mutation	SNP	G	G	A	rs138592676		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:86123451G>A	ENST00000445632.2	+	11	1513	c.1241G>A	c.(1240-1242)cGg>cAg	p.R414Q	CCDC81_ENST00000528728.1_Missense_Mutation_p.R149Q|CCDC81_ENST00000354755.1_Missense_Mutation_p.R324Q|CCDC81_ENST00000278487.3_Missense_Mutation_p.R149Q	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	414								p.R324Q(1)		kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				TTTGACAAACGGCCACTCAGT	0.363													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20419	0.0		0.0	False		,,,				2504	0.0				p.R324Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G971A	11						.	G	GLN/ARG,GLN/ARG	1,4403		0,1,2201	111.0	111.0	111.0		1241,971	5.5	1.0	11	dbSNP_134	111	1,8597	1.2+/-3.3	0,1,4298	yes	missense,missense	CCDC81	NM_001156474.1,NM_021827.4	43,43	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	414/653,324/563	86123451	2,13000	2202	4299	6501	85801099	SO:0001583	missense	60494	exon10			AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1241G>A	11.37:g.86123451G>A	ENSP00000415528:p.Arg414Gln		85801099	NM_021827	A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	29.1	4.973130	0.92919	2.27E-4	1.16E-4	ENSG00000149201	ENST00000354755;ENST00000278487;ENST00000445632;ENST00000528728	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000002	T	0.66963	0.2843	M	0.78801	2.425	0.39964	D	0.974703	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.69091	-0.5237	9	.	.	.	-16.9234	18.2109	0.89869	0.0:0.0:1.0:0.0	.	149;414;324	Q6ZN84-3;Q6ZN84;Q6ZN84-2	.;CCD81_HUMAN;.	Q	324;149;414;149	ENSP00000346800:R324Q;ENSP00000278487:R149Q;ENSP00000415528:R414Q;ENSP00000437165:R149Q	.	R	+	2	0	CCDC81	85801099	1.000000	0.71417	0.998000	0.56505	0.831000	0.47069	5.671000	0.68095	2.581000	0.87130	0.655000	0.94253	CGG		0.363	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
ANGPTL5	253935	broad.mit.edu	37	11	101762304	101762304	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:101762304delT	ENST00000334289.3	-	9	1468	c.873delA	c.(871-873)aaafs	p.K291fs		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	291	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)		p.E292fs*30(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		GATTATCTTCTTTTTTGAGAC	0.363																																					p.K291fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.873delA	11						.						91.0	79.0	83.0					11																	101762304		2203	4299	6502	101267514	SO:0001589	frameshift_variant	253935	exon9			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.873delA	11.37:g.101762304delT	ENSP00000335255:p.Lys291fs		101267514	NM_178127	A8K658|Q86VR9	Frame_Shift_Del	DEL	ENST00000334289.3	37	CCDS8312.1																																																																																				0.363	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394138.1	NM_178127	
PRDM10	56980	broad.mit.edu	37	11	129784891	129784891	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr11:129784891C>T	ENST00000360871.3	-	17	2780	c.2549G>A	c.(2548-2550)cGa>cAa	p.R850Q	PRDM10_ENST00000528746.1_Missense_Mutation_p.R824Q|PRDM10_ENST00000304538.6_Missense_Mutation_p.R764Q|PRDM10_ENST00000526082.1_Missense_Mutation_p.R768Q|PRDM10_ENST00000423662.2_Missense_Mutation_p.R768Q|PRDM10_ENST00000358825.5_Missense_Mutation_p.R854Q	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	854					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R850Q(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		ATGCTTCTTTCGAATGTGCTG	0.438																																					p.R854Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2561A	11						.						102.0	102.0	102.0					11																	129784891		2201	4297	6498	129290101	SO:0001583	missense	56980	exon18			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2549G>A	11.37:g.129784891C>T	ENSP00000354118:p.Arg850Gln		129290101	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	C	35	5.533430	0.96460	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.83557	0.5280	L	0.29908	0.895	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999;1.0;0.999	D;D;D;D;D;D;D	0.87578	0.994;0.998;0.99;0.994;0.99;0.996;0.99	D	0.84986	0.0891	10	0.87932	D	0	-13.8327	19.9664	0.97271	0.0:1.0:0.0:0.0	.	764;824;850;854;768;764;768	B7ZL72;E9PLV1;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	Q	854;764;850;768;824;768;567	ENSP00000351686:R854Q;ENSP00000302669:R764Q;ENSP00000354118:R850Q;ENSP00000398431:R768Q;ENSP00000431262:R824Q;ENSP00000432237:R768Q;ENSP00000435940:R567Q	ENSP00000302669:R764Q	R	-	2	0	PRDM10	129290101	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.188000	0.77739	2.718000	0.92993	0.655000	0.94253	CGA		0.438	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
ANO4	121601	broad.mit.edu	37	12	101477501	101477501	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:101477501C>T	ENST00000392977.3	+	16	1651	c.1441C>T	c.(1441-1443)Cgg>Tgg	p.R481W	ANO4_ENST00000392979.3_Missense_Mutation_p.R446W|ANO4_ENST00000550015.1_Intron|ANO4_ENST00000299222.9_Intron			Q32M45	ANO4_HUMAN	anoctamin 4	481					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R446W(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CAAGAAAGAGCGGATGAATCC	0.378										HNSCC(74;0.22)																											p.R446W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1336T	12						.						103.0	106.0	105.0					12																	101477501		2203	4300	6503	100001632	SO:0001583	missense	121601	exon15			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1441C>T	12.37:g.101477501C>T	ENSP00000376703:p.Arg481Trp		100001632	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	C	19.25	3.791662	0.70452	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.66995	-0.24;-0.24	5.78	2.85	0.33270	.	0.000000	0.64402	D	0.000001	T	0.80919	0.4716	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.971	T	0.82802	-0.0277	10	0.72032	D	0.01	.	15.2369	0.73438	0.4815:0.5185:0.0:0.0	.	481;446	Q32M45;Q32M45-2	ANO4_HUMAN;.	W	446;481	ENSP00000376705:R446W;ENSP00000376703:R481W	ENSP00000376703:R481W	R	+	1	2	ANO4	100001632	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	1.817000	0.39002	0.403000	0.25479	0.655000	0.94253	CGG		0.378	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
KIAA1033	23325	broad.mit.edu	37	12	105531721	105531721	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:105531721A>G	ENST00000332180.5	+	15	1471	c.1384A>G	c.(1384-1386)Atg>Gtg	p.M462V		NM_015275.1	NP_056090.1			KIAA1033									p.M462V(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GAATCTCTACATGTCCATGCA	0.348																																					p.M462V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1384G	12						.						89.0	84.0	86.0					12																	105531721		1843	4087	5930	104055851	SO:0001583	missense	23325	exon15			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1384A>G	12.37:g.105531721A>G	ENSP00000328062:p.Met462Val		104055851	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	A	8.651	0.898321	0.17686	.	.	ENSG00000136051	ENST00000332180	T	0.25085	1.82	5.63	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.16471	0.0396	L	0.34521	1.04	0.58432	D	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.06303	-1.0834	10	0.02654	T	1	.	11.9489	0.52944	0.932:0.0:0.068:0.0	.	463;462	B7ZKT9;Q2M389	.;WASH7_HUMAN	V	462	ENSP00000328062:M462V	ENSP00000328062:M462V	M	+	1	0	KIAA1033	104055851	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	4.525000	0.60559	1.068000	0.40764	-0.254000	0.11334	ATG		0.348	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
POLR3B	55703	broad.mit.edu	37	12	106890685	106890685	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:106890685C>T	ENST00000228347.4	+	25	3195	c.2973C>T	c.(2971-2973)tcC>tcT	p.S991S	POLR3B_ENST00000539066.1_Silent_p.S933S|RP11-144F15.1_ENST00000551505.1_Intron	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	991					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.S991S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						ATGTTACATCCGGCATCACAG	0.428																																					p.S991S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2973T	12						.						177.0	144.0	155.0					12																	106890685		2203	4300	6503	105414815	SO:0001819	synonymous_variant	55703	exon25			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.2973C>T	12.37:g.106890685C>T			105414815	NM_018082	A8K6H0|B3KV73|F5H1E6|Q9NW59	Silent	SNP	ENST00000228347.4	37	CCDS9105.1																																																																																				0.428	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
ANKRD13A	88455	broad.mit.edu	37	12	110475213	110475213	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:110475213G>A	ENST00000261739.4	+	15	1793	c.1627G>A	c.(1627-1629)Gcc>Acc	p.A543T	C12orf76_ENST00000546651.2_Intron	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	543						endosome (GO:0005768)|plasma membrane (GO:0005886)		p.A543T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						GTGCCCCAGCGCCCTGAGCGA	0.552																																					p.A543T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1627A	12						.						70.0	77.0	75.0					12																	110475213		2203	4300	6503	108959596	SO:0001583	missense	88455	exon15			AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.1627G>A	12.37:g.110475213G>A	ENSP00000261739:p.Ala543Thr		108959596	NM_033121	O60736	Missense_Mutation	SNP	ENST00000261739.4	37	CCDS9140.1	.	.	.	.	.	.	.	.	.	.	G	7.476	0.647577	0.14516	.	.	ENSG00000076513	ENST00000261738;ENST00000261739;ENST00000553251;ENST00000551491	T	0.56444	0.46	5.88	0.0829	0.14431	.	1.062880	0.07143	N	0.847668	T	0.35422	0.0931	N	0.22421	0.69	0.09310	N	1	B;B;B	0.11235	0.0;0.004;0.002	B;B;B	0.04013	0.001;0.001;0.001	T	0.23868	-1.0176	10	0.39692	T	0.17	-16.0378	5.3939	0.16259	0.4371:0.2385:0.3244:0.0	.	542;289;543	B4DYP5;E9PGV0;Q8IZ07	.;.;AN13A_HUMAN	T	289;543;181;70	ENSP00000261739:A543T	ENSP00000261738:A289T	A	+	1	0	ANKRD13A	108959596	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.052000	0.11865	0.018000	0.15052	0.655000	0.94253	GCC		0.552	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
HECTD4	283450	broad.mit.edu	37	12	112668612	112668612	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:112668612C>T	ENST00000430131.2	-	39	6094	c.4949G>A	c.(4948-4950)cGt>cAt	p.R1650H	HECTD4_ENST00000550722.1_Missense_Mutation_p.R1926H|HECTD4_ENST00000377560.5_Missense_Mutation_p.R1900H			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1650					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R1900H(1)									GATGAAGGGACGCACAGGATC	0.498																																					p.R1900H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5699A	12						.						85.0	77.0	79.0					12																	112668612		2065	4229	6294	111152995	SO:0001583	missense	283450	exon39			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4949G>A	12.37:g.112668612C>T	ENSP00000404379:p.Arg1650His		111152995	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	21.7	4.188667	0.78789	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.62105	0.05;0.07;0.05	5.5	5.5	0.81552	.	.	.	.	.	T	0.69070	0.3070	N	0.19112	0.55	0.51482	D	0.999928	D	0.71674	0.998	D	0.72075	0.976	T	0.73836	-0.3857	9	0.87932	D	0	.	19.4102	0.94670	0.0:1.0:0.0:0.0	.	1650	Q9Y4D8	K0614_HUMAN	H	1900;1650;1926	ENSP00000366783:R1900H;ENSP00000404379:R1650H;ENSP00000449784:R1926H	ENSP00000366783:R1900H	R	-	2	0	C12orf51	111152995	0.995000	0.38212	0.946000	0.38457	0.167000	0.22549	7.461000	0.80834	2.599000	0.87857	0.655000	0.94253	CGT		0.498	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
C3AR1	719	broad.mit.edu	37	12	8211768	8211768	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:8211768G>A	ENST00000307637.4	-	2	1217	c.1014C>T	c.(1012-1014)atC>atT	p.I338I		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	338					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.I338I(1)		breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		CTAGCCTAGTGATCGTTATTG	0.488																																					p.I338I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1014T	12						.						149.0	138.0	142.0					12																	8211768		2203	4300	6503	8103035	SO:0001819	synonymous_variant	719	exon2			U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.1014C>T	12.37:g.8211768G>A			8103035	NM_004054	O43771|Q92868	Silent	SNP	ENST00000307637.4	37	CCDS8588.1																																																																																				0.488	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1		
TM7SF3	51768	broad.mit.edu	37	12	27127011	27127011	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:27127011G>T	ENST00000343028.4	-	12	1825	c.1600C>A	c.(1600-1602)Cct>Act	p.P534T	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	534						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P534T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					TGGTAGCTAGGGTCCAGAATG	0.522																																					p.P534T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1600A	12						.						136.0	125.0	129.0					12																	27127011		2203	4300	6503	27018278	SO:0001583	missense	51768	exon12			AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1600C>A	12.37:g.27127011G>T	ENSP00000342322:p.Pro534Thr		27018278	NM_016551	B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	37	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632744	0.87660	.	.	ENSG00000064115	ENST00000343028	T	0.41400	1.0	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.51432	0.1674	L	0.34521	1.04	0.80722	D	1	D	0.62365	0.991	P	0.57101	0.813	T	0.50676	-0.8800	10	0.62326	D	0.03	-21.9379	19.9662	0.97271	0.0:0.0:1.0:0.0	.	534	Q9NS93	TM7S3_HUMAN	T	534	ENSP00000342322:P534T	ENSP00000342322:P534T	P	-	1	0	TM7SF3	27018278	1.000000	0.71417	0.995000	0.50966	0.895000	0.52256	9.417000	0.97391	2.793000	0.96121	0.655000	0.94253	CCT		0.522	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551	
REP15	387849	broad.mit.edu	37	12	27850071	27850071	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:27850071G>A	ENST00000310791.2	+	1	644	c.576G>A	c.(574-576)ctG>ctA	p.L192L	RP11-1060J15.4_ENST00000536922.1_RNA|RP11-1060J15.4_ENST00000536317.1_RNA|RP11-1060J15.4_ENST00000542660.1_RNA	NM_001029874.1	NP_001025045.1	Q6BDI9	REP15_HUMAN	RAB15 effector protein	192					receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	endosome membrane (GO:0010008)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)		p.L192L(1)		breast(1)|cervix(1)|large_intestine(2)|lung(4)|ovary(1)	9	Lung SC(9;0.0873)					GGAGCCATCTGCCAGGAGGGA	0.488																																					p.L192L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A	12						.						75.0	75.0	75.0					12																	27850071		2203	4300	6503	27741338	SO:0001819	synonymous_variant	387849	exon1			BC140921	CCDS31762.1	12p11.22	2010-09-02			ENSG00000174236	ENSG00000174236			33748	protein-coding gene	gene with protein product		610848				16195351	Standard	NM_001029874		Approved	RAB15EP	uc001rig.1	Q6BDI9		ENST00000310791.2:c.576G>A	12.37:g.27850071G>A			27741338	NM_001029874	B2RU16	Silent	SNP	ENST00000310791.2	37	CCDS31762.1																																																																																				0.488	REP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402894.1	NM_001029874	
LRRK2	120892	broad.mit.edu	37	12	40689418	40689418	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:40689418T>C	ENST00000298910.7	+	23	3126	c.3068T>C	c.(3067-3069)cTc>cCc	p.L1023P	LRRK2_ENST00000343742.2_Missense_Mutation_p.L1023P	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1023					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.L1023P(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CAGAATGCACTCACGAGCTTT	0.348																																					p.L1023P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3068C	12						.						64.0	59.0	61.0					12																	40689418		2203	4300	6503	38975685	SO:0001583	missense	120892	exon23			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3068T>C	12.37:g.40689418T>C	ENSP00000298910:p.Leu1023Pro		38975685	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808400	0.70797	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.69435	-0.4;-0.4	5.71	5.71	0.89125	.	0.068583	0.64402	D	0.000015	D	0.88047	0.6332	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92033	0.5635	10	0.87932	D	0	.	15.9657	0.79968	0.0:0.0:0.0:1.0	.	1023;1023	E9PC85;Q5S007	.;LRRK2_HUMAN	P	1023	ENSP00000341930:L1023P;ENSP00000298910:L1023P	ENSP00000298910:L1023P	L	+	2	0	LRRK2	38975685	0.987000	0.35691	0.197000	0.23402	0.986000	0.74619	5.739000	0.68622	2.175000	0.68902	0.482000	0.46254	CTC		0.348	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
SCAF11	9169	broad.mit.edu	37	12	46322511	46322511	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:46322511G>A	ENST00000369367.3	-	11	1206	c.973C>T	c.(973-975)Cgt>Tgt	p.R325C	SCAF11_ENST00000419565.2_Missense_Mutation_p.R325C|SCAF11_ENST00000549162.1_Missense_Mutation_p.R133C|SCAF11_ENST00000465950.1_Missense_Mutation_p.R10C	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	325					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R325C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						CTTGTGTTACGTGTAGACCTC	0.438																																					p.R325C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C973T	12						.						188.0	183.0	184.0					12																	46322511		2203	4300	6503	44608778	SO:0001583	missense	9169	exon11			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.973C>T	12.37:g.46322511G>A	ENSP00000358374:p.Arg325Cys		44608778	NM_004719	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261189	0.80246	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.60299	0.45;1.63;0.88;1.63;0.2	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000002	T	0.67192	0.2867	L	0.34521	1.04	0.48696	D	0.999699	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.68815	-0.5309	10	0.87932	D	0	-14.9068	15.0768	0.72082	0.0:0.0:0.8582:0.1418	.	133;325	F8VXG7;Q99590	.;SCAFB_HUMAN	C	10;325;133;325;265	ENSP00000449812:R10C;ENSP00000358374:R325C;ENSP00000448864:R133C;ENSP00000413036:R325C;ENSP00000446746:R265C	ENSP00000358374:R325C	R	-	1	0	SCAF11	44608778	1.000000	0.71417	0.958000	0.39756	0.943000	0.58893	4.253000	0.58791	2.814000	0.96858	0.585000	0.79938	CGT		0.438	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
ENDOU	8909	broad.mit.edu	37	12	48104653	48104653	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:48104653A>G	ENST00000422538.3	-	10	1287	c.1165T>C	c.(1165-1167)Tgg>Cgg	p.W389R	RP1-197B17.3_ENST00000547799.1_lincRNA|ENDOU_ENST00000545824.2_Missense_Mutation_p.W326R|ENDOU_ENST00000542202.1_Missense_Mutation_p.L107P|ENDOU_ENST00000229003.3_Missense_Mutation_p.W348R	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	389					female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)	p.W348R(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						GACTTGTCCCAGGTATATGTC	0.537																																					p.W389R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1165C	12						.						189.0	153.0	165.0					12																	48104653		2203	4300	6503	46390920	SO:0001583	missense	8909	exon10			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.1165T>C	12.37:g.48104653A>G	ENSP00000397679:p.Trp389Arg		46390920	NM_001172439	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Missense_Mutation	SNP	ENST00000422538.3	37	CCDS53785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.64|17.64	3.439488|3.439488	0.63067|0.63067	.|.	.|.	ENSG00000111405|ENSG00000111405	ENST00000542202|ENST00000229003;ENST00000422538;ENST00000545824	.|T;T	.|0.32272	.|1.46;1.48	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57154|0.57154	0.2034|0.2034	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	D|D;D;D	0.64830|0.89917	0.994|1.0;0.993;1.0	D|D;D;D	0.66847|0.97110	0.947|1.0;0.972;1.0	T|T	0.59434|0.59434	-0.7455|-0.7455	8|10	0.72032|0.52906	D|T	0.01|0.07	-17.8757|-17.8757	14.5614|14.5614	0.68140|0.68140	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	107|326;389;348	B7Z7N4|P21128-3;P21128;P21128-2	.|.;ENDOU_HUMAN;.	P|R	107|348;389;326	.|ENSP00000229003:W348R;ENSP00000397679:W389R	ENSP00000437756:L107P|ENSP00000229003:W348R	L|W	-|-	2|1	0|0	ENDOU|ENDOU	46390920|46390920	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.303000|0.303000	0.27691|0.27691	8.393000|8.393000	0.90182|0.90182	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	CTG|TGG		0.537	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000405352.1	NM_006025.2	
HDAC7	51564	broad.mit.edu	37	12	48181929	48181929	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:48181929C>T	ENST00000427332.2	-	20	2293	c.2137G>A	c.(2137-2139)Ggc>Agc	p.G713S	HDAC7_ENST00000552960.1_Missense_Mutation_p.G735S|HDAC7_ENST00000488927.1_5'Flank|HDAC7_ENST00000380610.4_Missense_Mutation_p.G769S|HDAC7_ENST00000080059.7_Missense_Mutation_p.G752S|HDAC7_ENST00000354334.3_Missense_Mutation_p.G715S			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	713	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.G713S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		TGCTGGGTGCCGTTGCCATGG	0.592																																					p.G715S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2143A	12						.						286.0	212.0	237.0					12																	48181929		2203	4300	6503	46468196	SO:0001583	missense	51564	exon19			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2137G>A	12.37:g.48181929C>T	ENSP00000404394:p.Gly713Ser		46468196	NM_001098416	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37		.	.	.	.	.	.	.	.	.	.	C	33	5.241512	0.95272	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61	4.76	4.76	0.60689	.	0.053032	0.85682	D	0.000000	D	0.97081	0.9046	H	0.99261	4.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.995	D	0.98991	1.0808	10	0.87932	D	0	.	16.8039	0.85621	0.0:1.0:0.0:0.0	.	752;735;715	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	S	752;715;735;769;713	ENSP00000080059:G752S;ENSP00000351326:G715S;ENSP00000448532:G735S;ENSP00000369984:G769S;ENSP00000404394:G713S	ENSP00000080059:G752S	G	-	1	0	HDAC7	46468196	1.000000	0.71417	0.983000	0.44433	0.978000	0.69477	5.992000	0.70609	2.380000	0.81148	0.555000	0.69702	GGC		0.592	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
CCNT1	904	broad.mit.edu	37	12	49088182	49088182	+	Missense_Mutation	SNP	C	C	T	rs575488596		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:49088182C>T	ENST00000261900.3	-	9	1037	c.815G>A	c.(814-816)cGa>cAa	p.R272Q		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	272					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.R272Q(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						ATCTGTTCCTCGGTCATCTGC	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22194	0.0		0.0	False		,,,				2504	0.0				p.R272Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G815A	12						.						154.0	139.0	144.0					12																	49088182		2203	4300	6503	47374449	SO:0001583	missense	904	exon9			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.815G>A	12.37:g.49088182C>T	ENSP00000261900:p.Arg272Gln		47374449	NM_001240	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	C	0.871	-0.731986	0.03135	.	.	ENSG00000129315	ENST00000261900	T	0.15834	2.39	5.33	4.42	0.53409	.	0.520875	0.20042	N	0.100496	T	0.04588	0.0125	N	0.01705	-0.755	0.29661	N	0.843257	B	0.11235	0.004	B	0.10450	0.005	T	0.39099	-0.9630	10	0.05620	T	0.96	-5.9235	5.0424	0.14465	0.0:0.5726:0.2376:0.1899	.	272	O60563	CCNT1_HUMAN	Q	272	ENSP00000261900:R272Q	ENSP00000261900:R272Q	R	-	2	0	CCNT1	47374449	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.244000	0.43124	2.504000	0.84457	0.491000	0.48974	CGA		0.393	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
CCDC65	85478	broad.mit.edu	37	12	49310877	49310877	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:49310877G>T	ENST00000320516.4	+	4	783	c.595G>T	c.(595-597)Gat>Tat	p.D199Y	CCDC65_ENST00000266984.5_Missense_Mutation_p.D199Y|RP11-302B13.5_ENST00000398092.4_Intron	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	199								p.D199Y(1)		breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						CATGTGGAATGATCTCAAAAA	0.458																																					p.D199Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G595T	12						.						111.0	97.0	102.0					12																	49310877		2203	4300	6503	47597144	SO:0001583	missense	85478	exon4				CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.595G>T	12.37:g.49310877G>T	ENSP00000312706:p.Asp199Tyr		47597144	NM_033124	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Missense_Mutation	SNP	ENST00000320516.4	37	CCDS8772.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996656	0.74818	.	.	ENSG00000139537	ENST00000266984;ENST00000320516	T;T	0.02498	4.27;4.27	5.32	5.32	0.75619	.	0.353674	0.31809	N	0.007028	T	0.12092	0.0294	L	0.54323	1.7	0.49798	D	0.99982	D	0.71674	0.998	D	0.65443	0.935	T	0.00063	-1.2154	10	0.72032	D	0.01	-24.8086	18.3142	0.90213	0.0:0.0:1.0:0.0	.	199	Q8IXS2	CCD65_HUMAN	Y	199	ENSP00000266984:D199Y;ENSP00000312706:D199Y	ENSP00000266984:D199Y	D	+	1	0	CCDC65	47597144	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.899000	0.75682	2.941000	0.99782	0.655000	0.94253	GAT		0.458	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124	
FAM186B	84070	broad.mit.edu	37	12	49993957	49993957	+	Missense_Mutation	SNP	C	C	T	rs138755693		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:49993957C>T	ENST00000257894.2	-	4	1627	c.1466G>A	c.(1465-1467)cGg>cAg	p.R489Q	FAM186B_ENST00000551047.1_Intron|PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000544141.1_Missense_Mutation_p.R399Q	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	489						protein complex (GO:0043234)		p.R489Q(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CAGCTGCCTCCGCATCTCCCG	0.612																																					p.R489Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1466A	12						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	46.0	48.0	47.0		1466	-4.6	0.0	12	dbSNP_134	47	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM186B	NM_032130.2	43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	489/894	49993957	2,13004	2203	4300	6503	48280224	SO:0001583	missense	84070	exon4			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.1466G>A	12.37:g.49993957C>T	ENSP00000257894:p.Arg489Gln		48280224	NM_032130	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	ENST00000257894.2	37	CCDS8788.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315980	0.40996	2.27E-4	1.16E-4	ENSG00000135436	ENST00000544141;ENST00000532262;ENST00000257894	T;T;T	0.16073	2.37;2.37;2.61	5.04	-4.61	0.03380	.	0.735472	0.11144	N	0.594919	T	0.07007	0.0178	N	0.20401	0.57	0.09310	N	1	B;B	0.23490	0.086;0.086	B;B	0.18263	0.008;0.021	T	0.36212	-0.9757	9	.	.	.	-3.4103	2.9974	0.06003	0.1281:0.2051:0.1263:0.5404	.	399;489	B4DZ15;Q8IYM0	.;F186B_HUMAN	Q	399;102;489	ENSP00000438569:R399Q;ENSP00000436995:R102Q;ENSP00000257894:R489Q	.	R	-	2	0	FAM186B	48280224	0.000000	0.05858	0.017000	0.16124	0.209000	0.24338	-0.251000	0.08818	-0.532000	0.06332	-0.251000	0.11542	CGG		0.612	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394583.2	NM_032130	
TMPRSS12	283471	broad.mit.edu	37	12	51237626	51237626	+	Splice_Site	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:51237626T>G	ENST00000398458.3	+	2	221	c.189T>G	c.(187-189)gaT>gaG	p.D63E	TMPRSS12_ENST00000551456.1_Splice_Site_p.D63E|RN7SL519P_ENST00000497925.2_RNA	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	63						integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.D63E(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						TATTTTTAGATTGTGGAACAG	0.423																																					p.D63E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T189G	12						.						32.0	30.0	31.0					12																	51237626		1875	4073	5948	49523893	SO:0001630	splice_region_variant	283471	exon2			BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.188-1T>G	12.37:g.51237626T>G			49523893	NM_182559	B9ZVX2	Missense_Mutation	SNP	ENST00000398458.3	37	CCDS44881.1	.	.	.	.	.	.	.	.	.	.	T	8.210	0.800218	0.16397	.	.	ENSG00000186452	ENST00000551456;ENST00000398458	D;D	0.88046	-2.33;-2.33	5.7	1.79	0.24919	.	1.902360	0.02745	N	0.116694	T	0.71178	0.3309	N	0.08118	0	0.27308	N	0.957392	B;B	0.23990	0.095;0.005	B;B	0.18561	0.022;0.009	T	0.64305	-0.6439	10	0.06891	T	0.86	.	4.382	0.11299	0.1442:0.1636:0.0:0.6922	.	63;63	F8WBX2;Q86WS5	.;TMPSC_HUMAN	E	63	ENSP00000447259:D63E;ENSP00000381476:D63E	ENSP00000381476:D63E	D	+	3	2	TMPRSS12	49523893	0.890000	0.30428	0.904000	0.35570	0.120000	0.20174	0.154000	0.16343	0.392000	0.25172	-0.400000	0.06385	GAT		0.423	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559	Missense_Mutation
KRT79	338785	broad.mit.edu	37	12	53216979	53216979	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:53216979A>G	ENST00000330553.5	-	7	1222	c.1188T>C	c.(1186-1188)cgT>cgC	p.R396R		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	396	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.R396R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAGCTCCCCACGCTGCTCCG	0.617																																					p.R396R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1188C	12						.						77.0	71.0	73.0					12																	53216979		2203	4300	6503	51503246	SO:0001819	synonymous_variant	338785	exon7			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.1188T>C	12.37:g.53216979A>G			51503246	NM_175834	Q6P465|Q7Z793	Silent	SNP	ENST00000330553.5	37	CCDS8839.1																																																																																				0.617	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
AMHR2	269	broad.mit.edu	37	12	53818197	53818197	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:53818197C>T	ENST00000257863.4	+	2	255	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C	AMHR2_ENST00000379791.3_Missense_Mutation_p.R59C|AMHR2_ENST00000550311.1_Missense_Mutation_p.R59C	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	59					Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)	p.R59C(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	CCTCTACAGCCGCTGCTGCTT	0.572																																					p.R59C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C175T	12						.						30.0	32.0	31.0					12																	53818197		2203	4300	6503	52104464	SO:0001583	missense	269	exon2			AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.175C>T	12.37:g.53818197C>T	ENSP00000257863:p.Arg59Cys		52104464	NM_001164691	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018310	0.54576	.	.	ENSG00000135409	ENST00000257863;ENST00000550311;ENST00000379791	D;D;D	0.97688	-4.49;-4.49;-4.49	4.15	3.26	0.37387	TGF-beta receptor/activin receptor, type I/II (1);	0.702096	0.11894	N	0.519321	D	0.94391	0.8196	N	0.24115	0.695	0.38321	D	0.943539	D;D	0.61697	0.968;0.99	B;P	0.44946	0.432;0.465	D	0.92385	0.5916	10	0.72032	D	0.01	.	7.98	0.30177	0.0:0.8879:0.0:0.1121	.	59;59	F8W1D2;Q16671	.;AMHR2_HUMAN	C	59	ENSP00000257863:R59C;ENSP00000446661:R59C;ENSP00000369117:R59C	ENSP00000257863:R59C	R	+	1	0	AMHR2	52104464	0.592000	0.26832	0.988000	0.46212	0.997000	0.91878	1.607000	0.36836	1.110000	0.41699	0.655000	0.94253	CGC		0.572	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
PMEL	6490	broad.mit.edu	37	12	56351304	56351304	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:56351304G>A	ENST00000548747.1	-	6	1445	c.783C>T	c.(781-783)gaC>gaT	p.D261D	PMEL_ENST00000536427.1_Silent_p.D261D|PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000548493.1_Silent_p.D261D|PMEL_ENST00000550464.1_Silent_p.D175D|PMEL_ENST00000360714.4_Silent_p.D261D|PMEL_ENST00000539511.1_Silent_p.D175D|PMEL_ENST00000552882.1_Silent_p.D261D|PMEL_ENST00000449260.2_Silent_p.D261D|PMEL_ENST00000550447.1_Intron			P40967	PMEL_HUMAN	premelanosome protein	261	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)		p.D261D(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGTCTCCAAAGTCCCAGGTGT	0.572																																					p.D261D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C783T	12						.						112.0	113.0	113.0					12																	56351304		2203	4300	6503	54637571	SO:0001819	synonymous_variant	6490	exon6			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.783C>T	12.37:g.56351304G>A			54637571	NM_006928	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	ENST00000548747.1	37	CCDS8897.1	.	.	.	.	.	.	.	.	.	.	G	8.922	0.961246	0.18583	.	.	ENSG00000185664	ENST00000549404	.	.	.	5.6	3.75	0.43078	.	.	.	.	.	T	0.56514	0.1990	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53556	-0.8422	4	.	.	.	-2.0465	7.4927	0.27471	0.3056:0.0:0.6944:0.0	.	.	.	.	F	149	.	.	L	-	1	0	PMEL	54637571	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.616000	0.46376	1.506000	0.48736	0.655000	0.94253	CTT		0.572	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409626.1	NM_006928	
SPRYD4	283377	broad.mit.edu	37	12	56863169	56863169	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:56863169T>C	ENST00000338146.5	+	2	507	c.432T>C	c.(430-432)ggT>ggC	p.G144G	MIP_ENST00000555551.1_5'Flank	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	144	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.G144G(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						CAGTTGAGGGTATTGGGCAGC	0.562																																					p.G144G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T432C	12						.						98.0	92.0	94.0					12																	56863169		2203	4300	6503	55149436	SO:0001819	synonymous_variant	283377	exon2			AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.432T>C	12.37:g.56863169T>C			55149436	NM_207344	A8K7A5	Silent	SNP	ENST00000338146.5	37	CCDS8920.1																																																																																				0.562	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_207344	
RDH16	8608	broad.mit.edu	37	12	57345952	57345952	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:57345952A>C	ENST00000398138.3	-	4	1671	c.815T>G	c.(814-816)cTg>cGg	p.L272R	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	272					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)	p.L272R(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						GCAGGCAATCAGCGCATGCTC	0.517																																					p.L272R	GBM(179;741 2921 43105 45298)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T815G	12						.						94.0	106.0	102.0					12																	57345952		2132	4252	6384	55632219	SO:0001583	missense	8608	exon4				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.815T>G	12.37:g.57345952A>C	ENSP00000381206:p.Leu272Arg		55632219	NM_003708	Q9UNV2	Missense_Mutation	SNP	ENST00000398138.3	37	CCDS41797.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592756	0.86953	.	.	ENSG00000139547	ENST00000398138	D	0.94723	-3.5	5.28	5.28	0.74379	NAD(P)-binding domain (1);	0.000000	0.49916	D	0.000140	D	0.98021	0.9348	H	0.95224	3.64	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.992	D	0.99180	1.0867	10	0.87932	D	0	.	14.3305	0.66553	1.0:0.0:0.0:0.0	.	148;272	Q59FX7;O75452	.;RDH16_HUMAN	R	272	ENSP00000381206:L272R	ENSP00000353980:L148R	L	-	2	0	RDH16	55632219	0.988000	0.35896	0.582000	0.28627	0.875000	0.50365	8.829000	0.92055	2.216000	0.71823	0.533000	0.62120	CTG		0.517	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1	NM_003708	
LRP1	4035	broad.mit.edu	37	12	57590875	57590875	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:57590875C>A	ENST00000243077.3	+	56	9469	c.9003C>A	c.(9001-9003)ggC>ggA	p.G3001G	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3001	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.G3001G(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACACTCATGGCAGCTATAAGT	0.642																																					p.G3001G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9003A	12						.						95.0	91.0	93.0					12																	57590875		2203	4300	6503	55877142	SO:0001819	synonymous_variant	4035	exon56			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9003C>A	12.37:g.57590875C>A			55877142	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1																																																																																				0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
INHBC	3626	broad.mit.edu	37	12	57843559	57843559	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:57843559C>T	ENST00000309668.2	+	2	940	c.813C>T	c.(811-813)taC>taT	p.Y271Y		NM_005538.2	NP_005529.1	P55103	INHBC_HUMAN	inhibin, beta C	271					growth (GO:0040007)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	transforming growth factor beta receptor binding (GO:0005160)	p.Y271Y(2)		breast(2)|endometrium(1)|large_intestine(6)|liver(2)|lung(4)|prostate(1)	16						CTGAGGGCTACGCCATGAACT	0.542																																					p.Y271Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C813T	12						.						93.0	77.0	82.0					12																	57843559		2203	4300	6503	56129826	SO:0001819	synonymous_variant	3626	exon2				CCDS8938.1	12q13	2008-02-05				ENSG00000175189			6068	protein-coding gene	gene with protein product		601233				7826378	Standard	NM_005538		Approved		uc001snv.1	P55103	OTTHUMG00000169994	ENST00000309668.2:c.813C>T	12.37:g.57843559C>T			56129826	NM_005538	A1L3Y2	Silent	SNP	ENST00000309668.2	37	CCDS8938.1																																																																																				0.542	INHBC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406770.1	NM_005538	
LRIG3	121227	broad.mit.edu	37	12	59266420	59266420	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:59266420A>G	ENST00000320743.3	-	19	3580	c.3294T>C	c.(3292-3294)tgT>tgC	p.C1098C	LRIG3_ENST00000379141.4_Silent_p.C1038C	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	1098					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C1098C(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			GTTTAAAGGTACAAATGTGAT	0.383			T	ROS1	NSCLC																																p.C1098C			Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3294C	12						.						77.0	85.0	82.0					12																	59266420		2203	4300	6503	57552687	SO:0001819	synonymous_variant	121227	exon19			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.3294T>C	12.37:g.59266420A>G			57552687	NM_153377	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	37	CCDS8960.1																																																																																				0.383	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
DYRK2	8445	broad.mit.edu	37	12	68051038	68051038	+	Silent	SNP	G	G	A	rs376315832		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:68051038G>A	ENST00000344096.3	+	3	764	c.351G>A	c.(349-351)acG>acA	p.T117T	DYRK2_ENST00000393555.3_Silent_p.T44T|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	117					cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)	p.T117T(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		TGGGCAAAACGGGCTTGCCAG	0.537																																					p.T44T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G132A	12						.	G	,	0,4406		0,0,2203	91.0	77.0	82.0		132,351	-7.0	0.2	12		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DYRK2	NM_003583.3,NM_006482.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	44/529,117/602	68051038	1,13005	2203	4300	6503	66337305	SO:0001819	synonymous_variant	8445	exon2			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.351G>A	12.37:g.68051038G>A			66337305	NM_003583	B2R9V9|Q9BRB5	Silent	SNP	ENST00000344096.3	37	CCDS8978.1																																																																																				0.537	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402218.1		
NUP107	57122	broad.mit.edu	37	12	69135653	69135653	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:69135653C>T	ENST00000229179.4	+	27	2895	c.2563C>T	c.(2563-2565)Cca>Tca	p.P855S	NUP107_ENST00000378905.2_Missense_Mutation_p.P616S|NUP107_ENST00000539906.1_Missense_Mutation_p.P826S	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	855					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)	p.P855S(1)	NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			GCTTTGTCTGCCAATGTTGTG	0.388																																					p.P855S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2563T	12						.						224.0	202.0	209.0					12																	69135653		2203	4300	6503	67421920	SO:0001583	missense	57122	exon27			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2563C>T	12.37:g.69135653C>T	ENSP00000229179:p.Pro855Ser		67421920	NM_020401	B4DZ67|Q6PJE1	Missense_Mutation	SNP	ENST00000229179.4	37	CCDS8985.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287723	0.59976	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.4	4.5	0.54988	.	0.050399	0.85682	D	0.000000	T	0.79009	0.4374	M	0.86502	2.82	0.31942	N	0.610808	D;D;D	0.89917	1.0;0.978;1.0	D;P;D	0.77004	0.989;0.663;0.982	D	0.85036	0.0920	8	.	.	.	-7.0436	16.3837	0.83490	0.0:0.868:0.132:0.0	.	826;616;855	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	S	855;616;826	.	.	P	+	1	0	NUP107	67421920	1.000000	0.71417	0.998000	0.56505	0.238000	0.25445	6.768000	0.74980	1.415000	0.47037	0.655000	0.94253	CCA		0.388	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	NM_020401	
ANKS1B	56899	broad.mit.edu	37	12	99640070	99640070	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:99640070T>C	ENST00000547776.2	-	13	2328	c.2329A>G	c.(2329-2331)Aca>Gca	p.T777A	ANKS1B_ENST00000550833.1_5'Flank|ANKS1B_ENST00000547010.1_Missense_Mutation_p.T357A|ANKS1B_ENST00000329257.7_Missense_Mutation_p.T777A	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	777						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)	p.T777A(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CATTCCGATGTGAAGGATGGT	0.423																																					p.T777A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2329G	12						.						63.0	58.0	59.0					12																	99640070		1877	4099	5976	98164201	SO:0001583	missense	56899	exon13			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2329A>G	12.37:g.99640070T>C	ENSP00000449629:p.Thr777Ala		98164201	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	T	8.762	0.923776	0.18056	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;T;T	0.60171	1.03;0.21;1.03	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	N	0.26042	0.785	0.80722	D	1	P;D	0.58970	0.51;0.984	B;D	0.68192	0.279;0.956	T	0.60672	-0.7217	9	.	.	.	-9.6929	13.9447	0.64077	0.0:0.0:0.0:1.0	.	357;777	Q7Z6G8-6;Q7Z6G8	.;ANS1B_HUMAN	A	777;357;777;356	ENSP00000449629:T777A;ENSP00000448512:T357A;ENSP00000331381:T777A	.	T	-	1	0	ANKS1B	98164201	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.969000	0.76092	2.090000	0.63153	0.379000	0.24179	ACA		0.423	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
RIMBP2	23504	broad.mit.edu	37	12	130926735	130926735	+	Missense_Mutation	SNP	C	C	T	rs368697814		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr12:130926735C>T	ENST00000261655.4	-	8	1274	c.1111G>A	c.(1111-1113)Gtc>Atc	p.V371I	RIMBP2_ENST00000535703.1_Missense_Mutation_p.V279I|RIMBP2_ENST00000536002.1_Missense_Mutation_p.V279I	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	371	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.V371I(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTGCTGGTGACGCACTGCACG	0.627													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20079	0.0		0.0	False		,,,				2504	0.0				p.V371I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1111A	12						.		ILE/VAL	0,4406		0,0,2203	130.0	123.0	125.0		1111	1.4	0.7	12		125	2,8598	2.2+/-6.3	0,2,4298	no	missense	RIMBP2	NM_015347.4	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	371/1053	130926735	2,13004	2203	4300	6503	129492688	SO:0001583	missense	23504	exon8			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1111G>A	12.37:g.130926735C>T	ENSP00000261655:p.Val371Ile		129492688	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	c	8.503	0.864791	0.17250	0.0	2.33E-4	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.55234	0.53;0.53;0.53	4.23	1.38	0.22167	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.571798	0.18107	N	0.151472	T	0.34803	0.0910	L	0.31065	0.9	0.29306	N	0.86836	B;B;B	0.12013	0.003;0.005;0.002	B;B;B	0.15052	0.001;0.012;0.0	T	0.20974	-1.0259	10	0.22109	T	0.4	-17.8382	7.9812	0.30185	0.0:0.5957:0.0:0.4043	.	279;279;371	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	I	371;279;279;279	ENSP00000261655:V371I;ENSP00000440347:V279I;ENSP00000439159:V279I	ENSP00000261655:V371I	V	-	1	0	RIMBP2	129492688	0.996000	0.38824	0.719000	0.30619	0.568000	0.35870	0.410000	0.21098	0.454000	0.26884	0.537000	0.68136	GTC		0.627	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
ITGBL1	9358	broad.mit.edu	37	13	102220063	102220063	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:102220063T>C	ENST00000376180.3	+	3	549	c.330T>C	c.(328-330)tgT>tgC	p.C110C	ITGBL1_ENST00000545560.2_5'UTR|ITGBL1_ENST00000376162.3_Silent_p.C17C	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	110	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)		p.C110C(1)		breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATGGTAAGTGTGACTGTGGCA	0.428																																					p.C110C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T330C	13						.						224.0	195.0	205.0					13																	102220063		2203	4300	6503	101018064	SO:0001819	synonymous_variant	9358	exon3			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.330T>C	13.37:g.102220063T>C			101018064	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	ENST00000376180.3	37	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	T	10.47	1.359735	0.24598	.	.	ENSG00000198542	ENST00000537118	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33266	-0.9875	5	0.05351	T	0.99	.	14.2677	0.66129	0.0:0.0:0.0:1.0	.	.	.	.	A	19	.	ENSP00000444152:V19A	V	+	2	0	ITGBL1	101018064	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.123000	0.41996	2.171000	0.68590	0.528000	0.53228	GTG		0.428	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
ZMYM2	7750	broad.mit.edu	37	13	20656974	20656974	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:20656974G>T	ENST00000382874.2	+	24	3812	c.3622G>T	c.(3622-3624)Gga>Tga	p.G1208*	ZMYM2_ENST00000382871.2_Nonsense_Mutation_p.G1208*|ZMYM2_ENST00000382869.3_Nonsense_Mutation_p.G1208*|ZMYM2_ENST00000494061.2_3'UTR	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.G1206*(1)|p.G1208*(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AAAACAACTAGGATCACACTC	0.333																																					p.G1208X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G3622T	13						.						88.0	82.0	84.0					13																	20656974		1833	4077	5910	19554974	SO:0001587	stop_gained	7750	exon23			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3622G>T	13.37:g.20656974G>T	ENSP00000372327:p.Gly1208*		19554974	NM_197968	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Nonsense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	G	43	10.312685	0.99381	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	.	.	.	5.2	5.2	0.72013	.	0.049797	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.2547	19.0826	0.93188	0.0:0.0:1.0:0.0	.	.	.	.	X	1208;1208;1206;1206;586	.	ENSP00000372322:G1208X	G	+	1	0	ZMYM2	19554974	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.300000	0.89948	2.573000	0.86826	0.484000	0.47621	GGA		0.333	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
XPO4	64328	broad.mit.edu	37	13	21396329	21396329	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:21396329C>A	ENST00000255305.6	-	8	1011	c.940G>T	c.(940-942)Gga>Tga	p.G314*	XPO4_ENST00000400602.2_Nonsense_Mutation_p.G314*			Q9C0E2	XPO4_HUMAN	exportin 4	314					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G287*(1)		breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		ACTTGTGATCCTTCATCTGGG	0.433																																					p.G314X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G940T	13						.						138.0	136.0	136.0					13																	21396329		1914	4117	6031	20294329	SO:0001587	stop_gained	64328	exon8			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.940G>T	13.37:g.21396329C>A	ENSP00000255305:p.Gly314*		20294329	NM_022459	Q5VUZ5|Q8N3V6|Q9H934	Nonsense_Mutation	SNP	ENST00000255305.6	37	CCDS41872.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685424	0.88639	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	.	.	.	5.57	5.57	0.84162	.	0.090480	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-8.9644	10.3762	0.44083	0.0:0.8542:0.0:0.1458	.	.	.	.	X	314;184;314	.	ENSP00000255305:G314X	G	-	1	0	XPO4	20294329	1.000000	0.71417	0.960000	0.40013	0.567000	0.35839	4.494000	0.60347	2.779000	0.95612	0.655000	0.94253	GGA		0.433	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
RNF6	6049	broad.mit.edu	37	13	26789541	26789541	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:26789541T>C	ENST00000381588.4	-	5	1230	c.478A>G	c.(478-480)Aga>Gga	p.R160G	RNF6_ENST00000468480.1_Intron|RNF6_ENST00000346166.3_Missense_Mutation_p.R160G|RNF6_ENST00000381570.3_Missense_Mutation_p.R160G|RNF6_ENST00000399762.2_Intron	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	160					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R160G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TCAAATCCTCTATTTTCATGA	0.388																																					p.R160G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A478G	13						.						145.0	144.0	144.0					13																	26789541		2203	4300	6503	25687541	SO:0001583	missense	6049	exon5			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.478A>G	13.37:g.26789541T>C	ENSP00000371000:p.Arg160Gly		25687541	NM_005977	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	ENST00000381588.4	37	CCDS9316.1	.	.	.	.	.	.	.	.	.	.	T	6.381	0.438413	0.12104	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570	T;T;T	0.07444	3.19;3.19;3.19	4.49	3.23	0.37069	.	0.330550	0.30940	N	0.008568	T	0.07188	0.0182	L	0.57536	1.79	0.80722	D	1	B	0.33694	0.421	B	0.30401	0.115	T	0.06734	-1.0810	10	0.02654	T	1	-16.0986	10.0701	0.42328	0.0:0.0:0.1676:0.8323	.	160	Q9Y252	RNF6_HUMAN	G	160	ENSP00000342121:R160G;ENSP00000371000:R160G;ENSP00000370982:R160G	ENSP00000342121:R160G	R	-	1	2	RNF6	25687541	0.969000	0.33509	0.994000	0.49952	0.968000	0.65278	1.516000	0.35856	1.888000	0.54679	0.455000	0.32223	AGA		0.388	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977	
FRY	10129	broad.mit.edu	37	13	32691540	32691540	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:32691540T>C	ENST00000380250.3	+	4	890	c.394T>C	c.(394-396)Tat>Cat	p.Y132H		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	132						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Y132H(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ATTTGACTGGTATAAAAGGCA	0.388																																					p.Y132H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T394C	13						.						137.0	130.0	132.0					13																	32691540		1914	4138	6052	31589540	SO:0001583	missense	10129	exon4			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.394T>C	13.37:g.32691540T>C	ENSP00000369600:p.Tyr132His		31589540	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.0|21.0	4.074579|4.074579	0.76415|0.76415	.|.	.|.	ENSG00000073910|ENSG00000073910	ENST00000267067|ENST00000380250;ENST00000436046	.|T	.|0.25085	.|1.82	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.39733	.|0.1089	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	.|P	.|0.46395	.|0.877	.|P	.|0.55615	.|0.78	.|T	.|0.08617	.|-1.0713	.|10	.|0.40728	.|T	.|0.16	.|.	15.2363|15.2363	0.73432|0.73432	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|132	.|Q5TBA9	.|FRY_HUMAN	.|H	-1|132;129	.|ENSP00000369600:Y132H	.|ENSP00000369600:Y132H	.|Y	+|+	.|1	.|0	FRY|FRY	31589540|31589540	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.568000|7.568000	0.82369|0.82369	2.050000|2.050000	0.60909|0.60909	0.533000|0.533000	0.62120|0.62120	.|TAT		0.388	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
DGKH	160851	broad.mit.edu	37	13	42780220	42780220	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:42780220G>A	ENST00000337343.4	+	21	2560	c.2539G>A	c.(2539-2541)Gtg>Atg	p.V847M	DGKH_ENST00000261491.5_Missense_Mutation_p.V847M|DGKH_ENST00000540693.1_Missense_Mutation_p.V847M|DGKH_ENST00000379274.2_Missense_Mutation_p.V711M|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.V602M|DGKH_ENST00000536612.1_Missense_Mutation_p.V711M	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	847					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.V847M(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AGGCATAGCCGTGTTGAACAT	0.383																																					p.V847M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2539A	13						.						116.0	110.0	112.0					13																	42780220		2203	4300	6503	41678220	SO:0001583	missense	160851	exon21			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2539G>A	13.37:g.42780220G>A	ENSP00000337572:p.Val847Met		41678220	NM_178009	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319068	0.81469	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41	5.43	5.43	0.79202	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.79839	0.4515	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.997;0.999	D	0.83966	0.0324	10	0.87932	D	0	.	19.5914	0.95514	0.0:0.0:1.0:0.0	.	602;711;847;847	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	M	847;847;847;711;711;602	ENSP00000440823:V847M;ENSP00000337572:V847M;ENSP00000261491:V847M;ENSP00000368576:V711M;ENSP00000445114:V711M;ENSP00000441308:V602M	ENSP00000261491:V847M	V	+	1	0	DGKH	41678220	1.000000	0.71417	0.922000	0.36590	0.596000	0.36781	9.869000	0.99810	2.720000	0.93068	0.591000	0.81541	GTG		0.383	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
FNDC3A	22862	broad.mit.edu	37	13	49777377	49777377	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:49777377A>G	ENST00000492622.2	+	25	3544	c.3239A>G	c.(3238-3240)tAc>tGc	p.Y1080C	FNDC3A_ENST00000398316.3_Missense_Mutation_p.Y1024C|FNDC3A_ENST00000541916.1_Missense_Mutation_p.Y1080C	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1080	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.Y1080C(1)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CCAGTTATTTACAGTCTTCAA	0.318																																					p.Y1080C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3239G	13						.						124.0	123.0	123.0					13																	49777377		2202	4297	6499	48675378	SO:0001583	missense	22862	exon25			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.3239A>G	13.37:g.49777377A>G	ENSP00000417257:p.Tyr1080Cys		48675378	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360866	0.82353	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.55413	0.55;0.55;0.52	5.78	5.78	0.91487	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000012	T	0.75606	0.3872	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.79881	-0.1616	10	0.72032	D	0.01	-15.3683	15.2809	0.73784	1.0:0.0:0.0:0.0	.	1024;1080	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	C	1080;1016;1080;1024	ENSP00000417257:Y1080C;ENSP00000441831:Y1080C;ENSP00000381362:Y1024C	ENSP00000338579:Y1016C	Y	+	2	0	FNDC3A	48675378	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.904000	0.92590	2.199000	0.70637	0.533000	0.62120	TAC		0.318	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
MLNR	2862	broad.mit.edu	37	13	49796331	49796331	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:49796331A>G	ENST00000218721.1	+	2	1057	c.1057A>G	c.(1057-1059)Atc>Gtc	p.I353V	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	353					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)	p.I353V(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		TATCAACCCAATCCTCTACAA	0.478																																					p.I353V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1057G	13						.						178.0	169.0	172.0					13																	49796331		2203	4300	6503	48694332	SO:0001583	missense	2862	exon2			AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1057A>G	13.37:g.49796331A>G	ENSP00000218721:p.Ile353Val		48694332	NM_001507		Missense_Mutation	SNP	ENST00000218721.1	37	CCDS9414.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.903900	0.33628	.	.	ENSG00000102539	ENST00000218721	T	0.40756	1.02	5.49	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.147080	0.45867	U	0.000333	T	0.27933	0.0688	L	0.28014	0.82	0.80722	D	1	B	0.17038	0.02	B	0.26310	0.068	T	0.05115	-1.0905	10	0.24483	T	0.36	.	9.6965	0.40161	0.7188:0.0:0.2812:0.0	.	353	O43193	MTLR_HUMAN	V	353	ENSP00000218721:I353V	ENSP00000218721:I353V	I	+	1	0	MLNR	48694332	0.890000	0.30428	0.558000	0.28319	0.973000	0.67179	1.804000	0.38873	0.375000	0.24679	0.528000	0.53228	ATC		0.478	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
SUGT1	10910	broad.mit.edu	37	13	53237241	53237241	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:53237241T>C	ENST00000343788.6	+	8	571	c.489T>C	c.(487-489)tcT>tcC	p.S163S	SUGT1_ENST00000483074.1_3'UTR|SUGT1_ENST00000535397.1_Silent_p.S75S|SUGT1_ENST00000310528.8_Silent_p.S131S	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	163					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.S131S(1)		kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		GCTCAGAATCTGAGGTGGTAA	0.308																																					p.S163S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T489C	13						.						105.0	103.0	104.0					13																	53237241		2203	4298	6501	52135242	SO:0001819	synonymous_variant	10910	exon8			AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.489T>C	13.37:g.53237241T>C			52135242	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Silent	SNP	ENST00000343788.6	37	CCDS45050.1																																																																																				0.308	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
KLHL1	57626	broad.mit.edu	37	13	70281809	70281809	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:70281809G>A	ENST00000377844.4	-	10	2894	c.2135C>T	c.(2134-2136)aCa>aTa	p.T712I	KLHL1_ENST00000545028.1_Missense_Mutation_p.T519I	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	712					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.T712I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GTTGAGGTATGTCTGTCCATC	0.433																																					p.T712I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2135T	13						.						179.0	143.0	155.0					13																	70281809		2203	4300	6503	69179810	SO:0001583	missense	57626	exon10			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2135C>T	13.37:g.70281809G>A	ENSP00000367075:p.Thr712Ile		69179810	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669673	0.67814	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.78364	-1.17;-1.17	5.19	5.19	0.71726	Galactose oxidase, beta-propeller (1);	0.311546	0.27500	N	0.019087	T	0.73032	0.3535	L	0.38175	1.15	0.46149	D	0.998896	B;B	0.18166	0.026;0.013	B;B	0.21546	0.024;0.035	T	0.69639	-0.5091	10	0.62326	D	0.03	.	19.094	0.93242	0.0:0.0:1.0:0.0	.	712;712	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	I	712;519	ENSP00000367075:T712I;ENSP00000439602:T519I	ENSP00000367075:T712I	T	-	2	0	KLHL1	69179810	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.492000	0.73654	2.595000	0.87683	0.650000	0.86243	ACA		0.433	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
PCID2	55795	broad.mit.edu	37	13	113832595	113832595	+	Missense_Mutation	SNP	C	C	T	rs371915766		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr13:113832595C>T	ENST00000337344.4	-	14	1193	c.1117G>A	c.(1117-1119)Gtc>Atc	p.V373I	PCID2_ENST00000246505.5_Missense_Mutation_p.V427I|PCID2_ENST00000375477.1_Missense_Mutation_p.V373I|PCID2_ENST00000375479.2_Missense_Mutation_p.V373I|PCID2_ENST00000375459.1_Missense_Mutation_p.V371I|PCID2_ENST00000375457.2_Missense_Mutation_p.V371I|PCID2_ENST00000493650.1_5'UTR	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	373	PCI.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)			p.V427I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			TAGCCTTTGACGTGTCCCTGC	0.493																																					p.V373I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1117A	13						.						216.0	157.0	177.0					13																	113832595		2203	4300	6503	112880596	SO:0001583	missense	55795	exon14			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.1117G>A	13.37:g.113832595C>T	ENSP00000337405:p.Val373Ile		112880596	NM_018386	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	37	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	C	0.530	-0.858277	0.02610	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.35	4.17	0.49024	Proteasome component (PCI) domain (1);	0.062472	0.64402	N	0.000006	T	0.06645	0.0170	N	0.01874	-0.695	0.29087	N	0.882358	B;B	0.13594	0.008;0.0	B;B	0.13407	0.009;0.001	T	0.34750	-0.9816	10	0.02654	T	1	-18.4084	10.0674	0.42313	0.0:0.0768:0.0:0.9232	.	427;373	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	I	373;373;373;427;371;371;350;373;350	ENSP00000337405:V373I;ENSP00000364628:V373I;ENSP00000364626:V373I;ENSP00000246505:V427I;ENSP00000364608:V371I;ENSP00000364606:V371I;ENSP00000327335:V350I	ENSP00000246505:V427I	V	-	1	0	PCID2	112880596	1.000000	0.71417	0.987000	0.45799	0.083000	0.17756	6.083000	0.71326	0.861000	0.35504	-0.294000	0.09567	GTC		0.493	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	
ARHGEF40	55701	broad.mit.edu	37	14	21544776	21544776	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:21544776C>A	ENST00000298694.4	+	7	2018	c.1891C>A	c.(1891-1893)Ctt>Att	p.L631I	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.L631I			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	631						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L631I(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TCATGATGACCTTCCAACTGA	0.517																																					p.L631I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1891A	14						.						172.0	168.0	169.0					14																	21544776		2203	4300	6503	20614616	SO:0001583	missense	55701	exon7				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1891C>A	14.37:g.21544776C>A	ENSP00000298694:p.Leu631Ile		20614616	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	1.686	-0.505254	0.04261	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02446	4.36;4.29	5.76	3.58	0.41010	.	0.418719	0.20480	N	0.091518	T	0.02193	0.0068	N	0.19112	0.55	0.09310	N	1	B	0.16166	0.016	B	0.12156	0.007	T	0.44065	-0.9352	10	0.34782	T	0.22	.	7.7512	0.28898	0.0:0.7123:0.1876:0.1001	.	631	Q8TER5	ARH40_HUMAN	I	631	ENSP00000298694:L631I;ENSP00000298693:L631I	ENSP00000298693:L631I	L	+	1	0	ARHGEF40	20614616	0.002000	0.14202	0.241000	0.24154	0.144000	0.21451	1.021000	0.30040	1.400000	0.46741	0.561000	0.74099	CTT		0.517	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
RPGRIP1	57096	broad.mit.edu	37	14	21762957	21762957	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:21762957T>C	ENST00000400017.2	+	2	207	c.207T>C	c.(205-207)gaT>gaC	p.D69D	RPGRIP1_ENST00000557771.1_Silent_p.D69D|RPGRIP1_ENST00000206660.6_Silent_p.D69D|RPGRIP1_ENST00000556336.1_Silent_p.D69D	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	69					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.D69D(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGCAACAGGATGAGATCAAAA	0.413																																					p.D69D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T207C	14						.						59.0	56.0	57.0					14																	21762957		1847	4088	5935	20832797	SO:0001819	synonymous_variant	57096	exon2			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.207T>C	14.37:g.21762957T>C			20832797	NM_020366	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1																																																																																				0.413	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
C14orf93	60686	broad.mit.edu	37	14	23457191	23457191	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:23457191C>T	ENST00000299088.6	-	6	1547	c.1118G>A	c.(1117-1119)cGt>cAt	p.R373H	RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000397377.1_Missense_Mutation_p.R193H|C14orf93_ENST00000341470.4_Missense_Mutation_p.R373H|C14orf93_ENST00000397382.4_Missense_Mutation_p.R373H|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000406429.2_Missense_Mutation_p.R373H|RP11-298I3.4_ENST00000557615.1_RNA|C14orf93_ENST00000397379.3_Missense_Mutation_p.R373H	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	373						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)	p.R373H(1)		kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		GCGGTACTCACGCCTCTTAGT	0.537																																					p.R373H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1118A	14						.						90.0	89.0	90.0					14																	23457191		2203	4300	6503	22527031	SO:0001583	missense	60686	exon6			AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.1118G>A	14.37:g.23457191C>T	ENSP00000299088:p.Arg373His		22527031	NM_001130708	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Missense_Mutation	SNP	ENST00000299088.6	37	CCDS9583.1	.	.	.	.	.	.	.	.	.	.	c	31	5.079897	0.94050	.	.	ENSG00000100802	ENST00000299088;ENST00000341470;ENST00000397379;ENST00000397382;ENST00000397377;ENST00000406429	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	5.17	5.17	0.71159	.	0.000000	0.56097	D	0.000023	T	0.55449	0.1921	N	0.08118	0	0.44424	D	0.997342	D;D	0.89917	0.999;1.0	D;D	0.85130	0.991;0.997	T	0.66559	-0.5893	10	0.72032	D	0.01	-40.4892	17.4752	0.87658	0.0:1.0:0.0:0.0	.	373;373	Q9H972;Q9H972-2	CN093_HUMAN;.	H	373;373;373;373;193;373	ENSP00000299088:R373H;ENSP00000341353:R373H;ENSP00000380535:R373H;ENSP00000380538:R373H;ENSP00000380533:R193H;ENSP00000384768:R373H	ENSP00000299088:R373H	R	-	2	0	C14orf93	22527031	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.041000	0.64196	2.415000	0.81967	0.645000	0.84053	CGT		0.537	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944	
IL25	64806	broad.mit.edu	37	14	23845043	23845043	+	Missense_Mutation	SNP	G	G	A	rs375340039		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:23845043G>A	ENST00000329715.2	+	2	746	c.488G>A	c.(487-489)cGt>cAt	p.R163H	IL25_ENST00000397242.2_Missense_Mutation_p.R147H|CMTM5_ENST00000342473.4_5'Flank|CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000382809.2_5'Flank|CMTM5_ENST00000359320.3_5'Flank|CMTM5_ENST00000339180.4_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	163					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)	p.R163H(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		AGGCTGTACCGTGTTTCCTTA	0.607													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16356	0.0		0.0	False		,,,				2504	0.0				p.R163H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488A	14						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	157.0	143.0	148.0		488,440	0.2	0.6	14		148	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IL25	NM_022789.3,NM_172314.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	163/178,147/162	23845043	1,13005	2203	4300	6503	22914883	SO:0001583	missense	64806	exon2			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.488G>A	14.37:g.23845043G>A	ENSP00000328111:p.Arg163His		22914883	NM_022789	Q2M3F0|Q8IZV3|Q8WXB0	Missense_Mutation	SNP	ENST00000329715.2	37	CCDS9597.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271987	0.59649	0.0	1.16E-4	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.55588	0.51;0.51	4.58	0.213	0.15244	.	0.391738	0.22245	N	0.062631	T	0.49949	0.1587	L	0.43152	1.355	0.21740	N	0.99956	B;D	0.64830	0.282;0.994	B;P	0.54100	0.064;0.742	T	0.40421	-0.9564	10	0.37606	T	0.19	-10.6501	8.3465	0.32277	0.0:0.4894:0.3438:0.1668	.	163;147	Q9H293;Q9H293-2	IL25_HUMAN;.	H	147;163	ENSP00000380417:R147H;ENSP00000328111:R163H	ENSP00000328111:R163H	R	+	2	0	IL25	22914883	0.000000	0.05858	0.643000	0.29450	0.980000	0.70556	-1.070000	0.03440	0.493000	0.27837	0.561000	0.74099	CGT		0.607	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2		
MYH7	4625	broad.mit.edu	37	14	23900139	23900139	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:23900139A>G	ENST00000355349.3	-	10	1028	c.866T>C	c.(865-867)aTc>aCc	p.I289T		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	289	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.I289T(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTTAGACAGGATTTGGTAGAA	0.478																																					p.I289T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T866C	14						.						128.0	138.0	135.0					14																	23900139		2203	4300	6503	22969979	SO:0001583	missense	4625	exon10			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.866T>C	14.37:g.23900139A>G	ENSP00000347507:p.Ile289Thr		22969979	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645876	0.67358	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88741	-2.42	3.63	3.63	0.41609	Myosin head, motor domain (2);	.	.	.	.	D	0.97272	0.9108	H	0.97983	4.12	0.80722	D	1	B	0.28208	0.203	D	0.68621	0.959	D	0.96924	0.9676	9	0.87932	D	0	.	12.4156	0.55492	1.0:0.0:0.0:0.0	.	289	P12883	MYH7_HUMAN	T	289	ENSP00000347507:I289T	ENSP00000347507:I289T	I	-	2	0	MYH7	22969979	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	8.867000	0.92314	1.522000	0.49001	0.260000	0.18958	ATC		0.478	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
AP1G2	8906	broad.mit.edu	37	14	24035494	24035494	+	Missense_Mutation	SNP	C	C	T	rs200202756		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:24035494C>T	ENST00000308724.5	-	3	1219	c.464G>A	c.(463-465)cGc>cAc	p.R155H	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.R155H|AP1G2_ENST00000556277.1_5'UTR	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	155					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)	p.R155H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CACCTTCTTGCGCACGTAGGG	0.602																																					p.R155H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G464A	14						.	C	HIS/ARG	0,4406		0,0,2203	66.0	65.0	65.0		464	5.0	1.0	14		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	AP1G2	NM_003917.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	155/786	24035494	1,13005	2203	4300	6503	23105334	SO:0001583	missense	8906	exon4			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.464G>A	14.37:g.24035494C>T	ENSP00000312442:p.Arg155His		23105334	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506592	0.85282	0.0	1.16E-4	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189	T;T;T	0.27256	1.68;1.68;1.68	5.01	5.01	0.66863	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.049543	0.85682	D	0.000000	T	0.56601	0.1996	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.968;0.987	T	0.64605	-0.6368	10	0.87932	D	0	-17.3989	9.2696	0.37664	0.0:0.9044:0.0:0.0956	.	155;155	G3V532;O75843	.;AP1G2_HUMAN	H	155	ENSP00000312442:R155H;ENSP00000380309:R155H;ENSP00000452153:R155H	ENSP00000312442:R155H	R	-	2	0	AP1G2	23105334	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.676000	0.46883	2.595000	0.87683	0.561000	0.74099	CGC		0.602	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
DTD2	112487	broad.mit.edu	37	14	31917483	31917483	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:31917483G>A	ENST00000310850.4	-	3	475	c.359C>T	c.(358-360)tCt>tTt	p.S120F	RP11-176H8.1_ENST00000547378.1_Intron|CTD-2213F21.2_ENST00000502430.2_RNA|DTD2_ENST00000356180.4_Missense_Mutation_p.S120F	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	120					D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.S120F(1)									CACAAATTGAGAGTAAAGTTC	0.408																																					p.S120F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C359T	14						.						247.0	251.0	250.0					14																	31917483		2203	4300	6503	30987234	SO:0001583	missense	112487	exon3			BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.359C>T	14.37:g.31917483G>A	ENSP00000312224:p.Ser120Phe		30987234	NM_080664	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871697	0.72065	.	.	ENSG00000129480	ENST00000310850;ENST00000356180	T;T	0.47177	0.85;0.85	5.85	5.85	0.93711	D-Tyr tRNAtyr deacylase-like domain (2);	0.346456	0.36134	N	0.002763	T	0.68439	0.3001	M	0.78916	2.43	0.43061	D	0.994685	P	0.50369	0.934	P	0.57679	0.825	T	0.71045	-0.4706	10	0.87932	D	0	0.1687	20.1542	0.98100	0.0:0.0:1.0:0.0	.	120	Q96FN9	DTD2_HUMAN	F	120	ENSP00000312224:S120F;ENSP00000348503:S120F	ENSP00000312224:S120F	S	-	2	0	C14orf126	30987234	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.716000	0.54904	2.767000	0.95098	0.563000	0.77884	TCT		0.408	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
LRFN5	145581	broad.mit.edu	37	14	42356694	42356694	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:42356694T>G	ENST00000298119.4	+	3	2055	c.866T>G	c.(865-867)aTt>aGt	p.I289S	LRFN5_ENST00000554171.1_Missense_Mutation_p.I289S|LRFN5_ENST00000554120.1_Missense_Mutation_p.I289S	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	289	Ig-like.					integral component of membrane (GO:0016021)		p.I289S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCTCCTCTCATTACTCGTCAT	0.483										HNSCC(30;0.082)																											p.I289S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T866G	14						.						121.0	116.0	118.0					14																	42356694		2203	4300	6503	41426444	SO:0001583	missense	145581	exon3			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.866T>G	14.37:g.42356694T>G	ENSP00000298119:p.Ile289Ser		41426444	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233212	0.58777	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.71222	-0.55;-0.55;-0.55	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	D	0.88336	0.6409	H	0.96833	3.89	0.80722	D	1	P;D	0.61080	0.847;0.989	P;D	0.65323	0.73;0.934	D	0.91892	0.5524	10	0.87932	D	0	.	13.6708	0.62424	0.0:0.0:0.0:1.0	.	289;289	G3V364;Q96NI6	.;LRFN5_HUMAN	S	289	ENSP00000298119:I289S;ENSP00000451897:I289S;ENSP00000451067:I289S	ENSP00000298119:I289S	I	+	2	0	LRFN5	41426444	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	2.165000	0.68154	0.460000	0.39030	ATT		0.483	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
FANCM	57697	broad.mit.edu	37	14	45653008	45653008	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:45653008A>T	ENST00000267430.5	+	17	4503	c.4418A>T	c.(4417-4419)aAt>aTt	p.N1473I	FANCM_ENST00000542564.2_Missense_Mutation_p.N1447I|FANCM_ENST00000555013.1_3'UTR	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1473					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.N1473I(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GAGAGTGAGAATTTTCCCAAA	0.343								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.N1473I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4418T	14						.						72.0	69.0	70.0					14																	45653008		2203	4300	6503	44722758	SO:0001583	missense	57697	exon17	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4418A>T	14.37:g.45653008A>T	ENSP00000267430:p.Asn1473Ile		44722758	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.23|15.23	2.772687|2.772687	0.49680|0.49680	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	T|T;T;T	0.20463|0.18810	2.07|2.78;2.78;2.19	5.2|5.2	2.85|2.85	0.33270|0.33270	.|.	.|1.923090	.|0.01719	.|N	.|0.028181	T|T	0.31670|0.31670	0.0804|0.0804	M|M	0.63428|0.63428	1.95|1.95	0.28266|0.28266	N|N	0.924603|0.924603	.|D;D	.|0.54397	.|0.966;0.966	.|P;P	.|0.48030	.|0.462;0.564	T|T	0.07654|0.07654	-1.0761|-1.0761	6|10	.|0.42905	.|T	.|0.14	.|.	6.6568|6.6568	0.22992|0.22992	0.8083:0.0:0.1917:0.0|0.8083:0.0:0.1917:0.0	.|.	.|1447;1473	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	D|I	405|1473;1447;989	ENSP00000450632:E405D|ENSP00000267430:N1473I;ENSP00000442493:N1447I;ENSP00000452033:N989I	.|ENSP00000267430:N1473I	E|N	+|+	3|2	2|0	FANCM|FANCM	44722758|44722758	0.991000|0.991000	0.36638|0.36638	0.607000|0.607000	0.28956|0.28956	0.379000|0.379000	0.30106|0.30106	1.906000|1.906000	0.39887|0.39887	0.399000|0.399000	0.25367|0.25367	0.477000|0.477000	0.44152|0.44152	GAA|AAT		0.343	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
LRR1	122769	broad.mit.edu	37	14	50074572	50074572	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:50074572G>A	ENST00000298288.6	+	3	1061	c.737G>A	c.(736-738)tGc>tAc	p.C246Y	LRR1_ENST00000318317.4_Intron	NM_152329.3	NP_689542.2	Q96L50	LLR1_HUMAN	leucine rich repeat protein 1	246					protein ubiquitination (GO:0016567)			p.C246Y(1)		kidney(2)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GTGCAGTTTTGCCAGCTCCAG	0.403																																					p.C246Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A	14						.						54.0	56.0	55.0					14																	50074572		2203	4300	6503	49144322	SO:0001583	missense	122769	exon3			BC030142	CCDS9686.1, CCDS9687.1	14q21.3	2011-02-02	2011-02-02	2011-02-02	ENSG00000165501	ENSG00000165501			19742	protein-coding gene	gene with protein product	"""LRR-repeat protein 1"""	609193	"""peptidylprolyl isomerase (cyclophilin)-like 5"""	PPIL5		11804328, 21074724	Standard	NR_037792		Approved	MGC20689, LRR-1	uc001wwn.3	Q96L50	OTTHUMG00000140273	ENST00000298288.6:c.737G>A	14.37:g.50074572G>A	ENSP00000298288:p.Cys246Tyr		49144322	NM_152329	A5D6X3|B4DDE0|Q52M24|Q86SZ1|Q8N6H9	Missense_Mutation	SNP	ENST00000298288.6	37	CCDS9686.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.325333	0.81580	.	.	ENSG00000165501	ENST00000298288;ENST00000361579	T	0.17854	2.25	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	L	0.58354	1.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.98;0.996	T	0.06991	-1.0796	10	0.02654	T	1	-9.1975	20.521	0.99222	0.0:0.0:1.0:0.0	.	268;246	A8MSW2;Q96L50	.;LLR1_HUMAN	Y	246;268	ENSP00000298288:C246Y	ENSP00000298288:C246Y	C	+	2	0	LRR1	49144322	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.629000	0.83207	2.861000	0.98227	0.650000	0.86243	TGC		0.403	LRR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410790.1	NM_203467	
NEMF	9147	broad.mit.edu	37	14	50298931	50298931	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:50298931A>G	ENST00000298310.5	-	9	1249	c.800T>C	c.(799-801)aTa>aCa	p.I267T	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Missense_Mutation_p.I267T|NEMF_ENST00000545773.1_Missense_Mutation_p.I225T			O60524	NEMF_HUMAN	nuclear export mediator factor	267					nuclear export (GO:0051168)	nucleus (GO:0005634)		p.I267T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TTACGTCAGTATGTCTTCAAC	0.318																																					p.I267T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T800C	14						.						119.0	114.0	115.0					14																	50298931		2203	4299	6502	49368681	SO:0001583	missense	9147	exon9			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.800T>C	14.37:g.50298931A>G	ENSP00000298310:p.Ile267Thr		49368681	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.989177	0.53934	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.43688	0.95;0.94;0.95;0.94	5.48	5.48	0.80851	Fibronectin-binding A, N-terminal (1);	0.054882	0.64402	D	0.000001	T	0.52805	0.1757	L	0.60455	1.87	0.80722	D	1	B;B;B;B;P	0.47677	0.12;0.067;0.13;0.371;0.899	B;B;B;B;P	0.57846	0.099;0.064;0.103;0.146;0.828	T	0.47420	-0.9119	10	0.09338	T	0.73	-19.4608	14.7379	0.69430	1.0:0.0:0.0:0.0	.	267;38;242;225;267	O60524-3;F5H639;O60524-5;O60524-4;O60524	.;.;.;.;NEMF_HUMAN	T	267;225;267;38;225	ENSP00000298310:I267T;ENSP00000438309:I225T;ENSP00000441016:I267T;ENSP00000452540:I225T	ENSP00000298310:I267T	I	-	2	0	NEMF	49368681	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.456000	0.90359	2.078000	0.62432	0.460000	0.39030	ATA		0.318	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
SAMD4A	23034	broad.mit.edu	37	14	55236926	55236926	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:55236926T>A	ENST00000554335.1	+	9	2364	c.1701T>A	c.(1699-1701)taT>taA	p.Y567*	SAMD4A_ENST00000251091.5_Nonsense_Mutation_p.Y479*|SAMD4A_ENST00000392067.3_Nonsense_Mutation_p.Y567*|SAMD4A_ENST00000555192.1_Nonsense_Mutation_p.Y158*|SAMD4A_ENST00000357634.3_Nonsense_Mutation_p.Y566*			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	567					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)	p.Y566*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TATCAGGATATCGACAGCAAA	0.463																																					p.Y566X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1698A	14						.						152.0	147.0	148.0					14																	55236926		2203	4300	6503	54306676	SO:0001587	stop_gained	23034	exon8			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1701T>A	14.37:g.55236926T>A	ENSP00000452535:p.Tyr567*		54306676	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Nonsense_Mutation	SNP	ENST00000554335.1	37	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	T	38	6.642654	0.97730	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	5.42	3.08	0.35506	.	0.066887	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1325	7.7157	0.28702	0.0:0.2281:0.0:0.7719	.	.	.	.	X	567;567;479;478;566;158	.	ENSP00000251091:Y196X	Y	+	3	2	SAMD4A	54306676	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.519000	0.22862	0.899000	0.36444	0.379000	0.24179	TAT		0.463	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
DLGAP5	9787	broad.mit.edu	37	14	55636165	55636165	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:55636165C>T	ENST00000247191.2	-	12	1716	c.1500G>A	c.(1498-1500)gaG>gaA	p.E500E	DLGAP5_ENST00000395425.2_Silent_p.E500E	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	500					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)	p.E500E(1)		biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						TACAGGTAGTCTCCTTTATAC	0.343																																					p.E500E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1500A	14						.						117.0	107.0	110.0					14																	55636165		2203	4300	6503	54705918	SO:0001819	synonymous_variant	9787	exon12			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1500G>A	14.37:g.55636165C>T			54705918	NM_001146015	A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	ENST00000247191.2	37	CCDS9723.1																																																																																				0.343	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
ARID4A	5926	broad.mit.edu	37	14	58831663	58831663	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:58831663C>T	ENST00000355431.3	+	20	3229	c.2856C>T	c.(2854-2856)atC>atT	p.I952I	ARID4A_ENST00000348476.3_Silent_p.I952I|ARID4A_ENST00000431317.2_Silent_p.I952I|ARID4A_ENST00000395168.3_Silent_p.I952I	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	952	Retinoblastoma protein binding. {ECO:0000255}.				erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I952I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TGCCTCTGATCGGGCCTGAAA	0.408																																					p.I952I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2856T	14						.						107.0	104.0	105.0					14																	58831663		2203	4300	6503	57901416	SO:0001819	synonymous_variant	5926	exon20			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2856C>T	14.37:g.58831663C>T			57901416	NM_023000	Q15991|Q15992|Q15993	Silent	SNP	ENST00000355431.3	37	CCDS9732.1																																																																																				0.408	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
DACT1	51339	broad.mit.edu	37	14	59113811	59113811	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:59113811C>T	ENST00000335867.4	+	4	2494	c.2470C>T	c.(2470-2472)Cgc>Tgc	p.R824C	DACT1_ENST00000541264.2_Missense_Mutation_p.R543C|DACT1_ENST00000395153.3_Missense_Mutation_p.R787C|DACT1_ENST00000556859.1_Missense_Mutation_p.R543C			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	824					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.R824C(1)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GAAGATCCTCCGCTTTCGGTC	0.448																																					p.R787C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2359T	14						.						115.0	120.0	118.0					14																	59113811		2203	4300	6503	58183564	SO:0001583	missense	51339	exon4			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2470C>T	14.37:g.59113811C>T	ENSP00000337439:p.Arg824Cys		58183564	NM_001079520	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934121	0.73442	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.84520	0.5490	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.85392	0.1126	10	0.87932	D	0	-20.2693	20.422	0.99049	0.0:1.0:0.0:0.0	.	787;824	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	C	543;543;787;824;543	ENSP00000451598:R543C;ENSP00000378581:R543C;ENSP00000378582:R787C;ENSP00000337439:R824C;ENSP00000442850:R543C	ENSP00000337439:R824C	R	+	1	0	DACT1	58183564	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	4.378000	0.59568	2.832000	0.97577	0.655000	0.94253	CGC		0.448	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
RBM25	58517	broad.mit.edu	37	14	73581010	73581010	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:73581010C>T	ENST00000261973.7	+	18	2693	c.2408C>T	c.(2407-2409)tCa>tTa	p.S803L	RBM25_ENST00000532483.1_3'UTR|RBM25_ENST00000527432.1_Missense_Mutation_p.S803L	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	803	PWI. {ECO:0000255|PROSITE- ProRule:PRU00627}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S803L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		GCTCATAGTTCACCCCAGAGC	0.244																																					p.S803L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2408T	14						.						80.0	87.0	84.0					14																	73581010		2203	4300	6503	72650763	SO:0001583	missense	58517	exon18			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.2408C>T	14.37:g.73581010C>T	ENSP00000261973:p.Ser803Leu		72650763	NM_021239	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	ENST00000261973.7	37	CCDS32113.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098201	0.76870	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.44482	0.92;0.92	6.03	6.03	0.97812	Splicing factor PWI (5);	0.252844	0.39985	N	0.001213	T	0.48187	0.1486	L	0.60455	1.87	0.80722	D	1	B	0.27117	0.168	B	0.32289	0.143	T	0.39354	-0.9618	10	0.54805	T	0.06	.	20.5596	0.99324	0.0:1.0:0.0:0.0	.	803	P49756	RBM25_HUMAN	L	803	ENSP00000261973:S803L;ENSP00000431150:S803L	ENSP00000261973:S803L	S	+	2	0	RBM25	72650763	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.890000	0.69774	2.868000	0.98415	0.555000	0.69702	TCA		0.244	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330	
LTBP2	4053	broad.mit.edu	37	14	75019600	75019600	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:75019600C>T	ENST00000261978.4	-	5	1573	c.1187G>A	c.(1186-1188)cGc>cAc	p.R396H	CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000557425.1_Intron|LTBP2_ENST00000556690.1_Missense_Mutation_p.R396H	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	396	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R396H(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CTCACAGATGCGGAAGCCAGA	0.647																																					p.R396H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1187A	14						.						68.0	53.0	58.0					14																	75019600		2203	4300	6503	74089353	SO:0001583	missense	4053	exon5				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1187G>A	14.37:g.75019600C>T	ENSP00000261978:p.Arg396His		74089353	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	c	32	5.164272	0.94727	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.38077	1.16;1.16	4.83	4.83	0.62350	Epidermal growth factor-like, type 3 (1);	0.000000	0.41823	D	0.000805	T	0.55000	0.1893	L	0.52011	1.625	0.38072	D	0.936419	D	0.89917	1.0	D	0.83275	0.996	T	0.60840	-0.7183	10	0.72032	D	0.01	.	16.3082	0.82856	0.0:1.0:0.0:0.0	.	396	Q14767	LTBP2_HUMAN	H	396	ENSP00000261978:R396H;ENSP00000451477:R396H	ENSP00000261978:R396H	R	-	2	0	LTBP2	74089353	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.912000	0.75753	2.519000	0.84933	0.550000	0.68814	CGC		0.647	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
YLPM1	56252	broad.mit.edu	37	14	75295972	75295972	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:75295972G>A	ENST00000552421.1	+	18	4226	c.4102G>A	c.(4102-4104)Gcc>Acc	p.A1368T	YLPM1_ENST00000325680.7_Missense_Mutation_p.A2074T			P49750	YLPM1_HUMAN	YLP motif containing 1	1879					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.A2074T(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GGAGGCCATTGCCAGCAGAAT	0.483																																					p.A2074T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6220A	14						.						150.0	142.0	145.0					14																	75295972		1982	4160	6142	74365725	SO:0001583	missense	56252	exon19			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.4102G>A	14.37:g.75295972G>A	ENSP00000447921:p.Ala1368Thr		74365725	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	37		.	.	.	.	.	.	.	.	.	.	G	18.83	3.707263	0.68615	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000423680	.	.	.	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000005	T	0.50343	0.1610	N	0.04203	-0.255	0.80722	D	1	D	0.60575	0.988	P	0.60236	0.871	T	0.57894	-0.7732	9	0.35671	T	0.21	-6.464	20.027	0.97525	0.0:0.0:1.0:0.0	.	2074	P49750-4	.	T	1368;2074;1787	.	ENSP00000324463:A2074T	A	+	1	0	YLPM1	74365725	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.682000	0.61671	2.724000	0.93272	0.557000	0.71058	GCC		0.483	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
TSHR	7253	broad.mit.edu	37	14	81609889	81609889	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:81609889C>T	ENST00000541158.2	+	11	1809	c.1487C>T	c.(1486-1488)aCg>aTg	p.T496M	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Missense_Mutation_p.T496M			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	496					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.T496M(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GGGTGCAACACGGCTGGTTTC	0.557			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.T496M		yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1487T	14						.						545.0	389.0	442.0					14																	81609889		2203	4300	6503	80679642	SO:0001583	missense	7253	exon10			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1487C>T	14.37:g.81609889C>T	ENSP00000441235:p.Thr496Met		80679642	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383073	0.61845	.	.	ENSG00000165409	ENST00000541158;ENST00000412429;ENST00000298171	D;D	0.85773	-2.03;-2.03	5.46	5.46	0.80206	.	0.152501	0.64402	D	0.000010	D	0.87120	0.6098	L	0.58428	1.81	0.42726	D	0.993698	D	0.54772	0.968	P	0.48189	0.57	D	0.88464	0.3057	10	0.62326	D	0.03	.	19.3008	0.94143	0.0:1.0:0.0:0.0	.	496	F5GYU5	.	M	496;143;496	ENSP00000441235:T496M;ENSP00000298171:T496M	ENSP00000298171:T496M	T	+	2	0	TSHR	80679642	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.023000	0.70848	2.562000	0.86427	0.561000	0.74099	ACG		0.557	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
EML5	161436	broad.mit.edu	37	14	89087152	89087152	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:89087152G>A	ENST00000380664.5	-	37	5296	c.5297C>T	c.(5296-5298)tCt>tTt	p.S1766F	EML5_ENST00000554922.1_Missense_Mutation_p.S1774F|EML5_ENST00000352093.5_Missense_Mutation_p.S1728F|EML5_ENST00000553320.1_5'Flank			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1766						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.S1774F(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TATTTTTAGAGAACTCACTAG	0.373																																					p.S1774F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5321T	14						.						107.0	98.0	101.0					14																	89087152		1857	4101	5958	88156905	SO:0001583	missense	161436	exon38			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.5297C>T	14.37:g.89087152G>A	ENSP00000370039:p.Ser1766Phe		88156905	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546080	0.86022	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664;ENST00000555823	T;T;T;T	0.60040	2.09;2.09;2.09;0.22	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.79299	0.4422	M	0.86502	2.82	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.82554	-0.0399	10	0.87932	D	0	-14.9513	19.7096	0.96089	0.0:0.0:1.0:0.0	.	1766	Q05BV3	EMAL5_HUMAN	F	1774;1728;1766;214	ENSP00000451998:S1774F;ENSP00000298315:S1728F;ENSP00000370039:S1766F;ENSP00000452030:S214F	ENSP00000298315:S1728F	S	-	2	0	EML5	88156905	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.652000	0.90054	0.655000	0.94253	TCT		0.373	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
EML5	161436	broad.mit.edu	37	14	89128020	89128020	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:89128020T>C	ENST00000380664.5	-	25	3652	c.3653A>G	c.(3652-3654)aAg>aGg	p.K1218R	EML5_ENST00000554922.1_Missense_Mutation_p.K1218R|EML5_ENST00000352093.5_Missense_Mutation_p.K1180R			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1218						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.K1218R(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TCTAAATAACTTCACAAATCC	0.368																																					p.K1218R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3653G	14						.						54.0	52.0	53.0					14																	89128020		1839	4084	5923	88197773	SO:0001583	missense	161436	exon25			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3653A>G	14.37:g.89128020T>C	ENSP00000370039:p.Lys1218Arg		88197773	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.475736	0.84640	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.37584	1.19;1.64;1.19	4.6	4.6	0.57074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50000	0.1590	L	0.49126	1.545	0.50039	D	0.999849	D;D	0.76494	0.999;0.995	D;D	0.83275	0.996;0.945	T	0.39663	-0.9603	10	0.12103	T	0.63	-12.2036	14.171	0.65510	0.0:0.0:0.0:1.0	.	1218;1218	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	R	1218;1180;1218	ENSP00000451998:K1218R;ENSP00000298315:K1180R;ENSP00000370039:K1218R	ENSP00000298315:K1180R	K	-	2	0	EML5	88197773	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.525000	0.81892	1.935000	0.56089	0.377000	0.23210	AAG		0.368	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
TTC8	123016	broad.mit.edu	37	14	89307486	89307486	+	Silent	SNP	C	C	A	rs71425331		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:89307486C>A	ENST00000345383.5	+	4	489	c.405C>A	c.(403-405)gcC>gcA	p.A135A	Y_RNA_ENST00000384612.1_RNA|TTC8_ENST00000346301.4_Silent_p.A135A|TTC8_ENST00000338104.6_Silent_p.A135A|TTC8_ENST00000380656.2_Silent_p.A145A|TTC8_ENST00000536576.1_5'UTR|TTC8_ENST00000358622.5_5'Flank|TTC8_ENST00000354441.6_Intron	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	145					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.A145A(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						CCAGAACCGCCTACACAGCCC	0.517																																					p.A135A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405A	14						.						51.0	57.0	55.0					14																	89307486		2203	4300	6503	88377239	SO:0001819	synonymous_variant	123016	exon4			AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.405C>A	14.37:g.89307486C>A			88377239	NM_198309	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Silent	SNP	ENST00000345383.5	37	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.00|12.00	1.806114|1.806114	0.31961|0.31961	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000343648|ENST00000554686	.|.	.|.	.|.	5.6|5.6	1.49|1.49	0.22878|0.22878	.|.	.|.	.|.	.|.	.|.	T|T	0.40522|0.40522	0.1120|0.1120	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30794|0.30794	-0.9966|-0.9966	5|4	0.08179|.	T|.	0.78|.	-4.8279|-4.8279	0.3159|0.3159	0.00295|0.00295	0.2727:0.2849:0.1333:0.3091|0.2727:0.2849:0.1333:0.3091	.|.	.|.	.|.	.|.	I|H	187|125	.|.	ENSP00000343586:L187I|.	L|P	+|+	1|2	2|0	TTC8|TTC8	88377239|88377239	0.459000|0.459000	0.25768|0.25768	0.999000|0.999000	0.59377|0.59377	0.902000|0.902000	0.53008|0.53008	-0.264000|-0.264000	0.08658|0.08658	0.742000|0.742000	0.32697|0.32697	0.563000|0.563000	0.77884|0.77884	CTA|CCT		0.517	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
KCNK13	56659	broad.mit.edu	37	14	90650622	90650622	+	Nonsense_Mutation	SNP	C	C	T	rs565658757	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:90650622C>T	ENST00000282146.4	+	2	943	c.502C>T	c.(502-504)Cga>Tga	p.R168*		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	168					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.R168*(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				GCTCCGGAGACGAGGGGCCCT	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17635	0.0		0.0	False		,,,				2504	0.0				p.R168X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C502T	14						.						71.0	73.0	72.0					14																	90650622		2203	4300	6503	89720375	SO:0001587	stop_gained	56659	exon2			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.502C>T	14.37:g.90650622C>T	ENSP00000282146:p.Arg168*		89720375	NM_022054	B5TJL8|Q96E79	Nonsense_Mutation	SNP	ENST00000282146.4	37	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691976	0.88735	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.09	1.75	0.24633	.	1.017930	0.07926	N	0.976702	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0045	0.30317	0.5844:0.3051:0.1105:0.0	.	.	.	.	X	168	.	ENSP00000282146:R168X	R	+	1	2	KCNK13	89720375	0.063000	0.20901	0.003000	0.11579	0.159000	0.22180	2.387000	0.44389	0.482000	0.27582	0.655000	0.94253	CGA		0.612	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
C14orf159	80017	broad.mit.edu	37	14	91642315	91642315	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:91642315C>T	ENST00000523771.1	+	7	1233	c.630C>T	c.(628-630)taC>taT	p.Y210Y	C14orf159_ENST00000523816.1_Silent_p.Y210Y|C14orf159_ENST00000520328.1_Silent_p.Y198Y|C14orf159_ENST00000412671.2_Silent_p.Y215Y|C14orf159_ENST00000525393.2_Silent_p.Y86Y|C14orf159_ENST00000518868.1_Silent_p.Y215Y|C14orf159_ENST00000522322.1_Silent_p.Y210Y|C14orf159_ENST00000256324.10_Silent_p.Y215Y|C14orf159_ENST00000428926.2_Silent_p.Y210Y|C14orf159_ENST00000521077.2_Silent_p.Y215Y			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	210						mitochondrion (GO:0005739)		p.Y210Y(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		AACCTGCCTACGGGGATGCCA	0.527																																					p.Y215Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C645T	14						.						100.0	91.0	94.0					14																	91642315		2203	4300	6503	90712068	SO:0001819	synonymous_variant	80017	exon7			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.630C>T	14.37:g.91642315C>T			90712068	NM_001102368	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Silent	SNP	ENST00000523771.1	37	CCDS32141.1																																																																																				0.527	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
KLC1	3831	broad.mit.edu	37	14	104136617	104136617	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr14:104136617A>G	ENST00000348520.6	+	7	1303	c.984A>G	c.(982-984)gaA>gaG	p.E328E	KLC1_ENST00000553286.1_Silent_p.E328E|KLC1_ENST00000334553.6_Silent_p.E328E|KLC1_ENST00000554280.1_Silent_p.E328E|KLC1_ENST00000557575.1_Silent_p.E328E|KLC1_ENST00000380038.3_Silent_p.E328E|RP11-73M18.2_ENST00000472726.2_Silent_p.E500E|KLC1_ENST00000445352.4_Silent_p.E326E|KLC1_ENST00000452929.2_Silent_p.E328E|KLC1_ENST00000347839.6_Silent_p.E328E|KLC1_ENST00000555836.1_Silent_p.E328E|KLC1_ENST00000557450.1_Silent_p.E328E|KLC1_ENST00000246489.7_Silent_p.E328E|KLC1_ENST00000389744.4_Silent_p.E328E	NM_182923.3	NP_891553.2	Q07866	KLC1_HUMAN	kinesin light chain 1	328					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|stress granule disassembly (GO:0035617)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|growth cone (GO:0030426)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E328E(1)	KLC1/ALK(2)	NS(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	12		Melanoma(154;0.155)|all_epithelial(191;0.19)				AAATCCGAGAAAAGGTACAAA	0.418																																					p.E328E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A984G	14						.						70.0	80.0	77.0					14																	104136617		2203	4300	6503	103206370	SO:0001819	synonymous_variant	3831	exon7			AF267530	CCDS32165.1, CCDS41996.1, CCDS45168.1	14q32.3	2013-01-10	2007-03-09	2007-03-09	ENSG00000126214	ENSG00000126214		"""Tetratricopeptide (TTC) repeat domain containing"""	6387	protein-coding gene	gene with protein product		600025	"""kinesin 2 60/70kDa"", ""kinesin 2"""	KNS2		8274221, 11106729	Standard	NM_005552		Approved	KNS2A, KLC, hKLC1S, hKLC1N, hKLC1P, hKLC1G, hKLC1R, hKLC1J, hKLC1B	uc010tyf.2	Q07866	OTTHUMG00000169227	ENST00000348520.6:c.984A>G	14.37:g.104136617A>G			103206370	NM_001130107	A6NF62|F8VTM4|Q7RTM2|Q7RTM3|Q7RTM5|Q7RTP9|Q7RTQ3|Q7RTQ5|Q7RTQ6|Q86SF5|Q86TF5|Q86V74|Q86V75|Q86V76|Q86V77|Q86V78|Q86V79|Q96H62	Silent	SNP	ENST00000348520.6	37	CCDS41996.1																																																																																				0.418	KLC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402947.2	NM_005552	
GABRA5	2558	broad.mit.edu	37	15	27128584	27128584	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:27128584G>A	ENST00000335625.5	+	6	1265	c.377G>A	c.(376-378)aGc>aAc	p.S126N	GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.S126N|GABRA5_ENST00000355395.5_Missense_Mutation_p.S126N|GABRA5_ENST00000557449.1_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	126					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S126N(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CTCCTTGCCAGCAAGATCTGG	0.557																																					p.S126N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G377A	15						.						88.0	98.0	95.0					15																	27128584		2199	4296	6495	24679677	SO:0001583	missense	2558	exon6				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.377G>A	15.37:g.27128584G>A	ENSP00000335592:p.Ser126Asn		24679677	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627328	0.66901	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.4	5.4	0.78164	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.75867	0.3908	L	0.50919	1.6	0.58432	D	0.999996	B	0.20550	0.046	B	0.28991	0.097	T	0.69837	-0.5037	10	0.30078	T	0.28	.	18.53	0.90987	0.0:0.0:1.0:0.0	.	126	P31644	GBRA5_HUMAN	N	126;126;94;126;126;126	ENSP00000335592:S126N;ENSP00000347557:S126N;ENSP00000450653:S94N;ENSP00000382953:S126N;ENSP00000450806:S126N;ENSP00000450717:S126N	ENSP00000335592:S126N	S	+	2	0	GABRA5	24679677	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.801000	0.85960	2.695000	0.91970	0.561000	0.74099	AGC		0.557	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
SLTM	79811	broad.mit.edu	37	15	59179726	59179726	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:59179726C>T	ENST00000380516.2	-	18	2476	c.2389G>A	c.(2389-2391)Gtt>Att	p.V797I	SLTM_ENST00000536328.1_Missense_Mutation_p.V366I|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	797	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V797I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTTTGACCAACAAAGCGATCC	0.398																																					p.V797I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2389A	15						.						93.0	84.0	87.0					15																	59179726		2192	4292	6484	56967018	SO:0001583	missense	79811	exon18			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2389G>A	15.37:g.59179726C>T	ENSP00000369887:p.Val797Ile		56967018	NM_024755	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440038	0.83993	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.12039	2.72	5.68	5.68	0.88126	.	0.000000	0.52532	D	0.000072	T	0.33847	0.0877	L	0.50333	1.59	0.58432	D	0.999998	D;D	0.67145	0.987;0.996	D;D	0.76071	0.942;0.987	T	0.00395	-1.1766	10	0.35671	T	0.21	.	19.7993	0.96500	0.0:1.0:0.0:0.0	.	797;366	Q9NWH9;A8K5V8	SLTM_HUMAN;.	I	797;363;366	ENSP00000369887:V797I	ENSP00000369887:V797I	V	-	1	0	SLTM	56967018	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.906000	0.75719	2.673000	0.90976	0.563000	0.77884	GTT		0.398	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
RNF111	54778	broad.mit.edu	37	15	59359141	59359141	+	Silent	SNP	T	T	C	rs75252387		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:59359141T>C	ENST00000557998.1	+	6	1832	c.1545T>C	c.(1543-1545)caT>caC	p.H515H	RNF111_ENST00000561186.1_Silent_p.H515H|RNF111_ENST00000434298.1_Silent_p.H515H|RNF111_ENST00000348370.4_Silent_p.H515H|RNF111_ENST00000559209.1_Silent_p.H515H	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	515	His-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H515H(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TTCAACATCATCACCACCACC	0.512																																					p.H515H	NSCLC(72;983 1365 10746 34387 47081)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1545C	15						.						248.0	173.0	198.0					15																	59359141		2192	4291	6483	57146433	SO:0001819	synonymous_variant	54778	exon6			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1545T>C	15.37:g.59359141T>C			57146433	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Silent	SNP	ENST00000557998.1	37	CCDS58366.1																																																																																				0.512	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
MYO1E	4643	broad.mit.edu	37	15	59445908	59445908	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:59445908G>A	ENST00000288235.4	-	26	3360	c.2961C>T	c.(2959-2961)agC>agT	p.S987S	AC092757.1_ENST00000408169.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	987					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.S987S(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		AGGTGTACAGGCTTTTCTGAT	0.557																																					p.S987S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2961T	15						.						101.0	104.0	103.0					15																	59445908		2191	4291	6482	57233200	SO:0001819	synonymous_variant	4643	exon26			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2961C>T	15.37:g.59445908G>A			57233200	NM_004998	Q14778	Silent	SNP	ENST00000288235.4	37	CCDS32254.1																																																																																				0.557	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
HERC1	8925	broad.mit.edu	37	15	63950778	63950778	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:63950778G>T	ENST00000443617.2	-	48	9651	c.9564C>A	c.(9562-9564)acC>acA	p.T3188T		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3188					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T3188T(2)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCATGACCATGGTTCTGGCCA	0.483																																					p.T3188T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C9564A	15						.						67.0	65.0	65.0					15																	63950778		1974	4174	6148	61737831	SO:0001819	synonymous_variant	8925	exon48			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9564C>A	15.37:g.63950778G>T			61737831	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																				0.483	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
TRIP4	9325	broad.mit.edu	37	15	64689826	64689826	+	Missense_Mutation	SNP	G	G	A	rs144113386		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:64689826G>A	ENST00000261884.3	+	4	487	c.427G>A	c.(427-429)Gta>Ata	p.V143I	RN7SL595P_ENST00000582065.1_RNA|TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	143					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.V143I(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						CAGCAACTCCGTAAAGAAGAA	0.428																																					p.V143I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	15						.	G	ILE/VAL	0,4406		0,0,2203	72.0	68.0	69.0		427	1.7	1.0	15	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense	TRIP4	NM_016213.4	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	143/582	64689826	1,13005	2203	4300	6503	62476879	SO:0001583	missense	9325	exon4			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.427G>A	15.37:g.64689826G>A	ENSP00000261884:p.Val143Ile		62476879	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	37	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327504	0.41197	0.0	1.16E-4	ENSG00000103671	ENST00000261884	.	.	.	5.26	1.73	0.24493	.	0.724330	0.13692	N	0.369463	T	0.18635	0.0447	N	0.22421	0.69	0.09310	N	0.99999	B	0.29341	0.242	B	0.18561	0.022	T	0.15122	-1.0448	9	0.23891	T	0.37	-17.3636	5.5941	0.17317	0.2184:0.0:0.2286:0.553	.	143	Q15650	TRIP4_HUMAN	I	143	.	ENSP00000261884:V143I	V	+	1	0	TRIP4	62476879	0.692000	0.27719	1.000000	0.80357	0.897000	0.52465	1.518000	0.35877	0.535000	0.28714	0.557000	0.71058	GTA		0.428	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
CILP	8483	broad.mit.edu	37	15	65489979	65489979	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:65489979C>A	ENST00000261883.4	-	9	2811	c.2645G>T	c.(2644-2646)aGg>aTg	p.R882M		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	882					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.R882M(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGAGTTGGGCCTTGGCTTGGC	0.557																																					p.R882M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2645T	15						.						84.0	76.0	79.0					15																	65489979		2202	4299	6501	63277032	SO:0001583	missense	8483	exon9			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.2645G>T	15.37:g.65489979C>A	ENSP00000261883:p.Arg882Met		63277032	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399069	0.62177	.	.	ENSG00000138615	ENST00000261883	T	0.10288	2.89	5.5	5.5	0.81552	.	0.121726	0.85682	D	0.000000	T	0.23806	0.0576	L	0.53249	1.67	0.48288	D	0.999626	D	0.59357	0.985	P	0.53649	0.731	T	0.00101	-1.2064	10	0.72032	D	0.01	-8.0343	18.7542	0.91826	0.0:1.0:0.0:0.0	.	882	O75339	CILP1_HUMAN	M	882	ENSP00000261883:R882M	ENSP00000261883:R882M	R	-	2	0	CILP	63277032	0.959000	0.32827	1.000000	0.80357	0.917000	0.54804	1.634000	0.37123	2.735000	0.93741	0.655000	0.94253	AGG		0.557	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
DIS3L	115752	broad.mit.edu	37	15	66625346	66625346	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:66625346G>A	ENST00000319212.4	+	17	2911	c.2861G>A	c.(2860-2862)aGa>aAa	p.R954K	DIS3L_ENST00000319194.5_Missense_Mutation_p.R871K|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	954					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.R871K(1)|p.R954K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGCTAGGTAAGAATATCCATA	0.289																																					p.R954K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2861A	15						.						40.0	42.0	41.0					15																	66625346		2198	4297	6495	64412400	SO:0001583	missense	115752	exon17				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2861G>A	15.37:g.66625346G>A	ENSP00000321711:p.Arg954Lys		64412400	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	G	9.631	1.136539	0.21123	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.20598	2.06;2.06	5.64	2.41	0.29592	.	0.326495	0.34700	N	0.003747	T	0.12732	0.0309	L	0.35723	1.085	0.20403	N	0.999907	B	0.16166	0.016	B	0.13407	0.009	T	0.34428	-0.9829	10	0.13853	T	0.58	-4.6475	5.6467	0.17594	0.2551:0.0:0.6115:0.1334	.	954	Q8TF46	DI3L1_HUMAN	K	871;954	ENSP00000321583:R871K;ENSP00000321711:R954K	ENSP00000321583:R871K	R	+	2	0	DIS3L	64412400	0.150000	0.22732	0.225000	0.23894	0.955000	0.61496	1.517000	0.35867	0.192000	0.20272	0.655000	0.94253	AGA		0.289	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
CORO2B	10391	broad.mit.edu	37	15	68937509	68937509	+	Missense_Mutation	SNP	G	G	A	rs370083446		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:68937509G>A	ENST00000566799.1	+	2	55	c.26G>A	c.(25-27)cGt>cAt	p.R9H	CORO2B_ENST00000261861.5_Missense_Mutation_p.R4H|CORO2B_ENST00000543950.1_Missense_Mutation_p.R4H|CORO2B_ENST00000540068.1_Missense_Mutation_p.R4H			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	9					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.R9H(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						ATGTCCTGGCGTCCGCAATAC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17917	0.0		0.0	False		,,,				2504	0.001				p.R9H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G26A	15						.						66.0	58.0	61.0					15																	68937509		2200	4298	6498	66724563	SO:0001583	missense	10391	exon2			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.26G>A	15.37:g.68937509G>A	ENSP00000454783:p.Arg9His		66724563	NM_006091	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308731	0.40895	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.60040	0.22;0.22	4.38	3.47	0.39725	.	0.051910	0.85682	D	0.000000	T	0.45276	0.1334	L	0.36672	1.1	0.54753	D	0.999987	B	0.12013	0.005	B	0.08055	0.003	T	0.31971	-0.9924	10	0.33141	T	0.24	-4.2981	11.4994	0.50428	0.0902:0.0:0.9098:0.0	.	9	Q9UQ03	COR2B_HUMAN	H	9;4;4	ENSP00000446250:R4H;ENSP00000443819:R4H	ENSP00000261861:R9H	R	+	2	0	CORO2B	66724563	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.662000	0.83803	0.962000	0.38057	-0.244000	0.11960	CGT		0.627	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
TMC3	342125	broad.mit.edu	37	15	81631844	81631844	+	Splice_Site	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:81631844A>G	ENST00000359440.5	-	17	1981	c.1846T>C	c.(1846-1848)Tcc>Ccc	p.S616P	TMC3_ENST00000558726.1_Splice_Site_p.S617P|RP11-761I4.3_ENST00000559277.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3									p.S616P(1)		autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						AAGTTGTTGGATCTGCAGATA	0.458																																					p.S616P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1846C	15						.						95.0	97.0	96.0					15																	81631844		2018	4191	6209	79418899	SO:0001630	splice_region_variant	342125	exon17			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.1845-1T>C	15.37:g.81631844A>G			79418899	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	37	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257818	0.80246	.	.	ENSG00000188869	ENST00000359440	T	0.70631	-0.5	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	M	0.89214	3.015	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89043	0.3450	10	0.87932	D	0	-34.3917	15.2874	0.73838	1.0:0.0:0.0:0.0	.	616;616	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	P	616	ENSP00000352413:S616P	ENSP00000352413:S616P	S	-	1	0	TMC3	79418899	1.000000	0.71417	0.999000	0.59377	0.677000	0.39632	8.644000	0.91044	2.248000	0.74166	0.459000	0.35465	TCC		0.458	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	Missense_Mutation
BTBD1	53339	broad.mit.edu	37	15	83710482	83710482	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:83710482G>A	ENST00000261721.4	-	4	1062	c.860C>T	c.(859-861)gCa>gTa	p.A287V	BTBD1_ENST00000560015.1_5'UTR|RP11-382A20.7_ENST00000570202.1_RNA|RP11-382A20.6_ENST00000568441.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.A287V|RP11-382A20.5_ENST00000566841.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	287					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)		p.A287V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		ACCCTTACCTGCTGCAAATTC	0.408																																					p.A287V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C860T	15						.						87.0	89.0	89.0					15																	83710482		2203	4300	6503	81501486	SO:0001583	missense	53339	exon4			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.860C>T	15.37:g.83710482G>A	ENSP00000261721:p.Ala287Val		81501486	NM_025238	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	ENST00000261721.4	37	CCDS10322.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645869	0.87958	.	.	ENSG00000064726	ENST00000261721;ENST00000379403	T;T	0.77489	-1.1;-1.02	5.62	5.62	0.85841	BTB/Kelch-associated (1);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	L	0.33485	1.01	0.80722	D	1	P;B	0.39376	0.67;0.237	P;B	0.46718	0.525;0.196	T	0.78391	-0.2222	10	0.54805	T	0.06	-20.6143	19.6517	0.95819	0.0:0.0:1.0:0.0	.	287;287	A6NMI8;Q9H0C5	.;BTBD1_HUMAN	V	287	ENSP00000261721:A287V;ENSP00000368713:A287V	ENSP00000261721:A287V	A	-	2	0	BTBD1	81501486	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.618000	0.98365	2.662000	0.90505	0.655000	0.94253	GCA		0.408	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1		
ACAN	176	broad.mit.edu	37	15	89381931	89381931	+	Silent	SNP	G	G	A	rs569119258	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:89381931G>A	ENST00000561243.1	+	2	108	c.108G>A	c.(106-108)ccG>ccA	p.P36P	ACAN_ENST00000559004.1_Silent_p.P36P|ACAN_ENST00000439576.2_Silent_p.P36P|ACAN_ENST00000352105.7_Silent_p.P36P|ACAN_ENST00000558207.1_Silent_p.P36P			P16112	PGCA_HUMAN	aggrecan	36	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.P36P(1)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCCCCCAACCGTCCCCGCTGA	0.627													G|||	3	0.000599042	0.0	0.0	5008	,	,		18832	0.003		0.0	False		,,,				2504	0.0				p.P36P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G108A	15						.						108.0	118.0	115.0					15																	89381931		2014	4177	6191	87182935	SO:0001819	synonymous_variant	176	exon3			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.108G>A	15.37:g.89381931G>A			87182935	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																				0.627	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
POLG	5428	broad.mit.edu	37	15	89864378	89864378	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr15:89864378G>A	ENST00000268124.5	-	17	3045	c.2712C>T	c.(2710-2712)gaC>gaT	p.D904D	POLG_ENST00000442287.2_Silent_p.D904D	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	904					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.D904D(2)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CAAAGTGGGCGTCTCCAAGCA	0.587								DNA polymerases (catalytic subunits)																													p.D904D	Colon(73;648 1203 11348 18386 27782)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.C2712T	15						.						73.0	78.0	77.0					15																	89864378		2200	4299	6499	87665382	SO:0001819	synonymous_variant	5428	exon17			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2712C>T	15.37:g.89864378G>A			87665382	NM_001126131	Q8NFM2|Q92515	Silent	SNP	ENST00000268124.5	37	CCDS10350.1																																																																																				0.587	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
EXOC3L1	283849	broad.mit.edu	37	16	67220789	67220790	+	Splice_Site	INS	-	-	G	rs201107172		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:67220789_67220790insG	ENST00000314586.6	-	7	1399		c.e7-2		KIAA0895L_ENST00000563902.1_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1						exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)		p.?(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CACACTTGCCTGGGGGGAGGGG	0.584																																					.												.	.	2	Unknown(2)	large_intestine(2)	.	16						.																																			65778291	SO:0001630	splice_region_variant	283849	.			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1159-2->C	16.37:g.67220795_67220795dupG			65778290	.	A8K7I9|Q8NAD2|Q8TEN2	Splice_Site	INS	ENST00000314586.6	37	CCDS10832.1																																																																																				0.584	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516	Intron
XYLT1	64131	broad.mit.edu	37	16	17211766	17211766	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:17211766T>C	ENST00000261381.6	-	11	2378	c.2294A>G	c.(2293-2295)gAg>gGg	p.E765G		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	765					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.E765G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACCCACCGGCTCATCCATGGG	0.567																																					p.E765G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2294G	16						.						121.0	101.0	108.0					16																	17211766		2197	4300	6497	17119267	SO:0001583	missense	64131	exon11			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2294A>G	16.37:g.17211766T>C	ENSP00000261381:p.Glu765Gly		17119267	NM_022166	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735171	0.89482	.	.	ENSG00000103489	ENST00000261381	T	0.54866	0.55	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77720	-0.2482	10	0.72032	D	0.01	-32.2574	14.3325	0.66566	0.0:0.0:0.0:1.0	.	765	Q86Y38	XYLT1_HUMAN	G	765	ENSP00000261381:E765G	ENSP00000261381:E765G	E	-	2	0	XYLT1	17119267	1.000000	0.71417	0.999000	0.59377	0.934000	0.57294	8.036000	0.88901	2.026000	0.59711	0.379000	0.24179	GAG		0.567	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
C16orf62	57020	broad.mit.edu	37	16	19648948	19648948	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:19648948C>T	ENST00000251143.5	+	20	1680	c.1668C>T	c.(1666-1668)caC>caT	p.H556H	C16orf62_ENST00000448695.1_Silent_p.H406H|C16orf62_ENST00000542263.1_Silent_p.H578H|C16orf62_ENST00000543152.1_Silent_p.H305H|C16orf62_ENST00000438132.3_Silent_p.H645H|C16orf62_ENST00000417362.2_Silent_p.H489H			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	556						integral component of membrane (GO:0016021)		p.H556H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TTATTGCCCACTTCCATGACT	0.289																																					p.H645H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1935T	16						.						95.0	94.0	94.0					16																	19648948		2196	4297	6493	19556449	SO:0001819	synonymous_variant	57020	exon20				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1668C>T	16.37:g.19648948C>T			19556449	NM_020314	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	ENST00000251143.5	37																																																																																					0.289	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	
COG7	91949	broad.mit.edu	37	16	23415033	23415033	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:23415033C>T	ENST00000307149.5	-	13	1970	c.1785G>A	c.(1783-1785)ttG>ttA	p.L595L		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	595					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.L595L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TCGAAATAAGCAACAGCTGTT	0.542																																					p.L595L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1785A	16						.						91.0	82.0	85.0					16																	23415033		2197	4300	6497	23322534	SO:0001819	synonymous_variant	91949	exon13			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1785G>A	16.37:g.23415033C>T			23322534	NM_153603	Q6UWU7	Silent	SNP	ENST00000307149.5	37	CCDS10610.1																																																																																				0.542	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		
PLK1	5347	broad.mit.edu	37	16	23695329	23695329	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:23695329C>A	ENST00000300093.4	+	5	1066	c.955C>A	c.(955-957)Ctg>Atg	p.L319M		NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	319					activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.L319M(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		CATCACCTGCCTGACCATTCC	0.547																																					p.L319M	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C955A	16						.						157.0	161.0	160.0					16																	23695329		2197	4300	6497	23602830	SO:0001583	missense	5347	exon5				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.955C>A	16.37:g.23695329C>A	ENSP00000300093:p.Leu319Met		23602830	NM_005030	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297118	0.81025	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.26067	1.76	5.28	5.28	0.74379	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53634	-0.8411	10	0.72032	D	0.01	-24.3887	10.2572	0.43405	0.0:0.9092:0.0:0.0908	.	319	P53350	PLK1_HUMAN	M	319;222	ENSP00000300093:L319M	ENSP00000300093:L319M	L	+	1	2	PLK1	23602830	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.481000	0.66826	2.620000	0.88729	0.655000	0.94253	CTG		0.547	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
ERN2	10595	broad.mit.edu	37	16	23706242	23706242	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:23706242C>T	ENST00000457008.2	-	16	1789	c.1751G>A	c.(1750-1752)cGg>cAg	p.R584Q	ERN2_ENST00000256797.4_Missense_Mutation_p.R684Q					endoplasmic reticulum to nucleus signaling 2									p.R684Q(1)		large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CTTCAGGTCCCGGTGCACTGT	0.622																																					p.R684Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2051A	16						.						50.0	51.0	51.0					16																	23706242		2197	4300	6497	23613743	SO:0001583	missense	10595	exon17			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1751G>A	16.37:g.23706242C>T	ENSP00000413812:p.Arg584Gln		23613743	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	37		.	.	.	.	.	.	.	.	.	.	C	33	5.223216	0.95139	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.65916	-0.18;-0.18	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90064	0.4158	10	0.87932	D	0	.	16.9969	0.86370	0.0:1.0:0.0:0.0	.	584;636	E7ETG2;A5YM65	.;.	Q	684;584	ENSP00000256797:R684Q;ENSP00000413812:R584Q	ENSP00000256797:R684Q	R	-	2	0	ERN2	23613743	1.000000	0.71417	0.976000	0.42696	0.691000	0.40173	7.384000	0.79751	2.676000	0.91093	0.655000	0.94253	CGG		0.622	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
ERN2	10595	broad.mit.edu	37	16	23707286	23707286	+	Silent	SNP	G	G	A	rs61730173	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:23707286G>A	ENST00000457008.2	-	13	1421	c.1383C>T	c.(1381-1383)acC>acT	p.T461T	ERN2_ENST00000256797.4_Silent_p.T561T					endoplasmic reticulum to nucleus signaling 2									p.T561T(1)		large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCCCCACTACGGTGAGTTGCT	0.622													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17019	0.0		0.0	False		,,,				2504	0.0				p.T561T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1683T	16						.	G		8,4386	14.3+/-33.2	0,8,2189	48.0	45.0	46.0		1683	-11.9	0.1	16	dbSNP_129	46	0,8600		0,0,4300	no	coding-synonymous	ERN2	NM_033266.3		0,8,6489	AA,AG,GG		0.0,0.1821,0.0616		561/975	23707286	8,12986	2197	4300	6497	23614787	SO:0001819	synonymous_variant	10595	exon14			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1383C>T	16.37:g.23707286G>A			23614787	NM_033266		Silent	SNP	ENST00000457008.2	37																																																																																					0.622	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
SLC5A11	115584	broad.mit.edu	37	16	24881272	24881272	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:24881272C>A	ENST00000347898.3	+	4	880	c.258C>A	c.(256-258)ggC>ggA	p.G86G	SLC5A11_ENST00000545376.1_Intron|SLC5A11_ENST00000567758.1_Silent_p.G86G|SLC5A11_ENST00000539472.1_Silent_p.G22G|SLC5A11_ENST00000568579.1_Intron|SLC5A11_ENST00000449109.2_Silent_p.G22G|SLC5A11_ENST00000565769.1_Silent_p.G22G|SLC5A11_ENST00000569071.1_Silent_p.G22G|SLC5A11_ENST00000424767.2_Silent_p.G86G	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.G86G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		ATTTCATTGGCCTGGCAGGGT	0.473																																					p.G86G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C258A	16						.						119.0	97.0	105.0					16																	24881272		2197	4300	6497	24788773	SO:0001819	synonymous_variant	115584	exon4			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.258C>A	16.37:g.24881272C>A			24788773	NM_052944		Silent	SNP	ENST00000347898.3	37	CCDS10625.1																																																																																				0.473	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	
ATXN2L	11273	broad.mit.edu	37	16	28845724	28845724	+	Missense_Mutation	SNP	C	C	T	rs560637561	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:28845724C>T	ENST00000336783.4	+	17	2400	c.2233C>T	c.(2233-2235)Cgg>Tgg	p.R745W	ATXN2L_ENST00000395547.2_Missense_Mutation_p.R745W|ATXN2L_ENST00000340394.8_Missense_Mutation_p.R745W|ATXN2L_ENST00000570200.1_Missense_Mutation_p.R745W|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000565845.1_3'UTR|ATXN2L_ENST00000325215.6_Missense_Mutation_p.R745W|ATXN2L_ENST00000382686.4_Missense_Mutation_p.R745W|ATXN2L_ENST00000564304.1_Missense_Mutation_p.R751W	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	745					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)	p.R745W(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GGGCAAGTACCGGGGAGCAAA	0.602																																					p.R745W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2233T	16						.						85.0	81.0	82.0					16																	28845724		2197	4300	6497	28753225	SO:0001583	missense	11273	exon17				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.2233C>T	16.37:g.28845724C>T	ENSP00000338718:p.Arg745Trp		28753225	NM_148415	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	CCDS10641.1	.	.	.	.	.	.	.	.	.	.	.	19.75	3.885050	0.72410	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.55052	0.55;0.56;0.58;0.55;0.54	5.79	5.79	0.91817	.	0.165132	0.40222	N	0.001147	T	0.64516	0.2605	L	0.48642	1.525	0.41991	D	0.990844	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.74674	0.984;0.965;0.965;0.984;0.984;0.965;0.984	T	0.61332	-0.7084	10	0.37606	T	0.19	-17.6156	13.7254	0.62754	0.1542:0.8458:0.0:0.0	.	745;745;745;745;745;745;745	Q8WWM7-6;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;ATX2L_HUMAN;.;.;.;.	W	745	ENSP00000341459:R745W;ENSP00000378917:R745W;ENSP00000338718:R745W;ENSP00000372133:R745W;ENSP00000315650:R745W	ENSP00000315650:R745W	R	+	1	2	ATXN2L	28753225	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.513000	0.35823	2.739000	0.93911	0.563000	0.77884	CGG		0.602	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245	
ZNF689	115509	broad.mit.edu	37	16	30616047	30616047	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:30616047G>A	ENST00000287461.3	-	3	1378	c.1041C>T	c.(1039-1041)tgC>tgT	p.C347C	ZNF689_ENST00000566673.1_5'UTR|RP11-146F11.5_ENST00000563540.1_RNA	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	347					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C347C(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			CACAGTGCTCGCAGGCATAGG	0.677																																					p.C347C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1041T	16						.						28.0	27.0	28.0					16																	30616047		2197	4300	6497	30523548	SO:0001819	synonymous_variant	115509	exon3			BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.1041C>T	16.37:g.30616047G>A			30523548	NM_138447	Q658J5	Missense_Mutation	SNP	ENST00000287461.3	37	CCDS10686.1																																																																																				0.677	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255552.1	NM_138447	
KAT8	84148	broad.mit.edu	37	16	31142107	31142107	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:31142107C>A	ENST00000543774.2	+	11	1533	c.1198C>A	c.(1198-1200)Ctg>Atg	p.L400M	KAT8_ENST00000448516.2_Missense_Mutation_p.L400M|KAT8_ENST00000219797.4_Missense_Mutation_p.L400M|RP11-388M20.2_ENST00000563605.1_RNA			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	400	MYST-type HAT.|Sufficient for interaction with KANSL1.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)	p.L400M(1)									CATCAGTACCCTGCAATCCCT	0.512																																					p.L400M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1198A	16						.						130.0	110.0	117.0					16																	31142107		2197	4300	6497	31049608	SO:0001583	missense	84148	exon10			AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.1198C>A	16.37:g.31142107C>A	ENSP00000456933:p.Leu400Met		31049608	NM_032188	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	ENST00000543774.2	37	CCDS10706.1	.	.	.	.	.	.	.	.	.	.	c	13.84	2.357332	0.41801	.	.	ENSG00000103510	ENST00000219797;ENST00000448516	.	.	.	5.03	4.08	0.47627	.	0.000000	0.64402	D	0.000001	T	0.78349	0.4269	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79976	-0.1576	9	0.66056	D	0.02	-16.0308	8.9001	0.35490	0.0:0.8283:0.0:0.1717	.	400;400	Q9H7Z6;G5E9P2	KAT8_HUMAN;.	M	400	.	ENSP00000219797:L400M	L	+	1	2	KAT8	31049608	0.921000	0.31238	0.959000	0.39883	0.147000	0.21601	1.942000	0.40243	1.366000	0.46076	0.651000	0.88453	CTG		0.512	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000255546.3	NM_032188	
ZNF423	23090	broad.mit.edu	37	16	49660124	49660124	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:49660124C>A	ENST00000561648.1	-	5	3587	c.3534G>T	c.(3532-3534)gaG>gaT	p.E1178D	ZNF423_ENST00000535559.1_Missense_Mutation_p.E1061D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E1118D|ZNF423_ENST00000563137.2_Missense_Mutation_p.E1118D|ZNF423_ENST00000562520.1_Missense_Mutation_p.E1118D|ZNF423_ENST00000262383.2_Missense_Mutation_p.E1178D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E1061D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1178					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1178D(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CTCTCTCGTTCTCGAAGGTCA	0.433																																					p.E1178D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3534T	16						.						320.0	280.0	293.0					16																	49660124		2199	4300	6499	48217625	SO:0001583	missense	23090	exon6			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3534G>T	16.37:g.49660124C>A	ENSP00000455426:p.Glu1178Asp		48217625	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566464	0.65651	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.28069	1.63;1.63	4.81	3.83	0.44106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	N	0.24115	0.695	0.42732	D	0.993718	D	0.58970	0.984	P	0.52957	0.714	T	0.02676	-1.1125	9	.	.	.	-34.5409	13.9636	0.64196	0.0:0.9219:0.0:0.0781	.	1178	Q2M1K9	ZN423_HUMAN	D	1178;1061	ENSP00000262383:E1178D;ENSP00000442321:E1061D	.	E	-	3	2	ZNF423	48217625	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.054000	0.49908	2.399000	0.81585	0.306000	0.20318	GAG		0.433	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
CHD9	80205	broad.mit.edu	37	16	53337937	53337937	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:53337937G>A	ENST00000398510.3	+	30	6106	c.6019G>A	c.(6019-6021)Gct>Act	p.A2007T	CHD9_ENST00000566029.1_Missense_Mutation_p.A2007T|CHD9_ENST00000447540.1_Missense_Mutation_p.A2007T|CHD9_ENST00000564845.1_Missense_Mutation_p.A2007T			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2007					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.A2007T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AAGTAAGATGGCTCATTCAAG	0.458																																					p.A2007T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6019A	16						.						141.0	133.0	135.0					16																	53337937		1943	4147	6090	51895438	SO:0001583	missense	80205	exon31			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6019G>A	16.37:g.53337937G>A	ENSP00000381522:p.Ala2007Thr		51895438	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	G	12.04	1.817423	0.32145	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	T;T	0.72835	-0.69;-0.69	6.16	1.49	0.22878	.	0.196145	0.35525	N	0.003149	T	0.48077	0.1480	N	0.10874	0.06	0.28929	N	0.891651	B;B;B;B	0.15473	0.0;0.013;0.0;0.001	B;B;B;B	0.17979	0.0;0.02;0.002;0.004	T	0.38351	-0.9665	10	0.27785	T	0.31	-6.0582	11.0537	0.47905	0.3356:0.0:0.6643:0.0	.	2007;2007;2007;2007	B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	T	2007	ENSP00000396345:A2007T;ENSP00000381522:A2007T	ENSP00000381522:A2007T	A	+	1	0	CHD9	51895438	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.795000	0.26972	0.468000	0.27243	0.650000	0.86243	GCT		0.458	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CES5A	221223	broad.mit.edu	37	16	55905602	55905602	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:55905602A>G	ENST00000290567.9	-	3	473	c.352T>C	c.(352-354)Tca>Cca	p.S118P	CES5A_ENST00000319165.9_Missense_Mutation_p.S118P|CES5A_ENST00000520435.1_Intron|CES5A_ENST00000521992.1_Missense_Mutation_p.S147P|CES5A_ENST00000518005.1_Missense_Mutation_p.S12P|CES5A_ENST00000541580.1_Intron	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	118						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.S118P(1)|p.S147P(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CAGTCTTCTGACACTCCGAAT	0.547																																					p.S118P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T352C	16						.						101.0	78.0	86.0					16																	55905602		2198	4300	6498	54463103	SO:0001583	missense	221223	exon3			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.352T>C	16.37:g.55905602A>G	ENSP00000290567:p.Ser118Pro		54463103	NM_001143685	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323930	0.81580	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000536025	T;T;T;T;T	0.73469	2.94;2.94;2.94;2.94;-0.75	5.14	5.14	0.70334	Carboxylesterase, type B (1);	0.000000	0.39834	N	0.001245	D	0.90930	0.7149	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	D	0.93396	0.6756	10	0.87932	D	0	.	11.6701	0.51396	1.0:0.0:0.0:0.0	.	118;118	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	P	147;118;12;118;12	ENSP00000428864:S147P;ENSP00000324271:S118P;ENSP00000428571:S12P;ENSP00000290567:S118P;ENSP00000439810:S12P	ENSP00000290567:S118P	S	-	1	0	CES5A	54463103	1.000000	0.71417	0.478000	0.27316	0.061000	0.15899	7.258000	0.78371	2.065000	0.61736	0.533000	0.62120	TCA		0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
MT1G	4495	broad.mit.edu	37	16	56700795	56700795	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:56700795G>A	ENST00000379811.3	-	3	256	c.185C>T	c.(184-186)gCc>gTc	p.A62V	MT1H_ENST00000569155.1_5'Flank|MT1G_ENST00000568675.1_3'UTR|MT1G_ENST00000569500.1_Missense_Mutation_p.A39V|MT1G_ENST00000444837.2_Missense_Mutation_p.A61V|MT1H_ENST00000332374.4_5'Flank			P13640	MT1G_HUMAN	metallothionein 1G	62	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to copper ion (GO:0071280)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cellular response to zinc ion (GO:0071294)|monocyte activation (GO:0042117)|monocyte differentiation (GO:0030224)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.A61V(1)		kidney(2)|large_intestine(1)|lung(2)	5						CCGACATCAGGCGCAGCAGCT	0.547																																					p.A61V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C182T	16						.						80.0	83.0	82.0					16																	56700795		2198	4300	6498	55258296	SO:0001583	missense	4495	exon3			BC020757	CCDS10766.1	16q13	2008-02-05			ENSG00000125144	ENSG00000125144		"""Metallothioneins"""	7399	protein-coding gene	gene with protein product	"""metallothionein 1K"""	156353		MT1		3403543, 6089206	Standard	NM_001301267		Approved	MT1K	uc002eju.1	P13640	OTTHUMG00000133275	ENST00000379811.3:c.185C>T	16.37:g.56700795G>A	ENSP00000369139:p.Ala62Val		55258296	NM_005950	P80296	Missense_Mutation	SNP	ENST00000379811.3	37		.	.	.	.	.	.	.	.	.	.	G	9.700	1.154155	0.21371	.	.	ENSG00000125144	ENST00000379811;ENST00000444837	T;T	0.10099	2.91;2.91	2.94	1.83	0.25207	.	0.286046	0.28365	U	0.015610	T	0.10981	0.0268	.	.	.	0.80722	D	1	P	0.34684	0.463	B	0.38616	0.277	T	0.08513	-1.0718	9	0.87932	D	0	.	7.4957	0.27487	0.0:0.0:0.522:0.478	.	61	P13640-2	.	V	62;61	ENSP00000369139:A62V;ENSP00000391397:A61V	ENSP00000369139:A62V	A	-	2	0	MT1G	55258296	0.960000	0.32886	0.971000	0.41717	0.011000	0.07611	1.597000	0.36729	1.638000	0.50547	0.174000	0.16983	GCC		0.547	MT1G-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000257054.1	NM_005950	
GPR97	222487	broad.mit.edu	37	16	57714447	57714447	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:57714447A>T	ENST00000333493.4	+	8	960	c.799A>T	c.(799-801)Atc>Ttc	p.I267F	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Missense_Mutation_p.I147F|GPR97_ENST00000327655.6_Missense_Mutation_p.I57F	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	267					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I267F(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CACGGTGCATATCCTCACACG	0.582																																					p.I267F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A799T	16						.						147.0	127.0	134.0					16																	57714447		2198	4300	6498	56271948	SO:0001583	missense	222487	exon8			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.799A>T	16.37:g.57714447A>T	ENSP00000332900:p.Ile267Phe		56271948	NM_170776	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	37	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	a	15.58	2.875037	0.51695	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.35605	1.55;1.3;1.55	5.26	-3.97	0.04094	.	0.922220	0.09211	N	0.833315	T	0.26195	0.0639	L	0.43646	1.37	0.09310	N	1	B	0.32939	0.391	B	0.33392	0.163	T	0.31138	-0.9954	10	0.72032	D	0.01	.	6.1354	0.20230	0.5527:0.0:0.3177:0.1296	.	267	Q86Y34	GPR97_HUMAN	F	267;57;147	ENSP00000332900:I267F;ENSP00000331199:I57F;ENSP00000404803:I147F	ENSP00000331199:I57F	I	+	1	0	GPR97	56271948	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.119000	0.10676	-0.738000	0.04817	-0.471000	0.05019	ATC		0.582	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
CDH11	1009	broad.mit.edu	37	16	65016045	65016045	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:65016045T>C	ENST00000268603.4	-	8	1774	c.1159A>G	c.(1159-1161)Agt>Ggt	p.S387G	CDH11_ENST00000566827.1_Missense_Mutation_p.S261G|CDH11_ENST00000394156.3_Missense_Mutation_p.S387G	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	387	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S387G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TGGATGTAACTTGGGGCCAAG	0.522			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.S387G			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1159G	16						.						156.0	132.0	140.0					16																	65016045		2203	4300	6503	63573546	SO:0001583	missense	1009	exon8			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1159A>G	16.37:g.65016045T>C	ENSP00000268603:p.Ser387Gly		63573546	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396772	0.62177	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.02579	4.24;4.24	5.76	4.67	0.58626	Cadherin (2);Cadherin-like (1);	0.079991	0.85682	D	0.000000	T	0.05364	0.0142	L	0.50919	1.6	0.42144	D	0.991524	D;B	0.56746	0.977;0.073	P;B	0.50270	0.636;0.045	T	0.52472	-0.8571	10	0.27785	T	0.31	.	8.5175	0.33255	0.0:0.1486:0.0:0.8514	.	387;387	P55287-2;P55287	.;CAD11_HUMAN	G	387;387;370	ENSP00000268603:S387G;ENSP00000377711:S387G	ENSP00000268603:S387G	S	-	1	0	CDH11	63573546	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.855000	0.69510	1.116000	0.41820	0.533000	0.62120	AGT		0.522	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CES2	8824	broad.mit.edu	37	16	66976106	66976106	+	Silent	SNP	G	G	A	rs368901475		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:66976106G>A	ENST00000317091.4	+	9	2412	c.1428G>A	c.(1426-1428)gcG>gcA	p.A476A	RP11-361L15.4_ENST00000566869.1_RNA|CES2_ENST00000417689.1_Silent_p.A476A	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	412					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.A476A(1)		breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	AGATGATGGCGGACTCCATGT	0.547																																					p.A476A	Ovarian(70;1230 1691 37888 38351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1428A	16						.	A	,	0,4400		0,0,2200	127.0	105.0	113.0		1428,1428	-5.1	0.0	16		113	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CES2	NM_003869.5,NM_198061.2	,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	476/624,476/608	66976106	1,12999	2200	4300	6500	65533607	SO:0001819	synonymous_variant	8824	exon9			BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.1428G>A	16.37:g.66976106G>A			65533607	NM_198061	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Silent	SNP	ENST00000317091.4	37	CCDS10825.1																																																																																				0.547	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268838.2	NM_003869	
LRRC36	55282	broad.mit.edu	37	16	67405099	67405099	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:67405099C>T	ENST00000329956.6	+	9	1467	c.1448C>T	c.(1447-1449)gCc>gTc	p.A483V	LRRC36_ENST00000541146.1_Silent_p.C7C|LRRC36_ENST00000435835.3_Missense_Mutation_p.A362V|LRRC36_ENST00000290940.7_Missense_Mutation_p.A215V|LRRC36_ENST00000563189.1_Missense_Mutation_p.A362V	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	483								p.A483V(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		AATATCCTTGCCAACCTGAAT	0.468																																					p.A483V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1448T	16						.						146.0	133.0	137.0					16																	67405099		2198	4300	6498	65962600	SO:0001583	missense	55282	exon9			BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.1448C>T	16.37:g.67405099C>T	ENSP00000329943:p.Ala483Val		65962600	NM_018296	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	37	CCDS32467.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008879	0.75046	.	.	ENSG00000159708	ENST00000329956;ENST00000290940;ENST00000435835	T;T;T	0.54866	2.89;0.55;1.28	5.67	1.33	0.21861	.	0.484716	0.19042	N	0.124275	T	0.49525	0.1562	L	0.50333	1.59	0.18873	N	0.999983	B;B;D;P	0.56521	0.077;0.077;0.976;0.93	B;B;P;P	0.52823	0.025;0.025;0.677;0.71	T	0.42666	-0.9438	10	0.72032	D	0.01	-0.2851	2.1105	0.03702	0.1606:0.5138:0.1555:0.1701	.	362;215;362;483	B7Z7B3;Q9NV11;Q1X8D7-2;Q1X8D7	.;.;.;LRC36_HUMAN	V	483;215;362	ENSP00000329943:A483V;ENSP00000290940:A215V;ENSP00000411122:A362V	ENSP00000290940:A215V	A	+	2	0	LRRC36	65962600	0.390000	0.25213	1.000000	0.80357	0.982000	0.71751	0.255000	0.18333	0.351000	0.24027	0.655000	0.94253	GCC		0.468	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	NM_018296	
NUDT7	283927	broad.mit.edu	37	16	77759352	77759352	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:77759352G>A	ENST00000268533.5	+	2	129	c.60G>A	c.(58-60)aaG>aaA	p.K20K	NUDT7_ENST00000568787.1_Silent_p.K20K|NUDT7_ENST00000563839.1_Intron|NUDT7_ENST00000564085.1_Silent_p.K20K|NUDT7_ENST00000437314.3_Silent_p.K20K	NM_001105663.2	NP_001099133.1	P0C024	NUDT7_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 7	20					acetyl-CoA catabolic process (GO:0046356)|brown fat cell differentiation (GO:0050873)|coenzyme A catabolic process (GO:0015938)|nucleoside diphosphate metabolic process (GO:0009132)	peroxisome (GO:0005777)	acetyl-CoA hydrolase activity (GO:0003986)|hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides (GO:0016818)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|receptor binding (GO:0005102)|snoRNA binding (GO:0030515)	p.K20K(1)		breast(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|skin(1)	18						ATGATGCTAAGGCCCGCTTAA	0.378																																					p.K20K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G60A	16						.						119.0	115.0	117.0					16																	77759352		1829	4084	5913	76316853	SO:0001819	synonymous_variant	283927	exon2			AA227330	CCDS42195.1, CCDS58480.1, CCDS58479.1, CCDS73916.1	16q23.1	2007-06-15				ENSG00000140876		"""Nudix motif containing"""	8054	protein-coding gene	gene with protein product		609231				11415433	Standard	NM_001105663		Approved		uc010chd.3	P0C024		ENST00000268533.5:c.60G>A	16.37:g.77759352G>A			76316853	NM_001105663	B4DLE5|H3BUB8	Silent	SNP	ENST00000268533.5	37	CCDS42195.1																																																																																				0.378	NUDT7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433873.1		
PLCG2	5336	broad.mit.edu	37	16	81942093	81942093	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:81942093G>A	ENST00000359376.3	+	17	1844	c.1630G>A	c.(1630-1632)Gag>Aag	p.E544K		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	544	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.E544K(4)|p.E544*(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GACGAGTGCCGAGAAGTTGCT	0.547																																					p.E544K												.	.	6	Substitution - Missense(4)|Substitution - Nonsense(2)	large_intestine(4)|lung(2)	c.G1630A	16						.						78.0	82.0	81.0					16																	81942093		2016	4177	6193	80499594	SO:0001583	missense	5336	exon17				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1630G>A	16.37:g.81942093G>A	ENSP00000352336:p.Glu544Lys		80499594	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	35	5.471535	0.96274	.	.	ENSG00000197943	ENST00000359376	T	0.36157	1.27	4.85	4.85	0.62838	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);SH2 motif (4);	0.098987	0.64402	D	0.000002	T	0.68063	0.2960	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.72338	0.977;0.794	T	0.75175	-0.3410	10	0.46703	T	0.11	.	17.982	0.89144	0.0:0.0:1.0:0.0	.	411;544	B4E3H3;P16885	.;PLCG2_HUMAN	K	544	ENSP00000352336:E544K	ENSP00000352336:E544K	E	+	1	0	PLCG2	80499594	1.000000	0.71417	0.985000	0.45067	0.982000	0.71751	9.416000	0.97383	2.249000	0.74217	0.655000	0.94253	GAG		0.547	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
TLDC1	57707	broad.mit.edu	37	16	84520507	84520507	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:84520507G>T	ENST00000343629.6	-	5	870	c.688C>A	c.(688-690)Ctg>Atg	p.L230M	TLDC1_ENST00000561807.1_5'Flank|TLDC1_ENST00000535580.1_Missense_Mutation_p.L203M	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	230						lysosomal membrane (GO:0005765)		p.L230M(1)									TCAGGGACCAGGGTAGTCAGA	0.572																																					p.L230M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688A	16						.						50.0	47.0	48.0					16																	84520507		2200	4300	6500	83078008	SO:0001583	missense	57707	exon5			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.688C>A	16.37:g.84520507G>T	ENSP00000343635:p.Leu230Met		83078008	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373082	0.24857	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	T;T	0.13901	2.73;2.55	4.98	2.77	0.32553	.	0.401503	0.25192	N	0.032459	T	0.29684	0.0741	M	0.75264	2.295	0.36250	D	0.85386	D;D	0.89917	1.0;0.994	D;P	0.76575	0.988;0.89	T	0.23762	-1.0179	10	0.48119	T	0.1	-24.9599	4.5534	0.12124	0.2917:0.1811:0.5271:0.0	.	203;230	F5GWS3;Q6P9B6	.;K1609_HUMAN	M	230;203	ENSP00000343635:L230M;ENSP00000441997:L203M	ENSP00000343635:L230M	L	-	1	2	KIAA1609	83078008	0.972000	0.33761	0.827000	0.32855	0.014000	0.08584	1.206000	0.32321	1.082000	0.41137	0.563000	0.77884	CTG		0.572	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
AXIN1	8312	broad.mit.edu	37	16	396792	396792	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:396792delG	ENST00000262320.3	-	2	605	c.234delC	c.(232-234)cccfs	p.P78fs	AXIN1_ENST00000354866.3_Frame_Shift_Del_p.P78fs|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	78					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.T79fs*5(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				ATGGTGGGGTGGGGGAGGCAC	0.587											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P78fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.234delC	16						.						37.0	34.0	35.0					16																	396792		2203	4300	6503	336793	SO:0001589	frameshift_variant	8312	exon2			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.234delC	16.37:g.396792delG	ENSP00000262320:p.Pro78fs	588	336793	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	37	CCDS10405.1																																																																																				0.587	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
USP7	7874	broad.mit.edu	37	16	9017151	9017151	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:9017151T>G	ENST00000344836.4	-	3	502	c.304A>C	c.(304-306)Atg>Ctg	p.M102L	USP7_ENST00000566224.1_5'Flank|USP7_ENST00000535863.1_Missense_Mutation_p.M3L|USP7_ENST00000381886.4_Missense_Mutation_p.M86L	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	102	Interaction with TSPYL5.|Interaction with p53/TP53, MDM2 and EBNA1.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.|Necessary for nuclear localization.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.M102L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						AAGCGTGGCATCACCATAATC	0.468																																					p.M102L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A304C	16						.						172.0	159.0	164.0					16																	9017151		2197	4300	6497	8924652	SO:0001583	missense	7874	exon3			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.304A>C	16.37:g.9017151T>G	ENSP00000343535:p.Met102Leu		8924652	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	T	19.64	3.865735	0.71949	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.62364	0.03;3.32;0.03	5.57	5.57	0.84162	TRAF-like (1);MATH (3);	0.066504	0.85682	D	0.000000	T	0.68696	0.3029	M	0.83483	2.645	0.80722	D	1	B;B	0.27732	0.187;0.187	B;B	0.32342	0.144;0.144	T	0.69866	-0.5029	10	0.52906	T	0.07	.	16.0415	0.80687	0.0:0.0:0.0:1.0	.	102;86	Q93009;B7Z815	UBP7_HUMAN;.	L	102;110;3;3;44	ENSP00000343535:M102L;ENSP00000443646:M3L;ENSP00000439272:M44L	ENSP00000343535:M102L	M	-	1	0	USP7	8924652	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.867000	0.87062	2.254000	0.74563	0.533000	0.62120	ATG		0.468	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
GRIN2A	2903	broad.mit.edu	37	16	9934563	9934563	+	Missense_Mutation	SNP	G	G	A	rs397518468		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:9934563G>A	ENST00000396573.2	-	8	1901	c.1592C>T	c.(1591-1593)aCg>aTg	p.T531M	GRIN2A_ENST00000562109.1_Missense_Mutation_p.T531M|GRIN2A_ENST00000404927.2_Missense_Mutation_p.T531M|GRIN2A_ENST00000535259.1_Missense_Mutation_p.T374M|GRIN2A_ENST00000330684.3_Missense_Mutation_p.T531M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.T531M	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	531			T -> M (in FESD; affects receptor kinetics). {ECO:0000269|PubMed:23933818}.		directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T531M(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACTGATTCCCGTTTCCACAAA	0.468																																					p.T531M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1592T	16						.						135.0	107.0	117.0					16																	9934563		2197	4300	6497	9842064	SO:0001583	missense	2903	exon7				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1592C>T	16.37:g.9934563G>A	ENSP00000379818:p.Thr531Met		9842064	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822404	0.90873	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.1	5.1	0.69264	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.047909	0.85682	D	0.000000	T	0.60235	0.2253	M	0.84156	2.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	T	0.64829	-0.6315	9	.	.	.	.	17.5328	0.87819	0.0:0.0:1.0:0.0	.	374;531;531	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	531;531;374;531;531	ENSP00000379818:T531M;ENSP00000385872:T531M;ENSP00000441572:T374M;ENSP00000332549:T531M;ENSP00000379820:T531M	.	T	-	2	0	GRIN2A	9842064	1.000000	0.71417	0.959000	0.39883	0.965000	0.64279	9.695000	0.98691	2.363000	0.80096	0.655000	0.94253	ACG		0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ACD	65057	broad.mit.edu	37	16	67693646	67693648	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	GCA	GCA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:67693646_67693648delGCA	ENST00000393919.4	-	3	815_817	c.551_553delTGC	c.(550-555)ctgcag>cag	p.L184del	PARD6A_ENST00000458121.2_5'Flank|PARD6A_ENST00000219255.3_5'Flank|PARD6A_ENST00000602551.1_5'Flank|ACD_ENST00000219251.8_In_Frame_Del_p.L181del			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	184					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.L181delL(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CCGCAGTCCTGCAGCAGCAGCAG	0.65																																					p.184_185del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.551_553del	16						.																																			66251149	SO:0001651	inframe_deletion	65057	exon3			AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.551_553delTGC	16.37:g.67693655_67693657delGCA	ENSP00000377496:p.Leu184del		66251147	NM_001082486	Q562H5|Q9H8F9	In_Frame_Del	DEL	ENST00000393919.4	37	CCDS42181.1																																																																																				0.650	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268880.1	NM_022914	
ZCCHC14	23174	broad.mit.edu	37	16	87446685	87446685	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr16:87446685C>T	ENST00000268616.4	-	11	1526	c.1309G>A	c.(1309-1311)Gac>Aac	p.D437N		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	437							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.D437N(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		TCAGCGCTGTCGGAGCTCTCT	0.647																																					p.D437N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1309A	16						.						60.0	57.0	58.0					16																	87446685		2198	4300	6498	86004186	SO:0001583	missense	23174	exon11			AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.1309G>A	16.37:g.87446685C>T	ENSP00000268616:p.Asp437Asn		86004186	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009917	0.54361	.	.	ENSG00000140948	ENST00000268616	T	0.34667	1.35	5.31	4.34	0.51931	.	0.097504	0.64402	D	0.000002	T	0.47154	0.1430	L	0.34521	1.04	0.42293	D	0.992143	D;D	0.89917	1.0;0.996	D;P	0.63703	0.917;0.646	T	0.51236	-0.8731	10	0.72032	D	0.01	-35.9256	15.22	0.73303	0.1421:0.8579:0.0:0.0	.	437;437	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	N	437	ENSP00000268616:D437N	ENSP00000268616:D437N	D	-	1	0	ZCCHC14	86004186	1.000000	0.71417	0.793000	0.32043	0.029000	0.11900	6.489000	0.73641	1.197000	0.43143	0.407000	0.27541	GAC		0.647	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
TNFSF13	8741	broad.mit.edu	37	17	7462459	7462460	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:7462459_7462460insG	ENST00000338784.4	+	1	546_547	c.103_104insG	c.(103-105)tggfs	p.W35fs	SENP3_ENST00000321337.7_5'Flank|TNFSF13_ENST00000349228.4_Frame_Shift_Ins_p.W35fs|TNFSF13_ENST00000380535.4_Frame_Shift_Ins_p.W35fs|TNFSF13_ENST00000396542.1_Frame_Shift_Ins_p.W18fs|TNFSF13_ENST00000396545.4_Frame_Shift_Ins_p.W35fs|TNFSF12_ENST00000557233.1_Intron|TNFSF13_ENST00000483039.1_Intron|TNFSF12-TNFSF13_ENST00000293826.4_Intron	NM_003808.3	NP_003799.1	O75888	TNF13_HUMAN	tumor necrosis factor (ligand) superfamily, member 13	35					gene expression (GO:0010467)|immunoglobulin production in mucosal tissue (GO:0002426)|mRNA metabolic process (GO:0016071)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	receptor binding (GO:0005102)	p.A37fs*88(2)		large_intestine(2)|lung(2)|skin(1)	5		Prostate(122;0.157)				CTGGTTGAGTTGGGGGGCAGCT	0.639																																					p.W35fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.103_104insG	17						.																																			7403184	SO:0001589	frameshift_variant	8741	exon1			AF046888	CCDS11111.1, CCDS11112.1, CCDS42256.1, CCDS56019.1, CCDS73957.1	17p13.1	2007-07-23			ENSG00000161955	ENSG00000161955		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11928	protein-coding gene	gene with protein product		604472				9743536	Standard	NM_172088		Approved	APRIL, CD256		O75888	OTTHUMG00000108145	ENST00000338784.4:c.109dupG	17.37:g.7462465_7462465dupG	ENSP00000343505:p.Trp35fs		7403183	NM_001198622	A8MYD5|B4DVT2|Q541E1|Q5U0G8|Q96HV6|Q9P1M8|Q9P1M9	Frame_Shift_Ins	INS	ENST00000338784.4	37	CCDS11111.1																																																																																				0.639	TNFSF13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226948.2	NM_003808	
MYH8	4626	broad.mit.edu	37	17	10307889	10307889	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:10307889A>C	ENST00000403437.2	-	22	2540	c.2446T>G	c.(2446-2448)Tgc>Ggc	p.C816G	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	816					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.C816G(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TACTGGATGCAGAAAAGTGCT	0.418									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.C816G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2446G	17						.						63.0	59.0	60.0					17																	10307889		2203	4300	6503	10248614	SO:0001583	missense	4626	exon22	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2446T>G	17.37:g.10307889A>C	ENSP00000384330:p.Cys816Gly		10248614	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	A	12.68	2.009667	0.35415	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.71817	-0.6	5.31	5.31	0.75309	.	0.000000	0.45867	U	0.000327	T	0.69993	0.3173	M	0.65320	2	0.34338	D	0.688427	B	0.11235	0.004	B	0.21151	0.033	T	0.76077	-0.3091	10	0.87932	D	0	.	15.4343	0.75133	1.0:0.0:0.0:0.0	.	816	P13535	MYH8_HUMAN	G	816	ENSP00000384330:C816G	ENSP00000252173:C816G	C	-	1	0	MYH8	10248614	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	0.336000	0.19823	2.231000	0.72958	0.533000	0.62120	TGC		0.418	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
TOP3A	7156	broad.mit.edu	37	17	18205981	18205981	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:18205981C>T	ENST00000321105.5	-	6	770	c.556G>A	c.(556-558)Gtc>Atc	p.V186I	TOP3A_ENST00000542570.1_Missense_Mutation_p.V91I	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	186					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)	p.V186I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GCTGTCCTGACGGCATGGGGT	0.537																																					p.V186I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G556A	17						.						108.0	89.0	96.0					17																	18205981		2203	4300	6503	18146706	SO:0001583	missense	7156	exon6			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.556G>A	17.37:g.18205981C>T	ENSP00000321636:p.Val186Ile		18146706	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	CCDS11194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.89|10.89	1.478057|1.478057	0.26511|0.26511	.|.	.|.	ENSG00000177302|ENSG00000177302	ENST00000412083|ENST00000321105;ENST00000542570	.|T;T	.|0.16324	.|2.35;3.8	6.07|6.07	4.05|4.05	0.47172|0.47172	.|DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, domain 2 (1);	.|0.156269	.|0.64402	.|N	.|0.000018	T|T	0.04907|0.04907	0.0132|0.0132	N|N	0.02142|0.02142	-0.665|-0.665	0.80722|0.80722	D|D	1|1	.|B;B	.|0.22211	.|0.066;0.066	.|B;B	.|0.18263	.|0.015;0.021	T|T	0.28299|0.28299	-1.0048|-1.0048	5|10	.|0.02654	.|T	.|1	-24.8839|-24.8839	8.1602|8.1602	0.31194|0.31194	0.0:0.683:0.0:0.317|0.0:0.683:0.0:0.317	.|.	.|91;186	.|B4DK80;Q13472	.|.;TOP3A_HUMAN	H|I	165|186;91	.|ENSP00000321636:V186I;ENSP00000442336:V91I	.|ENSP00000321636:V186I	R|V	-|-	2|1	0|0	TOP3A|TOP3A	18146706|18146706	0.991000|0.991000	0.36638|0.36638	0.036000|0.036000	0.18154|0.18154	0.458000|0.458000	0.32498|0.32498	2.542000|2.542000	0.45744|0.45744	0.828000|0.828000	0.34709|0.34709	-0.150000|-0.150000	0.13652|0.13652	CGT|GTC		0.537	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
TRIM16L	147166	broad.mit.edu	37	17	18630894	18630894	+	Silent	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:18630894T>G	ENST00000449552.2	+	4	1508	c.24T>G	c.(22-24)gcT>gcG	p.A8A	TRIM16L_ENST00000395671.4_Silent_p.A8A|TRIM16L_ENST00000572555.1_Silent_p.A8A|TRIM16L_ENST00000395902.3_Silent_p.A62A|TRIM16L_ENST00000395672.2_Silent_p.A8A|TRIM16L_ENST00000414850.2_Silent_p.A8A|TRIM16L_ENST00000571708.1_Silent_p.A8A			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like	8						cytoplasm (GO:0005737)		p.A8A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						AACTCCTTGCTGCTGTGAGGA	0.572																																					p.A8A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T24G	17						.						95.0	82.0	87.0					17																	18630894		2203	4300	6503	18571619	SO:0001819	synonymous_variant	147166	exon2			DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.24T>G	17.37:g.18630894T>G			18571619	NM_001037330	A0PK10|B2RUW6|B4DQK2|B4DWQ8	Silent	SNP	ENST00000449552.2	37	CCDS32588.1																																																																																				0.572	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130670.3	NM_001037330	
KIAA0100	9703	broad.mit.edu	37	17	26945882	26945882	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:26945882C>T	ENST00000528896.2	-	32	5824	c.5750G>A	c.(5749-5751)cGg>cAg	p.R1917Q	KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1774Q|KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1774Q|KIAA0100_ENST00000579924.2_5'UTR|SPAG5-AS1_ENST00000554154.1_RNA|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000424210.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1917						extracellular region (GO:0005576)		p.R1917Q(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CAGGCGCCACCGTGCCTGAGC	0.507																																					p.R1917Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5750A	17						.						138.0	116.0	123.0					17																	26945882		2203	4300	6503	23970009	SO:0001583	missense	9703	exon32			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5750G>A	17.37:g.26945882C>T	ENSP00000436773:p.Arg1917Gln		23970009	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028670	0.75390	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.40476	1.03;1.03	5.36	5.36	0.76844	FMP27,  C-terminal (1);	0.052271	0.85682	D	0.000000	T	0.41971	0.1182	N	0.11560	0.145	0.58432	D	0.999994	D	0.76494	0.999	P	0.62089	0.898	T	0.28396	-1.0045	10	0.13470	T	0.59	.	18.6657	0.91489	0.0:1.0:0.0:0.0	.	1917	Q14667	K0100_HUMAN	Q	1917;1887;1917;1774	ENSP00000436773:R1917Q;ENSP00000446443:R1774Q	ENSP00000005905:R1917Q	R	-	2	0	KIAA0100	23970009	1.000000	0.71417	0.967000	0.41034	0.947000	0.59692	7.241000	0.78201	2.518000	0.84900	0.655000	0.94253	CGG		0.507	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
SUPT6H	6830	broad.mit.edu	37	17	27014352	27014352	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:27014352G>A	ENST00000314616.6	+	23	3152	c.2869G>A	c.(2869-2871)Gcc>Acc	p.A957T	SUPT6H_ENST00000347486.4_Missense_Mutation_p.A957T	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	957	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A957T(2)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GCTGCTCAACGCCTTGTACTG	0.527																																					p.A957T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2869A	17						.						114.0	101.0	105.0					17																	27014352		2203	4300	6503	24038479	SO:0001583	missense	6830	exon23			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2869G>A	17.37:g.27014352G>A	ENSP00000319104:p.Ala957Thr		24038479	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351701	0.61183	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.83	4.85	0.62838	Tex-like domain (1);	0.051425	0.85682	D	0.000000	T	0.37320	0.0999	L	0.39147	1.195	0.58432	D	0.999999	P	0.42620	0.785	B	0.30943	0.122	T	0.18555	-1.0333	9	0.19590	T	0.45	-11.4847	13.8003	0.63196	0.0:0.0:0.7208:0.2792	.	957	Q7KZ85	SPT6H_HUMAN	T	957	.	ENSP00000319104:A957T	A	+	1	0	SUPT6H	24038479	1.000000	0.71417	0.958000	0.39756	0.975000	0.68041	4.175000	0.58263	1.432000	0.47375	0.557000	0.71058	GCC		0.527	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
OR1G1	8390	broad.mit.edu	37	17	3030635	3030635	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:3030635C>A	ENST00000328890.2	-	1	240	c.211G>T	c.(211-213)Gcc>Tcc	p.A71S		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	71					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A71S(1)		kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						ACAAAGCAGGCATCTGCAAGG	0.483																																					p.A71S	Colon(127;1481 1654 8243 19426 50557)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211T	17						.						101.0	89.0	93.0					17																	3030635		2203	4300	6503	2977385	SO:0001583	missense	8390	exon1			U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.211G>T	17.37:g.3030635C>A	ENSP00000331545:p.Ala71Ser		2977385	NM_003555	Q4VBM1|Q6IFL9|Q9UM76	Missense_Mutation	SNP	ENST00000328890.2	37	CCDS11020.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125462	0.37533	.	.	ENSG00000183024	ENST00000328890	T	0.03035	4.07	4.4	-7.19	0.01500	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02970	0.0088	L	0.35542	1.07	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45702	-0.9243	9	0.72032	D	0.01	.	8.4294	0.32748	0.0:0.1307:0.3176:0.5517	.	71	P47890	OR1G1_HUMAN	S	71	ENSP00000331545:A71S	ENSP00000331545:A71S	A	-	1	0	OR1G1	2977385	0.000000	0.05858	0.000000	0.03702	0.993000	0.82548	-1.653000	0.01986	-1.228000	0.02568	0.530000	0.56133	GCC		0.483	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207206.2		
ATAD5	79915	broad.mit.edu	37	17	29162987	29162987	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:29162987G>A	ENST00000321990.4	+	2	2266	c.1888G>A	c.(1888-1890)Gca>Aca	p.A630T	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	630					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.A630T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				CACTCAAAAAGCAGCCAACTT	0.373																																					p.A630T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1888A	17						.						89.0	86.0	87.0					17																	29162987		2203	4300	6503	26187113	SO:0001583	missense	79915	exon2				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1888G>A	17.37:g.29162987G>A	ENSP00000313171:p.Ala630Thr		26187113	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	9.150	1.015927	0.19355	.	.	ENSG00000176208	ENST00000321990	T	0.10192	2.9	5.09	3.05	0.35203	.	0.676657	0.14504	N	0.315541	T	0.09069	0.0224	L	0.39397	1.21	0.25221	N	0.989905	B;B	0.32203	0.36;0.049	B;B	0.36244	0.22;0.031	T	0.34030	-0.9845	10	0.22109	T	0.4	.	4.7422	0.13020	0.1643:0.0:0.5335:0.3021	.	630;630	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	T	630	ENSP00000313171:A630T	ENSP00000313171:A630T	A	+	1	0	ATAD5	26187113	1.000000	0.71417	0.991000	0.47740	0.839000	0.47603	1.933000	0.40153	0.617000	0.30160	0.655000	0.94253	GCA		0.373	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
RDM1	201299	broad.mit.edu	37	17	34257227	34257227	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:34257227G>A	ENST00000293273.6	-	2	174	c.129C>T	c.(127-129)ggC>ggT	p.G43G	RDM1_ENST00000394529.3_Silent_p.G20G|RDM1_ENST00000591402.1_Silent_p.G20G|RDM1_ENST00000431884.2_Silent_p.G43G|RDM1_ENST00000419453.2_Silent_p.G20G|RDM1_ENST00000394527.1_Silent_p.G20G|RDM1_ENST00000430160.2_Silent_p.G20G|RDM1_ENST00000394528.3_Silent_p.G43G|RDM1_ENST00000425909.3_Silent_p.G43G	NM_145654.3	NP_663629.1	Q8NG50	RDM1_HUMAN	RAD52 motif containing 1	43	Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G43G(1)		breast(1)|kidney(3)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)	9		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AATACAGAAGGCCAAACTGAG	0.498								Other identified genes with known or suspected DNA repair function																													p.G20G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C60T	17						.						117.0	121.0	120.0					17																	34257227		2203	4300	6503	31281340	SO:0001819	synonymous_variant	201299	exon1			AB080728	CCDS11301.1, CCDS42299.1, CCDS54111.1, CCDS54108.1, CCDS54109.1, CCDS54110.1, CCDS59280.1, CCDS59281.1	17q11.2	2014-04-10	2014-04-10	2005-10-20	ENSG00000187456	ENSG00000278023		"""RNA binding motif (RRM) containing"""	19950	protein-coding gene	gene with protein product		612896	"""RAD52 homolog B (S. cerevisiae)"", ""RAD52 motif 1"""	RAD52B		15611051	Standard	NM_001163120		Approved	MGC33977	uc002hkh.3	Q8NG50	OTTHUMG00000188399	ENST00000293273.6:c.129C>T	17.37:g.34257227G>A			31281340	NM_001163122	A0JP55|A8MV46|A8MY68|A8MZ92|A8RCS5|A8RCT0|A8RCT5|A8RCT8|A8RCU3|A8RCU8|A8RCW0|A8RCW5	Silent	SNP	ENST00000293273.6	37	CCDS11301.1																																																																																				0.498	RDM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256588.2	NM_145654	
C17orf78	284099	broad.mit.edu	37	17	35734837	35734837	+	Nonsense_Mutation	SNP	C	C	T	rs369234656		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:35734837C>T	ENST00000300618.4	+	2	129	c.79C>T	c.(79-81)Cga>Tga	p.R27*	C17orf78_ENST00000586700.1_Nonsense_Mutation_p.R27*|ACACA_ENST00000416895.1_Intron|ACACA_ENST00000353139.5_Intron	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	27						integral component of membrane (GO:0016021)		p.R27*(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				TAGCAGTTGCCGACTGGAACA	0.488																																					p.R27X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C79T	17						.	C	stop/ARG,,	0,3730		0,0,1865	71.0	69.0	70.0		79,,	3.7	1.0	17		70	1,8187		0,1,4093	no	stop-gained,intron,intron	ACACA,C17orf78	NM_173625.3,NM_198834.1,NM_198839.1	,,	0,1,5958	TT,TC,CC		0.0122,0.0,0.0084	,,	27/276,,	35734837	1,11917	1865	4094	5959	32808950	SO:0001587	stop_gained	284099	exon2			BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.79C>T	17.37:g.35734837C>T	ENSP00000300618:p.Arg27*		32808950	NM_173625	Q8N8D2	Nonsense_Mutation	SNP	ENST00000300618.4	37	CCDS45655.1	.	.	.	.	.	.	.	.	.	.	C	31	5.098348	0.94197	0.0	1.22E-4	ENSG00000167230	ENST00000300618;ENST00000321564	.	.	.	4.69	3.73	0.42828	.	0.276447	0.26203	N	0.025733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-1.1437	8.5676	0.33550	0.0:0.8957:0.0:0.1043	.	.	.	.	X	27	.	ENSP00000300618:R27X	R	+	1	2	C17orf78	32808950	1.000000	0.71417	0.996000	0.52242	0.751000	0.42716	1.115000	0.31209	1.210000	0.43336	0.655000	0.94253	CGA		0.488	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451570.2	NM_173625	
CDK12	51755	broad.mit.edu	37	17	37649059	37649059	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:37649059C>T	ENST00000447079.4	+	4	2197	c.2164C>T	c.(2164-2166)Cgc>Tgc	p.R722C	CDK12_ENST00000430627.2_Missense_Mutation_p.R722C	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	722					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.R722C(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CTGGGGGAAACGCTGTGTGGA	0.368			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.R722C			Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2164T	17						.						75.0	78.0	77.0					17																	37649059		2203	4300	6503	34902585	SO:0001583	missense	51755	exon4			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2164C>T	17.37:g.37649059C>T	ENSP00000398880:p.Arg722Cys		34902585	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703462	0.68501	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.45668	0.89;0.89	5.89	5.89	0.94794	Protein kinase-like domain (1);	0.000000	0.48286	D	0.000184	T	0.63307	0.2500	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	T	0.64635	-0.6361	10	0.87932	D	0	-7.551	15.0262	0.71671	0.1422:0.8578:0.0:0.0	.	721;722;722	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	C	722	ENSP00000407720:R722C;ENSP00000398880:R722C	ENSP00000407720:R722C	R	+	1	0	CDK12	34902585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.738000	0.62073	2.783000	0.95769	0.655000	0.94253	CGC		0.368	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
WIPF2	147179	broad.mit.edu	37	17	38434442	38434442	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:38434442C>A	ENST00000323571.4	+	8	1528	c.1288C>A	c.(1288-1290)Cgt>Agt	p.R430S	WIPF2_ENST00000536600.1_Missense_Mutation_p.R172S|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Missense_Mutation_p.R172S|WIPF2_ENST00000583130.1_Missense_Mutation_p.R430S|WIPF2_ENST00000585043.1_Missense_Mutation_p.R430S	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	430					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.R430S(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						TTCAGCTGCCCGTGGAGCCCC	0.493										HNSCC(43;0.11)																											p.R430S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1288A	17						.						184.0	176.0	179.0					17																	38434442		2203	4300	6503	35687968	SO:0001583	missense	147179	exon8			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.1288C>A	17.37:g.38434442C>A	ENSP00000320924:p.Arg430Ser		35687968	NM_133264	A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	ENST00000323571.4	37	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351692	0.82132	.	.	ENSG00000171475	ENST00000323571;ENST00000394103;ENST00000536600	T;T;T	0.54866	0.92;0.55;0.55	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.74997	0.3790	M	0.76838	2.35	0.58432	D	0.999999	D;D	0.76494	0.993;0.999	P;D	0.80764	0.823;0.994	T	0.75918	-0.3148	10	0.72032	D	0.01	-9.6951	19.3507	0.94384	0.0:1.0:0.0:0.0	.	172;430	A8MWR2;Q8TF74	.;WIPF2_HUMAN	S	430;172;172	ENSP00000320924:R430S;ENSP00000377663:R172S;ENSP00000439175:R172S	ENSP00000320924:R430S	R	+	1	0	WIPF2	35687968	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	3.661000	0.54503	2.873000	0.98535	0.561000	0.74099	CGT		0.493	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
NKIRAS2	28511	broad.mit.edu	37	17	40174474	40174474	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:40174474G>A	ENST00000307641.5	+	3	773	c.152G>A	c.(151-153)cGg>cAg	p.R51Q	NKIRAS2_ENST00000393885.4_Missense_Mutation_p.R51Q|NKIRAS2_ENST00000449471.4_Missense_Mutation_p.R51Q|NKIRAS2_ENST00000479407.1_Missense_Mutation_p.R51Q|NKIRAS2_ENST00000316082.4_Missense_Mutation_p.R51Q|NKIRAS2_ENST00000462043.2_Intron|NKIRAS2_ENST00000393884.2_Missense_Mutation_p.R49Q|NKIRAS2_ENST00000393881.3_Missense_Mutation_p.R51Q|NKIRAS2_ENST00000393880.1_Missense_Mutation_p.R51Q	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2	51	Small GTPase-like.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R51Q(1)		large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GAGACAGACCGGGGGGTGCGA	0.567																																					p.R51Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G152A	17						.						47.0	46.0	46.0					17																	40174474		2203	4300	6503	37428000	SO:0001583	missense	28511	exon3			AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503	ENST00000307641.5:c.152G>A	17.37:g.40174474G>A	ENSP00000303580:p.Arg51Gln		37428000	NM_017595	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Missense_Mutation	SNP	ENST00000307641.5	37	CCDS11415.1	.	.	.	.	.	.	.	.	.	.	G	37	6.154904	0.97329	.	.	ENSG00000168256	ENST00000307641;ENST00000393884;ENST00000449471;ENST00000393880;ENST00000393881;ENST00000393885;ENST00000462043;ENST00000316082	T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.29;-1.32;-1.32;-1.32;-1.32	5.53	5.53	0.82687	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90256	0.6953	M	0.81239	2.535	0.80722	D	1	D;D;D	0.71674	0.998;0.983;0.995	D;P;P	0.76575	0.988;0.671;0.746	D	0.88934	0.3375	10	0.40728	T	0.16	-19.979	19.8304	0.96632	0.0:0.0:1.0:0.0	.	51;51;51	B4DNM3;E9PAZ8;Q9NYR9	.;.;KBRS2_HUMAN	Q	51;49;51;51;51;51;51;51	ENSP00000303580:R51Q;ENSP00000377462:R49Q;ENSP00000401976:R51Q;ENSP00000377458:R51Q;ENSP00000377459:R51Q;ENSP00000377463:R51Q;ENSP00000312773:R51Q	ENSP00000303580:R51Q	R	+	2	0	NKIRAS2	37428000	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	9.869000	0.99810	2.775000	0.95449	0.585000	0.79938	CGG		0.567	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257457.1	NM_017595	
ANKFY1	51479	broad.mit.edu	37	17	4088218	4088218	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:4088218C>T	ENST00000341657.4	-	12	1629	c.1594G>A	c.(1594-1596)Gca>Aca	p.A532T	ANKFY1_ENST00000570535.1_Missense_Mutation_p.A574T|Y_RNA_ENST00000516003.1_RNA|ANKFY1_ENST00000573722.1_5'UTR|CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000574367.1_Missense_Mutation_p.A532T	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	532					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.A532T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTCAGGGATGCGGCCTCCTTT	0.622																																					p.A532T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1594A	17						.						78.0	87.0	84.0					17																	4088218		2176	4268	6444	4034967	SO:0001583	missense	51479	exon12			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1594G>A	17.37:g.4088218C>T	ENSP00000343362:p.Ala532Thr		4034967	NM_016376	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		.	.	.	.	.	.	.	.	.	.	C	1.594	-0.528246	0.04112	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	T	0.49139	0.79	5.12	-1.28	0.09318	Ankyrin repeat-containing domain (2);	0.723299	0.14266	N	0.330497	T	0.31670	0.0804	L	0.54908	1.71	0.19945	N	0.999944	B;B;B;B	0.15141	0.001;0.012;0.001;0.0	B;B;B;B	0.14023	0.01;0.004;0.001;0.0	T	0.24621	-1.0155	10	0.14252	T	0.57	3.0E-4	2.0699	0.03611	0.1066:0.2435:0.3195:0.3305	.	473;532;532;574	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	T	532;473	ENSP00000343362:A532T	ENSP00000343362:A532T	A	-	1	0	ANKFY1	4034967	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	-0.156000	0.10100	-0.360000	0.08138	0.655000	0.94253	GCA		0.622	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
ADAM11	4185	broad.mit.edu	37	17	42855538	42855538	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:42855538T>C	ENST00000200557.6	+	25	2373	c.2204T>C	c.(2203-2205)aTc>aCc	p.I735T	ADAM11_ENST00000535346.1_Missense_Mutation_p.I535T	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	735					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.I735T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				GGCACCAACATCATCATTGGC	0.627																																					p.I735T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2204C	17						.						68.0	48.0	55.0					17																	42855538		2203	4300	6503	40211064	SO:0001583	missense	4185	exon25			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.2204T>C	17.37:g.42855538T>C	ENSP00000200557:p.Ile735Thr		40211064	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920233	0.73098	.	.	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.02258	4.37;4.79	4.83	4.83	0.62350	.	0.057857	0.64402	D	0.000003	T	0.10423	0.0255	M	0.68593	2.085	0.58432	D	0.999999	D;D	0.89917	0.996;1.0	D;D	0.91635	0.954;0.999	T	0.03852	-1.0998	10	0.40728	T	0.16	.	13.6739	0.62443	0.0:0.0:0.0:1.0	.	535;735	B4DKD2;O75078	.;ADA11_HUMAN	T	735;535	ENSP00000200557:I735T;ENSP00000443773:I535T	ENSP00000200557:I735T	I	+	2	0	ADAM11	40211064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.105000	0.71505	1.937000	0.56155	0.459000	0.35465	ATC		0.627	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
SPPL2C	162540	broad.mit.edu	37	17	43923141	43923141	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:43923141G>T	ENST00000329196.5	+	1	886	c.869G>T	c.(868-870)gGc>gTc	p.G290V	MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	290						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)	p.G290V(1)									CTGGGTGCTGGCATTGGCCTC	0.612																																					p.G290V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G869T	17						.						116.0	113.0	114.0					17																	43923141		2203	4300	6503	41278921	SO:0001583	missense	162540	exon1				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.869G>T	17.37:g.43923141G>T	ENSP00000332488:p.Gly290Val		41278921	NM_175882	Q8TC67|Q8WVZ6	Missense_Mutation	SNP	ENST00000329196.5	37	CCDS32673.1	.	.	.	.	.	.	.	.	.	.	G	6.143	0.394577	0.11638	.	.	ENSG00000185294	ENST00000329196	T	0.14391	2.51	5.34	4.34	0.51931	.	0.312926	0.23028	N	0.052777	T	0.14787	0.0357	N	0.25286	0.73	0.44214	D	0.997043	B	0.33964	0.434	P	0.46208	0.507	T	0.20571	-1.0271	10	0.21014	T	0.42	-31.2903	11.6614	0.51349	0.0:0.1782:0.8218:0.0	.	290	Q8IUH8	IMP5_HUMAN	V	290	ENSP00000332488:G290V	ENSP00000332488:G290V	G	+	2	0	AC217771.1	41278921	0.009000	0.17119	0.861000	0.33841	0.041000	0.13682	1.583000	0.36579	1.428000	0.47296	0.655000	0.94253	GGC		0.612	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882	
CDC27	996	broad.mit.edu	37	17	45258949	45258949	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:45258949C>T	ENST00000066544.3	-	2	175	c.82G>A	c.(82-84)Gca>Aca	p.A28T	CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000527547.1_Missense_Mutation_p.A28T|CDC27_ENST00000446365.2_Missense_Mutation_p.R16H|CDC27_ENST00000531206.1_Missense_Mutation_p.A28T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	28					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.A28T(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AGGCGTTCTGCGAGGAAAACC	0.348																																					p.A28T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G82A	17						.						37.0	36.0	37.0					17																	45258949		2203	4300	6503	42613948	SO:0001583	missense	996	exon2			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.82G>A	17.37:g.45258949C>T	ENSP00000066544:p.Ala28Thr		42613948	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.343094|5.343094	0.95783|0.95783	.|.	.|.	ENSG00000004897|ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000533415;ENST00000527547;ENST00000526866|ENST00000446365	T;T;T;T|T	0.80566|0.62639	-1.33;-1.39;-1.33;-0.27|0.01	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61022|0.61022	0.2314|0.2314	M|M	0.82193|0.82193	2.58|2.58	0.41596|0.41596	D|D	0.988827|0.988827	D;D;D|P	0.71674|0.40931	0.997;0.998;0.997|0.733	P;D;D|B	0.65874|0.28638	0.864;0.939;0.909|0.092	T|T	0.71391|0.71391	-0.4607|-0.4607	10|9	0.72032|0.54805	D|T	0.01|0.06	-22.578|-22.578	15.3144|15.3144	0.74062|0.74062	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	28;28;28|16	G5EA36;G3V1C4;P30260|B4DL80	.;.;CDC27_HUMAN|.	T|H	28|16	ENSP00000066544:A28T;ENSP00000434614:A28T;ENSP00000437339:A28T;ENSP00000432105:A28T|ENSP00000392802:R16H	ENSP00000066544:A28T|ENSP00000392802:R16H	A|R	-|-	1|2	0|0	CDC27|CDC27	42613948|42613948	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.924000|0.924000	0.55760|0.55760	7.210000|7.210000	0.77924|0.77924	2.484000|2.484000	0.83849|0.83849	0.462000|0.462000	0.41574|0.41574	GCA|CGC		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
B4GALNT2	124872	broad.mit.edu	37	17	47241556	47241556	+	Silent	SNP	C	C	T	rs570206637		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:47241556C>T	ENST00000300404.2	+	8	1112	c.1053C>T	c.(1051-1053)acC>acT	p.T351T	B4GALNT2_ENST00000393354.2_Silent_p.T291T|B4GALNT2_ENST00000504681.1_Silent_p.T265T	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	351					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.T351T(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			CAGACTTGACCGTAATAGTGG	0.483																																					p.T351T	GBM(124;244 1635 8663 18097 33175)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1053T	17						.						160.0	160.0	160.0					17																	47241556		2203	4300	6503	44596555	SO:0001819	synonymous_variant	124872	exon8			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1053C>T	17.37:g.47241556C>T			44596555	NM_153446	B4DZE4|Q14CP1|Q86Y40	Silent	SNP	ENST00000300404.2	37	CCDS11544.1																																																																																				0.483	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
RNF43	54894	broad.mit.edu	37	17	56434883	56434883	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:56434883C>T	ENST00000584437.1	-	8	4209	c.2254G>A	c.(2254-2256)Gca>Aca	p.A752T	RNF43_ENST00000407977.2_Missense_Mutation_p.A752T|RNF43_ENST00000583753.1_Missense_Mutation_p.A711T|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Missense_Mutation_p.A752T|RNF43_ENST00000581868.1_Missense_Mutation_p.A625T|RNF43_ENST00000500597.2_Missense_Mutation_p.A711T|RNF43_ENST00000577625.1_Missense_Mutation_p.A625T			Q68DV7	RNF43_HUMAN	ring finger protein 43	752	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A752T(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGCCCTCTGCGGTGTCAGAA	0.592																																					p.A752T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2254A	17						.						76.0	74.0	74.0					17																	56434883		2203	4300	6503	53789882	SO:0001583	missense	54894	exon9				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.2254G>A	17.37:g.56434883C>T	ENSP00000463069:p.Ala752Thr		53789882	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	C	4.481	0.089206	0.08632	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.08984	3.17;3.03	5.71	-3.67	0.04476	.	0.725191	0.12452	N	0.467627	T	0.03959	0.0111	N	0.14661	0.345	0.09310	N	1	B;B;B	0.13145	0.003;0.007;0.002	B;B;B	0.10450	0.002;0.005;0.001	T	0.35748	-0.9776	10	0.62326	D	0.03	-10.1665	4.4891	0.11805	0.0724:0.3956:0.206:0.326	.	711;752;752	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	T	752;711	ENSP00000385328:A752T;ENSP00000441969:A711T	ENSP00000385328:A752T	A	-	1	0	RNF43	53789882	0.000000	0.05858	0.008000	0.14137	0.016000	0.09150	-0.154000	0.10130	-0.475000	0.06852	-2.416000	0.00220	GCA		0.592	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
PPM1D	8493	broad.mit.edu	37	17	58734197	58734197	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:58734197G>A	ENST00000305921.3	+	5	1487	c.1255G>A	c.(1255-1257)Gtc>Atc	p.V419I		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	419					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.V419I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TACACCACCAGTCAAGGTATA	0.373																																					p.V419I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1255A	17						.						105.0	96.0	99.0					17																	58734197		2203	4300	6503	56088979	SO:0001583	missense	8493	exon5			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1255G>A	17.37:g.58734197G>A	ENSP00000306682:p.Val419Ile		56088979	NM_003620	Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	9.310	1.055313	0.19907	.	.	ENSG00000170836	ENST00000305921;ENST00000544712;ENST00000392995	T;T	0.49720	0.77;0.89	6.02	4.01	0.46588	.	0.498366	0.23618	N	0.046273	T	0.24736	0.0600	N	0.12746	0.255	0.21915	N	0.999473	B	0.02656	0.0	B	0.04013	0.001	T	0.19811	-1.0294	10	0.09338	T	0.73	-9.5814	8.881	0.35374	0.1342:0.122:0.7438:0.0	.	419	O15297	PPM1D_HUMAN	I	419;267;419	ENSP00000306682:V419I;ENSP00000376720:V419I	ENSP00000306682:V419I	V	+	1	0	PPM1D	56088979	0.975000	0.34042	1.000000	0.80357	0.897000	0.52465	0.706000	0.25690	0.872000	0.35775	-0.162000	0.13425	GTC		0.373	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
MARCH10	162333	broad.mit.edu	37	17	60879073	60879073	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:60879073C>T	ENST00000311269.5	-	2	298	c.24G>A	c.(22-24)agG>agA	p.R8R	MARCH10_ENST00000544856.2_Silent_p.R8R|MARCH10_ENST00000456609.2_Silent_p.R8R|MARCH10_ENST00000583600.1_Silent_p.R8R	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	8					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R8R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						AGAACTTCTGCCTGTCCCTTG	0.453																																					p.R8R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G24A	17						.						192.0	149.0	163.0					17																	60879073		2203	4300	6503	58232805	SO:0001819	synonymous_variant	162333	exon2			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.24G>A	17.37:g.60879073C>T			58232805	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Silent	SNP	ENST00000311269.5	37	CCDS11635.1																																																																																				0.453	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
DCAF7	10238	broad.mit.edu	37	17	61660984	61660984	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:61660984G>A	ENST00000310827.4	+	6	866	c.649G>A	c.(649-651)Gaa>Aaa	p.E217K	DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000431926.1_Intron|DCAF7_ENST00000415273.2_Intron	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7	217					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.E216K(1)		endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						CATCATTTACGAAGACCCACA	0.592																																					p.R217Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G650A	17						.						105.0	108.0	107.0					17																	61660984		2146	4243	6389	59014716	SO:0001583	missense	10238	exon5			U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.649G>A	17.37:g.61660984G>A	ENSP00000308344:p.Glu217Lys		59014716	NM_005828	B4E039|D3DU14|O15491|Q9DAE4	Missense_Mutation	SNP	ENST00000310827.4	37		.	.	.	.	.	.	.	.	.	.	G	36	5.925896	0.97110	.	.	ENSG00000136485	ENST00000310827	T	0.62639	0.01	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80914	0.4715	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.82997	-0.0179	9	0.87932	D	0	-20.4753	19.1338	0.93418	0.0:0.0:1.0:0.0	.	217	P61962	DCAF7_HUMAN	K	217	ENSP00000308344:E217K	ENSP00000308344:E217K	E	+	1	0	DCAF7	59014716	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	9.657000	0.98554	2.752000	0.94435	0.655000	0.94253	GAA		0.592	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005828	
CACNG5	27091	broad.mit.edu	37	17	64880813	64880813	+	Intron	SNP	G	G	A	rs200525239		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:64880813G>A	ENST00000533854.1	+	5	807				CACNG5_ENST00000307139.3_Intron|CACNG5_ENST00000169565.3_Missense_Mutation_p.G202D			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.G202D(1)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GATAGGCTGGGCCTGGGCACT	0.572																																					p.G202D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G605A	17						.						84.0	80.0	81.0					17																	64880813		2203	4300	6503	62311275	SO:0001627	intron_variant	27091	exon4			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.570+35G>A	17.37:g.64880813G>A			62311275	NM_014404	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863022	0.32884	.	.	ENSG00000075429	ENST00000169565	T	0.50001	0.76	1.96	-2.5	0.06384	.	0.326488	0.27802	U	0.017799	T	0.29620	0.0739	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17684	-1.0361	6	.	.	.	.	3.9063	0.09183	0.0:0.3297:0.2811:0.3892	.	.	.	.	D	202	ENSP00000169565:G202D	.	G	+	2	0	CACNG5	62311275	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	0.375000	0.20518	-0.594000	0.05836	0.609000	0.83330	GGC		0.572	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811	
SLC13A5	284111	broad.mit.edu	37	17	6599208	6599208	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:6599208C>T	ENST00000433363.2	-	7	1125	c.892G>A	c.(892-894)Gcc>Acc	p.A298T	SLC13A5_ENST00000293800.6_Missense_Mutation_p.A281T|SLC13A5_ENST00000381074.4_Missense_Mutation_p.A255T|SLC13A5_ENST00000573648.1_Missense_Mutation_p.A298T	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	298					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)	p.A298T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						ACCTTGAGGGCAGCCTTCTCG	0.552																																					p.A298T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G892A	17						.						121.0	125.0	124.0					17																	6599208		2203	4300	6503	6539932	SO:0001583	missense	284111	exon7			AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.892G>A	17.37:g.6599208C>T	ENSP00000406220:p.Ala298Thr		6539932	NM_001143838	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	37	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835180	0.71373	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T;T	0.03635	4.07;3.86;3.86	5.29	3.29	0.37713	.	0.190993	0.56097	N	0.000035	T	0.07908	0.0198	M	0.64630	1.985	0.30418	N	0.778367	P;P;P;P;P	0.45011	0.848;0.582;0.635;0.455;0.455	P;B;P;P;P	0.48524	0.58;0.331;0.461;0.461;0.461	T	0.01549	-1.1327	10	0.59425	D	0.04	.	9.2759	0.37698	0.0:0.8244:0.0:0.1756	.	298;255;255;281;298	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	T	298;298;255	ENSP00000293800:A298T;ENSP00000406220:A298T;ENSP00000370464:A255T	ENSP00000293800:A298T	A	-	1	0	SLC13A5	6539932	0.984000	0.35163	0.005000	0.12908	0.011000	0.07611	2.760000	0.47581	1.381000	0.46364	0.655000	0.94253	GCC		0.552	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	
ALOX12	239	broad.mit.edu	37	17	6905107	6905107	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:6905107C>A	ENST00000251535.6	+	8	1191	c.1138C>A	c.(1138-1140)Cca>Aca	p.P380T	AC027763.2_ENST00000399540.2_3'UTR|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000574377.1_Intron|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	380	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.P380T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						GCGGTGCCTCCCAGGACTGCA	0.493																																					p.P380T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1138A	17						.						79.0	69.0	73.0					17																	6905107		2203	4300	6503	6845831	SO:0001583	missense	239	exon8			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1138C>A	17.37:g.6905107C>A	ENSP00000251535:p.Pro380Thr		6845831	NM_000697	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	37	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454189	0.63290	.	.	ENSG00000108839	ENST00000251535	T	0.08984	3.03	4.74	1.57	0.23409	Lipoxygenase, C-terminal (4);	0.195798	0.44483	D	0.000444	T	0.26048	0.0635	M	0.87682	2.9	0.40950	D	0.984533	D	0.67145	0.996	D	0.68621	0.959	T	0.02505	-1.1149	10	0.87932	D	0	-3.8025	6.4879	0.22099	0.0:0.6686:0.1542:0.1771	.	380	P18054	LOX12_HUMAN	T	380	ENSP00000251535:P380T	ENSP00000251535:P380T	P	+	1	0	ALOX12	6845831	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.856000	0.39389	0.678000	0.31325	0.573000	0.79308	CCA		0.493	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
TNFSF12	8742	broad.mit.edu	37	17	7460431	7460431	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:7460431G>A	ENST00000293825.6	+	7	777	c.514G>A	c.(514-516)Ggg>Agg	p.G172R	TNFSF12_ENST00000462811.1_3'UTR|TNFSF13_ENST00000349228.4_5'Flank|TNFSF13_ENST00000380535.4_5'Flank|TNFSF13_ENST00000396542.1_5'Flank|TNFSF13_ENST00000396545.4_5'Flank|TNFSF12_ENST00000557233.1_Intron|TNFSF13_ENST00000483039.1_5'Flank|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF13_ENST00000338784.4_5'Flank	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	172					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)	p.G172R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				CTTTGATGAGGGGAAGGCTGT	0.622																																					p.G172R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G514A	17						.						99.0	71.0	80.0					17																	7460431		2203	4300	6503	7401155	SO:0001583	missense	8742	exon7			AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.514G>A	17.37:g.7460431G>A	ENSP00000293825:p.Gly172Arg		7401155	NM_003809	Q8IZK7|Q8WUZ7	Missense_Mutation	SNP	ENST00000293825.6	37	CCDS11109.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914435	0.72983	.	.	ENSG00000239697	ENST00000293825	D	0.94497	-3.44	4.5	3.51	0.40186	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	.	.	.	.	D	0.94248	0.8153	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92157	0.5733	9	0.30078	T	0.28	.	12.0545	0.53527	0.0879:0.0:0.9121:0.0	.	172	O43508	TNF12_HUMAN	R	172	ENSP00000293825:G172R	ENSP00000293825:G172R	G	+	1	0	TNFSF12	7401155	1.000000	0.71417	0.820000	0.32676	0.987000	0.75469	4.433000	0.59929	1.022000	0.39626	0.561000	0.74099	GGG		0.622	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226951.2	NM_003809	
CNTROB	116840	broad.mit.edu	37	17	7849072	7849072	+	Silent	SNP	C	C	T	rs146923091		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:7849072C>T	ENST00000563694.1	+	13	2686	c.1761C>T	c.(1759-1761)ccC>ccT	p.P587P	CNTROB_ENST00000565740.1_Silent_p.P587P|CNTROB_ENST00000380255.3_Missense_Mutation_p.P533L|CNTROB_ENST00000380262.3_Silent_p.P587P	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	587	Pro-rich.|Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.P587P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				CCTCCAGCCCCGGGCCTCAGG	0.582																																					p.P587P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1761T	17						.	T	,	1,4405	2.1+/-5.4	0,1,2202	47.0	51.0	50.0		1761,1761	-3.2	1.0	17	dbSNP_134	50	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CNTROB	NM_001037144.5,NM_053051.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	587/926,587/904	7849072	1,13005	2203	4300	6503	7789797	SO:0001819	synonymous_variant	116840	exon13			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.1761C>T	17.37:g.7849072C>T			7789797	NM_053051	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Silent	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	c	3.762	-0.049491	0.07407	2.27E-4	0.0	ENSG00000170037	ENST00000380255	T	0.42131	0.98	5.48	-3.17	0.05202	.	0.545245	0.16901	N	0.194919	T	0.27663	0.0680	.	.	.	0.29078	N	0.882862	.	.	.	.	.	.	T	0.20075	-1.0286	7	0.41790	T	0.15	-4.421	2.0565	0.03583	0.121:0.235:0.1243:0.5197	.	.	.	.	L	533	ENSP00000369605:P533L	ENSP00000369605:P533L	P	+	2	0	CNTROB	7789797	0.038000	0.19896	0.970000	0.41538	0.134000	0.20937	-1.022000	0.03611	-0.170000	0.10816	-1.380000	0.01176	CCG		0.582	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
MAP2K6	5608	broad.mit.edu	37	17	67513689	67513689	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:67513689C>T	ENST00000590474.1	+	4	468	c.181C>T	c.(181-183)Cga>Tga	p.R61*	MAP2K6_ENST00000589647.1_Nonsense_Mutation_p.R5*	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	61	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R61*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					GGAACTGGGACGAGGTGCGTA	0.478																																					p.R61X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C181T	17						.						115.0	91.0	99.0					17																	67513689		2203	4300	6503	65025284	SO:0001587	stop_gained	5608	exon4			U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.181C>T	17.37:g.67513689C>T	ENSP00000468348:p.Arg61*		65025284	NM_002758		Nonsense_Mutation	SNP	ENST00000590474.1	37	CCDS11686.1	.	.	.	.	.	.	.	.	.	.	C	39	7.603643	0.98384	.	.	ENSG00000108984	ENST00000359094	.	.	.	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.7567	17.8901	0.88869	0.0:1.0:0.0:0.0	.	.	.	.	X	61	.	.	R	+	1	2	MAP2K6	65025284	1.000000	0.71417	0.976000	0.42696	0.987000	0.75469	4.744000	0.62118	2.634000	0.89283	0.585000	0.79938	CGA		0.478	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758	
TNRC6C	57690	broad.mit.edu	37	17	76064000	76064000	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr17:76064000delA	ENST00000588061.1	+	7	3501	c.2774delA	c.(2773-2775)caafs	p.Q925fs	TNRC6C_ENST00000541771.1_Frame_Shift_Del_p.Q925fs|TNRC6C_ENST00000301624.4_Frame_Shift_Del_p.Q925fs|TNRC6C_ENST00000544502.1_Frame_Shift_Del_p.Q922fs|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000335749.4_Frame_Shift_Del_p.Q922fs|TNRC6C_ENST00000588847.1_Frame_Shift_Del_p.Q922fs			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	925	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.K926fs*3(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAAGGACTTCAAAAGGTAAGT	0.473																																					p.Q925fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2774delA	17						.						79.0	80.0	80.0					17																	76064000		1931	4128	6059	73575595	SO:0001589	frameshift_variant	57690	exon6			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2774delA	17.37:g.76064000delA	ENSP00000468647:p.Gln925fs		73575595	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Frame_Shift_Del	DEL	ENST00000588061.1	37	CCDS45798.1																																																																																				0.473	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
CTAGE1	64693	broad.mit.edu	37	18	19996093	19996093	+	5'Flank	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr18:19996093G>A	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.A561V			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)		p.A561V(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					CAGGGGCCCAGCGTCAGAAGG	0.527																																					p.A561V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1682T	18						.						71.0	73.0	73.0					18																	19996093		2198	4299	6497	18250091	SO:0001631	upstream_gene_variant	64693	exon1			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19996093G>A	Exception_encountered		18250091	NM_172241	B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	37		.	.	.	.	.	.	.	.	.	.	G	5.936	0.356792	0.11239	.	.	ENSG00000212710	ENST00000391403	T	0.08102	3.13	0.779	-0.305	0.12784	.	.	.	.	.	T	0.04048	0.0113	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.46247	-0.9205	8	.	.	.	.	4.5999	0.12348	0.0:0.4099:0.5901:0.0	.	561	Q96RT6	CTGE2_HUMAN	V	561	ENSP00000375220:A561V	.	A	-	2	0	CTAGE1	18250091	0.967000	0.33354	0.012000	0.15200	0.003000	0.03518	0.231000	0.17872	-0.132000	0.11557	-0.482000	0.04802	GCT		0.527	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241	
YES1	7525	broad.mit.edu	37	18	751800	751800	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr18:751800A>G	ENST00000584307.1	-	3	446	c.276T>C	c.(274-276)ggT>ggC	p.G92G	YES1_ENST00000577961.1_Silent_p.G97G|YES1_ENST00000314574.4_Silent_p.G92G|YES1_ENST00000577611.1_5'UTR			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	92	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.G92G(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	ATATAGTAACACCACCTATCA	0.313																																					p.G92G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T276C	18						.						97.0	103.0	101.0					18																	751800		2202	4299	6501	741800	SO:0001819	synonymous_variant	7525	exon3			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.276T>C	18.37:g.751800A>G			741800	NM_005433	A6NLB3|D3DUH1	Silent	SNP	ENST00000584307.1	37	CCDS11824.1																																																																																				0.313	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
RTTN	25914	broad.mit.edu	37	18	67866668	67866668	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr18:67866668A>G	ENST00000255674.6	-	5	846	c.560T>C	c.(559-561)gTc>gCc	p.V187A	RTTN_ENST00000437017.1_Missense_Mutation_p.V187A|RTTN_ENST00000454359.1_Missense_Mutation_p.V187A	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	187					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.V187A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				AGAGGAGAGGACATGTCTGTC	0.373																																					p.V187A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T560C	18						.						144.0	148.0	147.0					18																	67866668		1910	4115	6025	66017648	SO:0001583	missense	25914	exon5			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.560T>C	18.37:g.67866668A>G	ENSP00000255674:p.Val187Ala		66017648	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262908	0.39995	.	.	ENSG00000176225	ENST00000255674;ENST00000454359;ENST00000437017	T;T;T	0.64991	3.63;-0.13;-0.13	5.31	5.31	0.75309	Armadillo-like helical (1);Armadillo-type fold (2);	0.082737	0.47852	D	0.000206	T	0.72399	0.3455	M	0.64997	1.995	0.42855	D	0.994091	D;D	0.61697	0.971;0.99	P;P	0.56474	0.721;0.799	T	0.76825	-0.2816	10	0.87932	D	0	.	15.2611	0.73625	1.0:0.0:0.0:0.0	.	187;187	Q86VV8-2;Q86VV8	.;RTTN_HUMAN	A	187	ENSP00000255674:V187A;ENSP00000402352:V187A;ENSP00000399520:V187A	ENSP00000255674:V187A	V	-	2	0	RTTN	66017648	1.000000	0.71417	0.472000	0.27241	0.796000	0.44982	9.021000	0.93673	2.010000	0.58986	0.459000	0.35465	GTC		0.373	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
AP1M2	10053	broad.mit.edu	37	19	10689573	10689573	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:10689573C>T	ENST00000250244.6	-	8	965	c.883G>A	c.(883-885)Gtc>Atc	p.V295I	AP1M2_ENST00000590923.1_Missense_Mutation_p.V297I	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	295	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.V295I(1)		endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CCCACCTTGACCATGATCTCC	0.552																																					p.V295I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A	19						.						57.0	56.0	56.0					19																	10689573		1932	4153	6085	10550573	SO:0001583	missense	10053	exon8			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.883G>A	19.37:g.10689573C>T	ENSP00000250244:p.Val295Ile		10550573	NM_005498	B2RDV5|Q9BSI8	Missense_Mutation	SNP	ENST00000250244.6	37	CCDS45964.1	.	.	.	.	.	.	.	.	.	.	c	11.67	1.707267	0.30322	.	.	ENSG00000129354	ENST00000250244	T	0.20332	2.08	5.12	2.99	0.34606	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.11623	0.0283	N	0.17379	0.485	0.51767	D	0.999938	B;B	0.15719	0.014;0.01	B;B	0.22880	0.024;0.042	T	0.13150	-1.0520	10	0.13853	T	0.58	-38.5384	9.6038	0.39622	0.0:0.8273:0.0:0.1727	.	297;295	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	I	295	ENSP00000250244:V295I	ENSP00000250244:V295I	V	-	1	0	AP1M2	10550573	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	0.679000	0.25291	0.577000	0.29470	0.555000	0.69702	GTC		0.552	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452034.1		
DOCK6	57572	broad.mit.edu	37	19	11356364	11356364	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:11356364G>T	ENST00000294618.7	-	9	909	c.898C>A	c.(898-900)Ctg>Atg	p.L300M		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	300					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.L300M(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						TCCGAGTTCAGGTCGAAGTAG	0.627																																					p.L300M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C898A	19						.						36.0	41.0	39.0					19																	11356364		1959	4146	6105	11217364	SO:0001583	missense	57572	exon9				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.898C>A	19.37:g.11356364G>T	ENSP00000294618:p.Leu300Met		11217364	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002568	0.54254	.	.	ENSG00000130158	ENST00000294618	T	0.49720	0.77	5.04	2.88	0.33553	.	0.000000	0.64402	D	0.000005	T	0.45377	0.1339	L	0.49455	1.56	0.80722	D	1	P	0.46784	0.884	P	0.47162	0.54	T	0.30909	-0.9962	10	0.29301	T	0.29	-15.9172	10.6936	0.45886	0.1628:0.0:0.8372:0.0	.	300	Q96HP0	DOCK6_HUMAN	M	300	ENSP00000294618:L300M	ENSP00000294618:L300M	L	-	1	2	DOCK6	11217364	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.547000	0.36190	1.118000	0.41863	-0.379000	0.06801	CTG		0.627	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
RAB3D	9545	broad.mit.edu	37	19	11446453	11446453	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:11446453C>T	ENST00000222120.3	-	3	495	c.235G>A	c.(235-237)Gcg>Acg	p.A79T	RAB3D_ENST00000589655.1_Missense_Mutation_p.A79T	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	79					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.A79T(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						TCCTGGCCCGCTGTGTCCTGG	0.602																																					p.A79T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	19						.						137.0	120.0	126.0					19																	11446453		2203	4300	6503	11307453	SO:0001583	missense	9545	exon3			AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.235G>A	19.37:g.11446453C>T	ENSP00000222120:p.Ala79Thr		11307453	NM_004283		Missense_Mutation	SNP	ENST00000222120.3	37	CCDS12257.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926772	0.92319	.	.	ENSG00000105514	ENST00000222120	D	0.88741	-2.42	4.78	4.78	0.61160	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96482	0.8852	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97682	1.0173	10	0.87932	D	0	.	17.088	0.86616	0.0:1.0:0.0:0.0	.	79	O95716	RAB3D_HUMAN	T	79	ENSP00000222120:A79T	ENSP00000222120:A79T	A	-	1	0	RAB3D	11307453	1.000000	0.71417	0.615000	0.29064	0.747000	0.42532	7.499000	0.81566	2.653000	0.90120	0.563000	0.77884	GCG		0.602	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283	
FARSA	2193	broad.mit.edu	37	19	13039175	13039175	+	Silent	SNP	G	G	A	rs554119533		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:13039175G>A	ENST00000314606.4	-	7	840	c.822C>T	c.(820-822)caC>caT	p.H274H	FARSA_ENST00000588025.1_Silent_p.H314H|CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Silent_p.H243H	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	274					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.H274H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	AGAAGGTGTCGTGCTGGTCAC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16376	0.0		0.0	False		,,,				2504	0.001				p.H274H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C822T	19						.						89.0	86.0	87.0					19																	13039175		2203	4300	6503	12900175	SO:0001819	synonymous_variant	2193	exon7			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.822C>T	19.37:g.13039175G>A			12900175	NM_004461	B4E363|Q9NSD8|Q9Y4W8	Silent	SNP	ENST00000314606.4	37	CCDS12287.1																																																																																				0.592	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461	
CASP14	23581	broad.mit.edu	37	19	15166877	15166877	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:15166877C>T	ENST00000427043.3	+	7	1014	c.706C>T	c.(706-708)Cgg>Tgg	p.R236W	CASP14_ENST00000221740.1_Missense_Mutation_p.R236W|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	236					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.R236W(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						AAGCACCCTCCGGAAACGGCT	0.502																																					p.R236W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C706T	19						.						64.0	58.0	60.0					19																	15166877		2203	4300	6503	15027877	SO:0001583	missense	23581	exon7				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.706C>T	19.37:g.15166877C>T	ENSP00000393417:p.Arg236Trp		15027877	NM_012114	O95823|Q3SYC9	Missense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	.	.	.	.	.	.	.	.	.	.	c	12.75	2.031636	0.35797	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.03580	3.88;3.88	4.43	2.11	0.27256	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (2);	0.313747	0.23072	N	0.052256	T	0.07548	0.0190	M	0.90870	3.155	0.35172	D	0.771699	B	0.33379	0.41	B	0.30646	0.118	T	0.03017	-1.1082	10	0.66056	D	0.02	.	4.782	0.13206	0.2109:0.6766:0.0:0.1125	.	236	P31944	CASPE_HUMAN	W	236	ENSP00000393417:R236W;ENSP00000221740:R236W	ENSP00000221740:R236W	R	+	1	2	CASP14	15027877	0.995000	0.38212	1.000000	0.80357	0.680000	0.39746	0.686000	0.25392	0.849000	0.35215	0.442000	0.29010	CGG		0.502	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
CYP4F12	66002	broad.mit.edu	37	19	15807842	15807842	+	Missense_Mutation	SNP	G	G	A	rs189002430	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:15807842G>A	ENST00000550308.1	+	13	1902	c.1522G>A	c.(1522-1524)Gcc>Acc	p.A508T	CYP4F12_ENST00000324632.10_Missense_Mutation_p.A508T	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	508					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.A508T(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	GATCATGCGCGCCGAGGGCGG	0.552													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18321	0.0		0.0	False		,,,				2504	0.0				p.A508T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1522A	19						.	G	THR/ALA	1,4391		0,1,2195	55.0	60.0	58.0		1522	0.1	0.2	19		58	2,8598		0,2,4298	yes	missense	CYP4F12	NM_023944.3	58	0,3,6493	AA,AG,GG		0.0233,0.0228,0.0231	benign	508/525	15807842	3,12989	2196	4300	6496	15668842	SO:0001583	missense	66002	exon13			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.1522G>A	19.37:g.15807842G>A	ENSP00000448998:p.Ala508Thr		15668842	NM_023944	E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	ENST00000550308.1	37	CCDS42517.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	.	8.027	0.760987	0.15914	2.28E-4	2.33E-4	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.79141	-1.24;-1.24	2.31	0.0891	0.14457	.	0.080319	0.47852	U	0.000220	T	0.65790	0.2725	L	0.35644	1.08	0.50632	D	0.999888	B	0.33528	0.416	B	0.39094	0.29	T	0.54410	-0.8298	10	0.36615	T	0.2	.	6.2759	0.20981	0.2857:0.0:0.7143:0.0	.	508	Q9HCS2	CP4FC_HUMAN	T	508	ENSP00000448998:A508T;ENSP00000321821:A508T	ENSP00000321821:A508T	A	+	1	0	CYP4F12	15668842	0.747000	0.28283	0.209000	0.23619	0.023000	0.10783	1.436000	0.34980	0.089000	0.17243	0.313000	0.20887	GCC		0.552	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9		
ZNF486	90649	broad.mit.edu	37	19	20307896	20307896	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:20307896G>C	ENST00000335117.8	+	4	434	c.377G>C	c.(376-378)tGt>tCt	p.C126S	CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C117S(1)|p.C126S(1)		endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						AAAAAAGGCTGTGAAAGTGTG	0.343																																					p.C126S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G377C	19						.						83.0	89.0	87.0					19																	20307896		2149	4287	6436	20168896	SO:0001583	missense	90649	exon4			BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.377G>C	19.37:g.20307896G>C	ENSP00000335042:p.Cys126Ser		20168896	NM_052852	Q0VG00	Missense_Mutation	SNP	ENST00000335117.8	37	CCDS46029.1	.	.	.	.	.	.	.	.	.	.	g	4.974	0.180864	0.09443	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.05025	3.51	0.149	0.149	0.14863	.	.	.	.	.	T	0.04952	0.0133	L	0.35542	1.07	0.30001	N	0.816005	B	0.19706	0.038	B	0.19148	0.024	T	0.31861	-0.9928	8	0.33141	T	0.24	.	.	.	.	.	126	Q96H40	ZN486_HUMAN	S	165;126	ENSP00000335042:C126S	ENSP00000335042:C126S	C	+	2	0	ZNF486	20168896	0.000000	0.05858	0.135000	0.22099	0.135000	0.20990	0.388000	0.20735	0.192000	0.20272	0.195000	0.17529	TGT		0.343	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	NM_052852	
ZNF43	7594	broad.mit.edu	37	19	21991478	21991478	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:21991478T>C	ENST00000354959.4	-	4	1530	c.1361A>G	c.(1360-1362)tAc>tGc	p.Y454C	ZNF43_ENST00000594012.1_Missense_Mutation_p.Y448C|ZNF43_ENST00000595461.1_Missense_Mutation_p.Y448C|ZNF43_ENST00000598381.1_Missense_Mutation_p.Y448C	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y454C(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTCACATTTGTAGGGTTTCTC	0.388																																					p.Y454C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1361G	19						.						58.0	61.0	60.0					19																	21991478		2203	4298	6501	21783318	SO:0001583	missense	7594	exon4			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1361A>G	19.37:g.21991478T>C	ENSP00000347045:p.Tyr454Cys		21783318	NM_003423	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	T	10.61	1.399567	0.25291	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.25414	1.8	1.75	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46054	0.1373	M	0.76938	2.355	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.17776	-1.0358	9	0.87932	D	0	.	4.8729	0.13642	0.2729:0.0:0.0:0.7271	.	454	P17038	ZNF43_HUMAN	C	453;454	ENSP00000347045:Y454C	ENSP00000347045:Y454C	Y	-	2	0	ZNF43	21783318	0.000000	0.05858	0.003000	0.11579	0.803000	0.45373	-0.245000	0.08890	0.805000	0.34159	0.248000	0.18094	TAC		0.388	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
ZNF57	126295	broad.mit.edu	37	19	2917491	2917491	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:2917491A>G	ENST00000306908.5	+	4	1020	c.872A>G	c.(871-873)tAc>tGc	p.Y291C	ZNF57_ENST00000523428.1_Missense_Mutation_p.Y259C|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y291C(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTTCACTTACCCCCAGGCT	0.478																																					p.Y291C	NSCLC(150;910 1964 4303 10464 26498)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A872G	19						.						76.0	83.0	81.0					19																	2917491		2203	4300	6503	2868491	SO:0001583	missense	126295	exon4			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.872A>G	19.37:g.2917491A>G	ENSP00000303696:p.Tyr291Cys		2868491	NM_173480	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	A	8.471	0.857491	0.17106	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.08546	3.08;3.08	2.25	1.2	0.21068	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05823	0.0152	L	0.31371	0.925	0.09310	N	1	B	0.22346	0.068	B	0.17433	0.018	T	0.40289	-0.9571	9	0.33940	T	0.23	.	5.2699	0.15618	0.8391:0.0:0.1609:0.0	.	291	Q68EA5	ZNF57_HUMAN	C	291;293;259	ENSP00000303696:Y291C;ENSP00000430223:Y259C	ENSP00000303696:Y291C	Y	+	2	0	ZNF57	2868491	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.494000	0.02296	0.144000	0.18951	0.418000	0.28097	TAC		0.478	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
ZNF91	7644	broad.mit.edu	37	19	23544907	23544907	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:23544907T>C	ENST00000300619.7	-	4	1079	c.874A>G	c.(874-876)Aaa>Gaa	p.K292E	ZNF91_ENST00000397082.2_Missense_Mutation_p.K260E|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	292					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K292E(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGTAGGGTTTCTCTCCAGTG	0.388																																					p.K292E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A874G	19						.						88.0	94.0	92.0					19																	23544907		2194	4290	6484	23336747	SO:0001583	missense	7644	exon4			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.874A>G	19.37:g.23544907T>C	ENSP00000300619:p.Lys292Glu		23336747	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.535986	0.27475	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.27104	1.69;1.69	1.56	1.56	0.23342	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23965	0.0580	M	0.75615	2.305	0.25899	N	0.983372	P;P	0.39376	0.619;0.67	B;B	0.29353	0.061;0.101	T	0.18335	-1.0340	9	0.87932	D	0	.	7.9503	0.30010	0.0:0.0:0.0:1.0	.	260;292	Q05481-2;Q05481	.;ZNF91_HUMAN	E	292;260	ENSP00000300619:K292E;ENSP00000380272:K260E	ENSP00000300619:K292E	K	-	1	0	ZNF91	23336747	0.434000	0.25570	0.002000	0.10522	0.003000	0.03518	2.093000	0.41710	0.708000	0.31955	0.136000	0.15936	AAA		0.388	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ATP4A	495	broad.mit.edu	37	19	36054407	36054407	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:36054407A>G	ENST00000262623.3	-	2	63	c.35T>C	c.(34-36)gTg>gCg	p.V12A		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	12					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.V12A(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	ACCCAGCTCCACCGAGTAGAG	0.617																																					p.V12A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T35C	19						.						108.0	117.0	114.0					19																	36054407		2203	4300	6503	40746247	SO:0001583	missense	495	exon2				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.35T>C	19.37:g.36054407A>G	ENSP00000262623:p.Val12Ala		40746247	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615445	0.66672	.	.	ENSG00000105675	ENST00000262623	D	0.93133	-3.17	4.16	4.16	0.48862	ATPase, P-type, gastric H+/K+-transporter, N-terminal (1);	2.068890	0.03726	N	0.252614	D	0.86740	0.6005	N	0.08118	0	0.29447	N	0.858738	B	0.14012	0.009	B	0.12837	0.008	T	0.76995	-0.2752	10	0.59425	D	0.04	.	7.6981	0.28606	0.7852:0.2148:0.0:0.0	.	12	P20648	ATP4A_HUMAN	A	12	ENSP00000262623:V12A	ENSP00000262623:V12A	V	-	2	0	ATP4A	40746247	0.993000	0.37304	0.995000	0.50966	0.921000	0.55340	3.219000	0.51200	1.758000	0.51981	0.449000	0.29647	GTG		0.617	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
PROSER3	148137	broad.mit.edu	37	19	36257685	36257685	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:36257685C>T	ENST00000544099.1	+	8	849	c.786C>T	c.(784-786)gcC>gcT	p.A262A	AC002398.13_ENST00000589397.1_RNA|C19orf55_ENST00000396908.4_Silent_p.A262A			Q2NL68	PRSR3_HUMAN		262								p.A262A(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			cggcaccagcccaggcccaga	0.682																																					p.A262A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C786T	19						.						15.0	17.0	17.0					19																	36257685		1719	3709	5428	40949525	SO:0001819	synonymous_variant	148137	exon8																														ENST00000544099.1:c.786C>T	19.37:g.36257685C>T			40949525	NM_001039887	Q8NDI3|Q8WWC8|Q96NL4	Silent	SNP	ENST00000544099.1	37																																																																																					0.682	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2		
RYR1	6261	broad.mit.edu	37	19	39016093	39016093	+	Missense_Mutation	SNP	C	C	T	rs374061380		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:39016093C>T	ENST00000359596.3	+	71	10577	c.10577C>T	c.(10576-10578)gCg>gTg	p.A3526V	RYR1_ENST00000355481.4_Missense_Mutation_p.A3521V|RYR1_ENST00000360985.3_Missense_Mutation_p.A3526V|AC067969.1_ENST00000597015.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3526					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A3526V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AATATGTGTGCGCCCACCGAC	0.642																																					p.A3521V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10562T	19						.						105.0	87.0	93.0					19																	39016093		2203	4300	6503	43707933	SO:0001583	missense	6261	exon70			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10577C>T	19.37:g.39016093C>T	ENSP00000352608:p.Ala3526Val		43707933	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321849	0.60634	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96940	-4.17;-4.18;-4.17	4.15	4.15	0.48705	.	0.085770	0.48286	U	0.000199	D	0.92708	0.7682	L	0.47016	1.485	0.42701	D	0.993616	P;P;P	0.51791	0.948;0.901;0.84	B;B;B	0.34418	0.182;0.182;0.089	D	0.93228	0.6615	10	0.42905	T	0.14	.	16.5643	0.84575	0.0:1.0:0.0:0.0	.	3526;3521;3526	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	V	3526;3521;3526;446	ENSP00000352608:A3526V;ENSP00000347667:A3521V;ENSP00000354254:A3526V	ENSP00000347667:A3521V	A	+	2	0	RYR1	43707933	1.000000	0.71417	0.927000	0.36925	0.971000	0.66376	7.397000	0.79903	2.302000	0.77476	0.655000	0.94253	GCG		0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SUPT5H	6829	broad.mit.edu	37	19	39964755	39964755	+	Missense_Mutation	SNP	C	C	T	rs369717101		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:39964755C>T	ENST00000599117.1	+	27	3012	c.2645C>T	c.(2644-2646)cCg>cTg	p.P882L	SUPT5H_ENST00000359191.6_Missense_Mutation_p.P878L|SUPT5H_ENST00000402194.2_Missense_Mutation_p.P878L|SUPT5H_ENST00000432763.2_Missense_Mutation_p.P882L|SUPT5H_ENST00000598725.1_Missense_Mutation_p.P882L			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	882	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|Pro-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.P882L(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCAGGGACGCCGGCCATGTGA	0.637											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P882L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2645T	19						.	C	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	85.0	92.0	89.0		2645,2633,2645,2645	5.2	1.0	19		89	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense,missense	SUPT5H	NM_003169.3,NM_001130825.1,NM_001130824.1,NM_001111020.2	98,98,98,98	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	882/1088,878/1084,882/1088,882/1088	39964755	1,13003	2203	4299	6502	44656595	SO:0001583	missense	6829	exon25			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2645C>T	19.37:g.39964755C>T	ENSP00000470252:p.Pro882Leu	889	44656595	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253452	0.59212	0.0	1.16E-4	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.52025	0.1709	L	0.36672	1.1	0.80722	D	1	B;B;B	0.26547	0.003;0.088;0.152	B;B;B	0.18263	0.002;0.021;0.011	T	0.47129	-0.9141	8	.	.	.	-13.5597	17.4052	0.87471	0.0:1.0:0.0:0.0	.	674;878;882	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	L	882;878;860;882	.	.	P	+	2	0	SUPT5H	44656595	1.000000	0.71417	0.952000	0.39060	0.877000	0.50540	7.541000	0.82084	2.409000	0.81822	0.462000	0.41574	CCG		0.637	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
CYP2A6	1548	broad.mit.edu	37	19	41351278	41351278	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:41351278C>A	ENST00000301141.5	-	7	1102	c.1082G>T	c.(1081-1083)aGa>aTa	p.R361I	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	361					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.R361I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GTCTCCAAATCTTTGGATCTC	0.552																																					p.R361I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1082T	19						.						123.0	116.0	118.0					19																	41351278		2203	4300	6503	46043118	SO:0001583	missense	1548	exon7			AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1082G>T	19.37:g.41351278C>A	ENSP00000301141:p.Arg361Ile		46043118	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	19.84	3.902605	0.72754	.	.	ENSG00000255974	ENST00000301141	D	0.97505	-4.41	2.76	2.76	0.32466	.	0.000000	0.85682	U	0.000000	D	0.98848	0.9611	H	0.96777	3.88	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99056	1.0829	10	0.87932	D	0	.	13.0915	0.59169	0.0:1.0:0.0:0.0	.	361;361	Q13120;P11509	.;CP2A6_HUMAN	I	361	ENSP00000301141:R361I	ENSP00000301141:R361I	R	-	2	0	CYP2A6	46043118	0.465000	0.25815	0.707000	0.30419	0.743000	0.42351	4.342000	0.59341	1.487000	0.48415	0.379000	0.24179	AGA		0.552	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
CYP2S1	29785	broad.mit.edu	37	19	41709507	41709507	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:41709507C>T	ENST00000310054.4	+	7	1345	c.1129C>T	c.(1129-1131)Cgg>Tgg	p.R377W	CYP2S1_ENST00000542619.1_Missense_Mutation_p.R102W	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	377					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R377W(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						CACCCTCATGCGGACCACCCG	0.677																																					p.R377W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1129T	19						.						26.0	24.0	24.0					19																	41709507		2170	4229	6399	46401347	SO:0001583	missense	29785	exon7			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.1129C>T	19.37:g.41709507C>T	ENSP00000308032:p.Arg377Trp		46401347	NM_030622	Q9BZ66	Missense_Mutation	SNP	ENST00000310054.4	37	CCDS12573.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016515	0.35606	.	.	ENSG00000167600	ENST00000301173;ENST00000310054;ENST00000542619	T;T	0.01397	4.94;4.94	5.02	-2.91	0.05631	.	1.394090	0.05003	N	0.469584	T	0.06462	0.0166	M	0.76727	2.345	0.09310	N	1	B;D	0.76494	0.389;0.999	B;P	0.60609	0.157;0.877	T	0.39396	-0.9616	10	0.87932	D	0	.	11.1798	0.48620	0.1878:0.7321:0.0801:0.0	.	102;377	B4DJI0;Q96SQ9	.;CP2S1_HUMAN	W	377;377;102	ENSP00000308032:R377W;ENSP00000445299:R102W	ENSP00000301173:R377W	R	+	1	2	CYP2S1	46401347	0.000000	0.05858	0.001000	0.08648	0.567000	0.35839	-0.067000	0.11579	-0.292000	0.08999	0.549000	0.68633	CGG		0.677	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		
ATP1A3	478	broad.mit.edu	37	19	42474549	42474549	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:42474549G>A	ENST00000302102.5	-	17	2559	c.2409C>T	c.(2407-2409)ggC>ggT	p.G803G	ATP1A3_ENST00000602133.1_Silent_p.G773G|ATP1A3_ENST00000543770.1_Silent_p.G814G|ATP1A3_ENST00000545399.1_Silent_p.G816G	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	803					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.G803G(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCATGTCAGTGCCCAGATCGA	0.647																																					p.G803G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2409T	19						.						100.0	84.0	89.0					19																	42474549		2203	4300	6503	47166389	SO:0001819	synonymous_variant	478	exon17				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2409C>T	19.37:g.42474549G>A			47166389	NM_152296	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	CCDS12594.1																																																																																				0.647	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
GSK3A	2931	broad.mit.edu	37	19	42744142	42744142	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:42744142C>T	ENST00000222330.3	-	2	563	c.436G>A	c.(436-438)Gcc>Acc	p.A146T	GSK3A_ENST00000398249.4_Missense_Mutation_p.A64T|AC006486.1_ENST00000378108.1_5'Flank|AC006486.9_ENST00000594664.1_Missense_Mutation_p.A59T	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.A146T(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				TTCTTGATGGCGACTAGTTCC	0.572																																					p.A146T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G436A	19						.						158.0	107.0	124.0					19																	42744142		2203	4300	6503	47435982	SO:0001583	missense	2931	exon2				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.436G>A	19.37:g.42744142C>T	ENSP00000222330:p.Ala146Thr		47435982	NM_019884	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	.	.	.	.	.	.	.	.	.	.	C	35	5.565753	0.96540	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.74421	-0.84;-0.84	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89942	0.6861	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.92332	0.5874	10	0.87932	D	0	-3.3243	17.9284	0.88990	0.0:1.0:0.0:0.0	.	146;64	P49840;A8MT37	GSK3A_HUMAN;.	T	146;64;91	ENSP00000222330:A146T;ENSP00000381301:A64T	ENSP00000222330:A146T	A	-	1	0	GSK3A	47435982	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.273000	0.78527	2.622000	0.88805	0.555000	0.69702	GCC		0.572	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
NPAS1	4861	broad.mit.edu	37	19	47535589	47535589	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:47535589C>A	ENST00000602212.1	+	4	632	c.412C>A	c.(412-414)Ctg>Atg	p.L138M	NPAS1_ENST00000602189.1_5'UTR|NPAS1_ENST00000449844.2_Missense_Mutation_p.L138M|NPAS1_ENST00000439365.2_5'Flank			Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1	138	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				central nervous system development (GO:0007417)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L138M(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		CGAGCAGCACCTGGGAGGTCA	0.657											OREG0025585	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L138M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412A	19						.																																			52227429	SO:0001583	missense	4861	exon3			U77968	CCDS12694.1	19q13.2-q13.3	2013-05-21				ENSG00000130751		"""Basic helix-loop-helix proteins"""	7894	protein-coding gene	gene with protein product	"""neuronal PAS1"", ""member of PAS superfamily 5"""	603346				9012850, 9079689	Standard	NM_002517		Approved	MOP5, PASD5, bHLHe11	uc002pfy.3	Q99742		ENST00000602212.1:c.412C>A	19.37:g.47535589C>A	ENSP00000469142:p.Leu138Met	947	52227429	NM_002517	B4DR69|Q99632|Q9BY83	Missense_Mutation	SNP	ENST00000602212.1	37	CCDS12694.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454107	0.43634	.	.	ENSG00000130751	ENST00000449844	T	0.14022	2.54	5.16	4.06	0.47325	PAS (1);	0.000000	0.53938	D	0.000043	T	0.11239	0.0274	L	0.48642	1.525	0.80722	D	1	B	0.28439	0.212	B	0.28784	0.094	T	0.08617	-1.0713	10	0.35671	T	0.21	.	5.7359	0.18067	0.0:0.8281:0.0:0.1719	.	138	Q99742	NPAS1_HUMAN	M	138	ENSP00000405290:L138M	ENSP00000405290:L138M	L	+	1	2	NPAS1	52227429	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.769000	0.38522	2.404000	0.81709	0.561000	0.74099	CTG		0.657	NPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466658.1	NM_002517	
PIH1D1	55011	broad.mit.edu	37	19	49952835	49952835	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:49952835G>A	ENST00000262265.5	-	3	469	c.234C>T	c.(232-234)ccC>ccT	p.P78P	PIH1D1_ENST00000596049.1_Silent_p.P78P|PIH1D1_ENST00000602226.1_5'Flank	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	78					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)		p.P78P(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		TCACGTCGGCGGGAGGAGGGA	0.557																																					p.P78P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C234T	19						.						106.0	97.0	100.0					19																	49952835		2203	4300	6503	54644647	SO:0001819	synonymous_variant	55011	exon3			AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.234C>T	19.37:g.49952835G>A			54644647	NM_017916	B4DGN7|B4E2X7|Q9BVL0	Silent	SNP	ENST00000262265.5	37	CCDS12765.1																																																																																				0.557	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916	
NAPSA	9476	broad.mit.edu	37	19	50864955	50864955	+	Missense_Mutation	SNP	G	G	A	rs186910155	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:50864955G>A	ENST00000253719.2	-	4	641	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	NR1H2_ENST00000600978.1_Intron|NR1H2_ENST00000542413.1_Intron	NM_004851.1	NP_004842.1	O96009	NAPSA_HUMAN	napsin A aspartic peptidase	145					membrane protein proteolysis (GO:0033619)|proteolysis (GO:0006508)|surfactant homeostasis (GO:0043129)	alveolar lamellar body (GO:0097208)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)|peptidase activity (GO:0008233)	p.R145W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		CCATCTACCCGCCCAGTTCCA	0.512																																					p.R145W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C433T	19						.						125.0	111.0	116.0					19																	50864955		2203	4300	6503	55556767	SO:0001583	missense	9476	exon4			AF090386	CCDS12794.1	19q13.33	2011-08-25				ENSG00000131400			13395	protein-coding gene	gene with protein product	"""kidney-derived aspartic protease-like protein"""	605631					Standard	NM_004851		Approved	NAP1, NAPA, Kdap, KAP	uc002prx.3	O96009		ENST00000253719.2:c.433C>T	19.37:g.50864955G>A	ENSP00000253719:p.Arg145Trp		55556767	NM_004851	Q8WWD9	Missense_Mutation	SNP	ENST00000253719.2	37	CCDS12794.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.266010	0.40095	.	.	ENSG00000131400	ENST00000253719	T	0.58358	0.34	4.13	0.057	0.14322	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.195769	0.50627	D	0.000117	T	0.61937	0.2387	L	0.50333	1.59	0.41539	D	0.9885	D	0.89917	1.0	D	0.70935	0.971	T	0.61964	-0.6954	10	0.87932	D	0	.	11.6568	0.51324	0.0:0.0:0.3014:0.6986	.	145	O96009	NAPSA_HUMAN	W	145	ENSP00000253719:R145W	ENSP00000253719:R145W	R	-	1	2	NAPSA	55556767	0.090000	0.21635	0.274000	0.24659	0.143000	0.21401	0.480000	0.22244	-0.147000	0.11254	0.491000	0.48974	CGG		0.512	NAPSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464714.1	NM_004851	
ZNF765	91661	broad.mit.edu	37	19	53911073	53911073	+	Missense_Mutation	SNP	G	G	T	rs560331430		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:53911073G>T	ENST00000396408.3	+	4	382	c.265G>T	c.(265-267)Gat>Tat	p.D89Y	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	89					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D89Y(1)		endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		TTGTTTCCAGGATATTGATAA	0.388																																					p.D89Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G265T	19						.						73.0	75.0	74.0					19																	53911073		2190	4297	6487	58602885	SO:0001583	missense	91661	exon4			BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.265G>T	19.37:g.53911073G>T	ENSP00000379689:p.Asp89Tyr		58602885	NM_001040185	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	ENST00000396408.3	37	CCDS46171.1	.	.	.	.	.	.	.	.	.	.	G	4.780	0.145124	0.09134	.	.	ENSG00000196417	ENST00000396408;ENST00000505866	T;T	0.08008	3.14;4.15	0.651	-0.659	0.11424	.	.	.	.	.	T	0.05686	0.0149	N	0.19112	0.55	0.09310	N	1	P	0.40875	0.731	B	0.42738	0.396	T	0.38672	-0.9650	7	.	.	.	.	.	.	.	.	89	Q7L2R6	ZN765_HUMAN	Y	89;36	ENSP00000379689:D89Y;ENSP00000421579:D36Y	.	D	+	1	0	ZNF765	58602885	0.000000	0.05858	0.001000	0.08648	0.053000	0.15095	-0.153000	0.10144	-0.220000	0.09988	0.174000	0.16983	GAT		0.388	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372	
ZSCAN5B	342933	broad.mit.edu	37	19	56701861	56701861	+	Missense_Mutation	SNP	C	C	T	rs368972539		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:56701861C>T	ENST00000586855.2	-	5	1136	c.823G>A	c.(823-825)Gtt>Att	p.V275I	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.V275I			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	275					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V275I(1)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTCTCCACAACGCAGGCAGAA	0.517																																					p.V275I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G823A	19						.	C	ILE/VAL	0,4406		0,0,2203	145.0	141.0	142.0		823	-1.5	0.0	19		142	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZSCAN5B	NM_001080456.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	275/496	56701861	1,13005	2203	4300	6503	61393673	SO:0001583	missense	342933	exon4				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.823G>A	19.37:g.56701861C>T	ENSP00000466072:p.Val275Ile		61393673	NM_001080456		Missense_Mutation	SNP	ENST00000586855.2	37	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	C	5.634	0.301601	0.10678	0.0	1.16E-4	ENSG00000197213	ENST00000358992	T	0.05580	3.42	1.86	-1.48	0.08745	.	.	.	.	.	T	0.03827	0.0108	L	0.31752	0.955	0.09310	N	1	B	0.29037	0.231	B	0.14023	0.01	T	0.40534	-0.9558	9	0.36615	T	0.2	.	4.7266	0.12943	0.0:0.4654:0.0:0.5346	.	275	A6NJL1	ZSA5B_HUMAN	I	275	ENSP00000351883:V275I	ENSP00000351883:V275I	V	-	1	0	ZSCAN5B	61393673	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.754000	0.04787	-0.286000	0.09076	0.306000	0.20318	GTT		0.517	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456	
ZNF530	348327	broad.mit.edu	37	19	58118456	58118456	+	Silent	SNP	C	C	T	rs551484617		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:58118456C>T	ENST00000332854.6	+	3	1783	c.1563C>T	c.(1561-1563)tgC>tgT	p.C521C	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C521C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTTATGAGTGCGATGAATGTG	0.453													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20285	0.0		0.0	False		,,,				2504	0.0				p.C521C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1563T	19						.						84.0	75.0	78.0					19																	58118456		2203	4300	6503	62810268	SO:0001819	synonymous_variant	348327	exon3			AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.1563C>T	19.37:g.58118456C>T			62810268	NM_020880	O43340|Q9P220	Silent	SNP	ENST00000332854.6	37	CCDS12955.1																																																																																				0.453	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1	NM_020880	
ZNF586	54807	broad.mit.edu	37	19	58290959	58290959	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:58290959A>G	ENST00000396154.2	+	3	1177	c.1004A>G	c.(1003-1005)cAt>cGt	p.H335R	ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000391702.3_Missense_Mutation_p.H292R|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000396150.4_3'UTR|ZNF586_ENST00000598885.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H335R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTTATTATACATCTGAGAGTT	0.453																																					p.H335R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1004G	19						.						79.0	84.0	82.0					19																	58290959		2203	4299	6502	62982771	SO:0001583	missense	54807	exon3			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.1004A>G	19.37:g.58290959A>G	ENSP00000379458:p.His335Arg		62982771	NM_017652	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469342	0.43839	.	.	ENSG00000083828	ENST00000449441;ENST00000391702;ENST00000396154	D;D	0.86865	-2.18;-2.18	1.65	1.65	0.23941	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94026	0.8086	M	0.93763	3.455	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.84585	0.0663	9	0.87932	D	0	.	8.1155	0.30940	1.0:0.0:0.0:0.0	.	335	Q9NXT0	ZN586_HUMAN	R	335;292;335	ENSP00000375583:H292R;ENSP00000379458:H335R	ENSP00000375583:H292R	H	+	2	0	ZNF586	62982771	0.359000	0.24955	0.002000	0.10522	0.004000	0.04260	2.173000	0.42472	0.732000	0.32470	0.533000	0.62120	CAT		0.453	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652	
GTF2F1	2962	broad.mit.edu	37	19	6387491	6387491	+	Missense_Mutation	SNP	C	C	T	rs201557731		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:6387491C>T	ENST00000394456.5	-	5	870	c.406G>A	c.(406-408)Gag>Aag	p.E136K	GTF2F1_ENST00000429701.2_Intron|CTB-180A7.6_ENST00000599584.1_RNA	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	136					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E136K(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GGGAAGGCCTCGAAGGCCCCG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		19321	0.001		0.0	False		,,,				2504	0.0				p.E136K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G406A	19						.						156.0	137.0	144.0					19																	6387491		2203	4300	6503	6338491	SO:0001583	missense	2962	exon5				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.406G>A	19.37:g.6387491C>T	ENSP00000377969:p.Glu136Lys		6338491	NM_002096	B2RCS0|Q9BWN0	Missense_Mutation	SNP	ENST00000394456.5	37	CCDS12165.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	36	5.650454	0.96714	.	.	ENSG00000125651	ENST00000394456;ENST00000542045	T	0.46063	0.88	5.39	5.39	0.77823	Transcription Factor IIF, Rap30/Rap74, interaction (1);	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	L	0.52364	1.645	0.80722	D	1	D	0.64830	0.994	P	0.59825	0.864	T	0.41698	-0.9494	10	0.19147	T	0.46	-47.8885	17.9226	0.88972	0.0:1.0:0.0:0.0	.	136	P35269	T2FA_HUMAN	K	136;196	ENSP00000377969:E136K	ENSP00000377969:E136K	E	-	1	0	GTF2F1	6338491	1.000000	0.71417	0.951000	0.38953	0.979000	0.70002	7.423000	0.80229	2.502000	0.84385	0.655000	0.94253	GAG		0.622	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096	
ZNF256	10172	broad.mit.edu	37	19	58452692	58452692	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:58452692T>C	ENST00000282308.3	-	3	1680	c.1484A>G	c.(1483-1485)gAg>gGg	p.E495G	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	495					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E495G(2)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		TTTCCCACACTCCCCACATTC	0.433																																					p.E495G	NSCLC(55;1313 1552 8040 11996)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1484G	19						.						92.0	89.0	90.0					19																	58452692		2203	4300	6503	63144504	SO:0001583	missense	10172	exon3			AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1484A>G	19.37:g.58452692T>C	ENSP00000282308:p.Glu495Gly		63144504	NM_005773	B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	37	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	19.54	3.846995	0.71603	.	.	ENSG00000152454	ENST00000282308	T	0.07444	3.19	2.68	2.68	0.31781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15739	0.0379	M	0.89785	3.06	0.09310	N	1	B	0.32573	0.376	B	0.28385	0.089	T	0.10567	-1.0624	9	0.87932	D	0	.	9.9374	0.41559	0.0:0.0:0.0:1.0	.	495	Q9Y2P7	ZN256_HUMAN	G	495	ENSP00000282308:E495G	ENSP00000282308:E495G	E	-	2	0	ZNF256	63144504	0.010000	0.17322	0.364000	0.25888	0.942000	0.58702	1.919000	0.40015	1.219000	0.43474	0.383000	0.25322	GAG		0.433	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
PRAM1	84106	broad.mit.edu	37	19	8563904	8563904	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:8563904T>C	ENST00000423345.4	-	2	1308	c.788A>G	c.(787-789)aAg>aGg	p.K263R	PRAM1_ENST00000255612.3_Missense_Mutation_p.K263R			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	311	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)	p.K263R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						GGAGTCGCGCTTCGGCTCGCT	0.647																																					p.K263R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A788G	19						.						35.0	39.0	38.0					19																	8563904		2175	4280	6455	8469904	SO:0001583	missense	84106	exon2			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.788A>G	19.37:g.8563904T>C	ENSP00000408342:p.Lys263Arg		8469904	NM_032152	Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	T	9.653	1.142019	0.21205	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.14893	2.47;2.47	3.91	0.652	0.17823	.	1.545320	0.04283	N	0.344254	T	0.11836	0.0288	N	0.22421	0.69	0.09310	N	1	B;B	0.15473	0.01;0.013	B;B	0.16289	0.006;0.015	T	0.32455	-0.9906	10	0.24483	T	0.36	.	6.0544	0.19802	0.0:0.3341:0.0:0.6659	.	263;311	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	R	263	ENSP00000255612:K263R;ENSP00000408342:K263R	ENSP00000255612:K263R	K	-	2	0	PRAM1	8469904	0.001000	0.12720	0.005000	0.12908	0.003000	0.03518	0.672000	0.25187	0.030000	0.15379	-0.353000	0.07706	AAG		0.647	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
MUC16	94025	broad.mit.edu	37	19	9062792	9062792	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:9062792G>A	ENST00000397910.4	-	3	24857	c.24654C>T	c.(24652-24654)gaC>gaT	p.D8218D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8220	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.D8218D(2)|p.D3851D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGTTGATATGTCCACAGTAT	0.468																																					p.D8218D												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C24654T	19						.						111.0	104.0	106.0					19																	9062792		1969	4148	6117	8923792	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24654C>T	19.37:g.9062792G>A			8923792	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9088255	9088255	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:9088255G>C	ENST00000397910.4	-	1	3763	c.3560C>G	c.(3559-3561)aCt>aGt	p.T1187S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1187	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T1187S(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCACCGACTAGTTTCAACTGT	0.458																																					p.T1187S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3560G	19						.						176.0	170.0	172.0					19																	9088255		2117	4232	6349	8949255	SO:0001583	missense	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3560C>G	19.37:g.9088255G>C	ENSP00000381008:p.Thr1187Ser		8949255	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	1.690	-0.504215	0.04261	.	.	ENSG00000181143	ENST00000397910	T	0.02369	4.32	1.09	-0.149	0.13420	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	.	.	.	P	0.39424	0.673	B	0.29440	0.102	T	0.46624	-0.9178	8	0.87932	D	0	.	4.7989	0.13287	0.0:0.4002:0.5997:0.0	.	1187	B5ME49	.	S	1187	ENSP00000381008:T1187S	ENSP00000381008:T1187S	T	-	2	0	MUC16	8949255	0.000000	0.05858	0.001000	0.08648	0.085000	0.17905	-1.461000	0.02366	0.006000	0.14734	0.305000	0.20034	ACT		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TRIM28	10155	broad.mit.edu	37	19	59061363	59061363	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr19:59061363C>T	ENST00000253024.5	+	15	2443	c.2154C>T	c.(2152-2154)cgC>cgT	p.R718R	TRIM28_ENST00000341753.6_Silent_p.R636R	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	718	Bromo.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R718R(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		AACCCTGCCGCCCCCTGCATC	0.577																																					p.R718R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2154T	19						.						86.0	73.0	77.0					19																	59061363		2203	4300	6503	63753175	SO:0001819	synonymous_variant	10155	exon15				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2154C>T	19.37:g.59061363C>T			63753175	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Silent	SNP	ENST00000253024.5	37	CCDS12985.1																																																																																				0.577	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
MTOR	2475	broad.mit.edu	37	1	11300544	11300544	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:11300544G>A	ENST00000361445.4	-	11	1678	c.1602C>T	c.(1600-1602)gaC>gaT	p.D534D		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	534	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.D534D(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CATCTTGAATGTCCTTCTTTA	0.567																																					p.D534D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1602T	1						.						186.0	160.0	169.0					1																	11300544		2203	4300	6503	11223131	SO:0001819	synonymous_variant	2475	exon11			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1602C>T	1.37:g.11300544G>A			11223131	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	CCDS127.1																																																																																				0.567	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
RHOC	389	broad.mit.edu	37	1	113246329	113246329	+	Silent	SNP	C	C	T	rs372772606		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:113246329C>T	ENST00000285735.2	-	3	1302	c.93G>A	c.(91-93)ccG>ccA	p.P31P	RHOC_ENST00000369638.2_Silent_p.P31P|RHOC_ENST00000369637.1_Silent_p.P31P|RHOC_ENST00000369636.2_Silent_p.P31P|RHOC_ENST00000369633.2_Silent_p.P31P|RHOC_ENST00000339083.7_Silent_p.P31P|RHOC_ENST00000369632.2_Silent_p.P31P|RP11-426L16.10_ENST00000606505.1_Missense_Mutation_p.G195R|RHOC_ENST00000369642.3_Silent_p.P31P|RP11-426L16.10_ENST00000471038.2_5'UTR			P08134	RHOC_HUMAN	ras homolog family member C	31					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)	p.P31P(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGTAGACCTCCGGAAACTGAT	0.557																																					p.P31P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G93A	1						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	83.0	65.0	71.0		93,93,93	-3.5	1.0	1		71	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	RHOC	NM_001042678.1,NM_001042679.1,NM_175744.4	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	31/194,31/194,31/194	113246329	1,13005	2203	4300	6503	113047852	SO:0001819	synonymous_variant	389	exon3			BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.93G>A	1.37:g.113246329C>T			113047852	NM_175744	B3KSW1|Q6ICN3	Silent	SNP	ENST00000285735.2	37	CCDS854.1																																																																																				0.557	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	NM_175744	
ARNT	405	broad.mit.edu	37	1	150786602	150786602	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:150786602C>T	ENST00000358595.5	-	20	2264	c.2064G>A	c.(2062-2064)tcG>tcA	p.S688S	ARNT_ENST00000515192.1_Silent_p.S674S|ARNT_ENST00000505755.1_Silent_p.S673S|RNU6-1309P_ENST00000363305.1_RNA|ARNT_ENST00000354396.2_Silent_p.S686S	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	688					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S688S(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGCACCAGGCGATGCAGTTG	0.527			T	ETV6	AML																																p.S672S			Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2016A	1						.						136.0	121.0	126.0					1																	150786602		2203	4300	6503	149053226	SO:0001819	synonymous_variant	405	exon19			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.2064G>A	1.37:g.150786602C>T			149053226	NM_001197325	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Silent	SNP	ENST00000358595.5	37	CCDS970.1																																																																																				0.527	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		
TCHH	7062	broad.mit.edu	37	1	152082206	152082206	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:152082206G>A	ENST00000368804.1	-	2	3486	c.3487C>T	c.(3487-3489)Cgc>Tgc	p.R1163C		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1163	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R1163C(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTCCTGGCGCCTTCTCTTC	0.607																																					p.R1163C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3487T	1						.						71.0	70.0	70.0					1																	152082206		1992	4172	6164	150348830	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3487C>T	1.37:g.152082206G>A	ENSP00000357794:p.Arg1163Cys		150348830	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650859	0.47362	.	.	ENSG00000159450	ENST00000368804	T	0.05925	3.37	4.07	3.06	0.35304	.	.	.	.	.	T	0.05410	0.0143	L	0.32530	0.975	0.39578	D	0.969387	D	0.76494	0.999	P	0.56563	0.801	T	0.29640	-1.0005	9	0.66056	D	0.02	4.139	8.8088	0.34954	0.0:0.2324:0.7676:0.0	.	1163	Q07283	TRHY_HUMAN	C	1163	ENSP00000357794:R1163C	ENSP00000357794:R1163C	R	-	1	0	TCHH	150348830	0.004000	0.15560	0.996000	0.52242	0.501000	0.33797	0.877000	0.28106	1.794000	0.52575	0.455000	0.32223	CGC		0.607	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
S100A7L2	645922	broad.mit.edu	37	1	153409591	153409591	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:153409591G>T	ENST00000368725.2	-	3	281	c.282C>A	c.(280-282)acC>acA	p.T94T		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	83							calcium ion binding (GO:0005509)	p.T83T(1)		NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTGGTCTATGGTTATATCCC	0.478																																					p.T94T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C282A	1						.						141.0	145.0	144.0					1																	153409591		2203	4300	6503	151676215	SO:0001819	synonymous_variant	645922	exon3					1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.282C>A	1.37:g.153409591G>T			151676215	NM_001045479		Silent	SNP	ENST00000368725.2	37																																																																																					0.478	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036797.2	NM_001045479	
S100A13	6284	broad.mit.edu	37	1	153598863	153598863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:153598863C>T	ENST00000392623.1	-	2	276	c.86G>A	c.(85-87)cGg>cAg	p.R29Q	S100A1_ENST00000368696.3_5'Flank|S100A1_ENST00000292169.1_5'Flank|S100A13_ENST00000491177.1_5'UTR|S100A1_ENST00000368698.3_5'Flank|S100A13_ENST00000339556.4_Missense_Mutation_p.R29Q|S100A13_ENST00000392622.1_Missense_Mutation_p.R29Q|S100A13_ENST00000368699.1_Missense_Mutation_p.R29Q|RP1-178F15.5_ENST00000497086.1_RNA|S100A13_ENST00000440685.2_Missense_Mutation_p.R29Q	NM_001024212.1	NP_001019383.1	Q99584	S10AD_HUMAN	S100 calcium binding protein A13	29	EF-hand.				cytokine secretion (GO:0050663)|interleukin-1 alpha secretion (GO:0050703)|mast cell degranulation (GO:0043303)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cell shape (GO:0008360)|response to copper ion (GO:0046688)|response to electrical stimulus (GO:0051602)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mast cell granule (GO:0042629)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)	p.R29Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)|Olopatadine(DB00768)	GCTATCCTTCCGGCCCTCCTG	0.552																																					p.R29Q	NSCLC(156;1296 1989 17590 30930 49554)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G86A	1						.						204.0	190.0	195.0					1																	153598863		2203	4300	6503	151865487	SO:0001583	missense	6284	exon3			AK097132	CCDS30874.1	1q21	2008-02-05	2001-11-28		ENSG00000189171	ENSG00000189171		"""S100 calcium binding proteins"""	10490	protein-coding gene	gene with protein product		601989	"""S100 calcium-binding protein A13"""			8985590	Standard	XM_005245434		Approved		uc001fch.3	Q99584	OTTHUMG00000036641	ENST00000392623.1:c.86G>A	1.37:g.153598863C>T	ENSP00000376399:p.Arg29Gln		151865487	NM_005979	Q52PI9|Q6FGF8	Missense_Mutation	SNP	ENST00000392623.1	37	CCDS30874.1	.	.	.	.	.	.	.	.	.	.	C	4.386	0.071253	0.08436	.	.	ENSG00000189171	ENST00000339556;ENST00000368699;ENST00000440685;ENST00000392623;ENST00000392622	T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01	4.95	3.82	0.43975	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.290077	0.28895	N	0.013790	T	0.02047	0.0064	.	.	.	0.09310	N	1	P	0.44090	0.826	B	0.32149	0.141	T	0.43163	-0.9408	9	0.36615	T	0.2	.	7.631	0.28238	0.0:0.795:0.0:0.205	.	29	Q99584	S10AD_HUMAN	Q	29	ENSP00000344822:R29Q;ENSP00000357688:R29Q;ENSP00000392767:R29Q;ENSP00000376399:R29Q;ENSP00000376398:R29Q	ENSP00000344822:R29Q	R	-	2	0	S100A13	151865487	0.000000	0.05858	0.556000	0.28293	0.009000	0.06853	-0.874000	0.04210	2.308000	0.77769	0.511000	0.50034	CGG		0.552	S100A13-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089109.3	NM_005979	
GATAD2B	57459	broad.mit.edu	37	1	153790563	153790563	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:153790563G>A	ENST00000368655.4	-	5	925	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	228					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R228W(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCCCCAGGCCGAGAGGGAAGC	0.522																																					p.R228W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C682T	1						.						127.0	130.0	129.0					1																	153790563		2203	4300	6503	152057187	SO:0001583	missense	57459	exon5			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.682C>T	1.37:g.153790563G>A	ENSP00000357644:p.Arg228Trp		152057187	NM_020699	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167776	0.78339	.	.	ENSG00000143614	ENST00000368655	T	0.35048	1.33	5.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	L	0.36672	1.1	0.58432	D	0.999998	D	0.89917	1.0	D	0.71414	0.973	T	0.35325	-0.9793	10	0.72032	D	0.01	-15.4977	16.4731	0.84124	0.0:0.0:0.8601:0.1399	.	228	Q8WXI9	P66B_HUMAN	W	228	ENSP00000357644:R228W	ENSP00000357644:R228W	R	-	1	2	GATAD2B	152057187	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.644000	0.46613	2.712000	0.92718	0.407000	0.27541	CGG		0.522	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
ASH1L	55870	broad.mit.edu	37	1	155317683	155317683	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:155317683G>A	ENST00000368346.3	-	20	8221	c.7582C>T	c.(7582-7584)Cgt>Tgt	p.R2528C	MIR555_ENST00000384987.1_RNA|ASH1L_ENST00000392403.3_Missense_Mutation_p.R2523C			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2528	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R2523C(2)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGGGATTTACGCCCATAGTAC	0.433																																					p.R2523C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C7567T	1						.						112.0	99.0	103.0					1																	155317683		2203	4300	6503	153584307	SO:0001583	missense	55870	exon20			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7582C>T	1.37:g.155317683G>A	ENSP00000357330:p.Arg2528Cys		153584307	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	G	19.54	3.846263	0.71603	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.19394	2.15;2.15	5.4	5.4	0.78164	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.41050	0.1142	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.31166	-0.9953	10	0.87932	D	0	.	13.7936	0.63157	0.0:0.0:0.8108:0.1892	.	2528;2523	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	C	2528;2523	ENSP00000357330:R2528C;ENSP00000376204:R2523C	ENSP00000357330:R2528C	R	-	1	0	ASH1L	153584307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.648000	0.46647	2.809000	0.96659	0.655000	0.94253	CGT		0.433	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
PRCC	5546	broad.mit.edu	37	1	156756510	156756510	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:156756510G>A	ENST00000271526.4	+	3	899	c.627G>A	c.(625-627)tcG>tcA	p.S209S	PRCC_ENST00000491853.1_3'UTR|PRCC_ENST00000353233.3_Silent_p.S209S	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	209					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.S209S(2)	PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCAAACCCTCGGATGGCTCCC	0.562			T	TFE3	papillary renal																																p.S209S			Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G627A	1						.						101.0	101.0	101.0					1																	156756510		2203	4300	6503	155023134	SO:0001819	synonymous_variant	5546	exon3			X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.627G>A	1.37:g.156756510G>A			155023134	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Silent	SNP	ENST00000271526.4	37	CCDS1157.1																																																																																				0.562	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
ETV3L	440695	broad.mit.edu	37	1	157068577	157068577	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:157068577G>A	ENST00000454449.2	-	3	691	c.407C>T	c.(406-408)gCg>gTg	p.A136V		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	136					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A136V(1)|p.A136E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GGATGGCGGCGCCCGCACTTC	0.582																																					p.A136V												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C407T	1						.						72.0	77.0	75.0					1																	157068577		2203	4300	6503	155335201	SO:0001583	missense	440695	exon3			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.407C>T	1.37:g.157068577G>A	ENSP00000430271:p.Ala136Val		155335201	NM_001004341		Missense_Mutation	SNP	ENST00000454449.2	37	CCDS30893.1	.	.	.	.	.	.	.	.	.	.	G	2.815	-0.246057	0.05906	.	.	ENSG00000253831	ENST00000454449	T	0.54866	0.55	4.47	-1.22	0.09494	.	2.372340	0.02261	N	0.067532	T	0.15176	0.0366	N	0.14661	0.345	0.09310	N	1	B	0.16802	0.019	B	0.13407	0.009	T	0.17167	-1.0378	10	0.51188	T	0.08	.	6.6608	0.23012	0.234:0.234:0.532:0.0	.	136	Q6ZN32	ETV3L_HUMAN	V	136	ENSP00000430271:A136V	ENSP00000430271:A136V	A	-	2	0	ETV3L	155335201	0.005000	0.15991	0.003000	0.11579	0.045000	0.14185	0.692000	0.25482	-0.636000	0.05524	-2.995000	0.00078	GCG		0.582	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
SPTA1	6708	broad.mit.edu	37	1	158641935	158641935	+	Missense_Mutation	SNP	G	G	A	rs565907779		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:158641935G>A	ENST00000368147.4	-	11	1582	c.1402C>T	c.(1402-1404)Cgt>Tgt	p.R468C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	468					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R468C(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGACGATGACGCTCGTCCCAC	0.433													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18201	0.0		0.0	False		,,,				2504	0.0				p.R468C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1402T	1						.						106.0	103.0	104.0					1																	158641935		1959	4157	6116	156908559	SO:0001583	missense	6708	exon11			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1402C>T	1.37:g.158641935G>A	ENSP00000357129:p.Arg468Cys		156908559	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830990	0.50845	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.61510	0.1;0.1	5.0	4.08	0.47627	.	0.265080	0.20210	N	0.096925	T	0.54615	0.1869	M	0.79475	2.455	0.54753	D	0.999989	P	0.43024	0.798	P	0.47573	0.55	T	0.62263	-0.6891	10	0.66056	D	0.02	.	11.3638	0.49660	0.0894:0.0:0.9106:0.0	.	468	P02549	SPTA1_HUMAN	C	468	ENSP00000357130:R468C;ENSP00000357129:R468C	ENSP00000357129:R468C	R	-	1	0	SPTA1	156908559	1.000000	0.71417	0.116000	0.21606	0.064000	0.16182	5.648000	0.67930	1.300000	0.44818	0.655000	0.94253	CGT		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
OR6N1	128372	broad.mit.edu	37	1	158735815	158735815	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:158735815G>T	ENST00000335094.2	-	1	677	c.658C>A	c.(658-660)Cag>Aag	p.Q220K		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q220K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					CAGATGATCTGCACATAGGAG	0.483																																					p.Q220K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C658A	1						.						122.0	121.0	122.0					1																	158735815		2203	4300	6503	157002439	SO:0001583	missense	128372	exon1			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.658C>A	1.37:g.158735815G>T	ENSP00000335535:p.Gln220Lys		157002439	NM_001005185	Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.402839	0.01165	.	.	ENSG00000197403	ENST00000335094	T	0.00183	8.6	4.89	4.89	0.63831	GPCR, rhodopsin-like superfamily (1);	0.505886	0.16703	N	0.203022	T	0.00039	0.0001	N	0.12422	0.21	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.40440	-0.9563	10	0.33940	T	0.23	-0.8142	7.256	0.26177	0.1803:0.0:0.8197:0.0	.	220	Q8NGY5	OR6N1_HUMAN	K	220	ENSP00000335535:Q220K	ENSP00000335535:Q220K	Q	-	1	0	OR6N1	157002439	0.000000	0.05858	0.372000	0.25991	0.034000	0.12701	-0.533000	0.06157	2.513000	0.84729	0.655000	0.94253	CAG		0.483	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
OR6N2	81442	broad.mit.edu	37	1	158746612	158746612	+	Nonsense_Mutation	SNP	G	G	A	rs77219835	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:158746612G>A	ENST00000339258.1	-	1	813	c.814C>T	c.(814-816)Cga>Tga	p.R272*		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R272*(1)		endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					GCAAGTGTTCGGTCAAGGGTC	0.428													G|||	10	0.00199681	0.0068	0.0	5008	,	,		20814	0.001		0.0	False		,,,				2504	0.0				p.R272X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C814T	1						.	G	stop/ARG	16,4390	23.3+/-48.9	0,16,2187	129.0	121.0	124.0		814	4.7	0.9	1	dbSNP_132	124	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	OR6N2	NM_001005278.1		0,17,6486	AA,AG,GG		0.0116,0.3631,0.1307		272/318	158746612	17,12989	2203	4300	6503	157013236	SO:0001587	stop_gained	81442	exon1			BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.814C>T	1.37:g.158746612G>A	ENSP00000344101:p.Arg272*		157013236	NM_001005278	Q6IFR2	Nonsense_Mutation	SNP	ENST00000339258.1	37	CCDS30906.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	G	19.26	3.793961	0.70452	0.003631	1.16E-4	ENSG00000188340	ENST00000339258	.	.	.	4.74	4.74	0.60224	.	0.000000	0.32204	N	0.006423	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-2.3327	10.3333	0.43835	0.0:0.0:0.8039:0.1961	.	.	.	.	X	272	.	ENSP00000344101:R272X	R	-	1	2	OR6N2	157013236	0.001000	0.12720	0.937000	0.37676	0.830000	0.47004	0.387000	0.20718	2.440000	0.82611	0.650000	0.86243	CGA		0.428	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1		
IGSF9	57549	broad.mit.edu	37	1	159900501	159900501	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:159900501G>A	ENST00000368094.1	-	14	1991	c.1794C>T	c.(1792-1794)atC>atT	p.I598I	IGSF9_ENST00000361509.3_Silent_p.I582I|IGSF9_ENST00000493195.1_5'UTR	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	598	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I582I(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGACAAGACGATTTCGCTGA	0.607																																					p.I598I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1794T	1						.						73.0	65.0	68.0					1																	159900501		2203	4300	6503	158167125	SO:0001819	synonymous_variant	57549	exon14			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1794C>T	1.37:g.159900501G>A			158167125	NM_001135050		Silent	SNP	ENST00000368094.1	37	CCDS44254.1																																																																																				0.607	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
KCNJ10	3766	broad.mit.edu	37	1	160011738	160011738	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:160011738G>A	ENST00000368089.3	-	2	811	c.585C>T	c.(583-585)tgC>tgT	p.C195C	KCNJ10_ENST00000509700.1_5'UTR	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	195					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)	p.C195C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GGATCATGAGGCAGGGCTTGC	0.562																																					p.C195C	GBM(167;1368 2014 14817 36425 43215)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C585T	1						.						95.0	86.0	89.0					1																	160011738		2203	4300	6503	158278362	SO:0001819	synonymous_variant	3766	exon2			U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.585C>T	1.37:g.160011738G>A			158278362	NM_002241	A3KME7|Q5VUT9|Q8N4I7|Q92808	Silent	SNP	ENST00000368089.3	37	CCDS1193.1																																																																																				0.562	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060629.1	NM_002241	
LMX1A	4009	broad.mit.edu	37	1	165182977	165182977	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:165182977C>T	ENST00000342310.3	-	5	952	c.570G>A	c.(568-570)aaG>aaA	p.K190K	RP11-38C18.3_ENST00000441773.1_RNA|LMX1A_ENST00000367893.4_Silent_p.K190K|RP11-38C18.2_ENST00000457106.1_RNA|LMX1A_ENST00000489443.2_5'Flank|LMX1A_ENST00000294816.2_Silent_p.K190K	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	190					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.K190K(1)		NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					GCTTATGGTCCTTGCCTTCCT	0.498																																					p.K190K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G570A	1						.						238.0	215.0	223.0					1																	165182977		2203	4300	6503	163449601	SO:0001819	synonymous_variant	4009	exon5			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.570G>A	1.37:g.165182977C>T			163449601	NM_177398	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Silent	SNP	ENST00000342310.3	37	CCDS1247.1																																																																																				0.498	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398	
MAEL	84944	broad.mit.edu	37	1	166987188	166987188	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:166987188C>T	ENST00000367872.4	+	10	1277	c.1033C>T	c.(1033-1035)Cgt>Tgt	p.R345C	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Missense_Mutation_p.R314C	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	345					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)	p.R345C(2)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						GGATGCAGGGCGTTACCAGGT	0.443																																					p.R345C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1033T	1						.						147.0	123.0	131.0					1																	166987188		2203	4300	6503	165253812	SO:0001583	missense	84944	exon10			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.1033C>T	1.37:g.166987188C>T	ENSP00000356846:p.Arg345Cys		165253812	NM_032858	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	ENST00000367872.4	37	CCDS1257.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224676	0.79576	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624;ENST00000537744	T;T;T	0.60672	0.17;0.22;0.55	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000015	T	0.58963	0.2159	L	0.29908	0.895	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.75484	0.959;0.986	T	0.63721	-0.6573	10	0.72032	D	0.01	.	15.3142	0.74059	0.0:1.0:0.0:0.0	.	314;345	E9JVC3;Q96JY0	.;MAEL_HUMAN	C	345;314;314;67	ENSP00000356846:R345C;ENSP00000356844:R314C;ENSP00000402143:R314C	ENSP00000356844:R314C	R	+	1	0	MAEL	165253812	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.056000	0.57448	2.697000	0.92050	0.555000	0.69702	CGT		0.443	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083239.1	NM_032858	
GPA33	10223	broad.mit.edu	37	1	167038173	167038173	+	Missense_Mutation	SNP	C	C	T	rs201727201		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:167038173C>T	ENST00000367868.3	-	3	744	c.401G>A	c.(400-402)cGc>cAc	p.R134H	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	134	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.R134H(1)		endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GACCAACAGGCGGACACGTGA	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18162	0.0		0.001	False		,,,				2504	0.0				p.R134H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G401A	1						.	C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	172.0	136.0	148.0		401	-0.4	0.3	1		148	4,8596	3.7+/-12.6	0,4,4296	yes	missense	GPA33	NM_005814.1	29	0,8,6495	TT,TC,CC		0.0465,0.0908,0.0615	probably-damaging	134/320	167038173	8,12998	2203	4300	6503	165304797	SO:0001583	missense	10223	exon3			U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.401G>A	1.37:g.167038173C>T	ENSP00000356842:p.Arg134His		165304797	NM_005814	Q5VZP6	Missense_Mutation	SNP	ENST00000367868.3	37	CCDS1258.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.48	3.135493	0.56828	9.08E-4	4.65E-4	ENSG00000143167	ENST00000367868	T	0.04406	3.63	5.35	-0.435	0.12279	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.985937	0.08306	N	0.966094	T	0.01940	0.0061	M	0.71581	2.175	0.09310	N	1	B	0.30236	0.274	B	0.23275	0.045	T	0.41963	-0.9479	10	0.31617	T	0.26	.	7.5284	0.27668	0.0:0.4673:0.0:0.5327	.	134	Q99795	GPA33_HUMAN	H	134	ENSP00000356842:R134H	ENSP00000356842:R134H	R	-	2	0	GPA33	165304797	0.015000	0.18098	0.278000	0.24718	0.131000	0.20780	-0.201000	0.09464	0.068000	0.16574	0.655000	0.94253	CGC		0.557	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	NM_005814	
METTL13	51603	broad.mit.edu	37	1	171759661	171759661	+	Missense_Mutation	SNP	C	C	T	rs144305462		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:171759661C>T	ENST00000361735.3	+	5	1645	c.1379C>T	c.(1378-1380)cCg>cTg	p.P460L	METTL13_ENST00000362019.3_Missense_Mutation_p.P374L|METTL13_ENST00000458517.1_Missense_Mutation_p.P459L|METTL13_ENST00000367737.5_Missense_Mutation_p.P304L|METTL13_ENST00000466643.1_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	460							methyltransferase activity (GO:0008168)	p.P460L(1)		breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CCTGCAGCCCCGGGGCAGTCC	0.542																																					p.P374L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1121T	1						.	C	LEU/PRO,LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	92.0	89.0	90.0		911,1121,1379	4.6	0.9	1	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	METTL13	NM_001007239.1,NM_014955.2,NM_015935.4	98,98,98	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	304/544,374/614,460/700	171759661	2,13004	2203	4300	6503	170026284	SO:0001583	missense	51603	exon5			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1379C>T	1.37:g.171759661C>T	ENSP00000354920:p.Pro460Leu		170026284	NM_014955	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	37	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629507	0.28978	2.27E-4	1.16E-4	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.51	4.59	0.56863	.	0.354399	0.29473	N	0.012056	T	0.02571	0.0078	L	0.40543	1.245	0.09310	N	0.999998	B;P;B	0.39601	0.008;0.68;0.031	B;B;B	0.27887	0.002;0.084;0.006	T	0.34950	-0.9808	10	0.40728	T	0.16	-38.07	9.2936	0.37802	0.1644:0.6771:0.1585:0.0	.	459;304;460	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	L	459;374;304;460	ENSP00000401955:P459L;ENSP00000355393:P374L;ENSP00000356711:P304L;ENSP00000354920:P460L	ENSP00000354920:P460L	P	+	2	0	METTL13	170026284	0.000000	0.05858	0.893000	0.35052	0.433000	0.31745	0.805000	0.27112	1.312000	0.45043	0.561000	0.74099	CCG		0.542	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	
PAPPA2	60676	broad.mit.edu	37	1	176525693	176525693	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:176525693C>A	ENST00000367662.3	+	2	1399	c.235C>A	c.(235-237)Cta>Ata	p.L79I	PAPPA2_ENST00000367661.3_Missense_Mutation_p.L79I	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	79					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L79I(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGGGAACTACCTAAGGCCCTA	0.567																																					p.L79I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C235A	1						.						126.0	120.0	122.0					1																	176525693		1956	4138	6094	174792316	SO:0001583	missense	60676	exon2			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.235C>A	1.37:g.176525693C>A	ENSP00000356634:p.Leu79Ile		174792316	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	8.283	0.816072	0.16607	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.37235	4.47;1.21	4.63	2.34	0.29019	.	0.175809	0.25375	U	0.031134	T	0.28200	0.0696	M	0.62723	1.935	0.09310	N	1	P;P	0.40970	0.58;0.734	B;B	0.32090	0.099;0.14	T	0.23762	-1.0179	10	0.56958	D	0.05	-7.9445	7.4141	0.27034	0.0:0.7573:0.0:0.2427	.	79;79	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	I	79	ENSP00000356634:L79I;ENSP00000356633:L79I	ENSP00000356633:L79I	L	+	1	2	PAPPA2	174792316	0.009000	0.17119	0.900000	0.35374	0.221000	0.24807	0.317000	0.19487	0.944000	0.37579	0.561000	0.74099	CTA		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
ZNF648	127665	broad.mit.edu	37	1	182026052	182026052	+	Missense_Mutation	SNP	G	G	A	rs115402112	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:182026052G>A	ENST00000339948.3	-	2	1301	c.1094C>T	c.(1093-1095)cCg>cTg	p.P365L		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P365L(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CTCGGAGCACGGGAAGGGCTT	0.657																																					p.P365L	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1094T	1						.						69.0	65.0	66.0					1																	182026052		2203	4300	6503	180292675	SO:0001583	missense	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1094C>T	1.37:g.182026052G>A	ENSP00000344129:p.Pro365Leu		180292675	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950726	0.34471	.	.	ENSG00000179930	ENST00000339948	T	0.19105	2.17	2.64	0.574	0.17368	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13072	0.0317	L	0.33668	1.02	0.41794	D	0.989886	B	0.20368	0.044	B	0.04013	0.001	T	0.08994	-1.0695	9	0.56958	D	0.05	.	4.5886	0.12295	0.1327:0.0:0.6498:0.2175	.	365	Q5T619	ZN648_HUMAN	L	365	ENSP00000344129:P365L	ENSP00000344129:P365L	P	-	2	0	ZNF648	180292675	0.098000	0.21812	0.996000	0.52242	0.995000	0.86356	0.341000	0.19909	0.148000	0.19059	0.561000	0.74099	CCG		0.657	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
TPR	7175	broad.mit.edu	37	1	186310226	186310226	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:186310226G>A	ENST00000367478.4	-	29	4250	c.3954C>T	c.(3952-3954)agC>agT	p.S1318S		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1318	Necessary for interaction with HSF1.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.S1319S(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCAACATACCGCTTTTCTCAC	0.388			T	NTRK1	papillary thyroid																																p.S1318S			Dom	yes		1	1q25	7175	translocated promoter region		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3954T	1						.						163.0	148.0	153.0					1																	186310226		1920	4142	6062	184576849	SO:0001819	synonymous_variant	7175	exon29			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3954C>T	1.37:g.186310226G>A			184576849	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																				0.388	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
BRINP3	339479	broad.mit.edu	37	1	190129900	190129900	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:190129900C>T	ENST00000367462.3	-	7	1313	c.1082G>A	c.(1081-1083)aGc>aAc	p.S361N	BRINP3_ENST00000534846.1_Missense_Mutation_p.S259N	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	361					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.S361N(1)									TTGTTTCATGCTGTTCTCCAG	0.393																																					p.S361N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1082A	1						.						146.0	152.0	150.0					1																	190129900		2203	4300	6503	188396523	SO:0001583	missense	339479	exon7			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1082G>A	1.37:g.190129900C>T	ENSP00000356432:p.Ser361Asn		188396523	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883821	0.72410	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.19806	2.38;2.12	5.6	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	L	0.55481	1.735	0.53688	D	0.999974	D;D	0.61080	0.989;0.981	D;D	0.70487	0.969;0.932	T	0.10636	-1.0621	10	0.46703	T	0.11	.	12.501	0.55955	0.0:0.918:0.0:0.082	.	259;361	B7Z260;Q76B58	.;FAM5C_HUMAN	N	361;259	ENSP00000356432:S361N;ENSP00000438022:S259N	ENSP00000356432:S361N	S	-	2	0	FAM5C	188396523	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.007000	0.49536	1.361000	0.45981	0.573000	0.79308	AGC		0.393	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
CD46	4179	broad.mit.edu	37	1	207934672	207934672	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:207934672A>G	ENST00000358170.2	+	5	710	c.554A>G	c.(553-555)gAt>gGt	p.D185G	CD46_ENST00000360212.2_Missense_Mutation_p.D185G|CD46_ENST00000367047.1_Missense_Mutation_p.D122G|CD46_ENST00000480003.1_Missense_Mutation_p.D185G|CD46_ENST00000357714.1_Missense_Mutation_p.D185G|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000322918.5_Missense_Mutation_p.D185G|CD46_ENST00000361067.1_Missense_Mutation_p.D185G|CD46_ENST00000367042.1_Missense_Mutation_p.D185G|CD46_ENST00000322875.4_Missense_Mutation_p.D185G|CD46_ENST00000441839.2_Missense_Mutation_p.D185G|CD46_ENST00000367041.1_Missense_Mutation_p.D185G|CD46_ENST00000354848.1_Missense_Mutation_p.D185G	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	185	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)	p.D185G(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						GAGTATCTTGATGCAGTAACT	0.373																																					p.D185G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A554G	1						.						141.0	121.0	128.0					1																	207934672		2203	4300	6503	206001295	SO:0001583	missense	4179	exon5			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.554A>G	1.37:g.207934672A>G	ENSP00000350893:p.Asp185Gly		206001295	NM_153826	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	ENST00000358170.2	37	CCDS1485.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.495694	0.44352	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000367047;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	4.64	3.48	0.39840	Complement control module (2);Sushi/SCR/CCP (3);	0.440827	0.19163	N	0.121131	T	0.74245	0.3691	L	0.50993	1.605	0.09310	N	1	P;B;P;P;D;D;P;P;P;P;P;D;D;D	0.65815	0.517;0.207;0.512;0.517;0.98;0.994;0.685;0.851;0.517;0.94;0.517;0.992;0.992;0.995	P;B;P;P;D;D;P;P;P;P;P;D;D;D	0.85130	0.657;0.191;0.687;0.657;0.989;0.995;0.657;0.77;0.657;0.819;0.657;0.992;0.992;0.997	T	0.62627	-0.6814	10	0.62326	D	0.03	.	8.3487	0.32288	0.8:0.2:0.0:0.0	.	185;185;185;185;185;185;185;185;185;185;185;185;185;185	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	G	185;185;185;185;185;185;185;122;185;185;185;185	ENSP00000350893:D185G;ENSP00000346912:D185G;ENSP00000314664:D185G;ENSP00000356009:D185G;ENSP00000356008:D185G;ENSP00000350346:D185G;ENSP00000313875:D185G;ENSP00000356014:D122G;ENSP00000413543:D185G;ENSP00000354358:D185G;ENSP00000353342:D185G;ENSP00000418471:D185G	ENSP00000313875:D185G	D	+	2	0	CD46	206001295	0.178000	0.23122	0.019000	0.16419	0.036000	0.12997	1.222000	0.32515	0.883000	0.36040	-0.446000	0.05623	GAT		0.373	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088588.3	NM_172361	
PROX1	5629	broad.mit.edu	37	1	214171555	214171555	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:214171555C>T	ENST00000366958.4	+	2	2285	c.1677C>T	c.(1675-1677)tgC>tgT	p.C559C	PROX1_ENST00000498508.2_Silent_p.C559C|PROX1_ENST00000261454.4_Silent_p.C559C|PROX1_ENST00000435016.1_Silent_p.C559C	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	559					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.C559C(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGTCCGAGTGCGGCGATCTTC	0.493																																					p.C559C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1677T	1						.						90.0	94.0	93.0					1																	214171555		2203	4300	6503	212238178	SO:0001819	synonymous_variant	5629	exon2			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1677C>T	1.37:g.214171555C>T			212238178	NM_002763	A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	CCDS31021.1																																																																																				0.493	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
WNT4	54361	broad.mit.edu	37	1	22446807	22446807	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:22446807C>T	ENST00000290167.6	-	5	835	c.792G>A	c.(790-792)ccG>ccA	p.P264P	WNT4_ENST00000542383.1_Silent_p.P209P	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	264					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)	p.P264P(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CATCTGTGTGCGGCTTGAACT	0.632																																					p.P264P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G792A	1						.						155.0	130.0	139.0					1																	22446807		2203	4300	6503	22319394	SO:0001819	synonymous_variant	54361	exon5			AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.792G>A	1.37:g.22446807C>T			22319394	NM_030761	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Silent	SNP	ENST00000290167.6	37	CCDS223.1																																																																																				0.632	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008088.2		
DEGS1	8560	broad.mit.edu	37	1	224377794	224377794	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:224377794A>G	ENST00000323699.4	+	2	764	c.598A>G	c.(598-600)Att>Gtt	p.I200V	DEGS1_ENST00000391877.3_Missense_Mutation_p.I200V	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	200					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.I200V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		TGACATTTTAATTTATTACTT	0.398																																					p.I200V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A598G	1						.						142.0	144.0	144.0					1																	224377794		2203	4300	6503	222444417	SO:0001583	missense	8560	exon2			AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.598A>G	1.37:g.224377794A>G	ENSP00000316476:p.Ile200Val		222444417	NM_003676		Missense_Mutation	SNP	ENST00000323699.4	37	CCDS1540.1	.	.	.	.	.	.	.	.	.	.	A	0.503	-0.870017	0.02570	.	.	ENSG00000143753	ENST00000415210;ENST00000323699;ENST00000391877	T;T;T	0.15718	2.4;2.4;2.4	6.02	0.545	0.17190	Fatty acid desaturase, type 1 (1);	0.330497	0.37178	N	0.002206	T	0.08626	0.0214	N	0.21324	0.655	0.32485	N	0.540986	B;B	0.06786	0.0;0.001	B;B	0.12837	0.008;0.003	T	0.44360	-0.9333	10	0.05351	T	0.99	.	10.5196	0.44912	0.6185:0.0:0.3815:0.0	.	200;179	O15121;E7EMA0	DEGS1_HUMAN;.	V	179;200;200	ENSP00000400545:I179V;ENSP00000316476:I200V;ENSP00000375749:I200V	ENSP00000316476:I200V	I	+	1	0	DEGS1	222444417	0.002000	0.14202	0.073000	0.20177	0.335000	0.28730	0.142000	0.16096	-0.147000	0.11254	0.448000	0.29417	ATT		0.398	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091285.2		
OBSCN	84033	broad.mit.edu	37	1	228479825	228479825	+	Silent	SNP	C	C	T	rs200826459	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:228479825C>T	ENST00000422127.1	+	39	10610	c.10566C>T	c.(10564-10566)tgC>tgT	p.C3522C	OBSCN_ENST00000284548.11_Silent_p.C3522C|OBSCN_ENST00000366709.4_Silent_p.C641C|OBSCN_ENST00000570156.2_Silent_p.C3951C|OBSCN_ENST00000359599.6_Silent_p.C2369C|OBSCN_ENST00000366707.4_Silent_p.C641C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3522	Ig-like 35.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.C3576C(1)|p.C3805C(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGTGTGTGTGCGGGCAGGAGA	0.597													C|||	2	0.000399361	0.0	0.0	5008	,	,		18007	0.0		0.0	False		,,,				2504	0.002				p.C3522C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C10566T	1						.	C	,	2,4244		0,2,2121	115.0	122.0	120.0		10566,10566	-3.8	1.0	1		120	18,8426		0,18,4204	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,20,6325	TT,TC,CC		0.2132,0.0471,0.1576	,	3522/7969,3522/6621	228479825	20,12670	2123	4222	6345	226546448	SO:0001819	synonymous_variant	84033	exon39			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.10566C>T	1.37:g.228479825C>T			226546448	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																				0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RAB4A	5867	broad.mit.edu	37	1	229434789	229434789	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:229434789G>A	ENST00000366690.4	+	6	719	c.511G>A	c.(511-513)Gca>Aca	p.A171T	RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	171					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)	p.A171T(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				TGTACAGTGTGCAAGAAAAAT	0.353																																					p.A171T	Esophageal Squamous(11;250 603 9619 16563)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G511A	1						.						110.0	105.0	107.0					1																	229434789		2203	4300	6503	227501412	SO:0001583	missense	5867	exon6			BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.511G>A	1.37:g.229434789G>A	ENSP00000355651:p.Ala171Thr		227501412	NM_004578	Q5T7P7|Q9BQ44	Missense_Mutation	SNP	ENST00000366690.4	37	CCDS31050.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322955	0.81580	.	.	ENSG00000168118	ENST00000366690	T	0.80738	-1.41	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	L	0.46670	1.46	0.80722	D	1	B	0.24186	0.099	B	0.33121	0.158	T	0.77659	-0.2505	10	0.66056	D	0.02	.	19.5035	0.95105	0.0:0.0:1.0:0.0	.	166	P20338	RAB4A_HUMAN	T	171	ENSP00000355651:A171T	ENSP00000355651:A171T	A	+	1	0	RAB4A	227501412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.781000	0.99029	2.674000	0.91012	0.655000	0.94253	GCA		0.353	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091727.3	NM_004578	
LUZP1	7798	broad.mit.edu	37	1	23420333	23420333	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:23420333A>C	ENST00000302291.4	-	4	1223	c.422T>G	c.(421-423)cTg>cGg	p.L141R	LUZP1_ENST00000374623.3_Missense_Mutation_p.L141R|LUZP1_ENST00000418342.1_Missense_Mutation_p.L141R|LUZP1_ENST00000314174.5_Missense_Mutation_p.L141R			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	141					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)		p.L141R(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		CTCCTCATTCAGGCTCAGACA	0.458																																					p.L141R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T422G	1						.						61.0	65.0	64.0					1																	23420333		2202	4300	6502	23292920	SO:0001583	missense	7798	exon4			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.422T>G	1.37:g.23420333A>C	ENSP00000303758:p.Leu141Arg		23292920	NM_033631	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.848106	0.71603	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174;ENST00000471849	T;T;T;T;T	0.61158	1.21;1.21;1.21;1.01;0.13	6.17	6.17	0.99709	.	0.000000	0.38492	N	0.001665	T	0.77890	0.4198	M	0.81112	2.525	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80712	-0.1260	10	0.87932	D	0	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	141;141	Q86V48-2;Q86V48	.;LUZP1_HUMAN	R	141	ENSP00000393460:L141R;ENSP00000363752:L141R;ENSP00000303758:L141R;ENSP00000313705:L141R;ENSP00000428061:L141R	ENSP00000303758:L141R	L	-	2	0	LUZP1	23292920	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	CTG		0.458	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
PGBD5	79605	broad.mit.edu	37	1	230492905	230492905	+	Missense_Mutation	SNP	G	G	A	rs534656022		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:230492905G>A	ENST00000525115.1	-	2	310	c.287C>T	c.(286-288)aCg>aTg	p.T96M	PGBD5_ENST00000391860.1_Missense_Mutation_p.T50M|PGBD5_ENST00000321327.2_Missense_Mutation_p.T195M			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	96						integral component of membrane (GO:0016021)		p.T195M(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CTTCATCTCCGTCAGCGTCAC	0.582																																					p.T96M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C287T	1						.						124.0	102.0	109.0					1																	230492905		2203	4300	6503	228559528	SO:0001583	missense	79605	exon2			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.287C>T	1.37:g.230492905G>A	ENSP00000431404:p.Thr96Met		228559528	NM_024554	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		.	.	.	.	.	.	.	.	.	.	G	12.30	1.897235	0.33535	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17213	2.29;2.29;2.29	5.79	4.87	0.63330	.	0.691135	0.15361	N	0.266409	T	0.11281	0.0275	N	0.14661	0.345	0.09310	N	1	B	0.20459	0.045	B	0.16722	0.016	T	0.21586	-1.0241	10	0.38643	T	0.18	-6.9653	11.6278	0.51156	0.1415:0.0:0.8585:0.0	.	96	Q8N414	PGBD5_HUMAN	M	50;195;96	ENSP00000375733:T50M;ENSP00000322530:T195M;ENSP00000431404:T96M	ENSP00000322530:T195M	T	-	2	0	PGBD5	228559528	0.603000	0.26924	0.093000	0.20910	0.990000	0.78478	3.810000	0.55613	1.453000	0.47775	0.655000	0.94253	ACG		0.582	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
HEATR1	55127	broad.mit.edu	37	1	236716900	236716900	+	Missense_Mutation	SNP	G	G	A	rs200854169	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:236716900G>A	ENST00000366582.3	-	43	6332	c.6218C>T	c.(6217-6219)aCg>aTg	p.T2073M	HEATR1_ENST00000366581.2_Missense_Mutation_p.T1992M	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	2073					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.T2073M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGAGTCTCTCGTCTTTAGCAG	0.498													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18165	0.0		0.0	False		,,,				2504	0.0				p.T2073M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6218T	1						.						155.0	136.0	143.0					1																	236716900		2203	4300	6503	234783523	SO:0001583	missense	55127	exon43			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.6218C>T	1.37:g.236716900G>A	ENSP00000355541:p.Thr2073Met		234783523	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	8.976	0.974173	0.18736	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.21;-0.21	4.99	1.95	0.26073	Armadillo-like helical (1);Armadillo-type fold (1);	0.257976	0.43579	N	0.000553	T	0.41558	0.1164	L	0.28192	0.835	0.80722	D	1	P;P	0.46621	0.881;0.532	B;B	0.33295	0.161;0.027	T	0.20638	-1.0269	10	0.20519	T	0.43	.	7.9492	0.30003	0.4499:0.0:0.5501:0.0	.	1992;2073	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	M	2073;1992	ENSP00000355541:T2073M;ENSP00000355540:T1992M	ENSP00000355540:T1992M	T	-	2	0	HEATR1	234783523	0.955000	0.32602	0.839000	0.33178	0.099000	0.18886	1.662000	0.37418	0.737000	0.32582	-0.355000	0.07637	ACG		0.498	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
TNFRSF9	3604	broad.mit.edu	37	1	7995117	7995117	+	Missense_Mutation	SNP	G	G	A	rs145966863	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:7995117G>A	ENST00000377507.3	-	6	666	c.500C>T	c.(499-501)cCg>cTg	p.P167L		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	167					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.P167L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GGATGCTCCCGGAGAGAGGTC	0.542																																					p.P167L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C500T	1						.	G	LEU/PRO	0,4406		0,0,2203	88.0	75.0	79.0		500	3.5	0.1	1	dbSNP_134	79	2,8598	2.2+/-6.3	0,2,4298	yes	missense	TNFRSF9	NM_001561.5	98	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	167/256	7995117	2,13004	2203	4300	6503	7917704	SO:0001583	missense	3604	exon7			L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.500C>T	1.37:g.7995117G>A	ENSP00000366729:p.Pro167Leu		7917704	NM_001561		Missense_Mutation	SNP	ENST00000377507.3	37	CCDS92.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935547	0.34189	0.0	2.33E-4	ENSG00000049249	ENST00000377507	T	0.06687	3.27	5.44	3.55	0.40652	.	0.334095	0.27654	N	0.018415	T	0.09774	0.0240	M	0.70903	2.155	0.20307	N	0.999913	P	0.35107	0.484	B	0.29077	0.098	T	0.16958	-1.0385	10	0.46703	T	0.11	-8.4461	8.8211	0.35027	0.1798:0.0:0.8202:0.0	.	167	Q07011	TNR9_HUMAN	L	167	ENSP00000366729:P167L	ENSP00000366729:P167L	P	-	2	0	TNFRSF9	7917704	0.857000	0.29778	0.065000	0.19835	0.026000	0.11368	2.560000	0.45896	1.298000	0.44778	0.557000	0.71058	CCG		0.542	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003622.1		
ZDHHC18	84243	broad.mit.edu	37	1	27175122	27175122	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:27175122C>T	ENST00000374142.4	+	3	615	c.520C>T	c.(520-522)Cgg>Tgg	p.R174W		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	174					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.R174W(1)		endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		TTCTACATACCGGCCACCCCC	0.602																																					p.R174W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C520T	1						.						81.0	86.0	85.0					1																	27175122		2203	4300	6503	27047709	SO:0001583	missense	84243	exon3			AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.520C>T	1.37:g.27175122C>T	ENSP00000363257:p.Arg174Trp		27047709	NM_032283	A6NHY9|B4DQ84|Q5JYH0|Q9H020	Missense_Mutation	SNP	ENST00000374142.4	37	CCDS30650.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451986	0.84209	.	.	ENSG00000204160	ENST00000374142;ENST00000374141;ENST00000534643	T;T;T	0.25579	1.79;1.79;1.79	5.28	4.31	0.51392	.	0.226794	0.46442	D	0.000297	T	0.64549	0.2608	H	0.96175	3.78	0.45307	D	0.9983	D	0.89917	1.0	D	0.87578	0.998	T	0.77008	-0.2747	10	0.87932	D	0	-0.0626	16.5504	0.84471	0.139:0.861:0.0:0.0	.	174	Q9NUE0	ZDH18_HUMAN	W	174;39;39	ENSP00000363257:R174W;ENSP00000363256:R39W;ENSP00000435510:R39W	ENSP00000363256:R39W	R	+	1	2	ZDHHC18	27047709	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.583000	0.67484	2.754000	0.94517	0.561000	0.74099	CGG		0.602	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011706.3	NM_032283	
WDTC1	23038	broad.mit.edu	37	1	27630237	27630237	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:27630237G>A	ENST00000319394.3	+	14	2129	c.1594G>A	c.(1594-1596)Ggc>Agc	p.G532S	WDTC1_ENST00000361771.3_Missense_Mutation_p.G531S	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	532					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)	p.G531S(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CCGCTACTGCGGCCACTGCAA	0.607																																					p.G531S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1591A	1						.						89.0	87.0	87.0					1																	27630237		2203	4300	6503	27502824	SO:0001583	missense	23038	exon14			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.1594G>A	1.37:g.27630237G>A	ENSP00000317971:p.Gly532Ser		27502824	NM_015023	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Missense_Mutation	SNP	ENST00000319394.3	37		.	.	.	.	.	.	.	.	.	.	G	34	5.370263	0.95900	.	.	ENSG00000142784	ENST00000319394;ENST00000361771	D;D	0.84660	-1.88;-1.88	4.84	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94538	0.8241	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96138	0.9098	10	0.87932	D	0	.	16.9278	0.86181	0.0:0.0:1.0:0.0	.	532;531	Q8N5D0;Q8N5D0-4	WDTC1_HUMAN;.	S	532;531	ENSP00000317971:G532S;ENSP00000355317:G531S	ENSP00000317971:G532S	G	+	1	0	WDTC1	27502824	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.397000	0.97276	2.229000	0.72834	0.561000	0.74099	GGC		0.607	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023	
TSSK3	81629	broad.mit.edu	37	1	32829290	32829290	+	Silent	SNP	C	C	T	rs147988366	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:32829290C>T	ENST00000373534.3	+	2	745	c.240C>T	c.(238-240)gcC>gcT	p.A80A	FAM229A_ENST00000432622.1_5'Flank|FAM229A_ENST00000415596.1_Intron	NM_052841.3	NP_443073.1	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	80	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.A80A(1)		NS(1)|large_intestine(6)|lung(5)|skin(2)|stomach(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				TGGAGTCTGCCGACGGGAAAA	0.582																																					p.A80A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C240T	1						.	C		0,4406		0,0,2203	82.0	88.0	86.0		240	-9.4	0.1	1	dbSNP_134	86	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	TSSK3	NM_052841.3		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		80/269	32829290	3,13003	2203	4300	6503	32601877	SO:0001819	synonymous_variant	81629	exon2			AF296450	CCDS362.1	1p35-p34	2008-02-05	2005-03-10	2005-03-12	ENSG00000162526	ENSG00000162526			15473	protein-coding gene	gene with protein product		607660	"""serine/threonine kinase 22C (spermiogenesis associated)"""	STK22C		11597141	Standard	NM_052841		Approved	SPOGA3	uc001bvf.3	Q96PN8	OTTHUMG00000007585	ENST00000373534.3:c.240C>T	1.37:g.32829290C>T			32601877	NM_052841	Q5TEE5	Silent	SNP	ENST00000373534.3	37	CCDS362.1																																																																																				0.582	TSSK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020049.1		
SYNC	81493	broad.mit.edu	37	1	33160609	33160609	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:33160609T>C	ENST00000409190.3	-	2	1548	c.1090A>G	c.(1090-1092)Acc>Gcc	p.T364A	SYNC_ENST00000373484.3_Missense_Mutation_p.T364A	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	364	Coil 2.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)	p.T33A(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						TCAGCCTGGGTTCTCTGCAGA	0.597																																					p.T364A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1090G	1						.						93.0	94.0	94.0					1																	33160609		2203	4300	6503	32933196	SO:0001583	missense	81493	exon2			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.1090A>G	1.37:g.33160609T>C	ENSP00000386439:p.Thr364Ala		32933196	NM_001161708	B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	ENST00000409190.3	37	CCDS367.2	.	.	.	.	.	.	.	.	.	.	T	13.14	2.148441	0.37923	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	D;D	0.87966	-2.32;-2.32	3.67	3.67	0.42095	Filament (1);	0.206543	0.42172	D	0.000744	T	0.72716	0.3495	N	0.04508	-0.205	0.24806	N	0.992673	P;P	0.48089	0.734;0.905	B;P	0.50490	0.302;0.642	T	0.66023	-0.6026	10	0.08179	T	0.78	-9.5795	4.908	0.13807	0.0:0.1011:0.1892:0.7096	.	364;364	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	A	364	ENSP00000362583:T364A;ENSP00000386439:T364A	ENSP00000362583:T364A	T	-	1	0	SYNC	32933196	0.994000	0.37717	0.999000	0.59377	0.682000	0.39822	1.098000	0.31000	1.686000	0.51046	0.402000	0.26972	ACC		0.597	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022129.3	NM_030786	
CSF3R	1441	broad.mit.edu	37	1	36939140	36939140	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:36939140C>T	ENST00000373106.1	-	6	1116	c.569G>A	c.(568-570)cGc>cAc	p.R190H	CSF3R_ENST00000361632.4_Missense_Mutation_p.R190H|CSF3R_ENST00000331941.5_Missense_Mutation_p.R190H|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000338937.5_Missense_Mutation_p.R190H|CSF3R_ENST00000373104.1_Missense_Mutation_p.R190H|CSF3R_ENST00000418048.2_Missense_Mutation_p.R190H|CSF3R_ENST00000373103.1_Missense_Mutation_p.R190H|CSF3R_ENST00000440588.2_Missense_Mutation_p.R190H	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	190	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.R190H(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CAGGTGTTTGCGTGGGATGCA	0.597																																					p.R190H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G569A	1						.						97.0	84.0	88.0					1																	36939140		2203	4300	6503	36711727	SO:0001583	missense	1441	exon6			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.569G>A	1.37:g.36939140C>T	ENSP00000362198:p.Arg190His		36711727	NM_172313		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634735	0.87660	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23	5.52	5.52	0.82312	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.263761	0.39909	N	0.001239	T	0.57403	0.2051	M	0.71296	2.17	0.48901	D	0.99972	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.50742	-0.8792	10	0.14656	T	0.56	-30.3666	16.5874	0.84731	0.0:1.0:0.0:0.0	.	190;190;190;190	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	H	190	ENSP00000362198:R190H;ENSP00000362196:R190H;ENSP00000362195:R190H;ENSP00000355406:R190H;ENSP00000332180:R190H;ENSP00000401588:R190H;ENSP00000345013:R190H;ENSP00000397568:R190H	ENSP00000332180:R190H	R	-	2	0	CSF3R	36711727	0.991000	0.36638	1.000000	0.80357	0.748000	0.42578	3.376000	0.52417	2.607000	0.88179	0.609000	0.83330	CGC		0.597	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	
GRIK3	2899	broad.mit.edu	37	1	37270837	37270837	+	Splice_Site	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:37270837G>A	ENST00000373091.3	-	15	2332	c.2316C>T	c.(2314-2316)ggC>ggT	p.G772G	GRIK3_ENST00000373093.4_Splice_Site_p.G772G	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	772					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.G772G(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGTATGGGGAGCCTGAGCAGG	0.602																																					p.G772G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2316T	1						.						52.0	46.0	48.0					1																	37270837		2203	4300	6503	37043424	SO:0001630	splice_region_variant	2899	exon15			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2315-1C>T	1.37:g.37270837G>A			37043424	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	CCDS416.1																																																																																				0.602	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	Silent
GRIK3	2899	broad.mit.edu	37	1	37346470	37346470	+	Silent	SNP	G	G	A	rs140224218	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:37346470G>A	ENST00000373091.3	-	3	331	c.315C>T	c.(313-315)ggC>ggT	p.G105G	GRIK3_ENST00000373093.4_Silent_p.G105G	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	105					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.G105G(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TCGCCACCACGCCCAGTGCCA	0.622																																					p.G105G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C315T	1						.	G		2,4404	4.2+/-10.8	0,2,2201	48.0	47.0	47.0		315	-9.6	0.5	1	dbSNP_134	47	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	GRIK3	NM_000831.3		0,3,6498	AA,AG,GG		0.0116,0.0454,0.0231		105/920	37346470	3,12999	2203	4298	6501	37119057	SO:0001819	synonymous_variant	2899	exon3			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.315C>T	1.37:g.37346470G>A			37119057	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	CCDS416.1																																																																																				0.622	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
JAK1	3716	broad.mit.edu	37	1	65332611	65332611	+	Missense_Mutation	SNP	C	C	T	rs568014073		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:65332611C>T	ENST00000342505.4	-	7	1176	c.928G>A	c.(928-930)Gtt>Att	p.V310I		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	310	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.V310I(2)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TAGTAGAGAACGTTTCCACCG	0.403			Mis		ALL								C|||	1	0.000199681	0.0	0.0	5008	,	,		21133	0.001		0.0	False		,,,				2504	0.0				p.V310I			Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G928A	1						.						167.0	151.0	156.0					1																	65332611		1962	4152	6114	65105199	SO:0001583	missense	3716	exon7			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.928G>A	1.37:g.65332611C>T	ENSP00000343204:p.Val310Ile		65105199	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	37	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	C	1.303	-0.604370	0.03717	.	.	ENSG00000162434	ENST00000342505	T	0.75050	-0.9	5.59	-7.7	0.01259	FERM domain (1);	.	.	.	.	T	0.25938	0.0632	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15694	-1.0428	9	0.34782	T	0.22	-0.0242	6.326	0.21244	0.0917:0.1964:0.0909:0.621	.	310	P23458	JAK1_HUMAN	I	310	ENSP00000343204:V310I	ENSP00000343204:V310I	V	-	1	0	JAK1	65105199	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-3.487000	0.00454	-1.574000	0.01657	-0.882000	0.02950	GTT		0.403	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
SGIP1	84251	broad.mit.edu	37	1	67185045	67185045	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:67185045A>G	ENST00000371037.4	+	19	1776	c.1699A>G	c.(1699-1701)Aca>Gca	p.T567A	SGIP1_ENST00000371035.3_Missense_Mutation_p.T357A|SGIP1_ENST00000435165.2_Missense_Mutation_p.T72A|SGIP1_ENST00000237247.6_Missense_Mutation_p.T598A|SGIP1_ENST00000371039.1_Missense_Mutation_p.T370A|SGIP1_ENST00000371036.3_Missense_Mutation_p.T369A	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	567	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.T567A(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						AGCAGCATTTACAGAAACAGT	0.448																																					p.T567A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1699G	1						.						79.0	72.0	74.0					1																	67185045		2203	4300	6503	66957633	SO:0001583	missense	84251	exon19			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1699A>G	1.37:g.67185045A>G	ENSP00000360076:p.Thr567Ala		66957633	NM_032291	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599256	0.66332	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037;ENST00000435165	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04	5.4	5.4	0.78164	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	M	0.80183	2.485	0.58432	D	0.999999	P;B;B;B;B	0.41597	0.756;0.006;0.122;0.276;0.001	P;B;B;B;B	0.49953	0.627;0.015;0.064;0.07;0.008	T	0.51340	-0.8718	10	0.42905	T	0.14	-15.8356	15.428	0.75069	1.0:0.0:0.0:0.0	.	597;72;169;357;567	A6NEV3;Q6ZV33;B3KR01;B7Z5H8;Q9BQI5	.;.;.;.;SGIP1_HUMAN	A	598;370;357;597;570;369;567;72	ENSP00000237247:T598A;ENSP00000360078:T370A;ENSP00000360074:T357A;ENSP00000360075:T369A;ENSP00000360076:T567A;ENSP00000395525:T72A	ENSP00000237247:T598A	T	+	1	0	SGIP1	66957633	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	8.905000	0.92613	2.045000	0.60652	0.528000	0.53228	ACA		0.448	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291	
ST6GALNAC3	256435	broad.mit.edu	37	1	76877876	76877876	+	Missense_Mutation	SNP	G	G	A	rs369940675		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:76877876G>A	ENST00000328299.3	+	3	545	c.397G>A	c.(397-399)Gtt>Att	p.V133I	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	133					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.V133I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						CCATACCAGCGTTCCTCTTTT	0.428																																					p.V133I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G397A	1						.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	127.0	123.0	125.0		397,397	6.2	1.0	1		125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ST6GALNAC3	NM_001160011.1,NM_152996.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	133/211,133/306	76877876	1,13005	2203	4300	6503	76650464	SO:0001583	missense	256435	exon3				CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.397G>A	1.37:g.76877876G>A	ENSP00000329214:p.Val133Ile		76650464	NM_152996	Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	CCDS672.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109128	0.77096	0.0	1.16E-4	ENSG00000184005	ENST00000394994;ENST00000328299;ENST00000394993;ENST00000415813	T	0.28666	1.6	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	L	0.48986	1.54	0.80722	D	1	D;P;D	0.89917	0.973;0.937;1.0	P;P;D	0.71414	0.844;0.692;0.973	T	0.01416	-1.1360	10	0.30078	T	0.28	-39.2379	19.8676	0.96824	0.0:0.0:1.0:0.0	.	68;133;133	B4DM98;Q8NDV1;Q8NDV1-2	.;SIA7C_HUMAN;.	I	133;133;132;67	ENSP00000329214:V133I	ENSP00000329214:V133I	V	+	1	0	ST6GALNAC3	76650464	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.621000	0.83083	2.941000	0.99782	0.655000	0.94253	GTT		0.428	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996	
ST6GALNAC5	81849	broad.mit.edu	37	1	77510139	77510139	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:77510139delG	ENST00000477717.1	+	3	747	c.512delG	c.(511-513)tggfs	p.W171fs		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	171					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.G172fs*21(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						TTCATCTTCTGGGGCCCCAGC	0.627																																					p.W171fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.512delG	1						.						72.0	66.0	68.0					1																	77510139		2203	4300	6503	77282727	SO:0001589	frameshift_variant	81849	exon3				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.512delG	1.37:g.77510139delG	ENSP00000417583:p.Trp171fs		77282727	NM_030965	B1AK82	Frame_Shift_Del	DEL	ENST00000477717.1	37	CCDS673.1																																																																																				0.627	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
AK5	26289	broad.mit.edu	37	1	77883328	77883328	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:77883328A>G	ENST00000354567.2	+	8	1250	c.987A>G	c.(985-987)tcA>tcG	p.S329S	AK5_ENST00000344720.5_Silent_p.S303S|RNU7-8P_ENST00000515958.1_RNA	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	329					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)	p.S329S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						TCTTAGGTTCAAGTGACCTTG	0.348																																					p.S303S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A909G	1						.						120.0	105.0	110.0					1																	77883328		2203	4300	6503	77655916	SO:0001819	synonymous_variant	26289	exon8			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.987A>G	1.37:g.77883328A>G			77655916	NM_012093	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Silent	SNP	ENST00000354567.2	37	CCDS675.1																																																																																				0.348	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858	
SYDE2	84144	broad.mit.edu	37	1	85630376	85630376	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:85630376A>G	ENST00000341460.5	-	6	2967	c.2918T>C	c.(2917-2919)aTg>aCg	p.M973T		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	973	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.M973T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		CTGGCACGTCATCTTATTCAC	0.358																																					p.M973T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2918C	1						.						63.0	57.0	59.0					1																	85630376		1873	4098	5971	85402964	SO:0001583	missense	84144	exon6			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.2918T>C	1.37:g.85630376A>G	ENSP00000340594:p.Met973Thr		85402964	NM_032184	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093878	0.76870	.	.	ENSG00000097096	ENST00000341460	T	0.40225	1.04	5.55	5.55	0.83447	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83109	-0.0124	10	0.87932	D	0	.	15.7004	0.77538	1.0:0.0:0.0:0.0	.	973	Q5VT97	SYDE2_HUMAN	T	973	ENSP00000340594:M973T	ENSP00000340594:M973T	M	-	2	0	SYDE2	85402964	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	2.117000	0.64856	0.482000	0.46254	ATG		0.358	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2		
HFM1	164045	broad.mit.edu	37	1	91742573	91742573	+	Silent	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:91742573A>C	ENST00000370425.3	-	31	3536	c.3438T>G	c.(3436-3438)ctT>ctG	p.L1146L	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Silent_p.L378L|HFM1_ENST00000370424.3_Silent_p.L825L	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1146					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.L1146L(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TACTTTTACAAAGATGATTGC	0.318																																					p.L1146L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3438G	1						.						140.0	139.0	140.0					1																	91742573		2203	4299	6502	91515161	SO:0001819	synonymous_variant	164045	exon31			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3438T>G	1.37:g.91742573A>C			91515161	NM_001017975	B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.299|6.299	0.423341|0.423341	0.11928|0.11928	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370421	.|.	.|.	.|.	5.71|5.71	0.841|0.841	0.18918|0.18918	.|.	.|0.451664	.|0.21936	.|N	.|0.066958	T|T	0.65502|0.65502	0.2697|0.2697	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.72347|0.72347	-0.4321|-0.4321	4|6	.|0.87932	.|D	.|0	.|.	15.7605|15.7605	0.78076|0.78076	0.1093:0.0:0.8907:0.0|0.1093:0.0:0.8907:0.0	.|.	.|.	.|.	.|.	C|V	358|830	.|.	.|ENSP00000359450:L830V	F|L	-|-	2|1	0|2	HFM1|HFM1	91515161|91515161	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.723000|0.723000	0.41478|0.41478	1.667000|1.667000	0.37471|0.37471	-0.135000|-0.135000	0.11495|0.11495	-0.386000|-0.386000	0.06593|0.06593	TTT|TTG		0.318	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
SNX7	51375	broad.mit.edu	37	1	99150450	99150450	+	Missense_Mutation	SNP	T	T	A	rs373578146		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:99150450T>A	ENST00000306121.3	+	2	199	c.190T>A	c.(190-192)Ttg>Atg	p.L64M	SNX7_ENST00000529992.1_Missense_Mutation_p.L64M|SNX7_ENST00000370189.5_5'UTR	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	202	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.L64M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		GGATGCCTCATTGATGGACAT	0.308																																					p.L64M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T190A	1						.						104.0	95.0	98.0					1																	99150450		2203	4300	6503	98923038	SO:0001583	missense	51375	exon2			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.190T>A	1.37:g.99150450T>A	ENSP00000304429:p.Leu64Met		98923038	NM_152238	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	De_novo_Start_InFrame	SNP	ENST00000306121.3	37	CCDS755.2	.	.	.	.	.	.	.	.	.	.	T	16.24	3.067809	0.55539	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	T;T	0.33654	2.06;1.4	5.24	-7.22	0.01485	.	.	.	.	.	T	0.29256	0.0728	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.946;0.976	T	0.55256	-0.8169	9	0.48119	T	0.1	.	17.3659	0.87364	0.0:0.8452:0.0:0.1548	.	64;64	E9PNL2;Q9UNH6-3	.;.	M	64	ENSP00000434731:L64M;ENSP00000304429:L64M	ENSP00000304429:L64M	L	+	1	2	SNX7	98923038	0.000000	0.05858	0.029000	0.17559	0.967000	0.64934	-1.579000	0.02123	-1.328000	0.02261	-1.007000	0.02485	TTG		0.308	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
PLPPR4	9890	broad.mit.edu	37	1	99772218	99772218	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:99772218G>A	ENST00000370185.3	+	7	2441	c.1944G>A	c.(1942-1944)aaG>aaA	p.K648K	LPPR4_ENST00000457765.1_Silent_p.K590K|LPPR4_ENST00000370184.1_Silent_p.K490K	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		648					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.K648K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GCTCCTGGAAGTGGAAAGCCC	0.532																																					p.K648K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1944A	1						.						72.0	71.0	71.0					1																	99772218		2203	4300	6503	99544806	SO:0001819	synonymous_variant	9890	exon7																														ENST00000370185.3:c.1944G>A	1.37:g.99772218G>A			99544806	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	ENST00000370185.3	37	CCDS757.1																																																																																				0.532	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
FRRS1	391059	broad.mit.edu	37	1	100207805	100207805	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:100207805C>A	ENST00000414213.1	-	5	959	c.358G>T	c.(358-360)Gca>Tca	p.A120S	FRRS1_ENST00000287474.5_Missense_Mutation_p.A120S			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	120	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)	p.A120S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TTTTTAGATGCACTTCTGTGA	0.403																																					p.A120S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G358T	1						.						146.0	146.0	146.0					1																	100207805		2203	4300	6503	99980393	SO:0001583	missense	391059	exon5			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.358G>T	1.37:g.100207805C>A	ENSP00000393884:p.Ala120Ser		99980393	NM_001013660	A6NLN7	Missense_Mutation	SNP	ENST00000414213.1	37		.	.	.	.	.	.	.	.	.	.	C	0.391	-0.923673	0.02377	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.83	-8.57	0.00900	.	1.191410	0.05916	N	0.632532	T	0.01905	0.0060	N	0.02775	-0.495	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.28744	-1.0034	9	0.09590	T	0.72	-1.138	1.1683	0.01820	0.3226:0.311:0.1135:0.2529	.	120	Q6ZNA5-2	.	S	120	.	ENSP00000287474:A120S	A	-	1	0	FRRS1	99980393	0.013000	0.17824	0.001000	0.08648	0.099000	0.18886	-1.013000	0.03645	-1.025000	0.03334	-2.047000	0.00414	GCA		0.403	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013660	
GCSAML	148823	broad.mit.edu	37	1	247726901	247726901	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr1:247726901G>A	ENST00000366488.4	+	3	203	c.99G>A	c.(97-99)atG>atA	p.M33I	GCSAML_ENST00000527541.1_Start_Codon_SNP_p.M1I|GCSAML_ENST00000527084.1_Start_Codon_SNP_p.M1I|GCSAML_ENST00000366489.1_Missense_Mutation_p.M13I|RP11-978I15.10_ENST00000435333.1_RNA|GCSAML_ENST00000366491.2_Missense_Mutation_p.M13I|GCSAML_ENST00000463359.1_Start_Codon_SNP_p.M1I|RP11-978I15.10_ENST00000446347.1_RNA|GCSAML_ENST00000536561.1_Missense_Mutation_p.M13I	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	33								p.M33I(1)									GGCAGGAAATGACTACATTTG	0.343																																					p.M33I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G99A	1						.						60.0	61.0	61.0					1																	247726901		2203	4300	6503	245793524	SO:0001583	missense	148823	exon3			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366488.4:c.99G>A	1.37:g.247726901G>A	ENSP00000355444:p.Met33Ile		245793524	NM_145278	B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	ENST00000366488.4	37	CCDS1635.1	.	.	.	.	.	.	.	.	.	.	G	1.995	-0.430924	0.04669	.	.	ENSG00000169224	ENST00000527084;ENST00000527541;ENST00000366491;ENST00000366489;ENST00000526896;ENST00000463359;ENST00000529512;ENST00000366488;ENST00000536561	.	.	.	3.27	1.31	0.21738	.	.	.	.	.	T	0.16896	0.0406	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32929	-0.9888	8	0.02654	T	1	1.0645	3.7578	0.08592	0.1307:0.0:0.6285:0.2407	.	33	Q5JQS6	CA150_HUMAN	I	1;1;13;13;33;1;1;33;13	.	ENSP00000355444:M33I	M	+	3	0	C1orf150	245793524	0.380000	0.25131	0.059000	0.19551	0.114000	0.19823	1.032000	0.30178	0.359000	0.24239	0.585000	0.79938	ATG		0.343	GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097745.4	NM_145278	
DSTN	11034	broad.mit.edu	37	20	17581651	17581651	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:17581651C>T	ENST00000246069.7	+	2	618	c.272C>T	c.(271-273)aCa>aTa	p.T91I	DSTN_ENST00000474024.1_Missense_Mutation_p.T74I	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	91	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)		p.T91I(1)		endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						AGCTTTGAAACAAAAGAATCC	0.373																																					p.T91I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C272T	20						.						85.0	83.0	84.0					20																	17581651		2203	4300	6503	17529651	SO:0001583	missense	11034	exon2			S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.272C>T	20.37:g.17581651C>T	ENSP00000246069:p.Thr91Ile		17529651	NM_006870	B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Missense_Mutation	SNP	ENST00000246069.7	37	CCDS13127.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630051	0.87660	.	.	ENSG00000125868	ENST00000246069;ENST00000543261	T;T	0.32272	1.46;1.46	5.65	5.65	0.86999	Actin-binding, cofilin/tropomyosin type (3);	0.043880	0.85682	D	0.000000	T	0.60444	0.2269	M	0.81497	2.545	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.62656	-0.6808	10	0.59425	D	0.04	-13.4082	18.716	0.91675	0.0:1.0:0.0:0.0	.	91	P60981	DEST_HUMAN	I	91;74	ENSP00000246069:T91I;ENSP00000444808:T74I	ENSP00000246069:T91I	T	+	2	0	DSTN	17529651	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.743000	0.85020	2.681000	0.91329	0.563000	0.77884	ACA		0.373	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546	
NAPB	63908	broad.mit.edu	37	20	23358123	23358123	+	Splice_Site	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:23358123C>T	ENST00000377026.4	-	11	872	c.787G>A	c.(787-789)Gtg>Atg	p.V263M	NAPB_ENST00000472855.1_5'Flank|NAPB_ENST00000432543.2_Splice_Site_p.V224M|NAPB_ENST00000398425.3_Splice_Site_p.V169M	NM_001283018.1|NM_001283020.1|NM_022080.2	NP_001269947.1|NP_001269949.1|NP_071363.1	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, beta	263					intracellular protein transport (GO:0006886)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	extracellular vesicular exosome (GO:0070062)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)		p.V263M(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					AATTCCTTCACCTAGTATAAG	0.403																																					p.V263M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G787A	20						.						81.0	78.0	79.0					20																	23358123		2203	4300	6503	23306123	SO:0001630	splice_region_variant	63908	exon11			AK022817	CCDS13152.1, CCDS63241.1, CCDS63242.1, CCDS74710.1	20p12.3-p11.21	2008-08-01			ENSG00000125814	ENSG00000125814			15751	protein-coding gene	gene with protein product		611270				8455721	Standard	NM_022080		Approved	SNAP-BETA, SNAPB	uc002wta.3	Q9H115	OTTHUMG00000032062	ENST00000377026.4:c.787-1G>A	20.37:g.23358123C>T			23306123	NM_022080	B4DK44|Q4G0M0|Q4G187|Q5JXF9|Q8N3C4	Missense_Mutation	SNP	ENST00000377026.4	37	CCDS13152.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524863	0.85600	.	.	ENSG00000125814	ENST00000377026;ENST00000398425;ENST00000432543;ENST00000431864	T;T;T	0.39406	1.08;1.08;1.08	5.25	5.25	0.73442	Tetratricopeptide-like helical (1);	0.064020	0.64402	D	0.000007	T	0.76154	0.3948	H	0.96365	3.81	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.999;0.999	D;D;D;D	0.74023	0.982;0.97;0.982;0.982	D	0.84374	0.0545	10	0.87932	D	0	-14.8749	18.1845	0.89789	0.0:1.0:0.0:0.0	.	224;169;267;263	B4DK44;Q4G0M0;B4DIV0;Q9H115	.;.;.;SNAB_HUMAN	M	263;169;224;220	ENSP00000366225:V263M;ENSP00000381459:V169M;ENSP00000413600:V224M	ENSP00000366225:V263M	V	-	1	0	NAPB	23306123	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	7.737000	0.84957	2.608000	0.88229	0.462000	0.41574	GTG		0.403	NAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078317.2	NM_022080	Missense_Mutation
GDAP1L1	78997	broad.mit.edu	37	20	42907701	42907701	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:42907701T>C	ENST00000342560.5	+	6	953	c.865T>C	c.(865-867)Tac>Cac	p.Y289H	GDAP1L1_ENST00000537864.1_Missense_Mutation_p.Y97H	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	289	GST C-terminal.							p.Y289H(1)		endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTCCAAGAAATACTGGGAAGA	0.592																																					p.Y289H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T865C	20						.						78.0	76.0	76.0					20																	42907701		2203	4300	6503	42341115	SO:0001583	missense	78997	exon6				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.865T>C	20.37:g.42907701T>C	ENSP00000341782:p.Tyr289His		42341115	NM_024034	B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	ENST00000342560.5	37	CCDS13328.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081815	0.76528	.	.	ENSG00000124194	ENST00000342560;ENST00000372947;ENST00000372946;ENST00000545149;ENST00000262604;ENST00000438466;ENST00000537864;ENST00000447658	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.08	5.08	0.68730	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95589	0.8566	M	0.63843	1.955	0.80722	D	1	P;D;D	0.63046	0.956;0.992;0.99	P;D;P	0.67725	0.785;0.953;0.89	D	0.95736	0.8779	10	0.56958	D	0.05	.	15.1527	0.72713	0.0:0.0:0.0:1.0	.	231;308;289	B7Z1I3;B7Z621;Q96MZ0	.;.;GD1L1_HUMAN	H	289;284;231;255;75;231;97;71	ENSP00000341782:Y289H;ENSP00000392881:Y231H;ENSP00000440498:Y97H;ENSP00000391714:Y71H	ENSP00000262604:Y75H	Y	+	1	0	GDAP1L1	42341115	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.565000	0.82337	2.046000	0.60703	0.533000	0.62120	TAC		0.592	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079356.1	NM_024034	
ZMYND8	23613	broad.mit.edu	37	20	45865224	45865224	+	Missense_Mutation	SNP	G	G	A	rs373435522		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:45865224G>A	ENST00000311275.7	-	16	2895	c.2642C>T	c.(2641-2643)aCg>aTg	p.T881M	ZMYND8_ENST00000536340.1_Missense_Mutation_p.T908M|ZMYND8_ENST00000262975.4_Missense_Mutation_p.T835M|ZMYND8_ENST00000461685.1_Missense_Mutation_p.T855M|ZMYND8_ENST00000471951.2_Missense_Mutation_p.T901M|ZMYND8_ENST00000458360.2_Missense_Mutation_p.T749M|ZMYND8_ENST00000372023.3_Missense_Mutation_p.T830M|ZMYND8_ENST00000355972.4_Missense_Mutation_p.T881M|ZMYND8_ENST00000360911.3_Missense_Mutation_p.T830M|ZMYND8_ENST00000468376.2_5'Flank|ZMYND8_ENST00000446994.2_Missense_Mutation_p.T772M|ZMYND8_ENST00000396281.4_Missense_Mutation_p.T881M|ZMYND8_ENST00000352431.2_Missense_Mutation_p.T855M|ZMYND8_ENST00000540497.1_Missense_Mutation_p.T829M	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	881					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.T855M(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GATGGTGGACGTGGATGGGCT	0.597																																					p.T855M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2564T	20						.	G	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	187.0	124.0	146.0		2564,2564,2489	5.7	1.0	20		146	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ZMYND8	NM_012408.3,NM_183047.1,NM_183048.1	81,81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	855/1161,855/1189,830/1136	45865224	1,13005	2203	4300	6503	45298631	SO:0001583	missense	23613	exon16			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2642C>T	20.37:g.45865224G>A	ENSP00000312237:p.Thr881Met		45298631	NM_012408	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.581632	0.86748	0.0	1.16E-4	ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	D;D;D;D;D;D;D;D;D;D;D	0.91124	-1.97;-1.77;-1.78;-1.89;-1.88;-1.8;-1.79;-2.79;-1.86;-1.8;-1.91	5.74	5.74	0.90152	.	0.120489	0.53938	D	0.000045	D	0.94840	0.8333	M	0.68952	2.095	0.52501	D	0.999959	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85130	0.894;0.992;0.935;0.935;0.947;0.977;0.97;0.97;0.977;0.95;0.935;0.95;0.964;0.997;0.935;0.959	D	0.94818	0.7984	10	0.66056	D	0.02	-1.9627	18.11	0.89532	0.0:0.0:1.0:0.0	.	749;908;830;810;901;835;830;855;855;881;772;830;829;774;783;881	B7ZM62;F5H0X3;Q2HXV3;Q5TH11;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8	.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.	M	830;881;749;836;902;855;881;908;881;772;855;830;829	ENSP00000354166:T830M;ENSP00000312237:T881M;ENSP00000392964:T749M;ENSP00000335537:T855M;ENSP00000379577:T881M;ENSP00000439800:T908M;ENSP00000348246:T881M;ENSP00000396725:T772M;ENSP00000418210:T855M;ENSP00000361093:T830M;ENSP00000443086:T829M	ENSP00000262975:T836M	T	-	2	0	ZMYND8	45298631	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.968000	0.93407	2.695000	0.91970	0.655000	0.94253	ACG		0.597	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
B4GALT5	9334	broad.mit.edu	37	20	48263537	48263537	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:48263537G>A	ENST00000371711.4	-	3	516	c.329C>T	c.(328-330)gCa>gTa	p.A110V		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	110					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.A110V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			GGTATGGTTTGCAAAGTAGGT	0.443																																					p.A110V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C329T	20						.						207.0	190.0	196.0					20																	48263537		2203	4300	6503	47696944	SO:0001583	missense	9334	exon3			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.329C>T	20.37:g.48263537G>A	ENSP00000360776:p.Ala110Val		47696944	NM_004776	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	37	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511696	0.64522	.	.	ENSG00000158470	ENST00000371711	T	0.39592	1.07	5.45	5.45	0.79879	.	0.166080	0.53938	D	0.000052	T	0.39226	0.1070	L	0.36672	1.1	0.38886	D	0.957017	B	0.23185	0.081	B	0.25759	0.063	T	0.20107	-1.0285	10	0.41790	T	0.15	-10.3362	19.6309	0.95701	0.0:0.0:1.0:0.0	.	110	O43286	B4GT5_HUMAN	V	110	ENSP00000360776:A110V	ENSP00000360776:A110V	A	-	2	0	B4GALT5	47696944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.351000	0.59398	2.716000	0.92895	0.650000	0.86243	GCA		0.443	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
NFATC2	4773	broad.mit.edu	37	20	50140605	50140605	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:50140605C>T	ENST00000396009.3	-	2	394	c.175G>A	c.(175-177)Gca>Aca	p.A59T	NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609943.1_Missense_Mutation_p.A39T|NFATC2_ENST00000371564.3_Missense_Mutation_p.A59T|NFATC2_ENST00000414705.1_Missense_Mutation_p.A39T|NFATC2_ENST00000609507.1_Intron	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	59					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A59T(2)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					TCGGGGTATGCGGGTCCGGAG	0.592																																					p.A59T												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G175A	20						.						49.0	57.0	54.0					20																	50140605		2203	4300	6503	49574012	SO:0001583	missense	4773	exon2			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.175G>A	20.37:g.50140605C>T	ENSP00000379330:p.Ala59Thr		49574012	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883442	0.33255	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.14893	2.47;2.47;2.48	5.31	0.654	0.17833	.	1.029610	0.07687	N	0.938074	T	0.10165	0.0249	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.17268	0.016;0.016;0.016;0.021	B;B;B;B	0.09377	0.003;0.002;0.004;0.003	T	0.39522	-0.9610	10	0.23302	T	0.38	-0.1472	5.0295	0.14402	0.1161:0.4371:0.3411:0.1057	.	39;39;59;59	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	T	59;59;39	ENSP00000360619:A59T;ENSP00000379330:A59T;ENSP00000396471:A39T	ENSP00000360619:A59T	A	-	1	0	NFATC2	49574012	0.772000	0.28567	0.980000	0.43619	0.986000	0.74619	-0.193000	0.09573	0.184000	0.20083	0.313000	0.20887	GCA		0.592	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
ATP9A	10079	broad.mit.edu	37	20	50273555	50273555	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:50273555G>A	ENST00000338821.5	-	14	1692	c.1428C>T	c.(1426-1428)aaC>aaT	p.N476N	ATP9A_ENST00000402822.1_Silent_p.N355N|ATP9A_ENST00000311637.5_Silent_p.N340N	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	476					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N476N(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAGTCACACCGTTGGACTCAT	0.617																																					p.N476N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1428T	20						.						113.0	83.0	93.0					20																	50273555		2203	4300	6503	49706962	SO:0001819	synonymous_variant	10079	exon14			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1428C>T	20.37:g.50273555G>A			49706962	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	CCDS33489.1																																																																																				0.617	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
TRMT6	51605	broad.mit.edu	37	20	5930927	5930927	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:5930927C>T	ENST00000203001.2	-	1	255	c.125G>A	c.(124-126)aGa>aAa	p.R42K	TRMT6_ENST00000453074.2_5'UTR|MCM8_ENST00000378883.1_5'Flank|MCM8_ENST00000378896.3_5'Flank|TRMT6_ENST00000473131.1_5'UTR|MCM8_ENST00000378886.2_5'Flank|MCM8_ENST00000265187.4_5'Flank	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	42					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.R42K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						GACTTACTTTCTCCGCTGGAC	0.567																																					p.R42K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G125A	20						.						118.0	110.0	113.0					20																	5930927		2203	4300	6503	5878927	SO:0001583	missense	51605	exon1			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.125G>A	20.37:g.5930927C>T	ENSP00000203001:p.Arg42Lys		5878927	NM_015939	B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	ENST00000203001.2	37	CCDS13093.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523992	0.27299	.	.	ENSG00000089195	ENST00000203001	T	0.20598	2.06	5.41	3.49	0.39957	.	0.209718	0.49916	N	0.000127	T	0.09158	0.0226	N	0.10733	0.035	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.13522	-1.0506	10	0.07325	T	0.83	.	10.9421	0.47278	0.0:0.7918:0.0:0.2082	.	42	Q9UJA5	TRM6_HUMAN	K	42	ENSP00000203001:R42K	ENSP00000203001:R42K	R	-	2	0	TRMT6	5878927	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.239000	0.32719	0.855000	0.35359	0.609000	0.83330	AGA		0.567	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077889.2		
TUBB1	81027	broad.mit.edu	37	20	57599600	57599600	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr20:57599600C>T	ENST00000217133.1	+	4	1387	c.1118C>T	c.(1117-1119)gCc>gTc	p.A373V		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	373					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A373V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	AACAACACGGCCATCCAAGAG	0.527																																					p.A373V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1118T	20						.						46.0	44.0	45.0					20																	57599600		2203	4300	6503	57032995	SO:0001583	missense	81027	exon4			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.1118C>T	20.37:g.57599600C>T	ENSP00000217133:p.Ala373Val		57032995	NM_030773		Missense_Mutation	SNP	ENST00000217133.1	37	CCDS13475.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043682	0.93685	.	.	ENSG00000101162	ENST00000217133	D	0.84660	-1.88	5.54	5.54	0.83059	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94608	0.8262	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95617	0.8677	10	0.87932	D	0	.	18.4559	0.90720	0.0:1.0:0.0:0.0	.	373	Q9H4B7	TBB1_HUMAN	V	373	ENSP00000217133:A373V	ENSP00000217133:A373V	A	+	2	0	TUBB1	57032995	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.818000	0.86416	2.614000	0.88457	0.655000	0.94253	GCC		0.527	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
CLDN8	9073	broad.mit.edu	37	21	31587610	31587610	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr21:31587610C>T	ENST00000399899.1	-	1	781	c.634G>A	c.(634-636)Gga>Aga	p.G212R	CLDN8_ENST00000286809.1_Missense_Mutation_p.G212R	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	212					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.G212R(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						GACTTCTTTCCGGTGTGATAA	0.398																																					p.G212R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G634A	21						.						147.0	134.0	139.0					21																	31587610		2203	4300	6503	30509481	SO:0001583	missense	9073	exon1			AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.634G>A	21.37:g.31587610C>T	ENSP00000382783:p.Gly212Arg		30509481	NM_199328	D3DSE3|Q53EX7	Missense_Mutation	SNP	ENST00000399899.1	37	CCDS13587.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.668456	0.00765	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.83419	-1.72;-1.72	4.95	3.11	0.35812	.	1.029400	0.07685	N	0.937808	T	0.63450	0.2512	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.08055	0.003	T	0.51474	-0.8701	10	0.15499	T	0.54	.	4.04	0.09746	0.1474:0.559:0.2064:0.0873	.	212	P56748	CLD8_HUMAN	R	212	ENSP00000382783:G212R;ENSP00000286809:G212R	ENSP00000286809:G212R	G	-	1	0	CLDN8	30509481	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.863000	0.27913	0.789000	0.33779	-0.145000	0.13849	GGA		0.398	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182260.1	NM_199328	
TIAM1	7074	broad.mit.edu	37	21	32617909	32617909	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr21:32617909G>A	ENST00000286827.3	-	7	1950	c.1479C>T	c.(1477-1479)caC>caT	p.H493H	TIAM1_ENST00000541036.1_Silent_p.H493H|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	493	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H493H(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCCAGACGGCGTGTTTGGGGA	0.542																																					p.H493H												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1479T	21						.						94.0	83.0	87.0					21																	32617909		2203	4300	6503	31539780	SO:0001819	synonymous_variant	7074	exon7				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1479C>T	21.37:g.32617909G>A			31539780	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.542	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
C21orf59	56683	broad.mit.edu	37	21	33975570	33975570	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr21:33975570C>T	ENST00000290155.3	-	5	1189	c.567G>A	c.(565-567)gcG>gcA	p.A189A	C21orf59_ENST00000540881.1_Silent_p.A133A|C21orf59_ENST00000382549.4_Silent_p.A189A|AP000275.65_ENST00000553001.1_Silent_p.A189A	NM_021254.2	NP_067077.1	P57076	CU059_HUMAN	chromosome 21 open reading frame 59	189						cytosol (GO:0005829)|nucleus (GO:0005634)		p.A189A(1)		endometrium(2)|large_intestine(1)|prostate(1)|skin(1)	5						ACCACAGCTGCGCCTCTGCCT	0.547																																					p.A189A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G567A	21						.						105.0	94.0	98.0					21																	33975570		2203	4300	6503	32897441	SO:0001819	synonymous_variant	56683	exon5			AF282851	CCDS13617.1	21q22.11	2014-02-03	2003-07-22		ENSG00000159079	ENSG00000159079			1301	protein-coding gene	gene with protein product		615494	"""chromosome 21 open reading frame 48"""	C21orf48		24094744	Standard	NM_021254		Approved	FLJ20467, FBB18, CILD26	uc002yqc.3	P57076	OTTHUMG00000179510	ENST00000290155.3:c.567G>A	21.37:g.33975570C>T			32897441	NM_021254	Q53FH0	Silent	SNP	ENST00000290155.3	37	CCDS13617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.477|1.477	-0.558297|-0.558297	0.03967|0.03967	.|.	.|.	ENSG00000159079|ENSG00000159079	ENST00000425336|ENST00000431216	.|.	.|.	.|.	5.28|5.28	-10.6|-10.6	0.00265|0.00265	.|.	0.160384|.	0.56097|.	D|.	0.000038|.	T|T	0.40040|0.40040	0.1101|0.1101	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50955|0.50955	-0.8766|-0.8766	6|4	0.35671|.	T|.	0.21|.	-27.0179|-27.0179	3.8834|3.8834	0.09088|0.09088	0.1988:0.3592:0.3041:0.1379|0.1988:0.3592:0.3041:0.1379	.|.	.|.	.|.	.|.	T|H	37|157	.|.	ENSP00000407362:A37T|.	A|R	-|-	1|2	0|0	C21orf59|C21orf59	32897441|32897441	0.000000|0.000000	0.05858|0.05858	0.123000|0.123000	0.21794|0.21794	0.210000|0.210000	0.24377|0.24377	-2.054000|-2.054000	0.01399|0.01399	-3.567000|-3.567000	0.00140|0.00140	-1.834000|-1.834000	0.00590|0.00590	GCA|CGC		0.547	C21orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139431.1	NM_021254	
MX2	4600	broad.mit.edu	37	21	42748941	42748941	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr21:42748941C>T	ENST00000330714.3	+	2	292	c.108C>T	c.(106-108)ttC>ttT	p.F36F	MX2_ENST00000543692.1_Silent_p.F36F	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	36					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.F36F(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CACCGCCATTCGGCACAGTGC	0.498																																					p.F36F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C108T	21						.						79.0	84.0	82.0					21																	42748941		2203	4300	6503	41670811	SO:0001819	synonymous_variant	4600	exon2				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.108C>T	21.37:g.42748941C>T			41670811	NM_002463	B7Z5D3|D3DSI7	Silent	SNP	ENST00000330714.3	37	CCDS13672.1																																																																																				0.498	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
PRMT2	3275	broad.mit.edu	37	21	48069573	48069573	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr21:48069573C>T	ENST00000397637.1	+	6	1530	c.576C>T	c.(574-576)taC>taT	p.Y192Y	PRMT2_ENST00000355680.3_Silent_p.Y192Y|PRMT2_ENST00000397628.1_Silent_p.Y192Y|PRMT2_ENST00000458387.2_Silent_p.Y192Y|PRMT2_ENST00000440086.1_Silent_p.Y192Y|PRMT2_ENST00000397638.2_Silent_p.Y192Y|PRMT2_ENST00000491389.1_3'UTR|PRMT2_ENST00000451211.2_Silent_p.Y192Y|PRMT2_ENST00000291705.6_Silent_p.Y192Y|PRMT2_ENST00000334494.4_Silent_p.Y192Y			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	192	Interaction with ESR1.|Interaction with RB1. {ECO:0000250}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Y192Y(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCACCGTGTACCAGCAGAAGG	0.642																																					p.Y192Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C576T	21						.						123.0	83.0	97.0					21																	48069573		2203	4300	6503	46894001	SO:0001819	synonymous_variant	3275	exon6			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.576C>T	21.37:g.48069573C>T			46894001	NM_001535	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Silent	SNP	ENST00000397637.1	37	CCDS13737.1	.	.	.	.	.	.	.	.	.	.	.	7.659	0.684456	0.14973	.	.	ENSG00000160310	ENST00000455177	.	.	.	4.97	2.13	0.27403	.	.	.	.	.	T	0.57621	0.2066	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49661	-0.8916	4	.	.	.	-17.0477	8.9958	0.36052	0.0:0.7478:0.0:0.2522	.	.	.	.	I	132	.	.	T	+	2	0	PRMT2	46894001	0.995000	0.38212	0.999000	0.59377	0.754000	0.42855	0.201000	0.17276	0.234000	0.21139	0.655000	0.94253	ACC		0.642	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	
MAPK12	6300	broad.mit.edu	37	22	50695077	50695078	+	Splice_Site	INS	-	-	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:50695077_50695078insG	ENST00000215659.8	-	6	772		c.e6-2		MAPK12_ENST00000395780.1_Splice_Site|MAPK12_ENST00000497036.1_Splice_Site	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12						cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.?(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTTCAGGTCCTGGGGGCAGAGG	0.678																																					.												.	.	2	Unknown(2)	large_intestine(2)	.	22						.																																			49037205	SO:0001630	splice_region_variant	6300	.			U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.457-2->C	22.37:g.50695082_50695082dupG			49037204	.	Q14260|Q6IC53|Q99588|Q99672	Splice_Site	INS	ENST00000215659.8	37	CCDS14089.1																																																																																				0.678	MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969	Intron
MICAL3	57553	broad.mit.edu	37	22	18368740	18368740	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:18368740G>A	ENST00000441493.2	-	16	2497	c.2145C>T	c.(2143-2145)gcC>gcT	p.A715A	MICAL3_ENST00000429452.1_Silent_p.A715A|MICAL3_ENST00000400561.2_Silent_p.A715A|MICAL3_ENST00000383094.3_Silent_p.A715A|MICAL3_ENST00000414725.2_Silent_p.A715A|MICAL3_ENST00000207726.7_Silent_p.A715A|MICAL3_ENST00000585038.1_Silent_p.A715A|MICAL3_ENST00000444520.1_Silent_p.A715A	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	715					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.A715A(3)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGTTCCCAACGGCAACGTCCA	0.562																																					p.A715A												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C2145T	22						.						181.0	166.0	171.0					22																	18368740		1568	3582	5150	16748740	SO:0001819	synonymous_variant	57553	exon16			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2145C>T	22.37:g.18368740G>A			16748740	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																				0.562	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
SGSM1	129049	broad.mit.edu	37	22	25251358	25251358	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:25251358C>T	ENST00000400359.4	+	7	637	c.630C>T	c.(628-630)caC>caT	p.H210H	SGSM1_ENST00000400358.4_Silent_p.H210H	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	210						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)	p.H210H(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						ACAGCTCCCACGTGCGGCAGG	0.612																																					p.H210H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C630T	22						.						27.0	30.0	29.0					22																	25251358		2092	4213	6305	23581358	SO:0001819	synonymous_variant	129049	exon7			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.630C>T	22.37:g.25251358C>T			23581358	NM_001098497	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Silent	SNP	ENST00000400359.4	37	CCDS46674.1																																																																																				0.612	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	
KREMEN1	83999	broad.mit.edu	37	22	29533554	29533554	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:29533554G>A	ENST00000407188.1	+	6	850	c.850G>A	c.(850-852)Ggg>Agg	p.G284R	KREMEN1_ENST00000327813.5_Missense_Mutation_p.G286R|KREMEN1_ENST00000400338.2_Missense_Mutation_p.G286R|KREMEN1_ENST00000400335.4_Missense_Mutation_p.G286R			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	284	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G286R(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						CCGCTTCCACGGGAGGAGCCG	0.552																																					p.G286R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G856A	22						.						64.0	65.0	65.0					22																	29533554		1945	4137	6082	27863554	SO:0001583	missense	83999	exon6			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.850G>A	22.37:g.29533554G>A	ENSP00000385431:p.Gly284Arg		27863554	NM_001039570	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	ENST00000407188.1	37	CCDS43000.2	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859425	0.71834	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	4.99	3.97	0.46021	CUB (5);	0.090253	0.46758	N	0.000277	T	0.80065	0.4555	M	0.86343	2.81	0.58432	D	0.999993	D;D;B	0.89917	1.0;1.0;0.163	D;D;B	0.97110	1.0;0.984;0.042	T	0.82973	-0.0191	10	0.87932	D	0	.	11.5927	0.50955	0.0882:0.0:0.9118:0.0	.	284;286;286	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	R	286;286;286;284	ENSP00000383189:G286R;ENSP00000383192:G286R;ENSP00000331242:G286R;ENSP00000385431:G284R	ENSP00000331242:G286R	G	+	1	0	KREMEN1	27863554	1.000000	0.71417	0.097000	0.21041	0.963000	0.63663	5.104000	0.64584	1.260000	0.44134	0.467000	0.42956	GGG		0.552	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
SEC14L3	266629	broad.mit.edu	37	22	30866052	30866052	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:30866052C>T	ENST00000215812.4	-	4	278	c.188G>A	c.(187-189)cGg>cAg	p.R63Q	SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000539629.1_Missense_Mutation_p.R4Q|SEC14L3_ENST00000403066.1_Missense_Mutation_p.R4Q|SEC14L3_ENST00000540910.1_5'UTR|SEC14L3_ENST00000401751.1_Missense_Mutation_p.R4Q|SEC14L3_ENST00000415957.2_Missense_Mutation_p.R4Q	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	63						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.R63Q(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	CATGGTCTTCCGGAACTCCAT	0.542																																					p.R63Q	Esophageal Squamous(108;290 1516 3584 23771 37333)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G188A	22						.						146.0	137.0	140.0					22																	30866052		2203	4300	6503	29196052	SO:0001583	missense	266629	exon4			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.188G>A	22.37:g.30866052C>T	ENSP00000215812:p.Arg63Gln		29196052	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.103656|5.103656	0.94245|0.94245	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000435069|ENST00000403066;ENST00000415957;ENST00000215812;ENST00000401751;ENST00000539629	.|D;D;T;D;D	.|0.86956	.|-2.19;-2.19;0.13;-1.91;-1.91	5.29|5.29	5.29|5.29	0.74685|0.74685	.|Cellular retinaldehyde-binding/triple function, C-terminal (1);Phosphatidylinositol transfer protein-like, N-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95655|0.95655	0.8587|0.8587	H|H	0.96996|0.96996	3.92|3.92	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.96838|0.96838	0.9616|0.9616	5|10	.|0.87932	.|D	.|0	-26.7142|-26.7142	14.4273|14.4273	0.67225|0.67225	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|63	.|Q9UDX4	.|S14L3_HUMAN	R|Q	29|4;4;63;4;4	.|ENSP00000385941:R4Q;ENSP00000401864:R4Q;ENSP00000215812:R63Q;ENSP00000383896:R4Q;ENSP00000444691:R4Q	.|ENSP00000215812:R63Q	G|R	-|-	1|2	0|0	SEC14L3|SEC14L3	29196052|29196052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.732000|5.732000	0.68563|0.68563	2.466000|2.466000	0.83321|0.83321	0.643000|0.643000	0.83706|0.83706	GGA|CGG		0.542	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
SH3BP1	23616	broad.mit.edu	37	22	38039751	38039751	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:38039751A>G	ENST00000357436.4	+	7	887	c.574A>G	c.(574-576)Aag>Gag	p.K192E	SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000442465.2_Missense_Mutation_p.K192E|SH3BP1_ENST00000599616.1_Missense_Mutation_p.K128E|SH3BP1_ENST00000336738.5_Missense_Mutation_p.K192E|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	192	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)	p.K192E(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GGAGACGCTGAAGGAGGAGGA	0.612											OREG0026546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K192E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A574G	22						.						123.0	107.0	112.0					22																	38039751		2203	4300	6503	36369697	SO:0001583	missense	23616	exon7				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.574A>G	22.37:g.38039751A>G	ENSP00000350018:p.Lys192Glu	875	36369697	NM_018957	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	A	32	5.105639	0.94292	.	.	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465;ENST00000397014	T;T;T	0.23147	1.92;1.92;1.92	5.08	5.08	0.68730	BAR (2);	0.000000	0.64402	D	0.000003	T	0.44829	0.1312	M	0.67397	2.05	0.47862	D	0.999535	D;D;P;P;D	0.57571	0.98;0.96;0.698;0.916;0.96	P;P;B;P;P	0.59357	0.856;0.527;0.371;0.538;0.527	T	0.38023	-0.9680	10	0.48119	T	0.1	.	14.3245	0.66509	1.0:0.0:0.0:0.0	.	192;106;128;192;106	F5GZA8;E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;.;3BP1_HUMAN;.	E	192;192;192;106	ENSP00000350018:K192E;ENSP00000337213:K192E;ENSP00000395126:K192E	ENSP00000337213:K192E	K	+	1	0	SH3BP1	36369697	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.300000	0.78841	2.054000	0.61138	0.459000	0.35465	AAG		0.612	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
PACSIN2	11252	broad.mit.edu	37	22	43280556	43280556	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:43280556C>G	ENST00000263246.3	-	6	822	c.621G>C	c.(619-621)aaG>aaC	p.K207N	PACSIN2_ENST00000407585.1_Missense_Mutation_p.K207N|PACSIN2_ENST00000402229.1_Missense_Mutation_p.K207N|PACSIN2_ENST00000403744.3_Missense_Mutation_p.K207N|PACSIN2_ENST00000337959.4_Missense_Mutation_p.K207N	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	207	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)	p.K207N(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				ACTTCTCATACTTCTCTTTGG	0.532																																					p.K207N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G621C	22						.						92.0	98.0	96.0					22																	43280556		2203	4300	6503	41610500	SO:0001583	missense	11252	exon6			AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.621G>C	22.37:g.43280556C>G	ENSP00000263246:p.Lys207Asn		41610500	NM_001184971	O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	ENST00000263246.3	37	CCDS43023.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845446	0.51164	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229	T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54	5.63	3.55	0.40652	.	0.364213	0.32314	N	0.006265	T	0.28333	0.0700	M	0.82056	2.57	0.58432	D	0.999995	P;D	0.56521	0.853;0.976	P;P	0.53360	0.64;0.724	T	0.05386	-1.0888	10	0.33940	T	0.23	-10.1182	12.1148	0.53860	0.0:0.8613:0.0:0.1387	.	207;207	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	N	207	ENSP00000263246:K207N;ENSP00000338379:K207N;ENSP00000385952:K207N;ENSP00000385372:K207N;ENSP00000385040:K207N	ENSP00000263246:K207N	K	-	3	2	PACSIN2	41610500	1.000000	0.71417	0.959000	0.39883	0.968000	0.65278	0.721000	0.25911	0.854000	0.35336	0.655000	0.94253	AAG		0.532	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319665.1	NM_007229	
TBC1D22A	25771	broad.mit.edu	37	22	47507445	47507445	+	Silent	SNP	C	C	T	rs372661631		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:47507445C>T	ENST00000337137.4	+	12	1537	c.1371C>T	c.(1369-1371)tgC>tgT	p.C457C	TBC1D22A_ENST00000406733.1_Silent_p.C410C|TBC1D22A_ENST00000355704.3_Silent_p.C379C|TBC1D22A_ENST00000407381.3_Silent_p.C398C	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	457							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)	p.C457C(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		TGTACGTGTGCGCTGCTTTTC	0.373																																					p.C457C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1371T	22						.	C		0,4406		0,0,2203	121.0	118.0	119.0		1371	-2.9	0.5	22		119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TBC1D22A	NM_014346.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		457/518	47507445	1,13005	2203	4300	6503	45886109	SO:0001819	synonymous_variant	25771	exon12			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1371C>T	22.37:g.47507445C>T			45886109	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Silent	SNP	ENST00000337137.4	37	CCDS14078.1																																																																																				0.373	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
TUBGCP6	85378	broad.mit.edu	37	22	50659293	50659293	+	Silent	SNP	G	G	A	rs540310913	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr22:50659293G>A	ENST00000248846.5	-	16	3599	c.3495C>T	c.(3493-3495)tcC>tcT	p.S1165S	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_Silent_p.S1165S			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1165	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.S1165S(2)		breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGCTGGCATCGGACACGTGTC	0.637													N|||	2	0.000399361	0.0008	0.0	5008	,	,		22548	0.0		0.0	False		,,,				2504	0.001				p.S1165S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C3495T	22						.						90.0	83.0	85.0					22																	50659293		2203	4300	6503	49001420	SO:0001819	synonymous_variant	85378	exon16			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3495C>T	22.37:g.50659293G>A			49001420	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	ENST00000248846.5	37	CCDS14087.1																																																																																				0.637	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
CHST10	9486	broad.mit.edu	37	2	101023061	101023061	+	Missense_Mutation	SNP	G	G	A	rs148953500		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:101023061G>A	ENST00000264249.3	-	3	462	c.77C>T	c.(76-78)aCg>aTg	p.T26M	CHST10_ENST00000542617.1_Missense_Mutation_p.T74M|CHST10_ENST00000485085.1_5'Flank|CHST10_ENST00000409701.1_Missense_Mutation_p.T26M	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	26					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)	p.T26M(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						AAAGGTCAACGTGATGAACTT	0.473																																					p.T26M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C77T	2						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	333.0	310.0	318.0		77	4.3	0.9	2	dbSNP_134	318	0,8600		0,0,4300	no	missense	CHST10	NM_004854.4	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	26/357	101023061	1,13005	2203	4300	6503	100389493	SO:0001583	missense	9486	exon3			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.77C>T	2.37:g.101023061G>A	ENSP00000264249:p.Thr26Met		100389493	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	37	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861828	0.71949	2.27E-4	0.0	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474;ENST00000418201;ENST00000435960	T;T;T;T;T;T;T;T;T	0.72615	-0.59;-0.67;-0.59;0.75;0.71;0.47;0.6;0.53;0.45	5.18	4.29	0.51040	.	0.159635	0.53938	D	0.000045	T	0.65238	0.2672	N	0.24115	0.695	0.44871	D	0.997887	D	0.76494	0.999	P	0.50490	0.642	T	0.65384	-0.6181	10	0.34782	T	0.22	-19.269	15.4132	0.74943	0.0:0.0:0.8597:0.1403	.	26	O43529	CHSTA_HUMAN	M	26;74;26;26;26;74;26;26;26	ENSP00000264249:T26M;ENSP00000438869:T74M;ENSP00000387309:T26M;ENSP00000387121:T26M;ENSP00000405922:T26M;ENSP00000387977:T74M;ENSP00000407525:T26M;ENSP00000416831:T26M;ENSP00000395643:T26M	ENSP00000264249:T26M	T	-	2	0	CHST10	100389493	1.000000	0.71417	0.858000	0.33744	0.973000	0.67179	5.009000	0.63998	1.303000	0.44873	0.655000	0.94253	ACG		0.473	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
BUB1	699	broad.mit.edu	37	2	111413336	111413336	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:111413336A>G	ENST00000302759.6	-	16	1974	c.1856T>C	c.(1855-1857)gTg>gCg	p.V619A	BUB1_ENST00000409311.1_Missense_Mutation_p.V619A|BUB1_ENST00000535254.1_Missense_Mutation_p.V599A	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	619					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V619A(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TAAAATGTGCACTGACTCCAC	0.433																																					p.V619A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1856C	2						.						172.0	157.0	162.0					2																	111413336		2203	4300	6503	111129809	SO:0001583	missense	699	exon16			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.1856T>C	2.37:g.111413336A>G	ENSP00000302530:p.Val619Ala		111129809	NM_004336	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	37	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	A	3.619	-0.077971	0.07184	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	T;T;T	0.29655	2.3;1.56;2.57	5.73	-8.38	0.00973	.	1.014540	0.07832	N	0.961497	T	0.16041	0.0386	L	0.51422	1.61	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.08055	0.003;0.002;0.001	T	0.39099	-0.9630	10	0.08381	T	0.77	0.0714	1.692	0.02854	0.1867:0.3197:0.3041:0.1894	.	599;619;619	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	A	599;619;619;619	ENSP00000441013:V599A;ENSP00000386701:V619A;ENSP00000302530:V619A	ENSP00000302530:V619A	V	-	2	0	BUB1	111129809	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.777000	0.04669	-1.249000	0.02500	0.533000	0.62120	GTG		0.433	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	NM_004336	
GLI2	2736	broad.mit.edu	37	2	121742146	121742146	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:121742146G>A	ENST00000452319.1	+	12	1843	c.1783G>A	c.(1783-1785)Gtc>Atc	p.V595I	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.V595I|GLI2_ENST00000314490.11_Missense_Mutation_p.V267I					GLI family zinc finger 2									p.V595I(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				AGATGCCCACGTCACCAAGAA	0.607																																					p.V595I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1783A	2						.						132.0	120.0	124.0					2																	121742146		2203	4300	6503	121458616	SO:0001583	missense	2736	exon11				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1783G>A	2.37:g.121742146G>A	ENSP00000390436:p.Val595Ile		121458616	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113865	0.56398	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.16897	2.31;2.31;2.41	4.9	4.9	0.64082	.	0.059169	0.64402	D	0.000002	T	0.41026	0.1141	M	0.66297	2.02	0.45528	D	0.998489	D;P;D;P;D	0.76494	0.999;0.809;0.972;0.724;0.996	D;B;P;B;P	0.72982	0.979;0.031;0.721;0.232;0.908	T	0.10683	-1.0619	10	0.40728	T	0.16	.	18.2591	0.90028	0.0:0.0:1.0:0.0	.	595;578;250;250;267	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	I	595;595;267	ENSP00000390436:V595I;ENSP00000354586:V595I;ENSP00000312694:V267I	ENSP00000312694:V267I	V	+	1	0	GLI2	121458616	1.000000	0.71417	0.955000	0.39395	0.746000	0.42486	7.713000	0.84693	2.539000	0.85634	0.561000	0.74099	GTC		0.607	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
ZEB2	9839	broad.mit.edu	37	2	145274871	145274871	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:145274871T>C	ENST00000558170.2	-	2	1231	c.47A>G	c.(46-48)aAa>aGa	p.K16R	ZEB2-AS1_ENST00000609819.1_RNA|ZEB2_ENST00000493689.1_5'UTR|ZEB2-AS1_ENST00000608361.1_RNA|ZEB2-AS1_ENST00000609842.1_RNA|ZEB2-AS1_ENST00000427278.3_RNA|ZEB2_ENST00000303660.4_Missense_Mutation_p.K16R|ZEB2-AS1_ENST00000595109.1_RNA|ZEB2_ENST00000470879.1_Missense_Mutation_p.K16R|ZEB2_ENST00000539609.3_Missense_Mutation_p.K16R|ZEB2-AS1_ENST00000602006.1_RNA|ZEB2_ENST00000462355.1_Missense_Mutation_p.K16R|ZEB2-AS1_ENST00000609376.1_RNA|ZEB2_ENST00000409487.3_Missense_Mutation_p.K16R|ZEB2-AS1_ENST00000421083.1_RNA|ZEB2-AS1_ENST00000610265.1_RNA|ZEB2-AS1_ENST00000428623.1_RNA|ZEB2_ENST00000465070.1_Missense_Mutation_p.K16R	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	16					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.K16R(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		ATTGGCTTGTTTGCGCCTCTT	0.597																																					p.K16R	Melanoma(33;1235 1264 5755 16332)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A47G	2						.						153.0	158.0	156.0					2																	145274871		2203	4300	6503	144991341	SO:0001583	missense	9839	exon2			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.47A>G	2.37:g.145274871T>C	ENSP00000454157:p.Lys16Arg		144991341	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.30|16.30	3.083936|3.083936	0.55861|0.55861	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861;ENST00000409211;ENST00000435831;ENST00000444559|ENST00000431672	D;D;D;D;D;D;D;D|.	0.88975|.	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45|.	3.3|3.3	2.08|2.08	0.27032|0.27032	.|.	0.444204|.	0.19301|.	U|.	0.117633|.	T|T	0.43322|0.43322	0.1242|0.1242	L|L	0.43923|0.43923	1.385|1.385	0.30223|0.30223	N|N	0.796617|0.796617	D;B;P;P;B;B|.	0.53619|.	0.961;0.023;0.939;0.455;0.008;0.008|.	P;B;P;B;B;B|.	0.54590|.	0.756;0.01;0.482;0.127;0.01;0.01|.	T|T	0.41342|0.41342	-0.9514|-0.9514	10|5	0.87932|.	D|.	0|.	-1.1323|-1.1323	8.8118|8.8118	0.34971|0.34971	0.1693:0.0:0.0:0.8307|0.1693:0.0:0.0:0.8307	.|.	16;16;16;16;16;16|.	F5H814;B7Z2P2;C9JU62;E7ESP8;A0JP08;O60315|.	.;.;.;.;.;ZEB2_HUMAN|.	R|D	11;16;16;16;16;16;16;16;16|6	ENSP00000443792:K16R;ENSP00000302501:K16R;ENSP00000386854:K16R;ENSP00000395496:K16R;ENSP00000376601:K16R;ENSP00000387256:K16R;ENSP00000400993:K16R;ENSP00000399451:K16R|.	ENSP00000302501:K16R|.	K|N	-|-	2|1	0|0	ZEB2|ZEB2	144991341|144991341	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.250000|5.250000	0.65432|0.65432	0.400000|0.400000	0.25396|0.25396	0.363000|0.363000	0.22086|0.22086	AAA|AAC		0.597	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
RIF1	55183	broad.mit.edu	37	2	152320361	152320361	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:152320361C>T	ENST00000243326.5	+	29	4810	c.4327C>T	c.(4327-4329)Cga>Tga	p.R1443*	RIF1_ENST00000444746.2_Nonsense_Mutation_p.R1443*|RIF1_ENST00000428287.2_Nonsense_Mutation_p.R1443*|RIF1_ENST00000430328.2_Nonsense_Mutation_p.R1443*|RIF1_ENST00000453091.2_Nonsense_Mutation_p.R1443*			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.R1443*(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AAAAAAGGAACGACGTAAGGA	0.378																																					p.R1443X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4327T	2						.						38.0	41.0	40.0					2																	152320361		2202	4298	6500	152028607	SO:0001587	stop_gained	55183	exon30			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4327C>T	2.37:g.152320361C>T	ENSP00000243326:p.Arg1443*		152028607	NM_001177664	A0AVS0|Q9NS16	Nonsense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	44	10.903881	0.99486	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	.	.	.	5.55	4.4	0.53042	.	0.317317	0.34676	N	0.003768	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3889	6.856	0.24040	0.618:0.3059:0.0761:0.0	.	.	.	.	X	1443	.	ENSP00000243326:R1443X	R	+	1	2	RIF1	152028607	0.993000	0.37304	1.000000	0.80357	0.968000	0.65278	2.381000	0.44336	0.936000	0.37367	-0.474000	0.04947	CGA		0.378	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
FIGN	55137	broad.mit.edu	37	2	164466612	164466612	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:164466612C>T	ENST00000333129.3	-	3	2044	c.1730G>A	c.(1729-1731)cGc>cAc	p.R577H	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	577					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.R577H(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CGAGGGCTGGCGACACCTGGC	0.473																																					p.R577H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1730A	2						.						54.0	55.0	55.0					2																	164466612		1972	4132	6104	164174858	SO:0001583	missense	55137	exon3			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1730G>A	2.37:g.164466612C>T	ENSP00000333836:p.Arg577His		164174858	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	8.168	0.791046	0.16258	.	.	ENSG00000182263	ENST00000333129	D	0.92911	-3.13	5.6	5.6	0.85130	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.89252	0.6662	L	0.28115	0.83	0.80722	D	1	B	0.27068	0.167	B	0.36922	0.236	D	0.84350	0.0532	10	0.18276	T	0.48	-22.2021	19.9756	0.97304	0.0:1.0:0.0:0.0	.	577	Q5HY92	FIGN_HUMAN	H	577	ENSP00000333836:R577H	ENSP00000333836:R577H	R	-	2	0	FIGN	164174858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.050000	0.71063	2.793000	0.96121	0.563000	0.77884	CGC		0.473	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
LRP2	4036	broad.mit.edu	37	2	170115593	170115593	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:170115593G>A	ENST00000263816.3	-	17	2740	c.2455C>T	c.(2455-2457)Cgc>Tgc	p.R819C	LRP2_ENST00000443831.1_Missense_Mutation_p.R682C	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	819					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R819C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACTACTGTGCGTCTCGTTTTA	0.398																																					p.R819C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2455T	2						.						155.0	151.0	153.0					2																	170115593		2203	4300	6503	169823839	SO:0001583	missense	4036	exon17				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2455C>T	2.37:g.170115593G>A	ENSP00000263816:p.Arg819Cys		169823839	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392758	0.42410	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.96856	-3.29;-4.15	5.77	3.88	0.44766	Six-bladed beta-propeller, TolB-like (1);	0.049037	0.85682	N	0.000000	D	0.97657	0.9232	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.97637	1.0146	10	0.72032	D	0.01	.	9.1112	0.36730	0.0763:0.0:0.6796:0.2441	.	682;819	E9PC35;P98164	.;LRP2_HUMAN	C	819;682	ENSP00000263816:R819C;ENSP00000409813:R682C	ENSP00000263816:R819C	R	-	1	0	LRP2	169823839	1.000000	0.71417	0.772000	0.31596	0.038000	0.13279	1.618000	0.36954	1.447000	0.47661	0.591000	0.81541	CGC		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
KLHL23	151230	broad.mit.edu	37	2	170606039	170606039	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:170606039G>T	ENST00000392647.2	+	4	1718	c.1474G>T	c.(1474-1476)Gct>Tct	p.A492S	KLHL23_ENST00000272797.4_Missense_Mutation_p.A492S|KLHL23_ENST00000602521.1_5'UTR	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	492								p.A492S(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						GAGAGAGATAGCTCCCATGAT	0.438																																					p.A492S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1474T	2						.						142.0	127.0	132.0					2																	170606039		2203	4300	6503	170314285	SO:0001583	missense	151230	exon6			BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.1474G>T	2.37:g.170606039G>T	ENSP00000376419:p.Ala492Ser		170314285	NM_001199290	Q8N9B9|Q96FT8	Missense_Mutation	SNP	ENST00000392647.2	37	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235195	0.39498	.	.	ENSG00000213160	ENST00000272797;ENST00000392647	T;T	0.78816	-1.21;-1.21	5.35	5.35	0.76521	Kelch-type beta propeller (1);	0.058549	0.64402	D	0.000002	T	0.70448	0.3225	L	0.37897	1.145	0.30034	N	0.81318	B	0.26672	0.156	B	0.29267	0.1	T	0.75175	-0.3410	9	0.46703	T	0.11	.	13.9774	0.64282	0.0:0.0:0.8484:0.1516	.	492	Q8NBE8	KLH23_HUMAN	S	492	ENSP00000272797:A492S;ENSP00000376419:A492S	ENSP00000272797:A492S	A	+	1	0	KLHL23	170314285	1.000000	0.71417	0.887000	0.34795	0.999000	0.98932	3.851000	0.55926	2.516000	0.84829	0.655000	0.94253	GCT		0.438	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711	
PDE11A	50940	broad.mit.edu	37	2	178936450	178936450	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:178936450A>G	ENST00000286063.6	-	1	1032	c.715T>C	c.(715-717)Tct>Cct	p.S239P	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	239	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.S239P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	AGGAAAAGAGAGCAGCGGTCA	0.507									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.S239P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T715C	2						.						72.0	65.0	67.0					2																	178936450		2203	4300	6503	178644696	SO:0001583	missense	50940	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.715T>C	2.37:g.178936450A>G	ENSP00000286063:p.Ser239Pro		178644696	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427222	0.83667	.	.	ENSG00000128655	ENST00000286063	T	0.69806	-0.43	5.52	5.52	0.82312	GAF (2);	0.160773	0.64402	D	0.000014	D	0.87993	0.6318	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.92110	0.5695	10	0.87932	D	0	.	14.8099	0.69985	1.0:0.0:0.0:0.0	.	239	Q9HCR9	PDE11_HUMAN	P	239	ENSP00000286063:S239P	ENSP00000286063:S239P	S	-	1	0	PDE11A	178644696	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.905000	0.92613	2.093000	0.63338	0.533000	0.62120	TCT		0.507	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
TTN	7273	broad.mit.edu	37	2	179440281	179440281	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:179440281G>A	ENST00000591111.1	-	276	65879	c.65655C>T	c.(65653-65655)ccC>ccT	p.P21885P	TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Silent_p.P14586P|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.P14653P|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342992.6_Silent_p.P20958P|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.P23526P|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Silent_p.P14461P|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21885	Fibronectin type-III 58. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P14461P(1)|p.P14653P(1)|p.P20956P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGCTTTTACGGGCTCTGTAG	0.468																																					p.P14461L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C43382T	2						.						237.0	234.0	235.0					2																	179440281		1980	4167	6147	179148527	SO:0001819	synonymous_variant	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65655C>T	2.37:g.179440281G>A			179148527	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179464576	179464576	+	Splice_Site	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:179464576G>A	ENST00000591111.1	-	239	51353	c.51129C>T	c.(51127-51129)tgC>tgT	p.C17043C	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Splice_Site_p.C9744C|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Splice_Site_p.C9811C|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Splice_Site_p.C16116C|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Splice_Site_p.C18684C|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Splice_Site_p.C9619C|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17043					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.C9811C(1)|p.I16114I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGATGGTGGGCCTAGATTAT	0.368																																					p.C9619C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C28857T	2						.						49.0	46.0	47.0					2																	179464576		1835	4075	5910	179172821	SO:0001630	splice_region_variant	7273	exon117			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51128-1C>T	2.37:g.179464576G>A			179172821	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	37																																																																																					0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Silent
NCKAP1	10787	broad.mit.edu	37	2	183817892	183817892	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:183817892T>C	ENST00000361354.4	-	21	2693	c.2321A>G	c.(2320-2322)cAa>cGa	p.Q774R	NCKAP1_ENST00000360982.2_Missense_Mutation_p.Q780R	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	774					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)	p.Q780R(1)		breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GTCTAAATGTTGTGTTTGTTG	0.338																																					p.Q774R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2321G	2						.						113.0	108.0	110.0					2																	183817892		2203	4299	6502	183526137	SO:0001583	missense	10787	exon21			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2321A>G	2.37:g.183817892T>C	ENSP00000355348:p.Gln774Arg		183526137	NM_013436	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866338	0.91511	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.34072	1.38;1.38	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	M	0.80508	2.5	0.80722	D	1	P;P	0.48294	0.908;0.887	P;B	0.46917	0.531;0.395	T	0.50329	-0.8841	10	0.31617	T	0.26	-12.3257	16.8222	0.85835	0.0:0.0:0.0:1.0	.	774;780	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	R	774;780	ENSP00000355348:Q774R;ENSP00000354251:Q780R	ENSP00000354251:Q780R	Q	-	2	0	NCKAP1	183526137	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	CAA		0.338	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
DNAH7	56171	broad.mit.edu	37	2	196791250	196791250	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:196791250C>T	ENST00000312428.6	-	22	3612	c.3512G>A	c.(3511-3513)cGa>cAa	p.R1171Q		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1171	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.R1171Q(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CCAGTTAATTCGTTCATATTT	0.353																																					p.R1171Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3512A	2						.						125.0	114.0	117.0					2																	196791250		1822	4075	5897	196499495	SO:0001583	missense	56171	exon22			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3512G>A	2.37:g.196791250C>T	ENSP00000311273:p.Arg1171Gln		196499495	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	36	5.675931	0.96764	.	.	ENSG00000118997	ENST00000312428	T	0.74209	-0.82	5.08	5.08	0.68730	.	0.067584	0.56097	N	0.000025	D	0.92551	0.7634	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95707	0.8754	10	0.87932	D	0	.	18.4234	0.90600	0.0:1.0:0.0:0.0	.	1171	Q8WXX0	DYH7_HUMAN	Q	1171	ENSP00000311273:R1171Q	ENSP00000311273:R1171Q	R	-	2	0	DNAH7	196499495	0.995000	0.38212	0.186000	0.23195	0.434000	0.31775	5.064000	0.64338	2.522000	0.85027	0.585000	0.79938	CGA		0.353	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
APOB	338	broad.mit.edu	37	2	21235490	21235490	+	Missense_Mutation	SNP	G	G	A	rs200321839		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:21235490G>A	ENST00000233242.1	-	26	4377	c.4250C>T	c.(4249-4251)aCg>aTg	p.T1417M		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1417					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T1417M(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGTGTGAACGTATTCTTGTG	0.343													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21558	0.0		0.0	False		,,,				2504	0.0				p.T1417M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4250T	2						.						71.0	75.0	74.0					2																	21235490		2198	4300	6498	21088995	SO:0001583	missense	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4250C>T	2.37:g.21235490G>A	ENSP00000233242:p.Thr1417Met		21088995	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.38	1.622809	0.28889	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00776	5.71	5.88	4.05	0.47172	.	0.730351	0.13154	N	0.409589	T	0.00936	0.0031	M	0.72118	2.19	0.09310	N	0.999996	P	0.44659	0.84	B	0.21708	0.036	T	0.52997	-0.8500	10	0.66056	D	0.02	.	6.7119	0.23282	0.2265:0.1374:0.636:0.0	.	1417	P04114	APOB_HUMAN	M	1417	ENSP00000233242:T1417M	ENSP00000233242:T1417M	T	-	2	0	APOB	21088995	0.000000	0.05858	0.041000	0.18516	0.209000	0.24338	0.480000	0.22244	0.784000	0.33661	0.655000	0.94253	ACG		0.343	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
PIKFYVE	200576	broad.mit.edu	37	2	209179085	209179085	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:209179085T>C	ENST00000264380.4	+	14	1922	c.1764T>C	c.(1762-1764)caT>caC	p.H588H		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	588					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.H588H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TGGGCTGGCATCATAACAACC	0.378																																					p.H588H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1764C	2						.						66.0	72.0	70.0					2																	209179085		2203	4300	6503	208887330	SO:0001819	synonymous_variant	200576	exon14			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1764T>C	2.37:g.209179085T>C			208887330	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																				0.378	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
FN1	2335	broad.mit.edu	37	2	216251680	216251680	+	Splice_Site	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:216251680A>G	ENST00000359671.1	-	27	4336	c.4071T>C	c.(4069-4071)ggT>ggC	p.G1357G	FN1_ENST00000443816.1_Splice_Site_p.G1357G|FN1_ENST00000323926.6_Splice_Site_p.G1448G|FN1_ENST00000354785.4_Splice_Site_p.G1448G|FN1_ENST00000336916.4_Splice_Site_p.G1357G|FN1_ENST00000432072.2_Splice_Site_p.G1448G|FN1_ENST00000346544.3_Splice_Site_p.G1357G|FN1_ENST00000357009.2_Splice_Site_p.G1357G|FN1_ENST00000356005.4_Splice_Site_p.G1357G|FN1_ENST00000421182.1_Splice_Site_p.G1357G|FN1_ENST00000345488.5_Splice_Site_p.G1357G|FN1_ENST00000357867.4_Splice_Site_p.G1357G|FN1_ENST00000446046.1_Splice_Site_p.G1357G			P02751	FINC_HUMAN	fibronectin 1	1357	Cell-attachment.|Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.G1357G(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGGAATCAAGACCTGTTTTTC	0.463																																					p.G1357G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4071C	2						.						44.0	40.0	42.0					2																	216251680		2203	4300	6503	215959925	SO:0001630	splice_region_variant	2335	exon27				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4070-1T>C	2.37:g.216251680A>G			215959925	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																					0.463	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	Silent
RNF25	64320	broad.mit.edu	37	2	219538658	219538658	+	5'Flank	SNP	C	C	T	rs185827846	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:219538658C>T	ENST00000295704.2	-	0	0				STK36_ENST00000392105.3_Silent_p.D94D|STK36_ENST00000392106.2_Silent_p.D94D|STK36_ENST00000440309.1_Silent_p.D94D|STK36_ENST00000295709.3_Silent_p.D94D	NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25						positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D94D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAGAAGATGACGGAAAACTTC	0.512													C|||	3	0.000599042	0.0	0.0014	5008	,	,		19665	0.002		0.0	False		,,,				2504	0.0				p.D94D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C282T	2						.						123.0	113.0	116.0					2																	219538658		2203	4300	6503	219246902	SO:0001631	upstream_gene_variant	27148	exon4				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077		2.37:g.219538658C>T	Exception_encountered		219246902	NM_015690	A8K0D6|Q53HQ5|Q9H874	Silent	SNP	ENST00000295704.2	37	CCDS2420.1																																																																																				0.512	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
SCG2	7857	broad.mit.edu	37	2	224463791	224463791	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:224463791A>G	ENST00000305409.2	-	2	442	c.210T>C	c.(208-210)caT>caC	p.H70H		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.H70H(1)		NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTTCTTCCTTATGAGCTTGTT	0.458																																					p.H70H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T210C	2						.						126.0	131.0	130.0					2																	224463791		2201	4300	6501	224172035	SO:0001819	synonymous_variant	7857	exon2			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.210T>C	2.37:g.224463791A>G			224172035	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000305409.2	37	CCDS2457.1																																																																																				0.458	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
UGT1A6	54578	broad.mit.edu	37	2	234676937	234676937	+	Missense_Mutation	SNP	G	G	A	rs143573365		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:234676937G>A	ENST00000305139.6	+	4	1292	c.1153G>A	c.(1153-1155)Gtt>Att	p.V385I	UGT1A1_ENST00000608381.1_Missense_Mutation_p.V387I|UGT1A1_ENST00000608383.1_Missense_Mutation_p.V386I|UGT1A7_ENST00000373426.3_Missense_Mutation_p.V383I|UGT1A5_ENST00000373414.3_Missense_Mutation_p.V387I|UGT1A3_ENST00000482026.1_Missense_Mutation_p.V387I|UGT1A1_ENST00000609637.1_Missense_Mutation_p.V383I|UGT1A1_ENST00000373450.4_Missense_Mutation_p.V383I|UGT1A10_ENST00000344644.5_Missense_Mutation_p.V383I|UGT1A6_ENST00000373424.1_Missense_Mutation_p.V118I|UGT1A10_ENST00000373445.1_Missense_Mutation_p.V383I|UGT1A1_ENST00000360418.3_Missense_Mutation_p.V386I|UGT1A4_ENST00000373409.3_Missense_Mutation_p.V387I|UGT1A1_ENST00000609767.1_Missense_Mutation_p.V387I|UGT1A6_ENST00000406651.1_Missense_Mutation_p.V118I|UGT1A8_ENST00000305208.5_Missense_Mutation_p.V386I|UGT1A9_ENST00000354728.4_Missense_Mutation_p.V383I	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	385					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V383I(4)|p.V387I(3)|p.V385I(1)|p.V386I(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	ATGCAATGGCGTTCCCATGGT	0.498																																					p.V385I												.	.	9	Substitution - Missense(9)	large_intestine(9)	c.G1153A	2						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	229.0	202.0	211.0		1156,1153,1159,1147,1147,1147,1159,1159,1147,352	5.9	0.1	2	dbSNP_134	211	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A1,UGT1A3	NM_000463.2,NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_019093.2,NM_021027.2,NM_205862.1	29,29,29,29,29,29,29,29,29,29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	386/534,385/533,387/535,383/531,383/531,383/531,387/535,387/535,383/531,118/266	234676937	3,13003	2203	4300	6503	234341676	SO:0001583	missense	54579	exon4			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1153G>A	2.37:g.234676937G>A	ENSP00000303174:p.Val385Ile		234341676	NM_001072	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	CCDS2507.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039644	0.93630	0.0	3.49E-4	ENSG00000242366;ENSG00000242515;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000373445;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000406651;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208;ENST00000360418	T;T;T;T;T;T;T;T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.76622	0.4013	M	0.78285	2.405	0.50632	D	0.999884	B;D;D;D;P;P;P;B;P;D;D;D;D;P;P;P;P;B	0.89917	0.388;1.0;1.0;0.971;0.944;0.596;0.488;0.428;0.938;1.0;1.0;0.971;0.988;0.596;0.488;0.488;0.488;0.428	B;D;D;P;P;B;B;B;P;D;D;P;P;B;B;B;B;B	0.91635	0.11;0.996;0.999;0.523;0.759;0.322;0.092;0.068;0.665;0.996;0.996;0.523;0.787;0.322;0.092;0.092;0.1;0.068	T	0.70055	-0.4977	10	0.16896	T	0.51	.	20.2441	0.98394	0.0:0.0:1.0:0.0	.	386;387;387;387;385;383;383;383;386;387;387;387;385;383;383;383;383;383	A6NJC3;Q5DT01;B8K288;Q5DSZ9;B8K289;Q5DSZ7;Q5DSZ5;Q5DSZ6;P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q7Z6H8;Q9HAW9	.;.;.;.;.;.;.;.;UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;.;UD18_HUMAN	I	383;383;383;383;383;118;385;118;387;387;387;386;386	ENSP00000362549:V383I;ENSP00000343838:V383I;ENSP00000362544:V383I;ENSP00000346768:V383I;ENSP00000362525:V383I;ENSP00000362523:V118I;ENSP00000303174:V385I;ENSP00000386107:V118I;ENSP00000362513:V387I;ENSP00000362508:V387I;ENSP00000418532:V387I;ENSP00000304845:V386I;ENSP00000353593:V386I	ENSP00000343838:V383I	V	+	1	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234341676	1.000000	0.71417	0.110000	0.21437	0.971000	0.66376	7.655000	0.83696	2.774000	0.95407	0.655000	0.94253	GTT		0.498	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
EPT1	85465	broad.mit.edu	37	2	26587778	26587778	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:26587778G>A	ENST00000260585.7	+	3	324	c.205G>A	c.(205-207)Gca>Aca	p.A69T		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	69					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)	p.A69T(1)									TCTGCTAATGGCATACTTTGA	0.323																																					p.A69T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205A	2						.						101.0	89.0	93.0					2																	26587778		1800	4060	5860	26441282	SO:0001583	missense	85465	exon3				CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.205G>A	2.37:g.26587778G>A	ENSP00000260585:p.Ala69Thr		26441282	NM_033505	Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682317	0.29872	.	.	ENSG00000138018	ENST00000442141;ENST00000260585;ENST00000447170	T;T	0.44482	0.92;0.92	5.96	3.2	0.36748	.	0.150930	0.64402	N	0.000008	T	0.30166	0.0756	L	0.37850	1.14	0.50813	D	0.999895	B	0.06786	0.001	B	0.09377	0.004	T	0.05699	-1.0869	10	0.23891	T	0.37	-4.6443	9.985	0.41837	0.2076:0.0:0.7924:0.0	.	69	Q9C0D9	EPT1_HUMAN	T	37;69;69	ENSP00000415280:A37T;ENSP00000260585:A69T	ENSP00000260585:A69T	A	+	1	0	EPT1	26441282	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.896000	0.56266	0.420000	0.25954	0.655000	0.94253	GCA		0.323	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000324484.3	NM_033505.2	
HEATR5B	54497	broad.mit.edu	37	2	37302698	37302698	+	Missense_Mutation	SNP	C	C	T	rs372034610		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:37302698C>T	ENST00000233099.5	-	5	622	c.527G>A	c.(526-528)cGt>cAt	p.R176H	HEATR5B_ENST00000354531.2_Missense_Mutation_p.R176H	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	176						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.R176H(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GTAAATATCACGATGGGAGGA	0.438																																					p.R176H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G527A	2						.	C	HIS/ARG	0,4406		0,0,2203	158.0	143.0	148.0		527	5.0	1.0	2		148	1,8599	1.2+/-3.3	0,1,4299	no	missense	HEATR5B	NM_019024.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	176/2072	37302698	1,13005	2203	4300	6503	37156202	SO:0001583	missense	54497	exon5			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.527G>A	2.37:g.37302698C>T	ENSP00000233099:p.Arg176His		37156202	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	32	5.116470	0.94385	0.0	1.16E-4	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.65916	-0.18;-0.18	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.82088	-0.0630	10	0.72032	D	0.01	-13.7153	18.7317	0.91738	0.0:1.0:0.0:0.0	.	176	Q9P2D3	HTR5B_HUMAN	H	176	ENSP00000233099:R176H;ENSP00000346531:R176H	ENSP00000233099:R176H	R	-	2	0	HEATR5B	37156202	1.000000	0.71417	0.979000	0.43373	0.773000	0.43773	7.598000	0.82745	2.500000	0.84329	0.491000	0.48974	CGT		0.438	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
MSH6	2956	broad.mit.edu	37	2	48025815	48025815	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:48025815A>G	ENST00000234420.5	+	4	845	c.693A>G	c.(691-693)gtA>gtG	p.V231V	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Silent_p.V101V|MSH6_ENST00000538136.1_5'UTR	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	231					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.V231V(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AAGAGGAAGTACAGCCTAAGA	0.408			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.V231V		yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.	3	Whole gene deletion(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.A693G	2						.						110.0	109.0	109.0					2																	48025815		2203	4300	6503	47879319	SO:0001819	synonymous_variant	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.693A>G	2.37:g.48025815A>G			47879319	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Silent	SNP	ENST00000234420.5	37	CCDS1836.1																																																																																				0.408	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
PROKR1	10887	broad.mit.edu	37	2	68882132	68882132	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:68882132C>T	ENST00000303786.3	+	3	1026	c.606C>T	c.(604-606)acC>acT	p.T202T	PROKR1_ENST00000394342.2_Silent_p.T202T			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	202					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.T202T(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ACTTCACCACCGAGACGGTCC	0.557																																					p.T202T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C606T	2						.						171.0	146.0	155.0					2																	68882132		2203	4300	6503	68735636	SO:0001819	synonymous_variant	10887	exon2			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.606C>T	2.37:g.68882132C>T			68735636	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	ENST00000303786.3	37	CCDS1889.1																																																																																				0.557	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
GKN1	56287	broad.mit.edu	37	2	69207125	69207125	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:69207125C>T	ENST00000377938.2	+	5	501	c.438C>T	c.(436-438)agC>agT	p.S146S		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	146	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)		p.S146S(1)|p.S146R(1)		breast(2)|large_intestine(4)|lung(5)	11						ATGACCTGAGCAAGTTCGGAA	0.502																																					p.S146S												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C438T	2						.						171.0	125.0	141.0					2																	69207125		2203	4300	6503	69060629	SO:0001819	synonymous_variant	56287	exon5			AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.438C>T	2.37:g.69207125C>T			69060629	NM_019617	Q8IUA9	Silent	SNP	ENST00000377938.2	37	CCDS1891.2																																																																																				0.502	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617	
ANKRD53	79998	broad.mit.edu	37	2	71206872	71206872	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:71206872G>A	ENST00000360589.3	+	3	533	c.499G>A	c.(499-501)Gtg>Atg	p.V167M	ANKRD53_ENST00000441349.1_Missense_Mutation_p.V133M|ANKRD53_ENST00000457410.1_Missense_Mutation_p.V133M|AC007040.11_ENST00000606025.1_Intron|ANKRD53_ENST00000272421.6_Missense_Mutation_p.V167M	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	167								p.V167M(1)		endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						CAAGTTTCCCGTGGACCTGCT	0.592																																					p.V167M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G499A	2						.						136.0	98.0	111.0					2																	71206872		2203	4300	6503	71060380	SO:0001583	missense	79998	exon3			BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.499G>A	2.37:g.71206872G>A	ENSP00000353796:p.Val167Met		71060380	NM_001115116	Q8IYP8	Missense_Mutation	SNP	ENST00000360589.3	37	CCDS46321.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356871	0.61293	.	.	ENSG00000144031	ENST00000272421;ENST00000441349;ENST00000457410;ENST00000360589	T;T;T;T	0.74106	1.34;-0.81;1.34;1.34	5.17	4.24	0.50183	Ankyrin repeat-containing domain (3);	0.101587	0.39909	N	0.001233	D	0.84790	0.5550	M	0.77820	2.39	0.29372	N	0.863957	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.949;0.999	T	0.80491	-0.1359	10	0.87932	D	0	-26.3758	12.3292	0.55028	0.0:0.1707:0.8292:0.0	.	133;167;167	C9JQK2;Q8N9V6;Q8N9V6-2	.;ANR53_HUMAN;.	M	167;133;133;167	ENSP00000272421:V167M;ENSP00000388883:V133M;ENSP00000407004:V133M;ENSP00000353796:V167M	ENSP00000272421:V167M	V	+	1	0	ANKRD53	71060380	0.998000	0.40836	0.564000	0.28396	0.834000	0.47266	2.843000	0.48238	2.583000	0.87209	0.655000	0.94253	GTG		0.592	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330275.2	NM_024933	
RETSAT	54884	broad.mit.edu	37	2	85571799	85571799	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:85571799T>C	ENST00000295802.4	-	7	1286	c.1174A>G	c.(1174-1176)Atc>Gtc	p.I392V	RETSAT_ENST00000475624.2_5'UTR|RETSAT_ENST00000263854.6_Missense_Mutation_p.I392V|RETSAT_ENST00000457495.2_Missense_Mutation_p.I331V	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	392					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.I392V(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	CGCAGGCAGATGAAAACAGAG	0.592																																					p.I392V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1174G	2						.						121.0	97.0	105.0					2																	85571799		2203	4300	6503	85425310	SO:0001583	missense	54884	exon7			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1174A>G	2.37:g.85571799T>C	ENSP00000295802:p.Ile392Val		85425310	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.998627	0.00435	.	.	ENSG00000042445	ENST00000295802;ENST00000263854;ENST00000457495	T;T	0.21543	2.04;2.0	4.62	0.451	0.16629	.	0.296266	0.36740	N	0.002436	T	0.09686	0.0238	N	0.25890	0.77	0.33718	D	0.616678	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.11329	0.006;0.006;0.004	T	0.29912	-0.9996	10	0.08381	T	0.77	-19.2192	4.1299	0.10144	0.0:0.2459:0.1794:0.5747	.	331;331;392	G5E9N3;B4DKE1;Q6NUM9	.;.;RETST_HUMAN	V	392;392;331	ENSP00000295802:I392V;ENSP00000405040:I331V	ENSP00000263854:I392V	I	-	1	0	RETSAT	85425310	0.606000	0.26949	0.976000	0.42696	0.012000	0.07955	-0.146000	0.10250	0.241000	0.21283	-0.429000	0.05907	ATC		0.592	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
SMYD1	150572	broad.mit.edu	37	2	88367492	88367492	+	Missense_Mutation	SNP	C	C	T	rs186217134		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:88367492C>T	ENST00000419482.2	+	1	194	c.109C>T	c.(109-111)Cgg>Tgg	p.R37W	SMYD1_ENST00000444564.2_Missense_Mutation_p.R37W|SMYD1_ENST00000438570.1_Missense_Mutation_p.R37W	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	37	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.R37W(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CTTTGCTGAGCGGGCTTATTC	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		18467	0.001		0.0	False		,,,				2504	0.0				p.R37W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C109T	2						.						185.0	212.0	203.0					2																	88367492		2203	4300	6503	88148607	SO:0001583	missense	150572	exon1			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.109C>T	2.37:g.88367492C>T	ENSP00000393453:p.Arg37Trp		88148607	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	20.6	4.011132	0.75046	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000438570	T;T;T	0.13657	2.57;2.57;2.57	5.85	2.83	0.33086	SET domain (2);	0.054980	0.64402	D	0.000001	T	0.24314	0.0589	L	0.34521	1.04	0.32745	N	0.507228	D;D	0.76494	0.999;0.997	D;P	0.67548	0.952;0.756	T	0.28138	-1.0053	10	0.87932	D	0	-23.5359	13.8089	0.63250	0.4109:0.5891:0.0:0.0	.	37;37	Q8NB12;C9JUP3	SMYD1_HUMAN;.	W	37	ENSP00000393453:R37W;ENSP00000407888:R37W;ENSP00000387482:R37W	ENSP00000393453:R37W	R	+	1	2	SMYD1	88148607	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.907000	0.39897	0.744000	0.32741	0.655000	0.94253	CGG		0.512	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
REV1	51455	broad.mit.edu	37	2	100021091	100021091	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:100021091A>G	ENST00000258428.3	-	18	3089	c.2861T>C	c.(2860-2862)gTa>gCa	p.V954A	REV1_ENST00000465835.1_5'UTR|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000393445.3_Missense_Mutation_p.V953A	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	954					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.V954A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GACTTGCTCTACTTGTTCCCG	0.438								Direct reversal of damage																													p.V954A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2861C	2						.						136.0	125.0	128.0					2																	100021091		2203	4300	6503	99387523	SO:0001583	missense	51455	exon18			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.2861T>C	2.37:g.100021091A>G	ENSP00000258428:p.Val954Ala		99387523	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603448	0.66445	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.36699	1.24;1.24	5.6	5.6	0.85130	.	0.288869	0.37809	N	0.001928	T	0.40094	0.1103	M	0.69823	2.125	0.48632	D	0.999682	P;B	0.34562	0.457;0.039	B;B	0.31390	0.129;0.052	T	0.36672	-0.9738	10	0.51188	T	0.08	.	16.0858	0.81049	1.0:0.0:0.0:0.0	.	954;953	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	A	953;954	ENSP00000377091:V953A;ENSP00000258428:V954A	ENSP00000258428:V954A	V	-	2	0	REV1	99387523	1.000000	0.71417	0.980000	0.43619	0.968000	0.65278	8.067000	0.89488	2.264000	0.75181	0.533000	0.62120	GTA		0.438	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
AFF3	3899	broad.mit.edu	37	2	100171179	100171179	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:100171179C>T	ENST00000409236.2	-	21	3413	c.3301G>A	c.(3301-3303)Gcc>Acc	p.A1101T	AFF3_ENST00000317233.4_Missense_Mutation_p.A1101T|AFF3_ENST00000409579.1_Missense_Mutation_p.A1126T|AFF3_ENST00000356421.2_Missense_Mutation_p.A1126T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1101					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.A1126T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GGGGCTTGGGCGGCTTTAGAT	0.512																																					p.A1126T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3376A	2						.						51.0	51.0	51.0					2																	100171179		2203	4300	6503	99537611	SO:0001583	missense	3899	exon22			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.3301G>A	2.37:g.100171179C>T	ENSP00000387207:p.Ala1101Thr		99537611	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024176	0.35701	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000445815	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.59	1.52	0.23074	.	0.292827	0.30630	N	0.009212	T	0.52175	0.1718	L	0.49350	1.555	0.21933	N	0.999462	P;D	0.62365	0.776;0.991	P;B	0.44359	0.447;0.281	T	0.44590	-0.9318	10	0.18710	T	0.47	.	2.7092	0.05170	0.2221:0.4382:0.208:0.1318	.	1101;1126	P51826;P51826-2	AFF3_HUMAN;.	T	1101;1126;1126;1101;143	ENSP00000317421:A1101T;ENSP00000348793:A1126T;ENSP00000386834:A1126T;ENSP00000387207:A1101T;ENSP00000416685:A143T	ENSP00000317421:A1101T	A	-	1	0	AFF3	99537611	1.000000	0.71417	0.842000	0.33263	0.442000	0.32017	0.751000	0.26348	0.290000	0.22444	-0.137000	0.14449	GCC		0.512	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
STK11IP	114790	broad.mit.edu	37	2	220473318	220473318	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:220473318delC	ENST00000456909.1	+	15	1707	c.1617delC	c.(1615-1617)cgcfs	p.R539fs	STK11IP_ENST00000295641.10_Frame_Shift_Del_p.R550fs			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	550	Glu-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.L552fs*50(1)|p.L517fs*50(1)|p.L541fs*50(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACTCTGTCGCCCCTTGTTGG	0.627																																					p.R550fs												.	.	3	Deletion - Frameshift(3)	large_intestine(3)	c.1650delC	2						.						43.0	47.0	46.0					2																	220473318		1979	4142	6121	220181562	SO:0001589	frameshift_variant	114790	exon15			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1617delC	2.37:g.220473318delC	ENSP00000389383:p.Arg539fs		220181562	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Frame_Shift_Del	DEL	ENST00000456909.1	37																																																																																					0.627	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
HDLBP	3069	broad.mit.edu	37	2	242187504	242187504	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr2:242187504G>A	ENST00000391975.1	-	14	1872	c.1645C>T	c.(1645-1647)Caa>Taa	p.Q549*	AC104841.1_ENST00000578965.1_RNA|HDLBP_ENST00000427183.2_Nonsense_Mutation_p.Q516*|HDLBP_ENST00000476807.1_5'Flank|HDLBP_ENST00000391976.2_Nonsense_Mutation_p.Q549*|HDLBP_ENST00000310931.4_Nonsense_Mutation_p.Q549*	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	549	KH 6. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)	p.Q549*(1)		breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TCACTTTTTTGTGCTGGGTCT	0.408																																					p.Q549X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1645T	2						.						163.0	146.0	151.0					2																	242187504		2203	4300	6503	241836177	SO:0001587	stop_gained	3069	exon14				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1645C>T	2.37:g.242187504G>A	ENSP00000375836:p.Gln549*		241836177	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Nonsense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.632880|9.632880	0.99224|0.99224	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000452931|ENST00000373292	.|.	.|.	.|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	0.150121|.	0.64402|.	D|.	0.000009|.	.|T	.|0.80314	.|0.4600	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77715	.|-0.2484	.|3	0.08599|.	T|.	0.76|.	-27.488|-27.488	20.3539|20.3539	0.98825|0.98825	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	549;549;549;516;58|357	.|.	ENSP00000312042:Q549X|.	Q|T	-|-	1|2	0|0	HDLBP|HDLBP	241836177|241836177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.628000|0.628000	0.37860|0.37860	9.787000|9.787000	0.99055|0.99055	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	CAA|ACA		0.408	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
STAB1	23166	broad.mit.edu	37	3	52547907	52547908	+	Frame_Shift_Ins	INS	-	-	C	rs563085224		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:52547907_52547908insC	ENST00000321725.6	+	32	3433_3434	c.3357_3358insC	c.(3358-3360)cccfs	p.P1120fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1120					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.R1122fs*37(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		AGGTCTTACTGCCCCCCCGAGG	0.624																																					p.L1119fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3357_3358insC	3						.			6,4260		0,6,2127						0.7	0.8			161	10,8244		0,10,4117	no	frameshift	STAB1	NM_015136.2		0,16,6244	A1A1,A1R,RR		0.1212,0.1406,0.1278				16,12504				52522948	SO:0001589	frameshift_variant	23166	exon32			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3364dupC	3.37:g.52547914_52547914dupC	ENSP00000312946:p.Pro1120fs		52522947	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Ins	INS	ENST00000321725.6	37	CCDS33768.1																																																																																				0.624	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
FILIP1L	11259	broad.mit.edu	37	3	99567751	99567751	+	Silent	SNP	G	G	A	rs373124183		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:99567751G>A	ENST00000354552.3	-	5	3239	c.2769C>T	c.(2767-2769)acC>acT	p.T923T	FILIP1L_ENST00000487087.1_Silent_p.T499T|FILIP1L_ENST00000331335.5_Silent_p.T923T|CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000383694.2_Silent_p.T683T|FILIP1L_ENST00000471562.1_Silent_p.T683T|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000421999.2_Intron	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	923						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T923T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						GACTCTCTGTGGTTGGACTTG	0.483																																					p.T923T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2769T	3						.	G	,,,	0,4082		0,0,2041	289.0	280.0	283.0		2769,2049,,2769	0.6	0.2	3		283	2,8394		0,2,4196	no	coding-synonymous,coding-synonymous,intron,coding-synonymous	FILIP1L,C3orf26	NM_001042459.1,NM_014890.2,NM_032359.3,NM_182909.2	,,,	0,2,6237	AA,AG,GG		0.0238,0.0,0.016	,,,	923/1134,683/894,,923/1136	99567751	2,12476	2041	4198	6239	101050441	SO:0001819	synonymous_variant	11259	exon5				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.2769C>T	3.37:g.99567751G>A			101050441	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Silent	SNP	ENST00000354552.3	37	CCDS43117.1																																																																																				0.483	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
DZIP3	9666	broad.mit.edu	37	3	108380750	108380750	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:108380750C>T	ENST00000361582.3	+	20	2456	c.2226C>T	c.(2224-2226)gaC>gaT	p.D742D	DZIP3_ENST00000463306.1_Silent_p.D742D	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	742					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D742D(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TAACTACAGACTATGGAGAAA	0.348																																					p.D742D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2226T	3						.						103.0	104.0	103.0					3																	108380750		2203	4300	6503	109863440	SO:0001819	synonymous_variant	9666	exon20			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.2226C>T	3.37:g.108380750C>T			109863440	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Silent	SNP	ENST00000361582.3	37	CCDS2952.1																																																																																				0.348	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
SIDT1	54847	broad.mit.edu	37	3	113321953	113321953	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:113321953A>G	ENST00000264852.4	+	12	1945	c.1219A>G	c.(1219-1221)Acc>Gcc	p.T407A	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Missense_Mutation_p.T407A	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	407					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.T407A(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						CGACTTCGACACCATGCCAGA	0.552																																					p.T407A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1219G	3						.						116.0	107.0	110.0					3																	113321953		2203	4300	6503	114804643	SO:0001583	missense	54847	exon12			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1219A>G	3.37:g.113321953A>G	ENSP00000264852:p.Thr407Ala		114804643	NM_017699	Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.855885	0.51376	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.22134	1.97;1.97	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000001	T	0.20088	0.0483	L	0.54323	1.7	0.44194	D	0.99701	B;B	0.32324	0.314;0.364	B;B	0.31751	0.121;0.135	T	0.04178	-1.0971	10	0.23302	T	0.38	-26.3476	10.4863	0.44724	0.9274:0.0:0.0726:0.0	.	407;407	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	A	407	ENSP00000264852:T407A;ENSP00000377416:T407A	ENSP00000264852:T407A	T	+	1	0	SIDT1	114804643	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.142000	0.77339	2.261000	0.74972	0.460000	0.39030	ACC		0.552	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
POGLUT1	56983	broad.mit.edu	37	3	119198925	119198925	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:119198925C>T	ENST00000295588.4	+	5	568	c.484C>T	c.(484-486)Cct>Tct	p.P162S		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	162					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)	p.P162S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						TATCATGTATCCTGCTTGGAC	0.463																																					p.P162S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C484T	3						.						136.0	122.0	127.0					3																	119198925		2203	4300	6503	120681615	SO:0001583	missense	56983	exon5			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.484C>T	3.37:g.119198925C>T	ENSP00000295588:p.Pro162Ser		120681615	NM_152305	B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	ENST00000295588.4	37	CCDS2988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.721103|4.721103	0.89205|0.89205	.|.	.|.	ENSG00000163389|ENSG00000163389	ENST00000295588|ENST00000476573	T|.	0.63417|.	-0.04|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85057|0.85057	0.5610|0.5610	M|M	0.93720|0.93720	3.45|3.45	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.88501|0.88501	0.3082|0.3082	10|5	0.87932|.	D|.	0|.	-9.2598|-9.2598	13.5814|13.5814	0.61905|0.61905	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	162|.	Q8NBL1|.	PGLT1_HUMAN|.	S|F	162|148	ENSP00000295588:P162S|.	ENSP00000295588:P162S|.	P|S	+|+	1|2	0|0	POGLUT1|POGLUT1	120681615|120681615	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.249000|7.249000	0.78278|0.78278	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	CCT|TCC		0.463	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355034.2	NM_152305	
FAM162A	26355	broad.mit.edu	37	3	122128665	122128665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:122128665C>T	ENST00000477892.1	+	5	536	c.452C>T	c.(451-453)gCc>gTc	p.A151V	FAM162A_ENST00000232125.5_Missense_Mutation_p.A141V	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	151					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A151V(2)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						GCTATGAAGGCCAAAACAGAG	0.408																																					p.A151V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C452T	3						.						73.0	68.0	69.0					3																	122128665		1862	4109	5971	123611355	SO:0001583	missense	26355	exon5			AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.452C>T	3.37:g.122128665C>T	ENSP00000419088:p.Ala151Val		123611355	NM_014367	Q9NRN6|Q9UJX8	Missense_Mutation	SNP	ENST00000477892.1	37	CCDS43139.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494088	0.64186	.	.	ENSG00000114023	ENST00000232125;ENST00000477892	T;T	0.35421	1.31;1.31	5.44	2.6	0.31112	.	2.722790	0.00875	N	0.002061	T	0.59211	0.2177	M	0.74881	2.28	0.80722	D	1	P	0.50819	0.939	P	0.56278	0.795	T	0.24835	-1.0149	10	0.54805	T	0.06	.	11.4763	0.50300	0.5066:0.4934:0.0:0.0	.	151	Q96A26	F162A_HUMAN	V	141;151	ENSP00000232125:A141V;ENSP00000419088:A151V	ENSP00000232125:A141V	A	+	2	0	FAM162A	123611355	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	1.340000	0.33896	0.376000	0.24707	-1.014000	0.02459	GCC		0.408	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355766.1	NM_014367	
SEMA5B	54437	broad.mit.edu	37	3	122631118	122631118	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:122631118G>A	ENST00000357599.3	-	19	3183	c.2797C>T	c.(2797-2799)Cgc>Tgc	p.R933C	SEMA5B_ENST00000195173.4_Missense_Mutation_p.R932C|SEMA5B_ENST00000451055.2_Missense_Mutation_p.R987C	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	933	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R933C(1)|p.R987C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GAACGGGTGCGTTGATAGTGA	0.647																																					p.R933C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2797T	3						.						74.0	63.0	67.0					3																	122631118		2203	4299	6502	124113808	SO:0001583	missense	54437	exon19			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2797C>T	3.37:g.122631118G>A	ENSP00000350215:p.Arg933Cys		124113808	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866380	0.51588	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000451055;ENST00000393583	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	4.69	3.82	0.43975	.	0.000000	0.85682	D	0.000000	D	0.92756	0.7697	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.94186	0.7436	10	0.87932	D	0	.	11.9748	0.53085	0.0835:0.0:0.9164:0.0	.	933	Q9P283	SEM5B_HUMAN	C	933;932;987;933	ENSP00000350215:R933C;ENSP00000195173:R932C;ENSP00000389588:R987C;ENSP00000377208:R933C	ENSP00000195173:R932C	R	-	1	0	SEMA5B	124113808	1.000000	0.71417	0.989000	0.46669	0.322000	0.28314	5.404000	0.66344	1.206000	0.43276	-0.192000	0.12808	CGC		0.647	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
EPHB1	2047	broad.mit.edu	37	3	134851793	134851793	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:134851793C>T	ENST00000398015.3	+	5	1569	c.1199C>T	c.(1198-1200)aCc>aTc	p.T400I	EPHB1_ENST00000493838.1_5'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	400	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.T400I(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TGGGCCCACACCCCCTACACC	0.617																																					p.T400I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1199T	3						.						45.0	51.0	49.0					3																	134851793		2190	4279	6469	136334483	SO:0001583	missense	2047	exon5			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1199C>T	3.37:g.134851793C>T	ENSP00000381097:p.Thr400Ile		136334483	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045982	0.93685	.	.	ENSG00000154928	ENST00000398015	T	0.62788	-0.0	5.51	5.51	0.81932	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83760	0.5324	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86208	0.1623	10	0.59425	D	0.04	.	19.4235	0.94732	0.0:1.0:0.0:0.0	.	400	P54762	EPHB1_HUMAN	I	400	ENSP00000381097:T400I	ENSP00000381097:T400I	T	+	2	0	EPHB1	136334483	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.590000	0.87494	0.655000	0.94253	ACC		0.617	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
PLOD2	5352	broad.mit.edu	37	3	145789117	145789117	+	Missense_Mutation	SNP	G	G	A	rs368177696		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:145789117G>A	ENST00000360060.3	-	17	2056	c.1879C>T	c.(1879-1881)Cgg>Tgg	p.R627W	PLOD2_ENST00000494950.1_Missense_Mutation_p.R593W|PLOD2_ENST00000282903.5_Missense_Mutation_p.R648W|RP11-274H2.3_ENST00000490375.1_RNA|PLOD2_ENST00000461497.1_Missense_Mutation_p.R308W|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	627					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.R648W(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ATGAACTCCCGGATAAAATGA	0.413																																					p.R627W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1879T	3						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	131.0	114.0	120.0		1879,1942	4.2	1.0	3		120	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PLOD2	NM_000935.2,NM_182943.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	627/738,648/759	145789117	1,13005	2203	4300	6503	147271807	SO:0001583	missense	5352	exon17			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1879C>T	3.37:g.145789117G>A	ENSP00000353170:p.Arg627Trp		147271807	NM_000935	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337892	0.60963	0.0	1.16E-4	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000360060;ENST00000494950	D;T;T;T	0.91237	-2.81;-0.21;-0.22;-0.2	5.15	4.18	0.49190	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.93871	0.8039	M	0.64404	1.975	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.72625	0.974;0.976;0.978;0.929	D	0.94318	0.7551	10	0.72032	D	0.01	-9.1348	14.8146	0.70024	0.0:0.0:0.7648:0.2352	.	593;627;648;308	E7ETU9;O00469;O00469-2;B3KWS3	.;PLOD2_HUMAN;.;.	W	308;648;627;593	ENSP00000419354:R308W;ENSP00000282903:R648W;ENSP00000353170:R627W;ENSP00000420094:R593W	ENSP00000282903:R648W	R	-	1	2	PLOD2	147271807	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	1.450000	0.35134	2.406000	0.81754	0.585000	0.79938	CGG		0.413	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
SELT	51714	broad.mit.edu	37	3	150344914	150344914	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:150344914G>A	ENST00000485923.1	+	5	795	c.407G>A	c.(406-408)cGa>cAa	p.R136Q	SELT_ENST00000471696.1_Missense_Mutation_p.R194Q|SELT_ENST00000477889.1_Missense_Mutation_p.R136Q|SELT_ENST00000480740.1_Missense_Mutation_p.R136Q			P62341	SELT_HUMAN		194					cell redox homeostasis (GO:0045454)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|pancreas development (GO:0031016)|selenocysteine incorporation (GO:0001514)	endoplasmic reticulum (GO:0005783)	selenium binding (GO:0008430)	p.R194Q(1)						LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCACACCATCGATCATAGCAC	0.373																																					p.R194Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581A	3						.						136.0	130.0	132.0					3																	150344914		1897	4106	6003	151827604	SO:0001583	missense	51714	exon5																														ENST00000485923.1:c.407G>A	3.37:g.150344914G>A	ENSP00000420390:p.Arg136Gln		151827604	NM_016275	O95904|Q8IY80|Q9CZ45|Q9NZJ3	Missense_Mutation	SNP	ENST00000485923.1	37		.	.	.	.	.	.	.	.	.	.	G	11.45	1.642000	0.29157	.	.	ENSG00000198843	ENST00000480740;ENST00000471696;ENST00000477889;ENST00000485923	.	.	.	5.45	5.45	0.79879	Thioredoxin-like fold (1);	0.421727	0.25631	N	0.029346	T	0.31857	0.0810	N	0.08118	0	0.30924	N	0.72771	B	0.17667	0.023	B	0.08055	0.003	T	0.14476	-1.0471	9	0.33940	T	0.23	-1.9626	19.293	0.94110	0.0:0.0:1.0:0.0	.	194	P62341	SELT_HUMAN	Q	136;194;136;136	.	ENSP00000418910:R194Q	R	+	2	0	RP11-392O18.1	151827604	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.636000	0.61339	2.561000	0.86390	0.555000	0.69702	CGA		0.373	SELT-005	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357629.1		
IFT80	57560	broad.mit.edu	37	3	159998492	159998492	+	Missense_Mutation	SNP	C	C	T	rs535870220		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:159998492C>T	ENST00000326448.7	-	15	2059	c.1627G>A	c.(1627-1629)Gac>Aac	p.D543N	IFT80_ENST00000496589.1_Missense_Mutation_p.D406N|IFT80_ENST00000483465.1_Missense_Mutation_p.D406N|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.D714N	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	543					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.D543N(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGCAAAATGTCTCTGTCCACA	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		18950	0.001		0.0	False		,,,				2504	0.0				p.D406N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1216A	3						.						126.0	114.0	118.0					3																	159998492		2203	4300	6503	161481186	SO:0001583	missense	57560	exon14			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1627G>A	3.37:g.159998492C>T	ENSP00000312778:p.Asp543Asn		161481186	NM_001190242	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	C	35	5.565837	0.96540	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	T;T;T	0.70045	-0.01;-0.45;-0.45	5.6	5.6	0.85130	.	0.096101	0.39407	U	0.001373	T	0.76492	0.3995	M	0.66506	2.035	0.80722	D	1	D	0.59767	0.986	P	0.53266	0.722	T	0.78178	-0.2305	10	0.59425	D	0.04	.	19.6123	0.95613	0.0:1.0:0.0:0.0	.	543	Q9P2H3	IFT80_HUMAN	N	543;406;406	ENSP00000312778:D543N;ENSP00000418196:D406N;ENSP00000420646:D406N	ENSP00000312778:D543N	D	-	1	0	IFT80	161481186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.176000	0.77643	2.640000	0.89533	0.467000	0.42956	GAC		0.338	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
GALNT15	117248	broad.mit.edu	37	3	16268973	16268973	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:16268973G>A	ENST00000339732.5	+	10	2389	c.1886G>A	c.(1885-1887)cGt>cAt	p.R629H	GALNT15_ENST00000437509.1_Intron	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	629	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R629H(2)									CAGCAGTGGCGTTTTGACCAG	0.443																																					p.R629H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1886A	3						.						124.0	122.0	123.0					3																	16268973		2203	4300	6503	16243977	SO:0001583	missense	117248	exon10			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1886G>A	3.37:g.16268973G>A	ENSP00000344260:p.Arg629His		16243977	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	CCDS33711.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.377|2.377	-0.343012|-0.343012	0.05243|0.05243	.|.	.|.	ENSG00000131386|ENSG00000131386	ENST00000339732|ENST00000543679	T|.	0.30448|.	1.53|.	5.4|5.4	0.574|0.574	0.17368|0.17368	Ricin B-related lectin (1);Ricin B lectin (2);|.	0.922020|.	0.09245|.	N|.	0.828632|.	T|T	0.39963|0.39963	0.1098|0.1098	L|L	0.46885|0.46885	1.475|1.475	0.30424|0.30424	N|N	0.77783|0.77783	B|.	0.11235|.	0.004|.	B|.	0.04013|.	0.001|.	T|T	0.41251|0.41251	-0.9519|-0.9519	10|6	0.18276|0.16896	T|T	0.48|0.51	.|.	7.9471|7.9471	0.29993|0.29993	0.4212:0.0:0.5788:0.0|0.4212:0.0:0.5788:0.0	.|.	629|.	Q8N3T1|.	GLTL2_HUMAN|.	H|I	629|159	ENSP00000344260:R629H|.	ENSP00000344260:R629H|ENSP00000445852:V159I	R|V	+|+	2|1	0|0	GALNTL2|GALNTL2	16243977|16243977	0.001000|0.001000	0.12720|0.12720	0.554000|0.554000	0.28268|0.28268	0.088000|0.088000	0.18126|0.18126	-0.853000|-0.853000	0.04303|0.04303	-0.111000|-0.111000	0.12001|0.12001	-0.140000|-0.140000	0.14226|0.14226	CGT|GTT		0.443	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
OXNAD1	92106	broad.mit.edu	37	3	16336406	16336406	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:16336406T>C	ENST00000285083.5	+	6	799	c.334T>C	c.(334-336)Tca>Cca	p.S112P	OXNAD1_ENST00000606098.1_Missense_Mutation_p.S112P|OXNAD1_ENST00000544043.1_Missense_Mutation_p.S130P|OXNAD1_ENST00000605932.1_Missense_Mutation_p.S112P|OXNAD1_ENST00000435829.2_Missense_Mutation_p.S130P	NM_138381.3	NP_612390.1	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	112	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.					mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)	p.S112P(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	13						TGGTGGGTTTTCAATATGCTC	0.393																																					p.S112P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T334C	3						.						156.0	155.0	155.0					3																	16336406		2203	4300	6503	16311410	SO:0001583	missense	92106	exon6			AL832787	CCDS2630.1	3p25-p24	2010-03-19			ENSG00000154814	ENSG00000154814			25128	protein-coding gene	gene with protein product						12477932	Standard	NM_138381		Approved	MGC15763	uc003caw.3	Q96HP4	OTTHUMG00000129867	ENST00000285083.5:c.334T>C	3.37:g.16336406T>C	ENSP00000285083:p.Ser112Pro		16311410	NM_138381	Q2HYC7|Q59FA4	Missense_Mutation	SNP	ENST00000285083.5	37	CCDS2630.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.988231	0.93106	.	.	ENSG00000154814	ENST00000285083;ENST00000435829;ENST00000544043	T;T;T	0.29397	1.57;1.57;1.57	6.02	6.02	0.97574	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.67896	0.2942	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.973	T	0.77854	-0.2433	10	0.87932	D	0	1.6093	16.5446	0.84426	0.0:0.0:0.0:1.0	.	130;112	F5H620;Q96HP4	.;OXND1_HUMAN	P	112;112;130	ENSP00000285083:S112P;ENSP00000389872:S112P;ENSP00000437967:S130P	ENSP00000285083:S112P	S	+	1	0	OXNAD1	16311410	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.602000	0.82796	2.311000	0.77944	0.533000	0.62120	TCA		0.393	OXNAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252109.1	NM_138381	
PPM1L	151742	broad.mit.edu	37	3	160786805	160786805	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:160786805C>T	ENST00000498165.1	+	4	1044	c.943C>T	c.(943-945)Cga>Tga	p.R315*	PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000464260.1_Nonsense_Mutation_p.R136*|PPM1L_ENST00000295839.9_Nonsense_Mutation_p.R188*	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	315	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.R315*(2)|p.R136*(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AGAAGCAGTTCGATTCATCAA	0.473																																					p.R315X	Pancreas(86;250 1994 13715 43211)											.	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.C943T	3						.						105.0	96.0	99.0					3																	160786805		2203	4300	6503	162269499	SO:0001587	stop_gained	151742	exon4			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.943C>T	3.37:g.160786805C>T	ENSP00000417659:p.Arg315*		162269499	NM_139245	Q2M3J2|Q96NM7	Nonsense_Mutation	SNP	ENST00000498165.1	37	CCDS33886.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048756	0.75846	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	14.0648	0.64821	0.1511:0.8489:0.0:0.0	.	.	.	.	X	315;136;188	.	ENSP00000295839:R188X	R	+	1	2	PPM1L	162269499	0.998000	0.40836	0.998000	0.56505	0.853000	0.48598	3.777000	0.55364	2.388000	0.81334	0.650000	0.86243	CGA		0.473	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245	
ZBBX	79740	broad.mit.edu	37	3	167051615	167051615	+	Splice_Site	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:167051615C>A	ENST00000392766.2	-	10	1027	c.687G>T	c.(685-687)gaG>gaT	p.E229D	ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000455345.2_Splice_Site_p.E229D|ZBBX_ENST00000392764.1_Splice_Site_p.E200D|ZBBX_ENST00000307529.5_Splice_Site_p.E229D|ZBBX_ENST00000392767.2_Splice_Site_p.E229D	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	229						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.E229D(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTCAGTTTACCTCAGAGCTGC	0.353																																					p.E229D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G687T	3						.						128.0	116.0	120.0					3																	167051615		1827	4079	5906	168534309	SO:0001630	splice_region_variant	79740	exon10			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.687+1G>T	3.37:g.167051615C>A			168534309	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905018	0.52333	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11712	2.92;2.92;2.92;2.92;2.75	4.77	4.77	0.60923	.	1.101910	0.07320	U	0.877438	T	0.17152	0.0412	L	0.50333	1.59	0.34175	D	0.670299	P;P	0.44139	0.827;0.734	B;B	0.44133	0.442;0.257	T	0.10497	-1.0627	9	.	.	.	-4.6338	13.652	0.62316	0.0:1.0:0.0:0.0	.	229;229	A8MT70-2;A8MT70	.;ZBBX_HUMAN	D	229;229;229;229;200	ENSP00000376519:E229D;ENSP00000376520:E229D;ENSP00000390232:E229D;ENSP00000305065:E229D;ENSP00000376517:E200D	.	E	-	3	2	ZBBX	168534309	1.000000	0.71417	0.999000	0.59377	0.305000	0.27757	3.803000	0.55560	2.334000	0.79466	0.555000	0.69702	GAG		0.353	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	Missense_Mutation
WDR49	151790	broad.mit.edu	37	3	167277927	167277927	+	Silent	SNP	G	G	A	rs372277287		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:167277927G>A	ENST00000308378.3	-	5	881	c.576C>T	c.(574-576)aaC>aaT	p.N192N	WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Silent_p.N17N|WDR49_ENST00000453925.2_Silent_p.N245N	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	192								p.N192N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TGATTTCTGCGTTGCCGTGGC	0.453																																					p.N192N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C576T	3						.	G		0,4406		0,0,2203	165.0	150.0	155.0		576	-1.9	1.0	3		155	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR49	NM_178824.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		192/698	167277927	1,13005	2203	4300	6503	168760621	SO:0001819	synonymous_variant	151790	exon5			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.576C>T	3.37:g.167277927G>A			168760621	NM_178824	Q8N297	Silent	SNP	ENST00000308378.3	37	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	G	4.474	0.087868	0.08583	0.0	1.16E-4	ENSG00000174776	ENST00000472600	.	.	.	4.94	-1.89	0.07689	.	.	.	.	.	T	0.51210	0.1661	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41556	-0.9502	4	.	.	.	.	7.1771	0.25751	0.366:0.1423:0.4917:0.0	.	.	.	.	M	257	.	.	T	-	2	0	WDR49	168760621	0.238000	0.23825	0.983000	0.44433	0.498000	0.33706	-0.526000	0.06207	-0.545000	0.06224	0.591000	0.81541	ACG		0.453	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
SLC2A2	6514	broad.mit.edu	37	3	170727822	170727822	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:170727822A>C	ENST00000314251.3	-	4	500	c.421T>G	c.(421-423)Ttg>Gtg	p.L141V	SLC2A2_ENST00000382808.4_Missense_Mutation_p.L22V	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	141					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)	p.L141V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	AACCCCATCAAGAGAGCTCCA	0.353																																					p.L141V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T421G	3						.						88.0	89.0	89.0					3																	170727822		2203	4300	6503	172210516	SO:0001583	missense	6514	exon4			J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.421T>G	3.37:g.170727822A>C	ENSP00000323568:p.Leu141Val		172210516	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	37	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.361012	0.41801	.	.	ENSG00000163581	ENST00000314251;ENST00000382808	T;T	0.79033	-1.23;-1.23	5.52	1.92	0.25849	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.84804	0.5553	M	0.80746	2.51	0.80722	D	1	D	0.60575	0.988	D	0.65323	0.934	D	0.83656	0.0158	10	0.87932	D	0	.	8.2323	0.31605	0.6234:0.0:0.3765:0.0	.	141	P11168	GTR2_HUMAN	V	141;22	ENSP00000323568:L141V;ENSP00000372258:L22V	ENSP00000323568:L141V	L	-	1	2	SLC2A2	172210516	0.994000	0.37717	0.984000	0.44739	0.989000	0.77384	1.477000	0.35431	0.396000	0.25283	0.533000	0.62120	TTG		0.353	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
CRYGS	1427	broad.mit.edu	37	3	186256620	186256620	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:186256620C>A	ENST00000392499.2	-	4	741	c.402G>T	c.(400-402)gaG>gaT	p.E134D	CRYGS_ENST00000307944.5_Missense_Mutation_p.E134D	NM_017541.2	NP_060011.1	P22914	CRBS_HUMAN	crystallin, gamma S	134	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|morphogenesis of an epithelium (GO:0002009)		structural constituent of eye lens (GO:0005212)	p.E134D(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	11	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		TCCAGACACCCTCCAGCACCT	0.522																																					p.E134D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G402T	3						.						92.0	84.0	87.0					3																	186256620		2203	4300	6503	187739314	SO:0001583	missense	1427	exon3				CCDS3275.1	3q27.3	2013-02-14			ENSG00000213139	ENSG00000213139			2417	protein-coding gene	gene with protein product	"""crystallin, gamma 8"""	123730		CRYG8			Standard	NM_017541		Approved		uc003fqe.3	P22914	OTTHUMG00000156615	ENST00000392499.2:c.402G>T	3.37:g.186256620C>A	ENSP00000376287:p.Glu134Asp		187739314	NM_017541	B2RAF8	Missense_Mutation	SNP	ENST00000392499.2	37	CCDS3275.1	.	.	.	.	.	.	.	.	.	.	C	3.184	-0.167340	0.06461	.	.	ENSG00000213139	ENST00000392499;ENST00000307944	T;T	0.73789	-0.78;-0.78	5.95	-11.8	0.00035	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.340989	0.25526	N	0.030067	T	0.27798	0.0684	N	0.02802	-0.49	0.25582	N	0.986781	B	0.02656	0.0	B	0.15484	0.013	T	0.55192	-0.8179	10	0.02654	T	1	.	0.8774	0.01227	0.3884:0.1076:0.2271:0.277	.	134	P22914	CRBS_HUMAN	D	134	ENSP00000376287:E134D;ENSP00000312099:E134D	ENSP00000312099:E134D	E	-	3	2	CRYGS	187739314	0.000000	0.05858	0.065000	0.19835	0.987000	0.75469	-3.543000	0.00436	-1.887000	0.01115	-0.152000	0.13540	GAG		0.522	CRYGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344784.1	NM_017541	
ITPR1	3708	broad.mit.edu	37	3	4878493	4878493	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:4878493C>A	ENST00000443694.2	+	58	8019	c.8019C>A	c.(8017-8019)gcC>gcA	p.A2673A	ITPR1_ENST00000357086.4_Silent_p.A2640A|ITPR1_ENST00000544951.1_Silent_p.A651A|ITPR1_ENST00000456211.2_Silent_p.A2625A|AC018816.3_ENST00000449914.1_Intron|ITPR1_ENST00000423119.2_Silent_p.A2640A|ITPR1_ENST00000463980.1_3'UTR|ITPR1_ENST00000354582.6_Silent_p.A2673A|ITPR1_ENST00000302640.8_Silent_p.A2673A|AC018816.3_ENST00000441894.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2688					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.A2625A(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GGATGAGAGCCATGTCATTGG	0.408																																					p.A2640A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7920A	3						.						27.0	26.0	27.0					3																	4878493		1916	4127	6043	4853493	SO:0001819	synonymous_variant	3708	exon58			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.8019C>A	3.37:g.4878493C>A			4853493	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	CCDS54551.1																																																																																				0.408	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
ARL8B	55207	broad.mit.edu	37	3	5214397	5214397	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:5214397T>C	ENST00000256496.3	+	4	590	c.344T>C	c.(343-345)cTa>cCa	p.L115P	AC026202.3_ENST00000439325.1_RNA|ARL8B_ENST00000468010.1_Intron|ARL8B_ENST00000419534.2_Missense_Mutation_p.L115P	NM_018184.2	NP_060654.1	Q9NVJ2	ARL8B_HUMAN	ADP-ribosylation factor-like 8B	115					cell cycle (GO:0007049)|cell division (GO:0051301)|chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L115P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0717)|Epithelial(13;0.0777)		CATAATCTTCTAGATAAACCA	0.303																																					p.L115P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T344C	3						.						73.0	74.0	74.0					3																	5214397		2203	4298	6501	5189397	SO:0001583	missense	55207	exon4			AK001564	CCDS2566.1	3p26.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000134108	ENSG00000134108		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25564	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10C"""	ARL10C		12477932	Standard	NM_018184		Approved	FLJ10702, Gie1	uc003bqg.3	Q9NVJ2	OTTHUMG00000090463	ENST00000256496.3:c.344T>C	3.37:g.5214397T>C	ENSP00000256496:p.Leu115Pro		5189397	NM_018184	B4DI85	Missense_Mutation	SNP	ENST00000256496.3	37	CCDS2566.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.626518	0.87560	.	.	ENSG00000134108	ENST00000256496;ENST00000438743;ENST00000419534	T;T	0.71579	-0.58;-0.58	5.39	5.39	0.77823	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90947	0.7154	H	0.99104	4.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.993	D	0.94689	0.7872	10	0.87932	D	0	-7.5008	15.4053	0.74871	0.0:0.0:0.0:1.0	.	115;106;115	B4DI85;B4DQT8;Q9NVJ2	.;.;ARL8B_HUMAN	P	115;167;115	ENSP00000256496:L115P;ENSP00000402996:L115P	ENSP00000256496:L115P	L	+	2	0	ARL8B	5189397	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.751000	0.85126	2.039000	0.60335	0.383000	0.25322	CTA		0.303	ARL8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206910.2	NM_018184	
OSBPL10	114884	broad.mit.edu	37	3	31789546	31789546	+	Missense_Mutation	SNP	C	C	T	rs367556908		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:31789546C>T	ENST00000396556.2	-	5	918	c.796G>A	c.(796-798)Ggc>Agc	p.G266S	OSBPL10_ENST00000467647.1_5'UTR|OSBPL10_ENST00000438237.2_Missense_Mutation_p.G202S	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	266					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.G266S(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GTGAGGGGGCCGGACCCTGGC	0.577																																					p.G266S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G796A	3						.	C	SER/GLY,SER/GLY	0,4406		0,0,2203	69.0	58.0	61.0		604,796	5.6	0.6	3		61	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	OSBPL10	NM_001174060.1,NM_017784.4	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	202/701,266/765	31789546	1,13005	2203	4300	6503	31764550	SO:0001583	missense	114884	exon5			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.796G>A	3.37:g.31789546C>T	ENSP00000379804:p.Gly266Ser		31764550	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182291	0.78677	0.0	1.16E-4	ENSG00000144645	ENST00000396556;ENST00000438237;ENST00000428241	T;T;T	0.38401	1.14;1.14;1.14	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.56848	0.2013	L	0.56199	1.76	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.999	D;P;D	0.97110	1.0;0.691;0.93	T	0.45234	-0.9275	10	0.27082	T	0.32	-19.7752	19.6855	0.95978	0.0:1.0:0.0:0.0	.	202;266;34	B4E212;Q9BXB5;Q59ED9	.;OSB10_HUMAN;.	S	266;202;74	ENSP00000379804:G266S;ENSP00000406124:G202S;ENSP00000399200:G74S	ENSP00000379804:G266S	G	-	1	0	OSBPL10	31764550	1.000000	0.71417	0.589000	0.28718	0.358000	0.29455	7.474000	0.81024	2.637000	0.89404	0.561000	0.74099	GGC		0.577	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
MLH1	4292	broad.mit.edu	37	3	37038114	37038114	+	Missense_Mutation	SNP	G	G	T	rs267607713		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:37038114G>T	ENST00000231790.2	+	2	337	c.121G>T	c.(121-123)Gat>Tat	p.D41Y	MLH1_ENST00000455445.2_Splice_Site|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000435176.1_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	41			D -> G (in HNPCC2). {ECO:0000269|PubMed:15365996}.|D -> H (associated with HNPCC2; has no effect on ex vivo splicing assay). {ECO:0000269|PubMed:18561205}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.D41Y(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TGCCAGTTTAGATGCAAAATC	0.363		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.D41Y		yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121T	3						.						108.0	107.0	107.0					3																	37038114		2203	4300	6503	37013118	SO:0001583	missense	4292	exon2	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.121G>T	3.37:g.37038114G>T	ENSP00000231790:p.Asp41Tyr		37013118	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.636358|4.636358	0.87760|0.87760	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937|ENST00000456676	D|.	0.93604|.	-3.25|.	5.85|5.85	5.85|5.85	0.93711|0.93711	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.92639|.	0.7661|.	H|H	0.99922|0.99922	4.955|4.955	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|.	0.95841|.	0.8866|.	10|.	0.87932|.	D|.	0|.	-24.1267|-24.1267	18.9356|18.9356	0.92584|0.92584	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	41;41|.	Q53GX1;P40692|.	.;MLH1_HUMAN|.	Y|Y	41;7;7|32	ENSP00000231790:D41Y|.	ENSP00000231790:D41Y|.	D|X	+|+	1|3	0|2	MLH1|MLH1	37013118|37013118	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.909000|8.909000	0.92647|0.92647	2.763000|2.763000	0.94921|0.94921	0.637000|0.637000	0.83480|0.83480	GAT|TAG		0.363	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
DLEC1	9940	broad.mit.edu	37	3	38127850	38127850	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:38127850G>A	ENST00000308059.6	+	9	1575	c.1554G>A	c.(1552-1554)tgG>tgA	p.W518*	DLEC1_ENST00000452631.2_Nonsense_Mutation_p.W518*|DLEC1_ENST00000346219.3_Nonsense_Mutation_p.W518*					deleted in lung and esophageal cancer 1									p.W518*(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AAACAAGCTGGCCACCACTAA	0.443																																					p.W518X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1554A	3						.						134.0	131.0	132.0					3																	38127850		1928	4142	6070	38102854	SO:0001587	stop_gained	9940	exon9			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1554G>A	3.37:g.38127850G>A	ENSP00000308597:p.Trp518*		38102854	NM_007337		Nonsense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	G	36	5.708004	0.96821	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1604	16.8531	0.85999	0.0:0.0:1.0:0.0	.	.	.	.	X	518	.	ENSP00000308597:W518X	W	+	3	0	DLEC1	38102854	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	8.409000	0.90223	2.477000	0.83638	0.650000	0.86243	TGG		0.443	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
ACAA1	30	broad.mit.edu	37	3	38163910	38163910	+	IGR	SNP	G	G	A	rs369229329		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:38163910G>A	ENST00000333167.8	-	0	1785				DLEC1_ENST00000452631.2_3'UTR|DLEC1_ENST00000308059.6_3'UTR|Y_RNA_ENST00000365095.1_RNA|DLEC1_ENST00000346219.3_Silent_p.P1717P|ACAA1_ENST00000480865.1_5'Flank	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)	p.P1717P(2)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		CTGAGGCTCCGCCCCAGCCCT	0.612																																					p.P1717P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.G5151A	3						.	G	,	0,3872		0,0,1936	43.0	47.0	46.0		,5151	1.3	0.1	3		46	1,8297		0,1,4148	no	utr-3,coding-synonymous	DLEC1	NM_007335.2,NM_007337.2	,	0,1,6084	AA,AG,GG		0.0121,0.0,0.0082	,	,1717/1779	38163910	1,12169	1936	4149	6085	38138914	SO:0001628	intergenic_variant	9940	exon36			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38163910G>A			38138914	NM_007337	G5E935|Q96CA6	Silent	SNP	ENST00000333167.8	37	CCDS2673.1																																																																																				0.612	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
ZDHHC3	51304	broad.mit.edu	37	3	44975466	44975466	+	Missense_Mutation	SNP	G	G	A	rs368475280		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:44975466G>A	ENST00000424952.2	-	4	710	c.442C>T	c.(442-444)Cgg>Tgg	p.R148W	ZDHHC3_ENST00000296127.3_Missense_Mutation_p.R148W|ZDHHC3_ENST00000342790.4_Missense_Mutation_p.R182W	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	148					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.R148W(1)		endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		CGAATGCACCGCTTACAAACA	0.557																																					p.R148W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C442T	3						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	223.0	190.0	202.0		442,442	4.0	1.0	3		202	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZDHHC3	NM_001135179.1,NM_016598.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	148/300,148/328	44975466	1,13005	2203	4300	6503	44950470	SO:0001583	missense	51304	exon4			AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.442C>T	3.37:g.44975466G>A	ENSP00000395502:p.Arg148Trp		44950470	NM_001135179	Q53A17|Q96BL0	Missense_Mutation	SNP	ENST00000424952.2	37	CCDS46811.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342614	0.82022	0.0	1.16E-4	ENSG00000163812	ENST00000339420;ENST00000296127;ENST00000424952;ENST00000342790	T;T;T;T	0.46819	1.63;0.86;0.86;0.86	4.97	3.95	0.45737	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.78502	0.4293	H	0.98559	4.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.84467	0.0597	10	0.87932	D	0	.	10.5555	0.45114	0.0:0.0:0.5733:0.4267	.	148;148;148	E9PGS3;Q9NYG2-2;Q9NYG2	.;.;ZDHC3_HUMAN	W	14;148;148;182	ENSP00000404108:R14W;ENSP00000296127:R148W;ENSP00000395502:R148W;ENSP00000345268:R182W	ENSP00000296127:R148W	R	-	1	2	ZDHHC3	44950470	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.732000	0.62029	2.466000	0.83321	0.655000	0.94253	CGG		0.557	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347004.1	NM_016598	
IP6K2	51447	broad.mit.edu	37	3	48730458	48730458	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:48730458A>G	ENST00000328631.5	-	3	580	c.357T>C	c.(355-357)caT>caC	p.H119H	IP6K2_ENST00000436134.1_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	119					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.H119H(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						CTAAGACATGATGTTTTTTGT	0.438																																					p.H119H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T357C	3						.						243.0	236.0	238.0					3																	48730458		2203	4300	6503	48705462	SO:0001819	synonymous_variant	51447	exon3			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.357T>C	3.37:g.48730458A>G			48705462	NM_016291	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Silent	SNP	ENST00000328631.5	37	CCDS2777.1																																																																																				0.438	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291	
RHOA	387	broad.mit.edu	37	3	49405932	49405932	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:49405932A>G	ENST00000418115.1	-	3	590	c.206T>C	c.(205-207)cTg>cCg	p.L69P	RHOA_ENST00000454011.2_Intron|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000422781.1_Missense_Mutation_p.L69P	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	69					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.L69P(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GAGGGGCCTCAGGCGATCATA	0.502																																					p.L69P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T206C	3						.						132.0	125.0	127.0					3																	49405932		2203	4300	6503	49380936	SO:0001583	missense	387	exon3			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.206T>C	3.37:g.49405932A>G	ENSP00000400175:p.Leu69Pro		49380936	NM_001664	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.571122	0.86542	.	.	ENSG00000067560	ENST00000418115;ENST00000422781;ENST00000445425	D;D;D	0.82619	-1.63;-1.63;-1.63	5.78	5.78	0.91487	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.94548	0.8244	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96375	0.9277	10	0.87932	D	0	.	14.9619	0.71164	1.0:0.0:0.0:0.0	.	69	P61586	RHOA_HUMAN	P	69	ENSP00000400175:L69P;ENSP00000413587:L69P;ENSP00000408402:L69P	ENSP00000400175:L69P	L	-	2	0	RHOA	49380936	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.163000	0.94750	2.219000	0.72066	0.450000	0.29827	CTG		0.502	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
NISCH	11188	broad.mit.edu	37	3	52521275	52521275	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:52521275C>A	ENST00000479054.1	+	17	1839	c.1767C>A	c.(1765-1767)ccC>ccA	p.P589P	NISCH_ENST00000345716.4_Silent_p.P589P			Q9Y2I1	NISCH_HUMAN	nischarin	589	Interaction with PAK1. {ECO:0000250}.|Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.P589P(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TCTTCCTGCCCTTCACCTGCA	0.642																																					p.P589P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1767A	3						.						114.0	100.0	105.0					3																	52521275		2203	4300	6503	52496315	SO:0001819	synonymous_variant	11188	exon16			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.1767C>A	3.37:g.52521275C>A			52496315	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	ENST00000479054.1	37	CCDS33767.1																																																																																				0.642	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
ITIH1	3697	broad.mit.edu	37	3	52818447	52818447	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:52818447G>A	ENST00000273283.2	+	11	1385	c.1361G>A	c.(1360-1362)cGg>cAg	p.R454Q	ITIH1_ENST00000540715.1_Missense_Mutation_p.R312Q|ITIH1_ENST00000537050.1_Missense_Mutation_p.R166Q|ITIH1_ENST00000542827.1_Missense_Mutation_p.R454Q	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	454	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R454Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AACAACGGACGGGCCCAGAGA	0.592																																					p.R312Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G935A	3						.						116.0	107.0	110.0					3																	52818447		2203	4300	6503	52793487	SO:0001583	missense	3697	exon9				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1361G>A	3.37:g.52818447G>A	ENSP00000273283:p.Arg454Gln		52793487	NM_001166434	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234471	0.79800	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	D;D;D;D;T	0.83335	-1.71;-1.71;-1.71;-1.71;4.08	5.19	4.29	0.51040	von Willebrand factor, type A (3);	0.498362	0.20249	N	0.096122	T	0.72779	0.3503	L	0.32530	0.975	0.21290	N	0.999732	P;P;P	0.48407	0.709;0.91;0.73	B;B;B	0.41135	0.09;0.18;0.348	T	0.68823	-0.5307	10	0.72032	D	0.01	-11.1076	7.6462	0.28321	0.0:0.1442:0.5498:0.306	.	312;55;454	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	Q	454;454;312;166;7	ENSP00000442584:R454Q;ENSP00000273283:R454Q;ENSP00000443973:R312Q;ENSP00000443847:R166Q;ENSP00000395836:R7Q	ENSP00000273283:R454Q	R	+	2	0	ITIH1	52793487	0.990000	0.36364	1.000000	0.80357	0.997000	0.91878	2.184000	0.42575	2.709000	0.92574	0.591000	0.81541	CGG		0.592	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ITIH3	3699	broad.mit.edu	37	3	52837988	52837988	+	Silent	SNP	C	C	T	rs375386244		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:52837988C>T	ENST00000449956.2	+	14	1833	c.1827C>T	c.(1825-1827)aaC>aaT	p.N609N	ITIH3_ENST00000416872.2_Intron	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	609					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.N609N(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTGAGGACAACGAGGATGAGA	0.617																																					p.N609N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1827T	3						.	C		1,4131		0,1,2065	59.0	70.0	66.0		1827	-2.0	0.6	3		66	0,8394		0,0,4197	no	coding-synonymous	ITIH3	NM_002217.3		0,1,6262	TT,TC,CC		0.0,0.0242,0.0080		609/891	52837988	1,12525	2066	4197	6263	52813028	SO:0001819	synonymous_variant	3699	exon14				CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.1827C>T	3.37:g.52837988C>T			52813028	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Silent	SNP	ENST00000449956.2	37	CCDS46845.1																																																																																				0.617	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
SFMBT1	51460	broad.mit.edu	37	3	52966194	52966194	+	Missense_Mutation	SNP	C	C	T	rs558266493		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:52966194C>T	ENST00000394752.3	-	6	966	c.584G>A	c.(583-585)cGt>cAt	p.R195H	SFMBT1_ENST00000394750.1_Missense_Mutation_p.R195H|SFMBT1_ENST00000358080.2_Missense_Mutation_p.R195H|SFMBT1_ENST00000296295.6_Missense_Mutation_p.R195H	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	195					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)	p.R195H(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		TCCTTCATAACGTAGCTTCAG	0.413																																					p.R195H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G584A	3						.						159.0	147.0	151.0					3																	52966194		2203	4300	6503	52941234	SO:0001583	missense	51460	exon7			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.584G>A	3.37:g.52966194C>T	ENSP00000378235:p.Arg195His		52941234	NM_001005158	Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	ENST00000394752.3	37	CCDS2867.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129081	0.37533	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.83	-1.02	0.10135	.	0.342816	0.34802	N	0.003668	T	0.22437	0.0541	N	0.16233	0.39	0.35814	D	0.824066	B;B	0.21753	0.06;0.013	B;B	0.20384	0.029;0.025	T	0.17410	-1.0370	10	0.19590	T	0.45	.	11.4104	0.49923	0.0:0.4812:0.0:0.5188	.	195;195	Q9UHJ3-2;Q9UHJ3	.;SMBT1_HUMAN	H	195	ENSP00000378235:R195H;ENSP00000350789:R195H;ENSP00000296295:R195H;ENSP00000378233:R195H	ENSP00000296295:R195H	R	-	2	0	SFMBT1	52941234	0.079000	0.21365	0.014000	0.15608	0.891000	0.51852	0.468000	0.22051	-0.089000	0.12484	-0.225000	0.12378	CGT		0.413	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329	
ERC2	26059	broad.mit.edu	37	3	55733483	55733483	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:55733483G>A	ENST00000288221.6	-	16	3025	c.2770C>T	c.(2770-2772)Cac>Tac	p.H924Y		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	924	Poly-His.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.H924Y(1)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		tggtggtggtggtaatggtga	0.507																																					p.H922Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2764T	3						.						246.0	252.0	250.0					3																	55733483		2093	4227	6320	55708523	SO:0001583	missense	26059	exon15			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2770C>T	3.37:g.55733483G>A	ENSP00000288221:p.His924Tyr		55708523	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.605983	0.66445	.	.	ENSG00000187672	ENST00000288221	T	0.31247	1.5	5.66	5.66	0.87406	.	0.240281	0.42964	D	0.000627	T	0.17831	0.0428	N	0.08118	0	0.51233	D	0.999912	P	0.35745	0.518	B	0.23574	0.047	T	0.09487	-1.0672	10	0.62326	D	0.03	-18.6144	19.7356	0.96200	0.0:0.0:1.0:0.0	.	924	O15083	ERC2_HUMAN	Y	924	ENSP00000288221:H924Y	ENSP00000288221:H924Y	H	-	1	0	ERC2	55708523	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.659000	0.74412	2.832000	0.97577	0.655000	0.94253	CAC		0.507	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
FEZF2	55079	broad.mit.edu	37	3	62355885	62355885	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:62355885G>A	ENST00000283268.3	-	5	1547	c.1253C>T	c.(1252-1254)aCg>aTg	p.T418M	PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000490916.1_RNA|FEZF2_ENST00000486811.1_Missense_Mutation_p.T418M|FEZF2_ENST00000475839.1_Missense_Mutation_p.T418M	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	418					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.T418M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		AGTGGCGCACGTGAAAGGCTT	0.527																																					p.T418M	NSCLC(170;1772 2053 12525 15604 23984)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1253T	3						.						260.0	237.0	245.0					3																	62355885		2203	4300	6503	62330925	SO:0001583	missense	55079	exon5			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1253C>T	3.37:g.62355885G>A	ENSP00000283268:p.Thr418Met		62330925	NM_018008	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	ENST00000283268.3	37	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365326	0.82463	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.08102	3.13;3.13;3.13	5.86	5.86	0.93980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.35854	1.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00171	-1.1959	10	0.72032	D	0.01	-16.5574	20.1772	0.98182	0.0:0.0:1.0:0.0	.	418	Q8TBJ5	FEZF2_HUMAN	M	418	ENSP00000418589:T418M;ENSP00000283268:T418M;ENSP00000418804:T418M	ENSP00000283268:T418M	T	-	2	0	FEZF2	62330925	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.778000	0.95560	0.655000	0.94253	ACG		0.527	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
SHQ1	55164	broad.mit.edu	37	3	72861878	72861878	+	Missense_Mutation	SNP	C	C	T	rs201983708		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:72861878C>T	ENST00000325599.8	-	9	1143	c.1004G>A	c.(1003-1005)cGc>cAc	p.R335H	SHQ1_ENST00000463369.1_Missense_Mutation_p.R307H	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	335					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R335H(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CTTGAAATGGCGATAGAGTGG	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		18073	0.001		0.0	False		,,,				2504	0.0				p.R335H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004A	3						.						174.0	158.0	164.0					3																	72861878		2203	4300	6503	72944568	SO:0001583	missense	55164	exon9			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.1004G>A	3.37:g.72861878C>T	ENSP00000315182:p.Arg335His		72944568	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	CCDS33788.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	21.4	4.146161	0.77888	.	.	ENSG00000144736	ENST00000325599;ENST00000463369	D;D	0.85629	-1.59;-2.01	5.56	5.56	0.83823	SHQ1 protein (1);	0.000000	0.85682	D	0.000000	D	0.94493	0.8227	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95366	0.8460	10	0.87932	D	0	-1.439	19.1204	0.93360	0.0:1.0:0.0:0.0	.	335	Q6PI26	SHQ1_HUMAN	H	335;307	ENSP00000315182:R335H;ENSP00000417452:R307H	ENSP00000315182:R335H	R	-	2	0	SHQ1	72944568	1.000000	0.71417	1.000000	0.80357	0.326000	0.28443	6.662000	0.74426	2.612000	0.88384	0.404000	0.27445	CGC		0.398	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
CNTN3	5067	broad.mit.edu	37	3	74548922	74548922	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:74548922G>A	ENST00000263665.6	-	2	97	c.70C>T	c.(70-72)Caa>Taa	p.Q24*		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	24					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.Q24*(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ACAGGGCCTTGTAAGAGAAGC	0.363																																					p.Q24X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C70T	3						.						85.0	90.0	88.0					3																	74548922		2203	4300	6503	74631612	SO:0001587	stop_gained	5067	exon2			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.70C>T	3.37:g.74548922G>A	ENSP00000263665:p.Gln24*		74631612	NM_020872	B9EK50|Q9H039	Nonsense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	37	6.094931	0.97276	.	.	ENSG00000113805	ENST00000263665	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	14.9832	0.71327	0.0:0.0:1.0:0.0	.	.	.	.	X	24	.	ENSP00000263665:Q24X	Q	-	1	0	CNTN3	74631612	1.000000	0.71417	0.958000	0.39756	0.946000	0.59487	3.166000	0.50785	2.602000	0.87976	0.655000	0.94253	CAA		0.363	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
MASP1	5648	broad.mit.edu	37	3	186980338	186980338	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr3:186980338C>T	ENST00000337774.5	-	3	797	c.408G>A	c.(406-408)atG>atA	p.M136I	MASP1_ENST00000169293.6_Missense_Mutation_p.M136I|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392472.2_Missense_Mutation_p.M23I|MASP1_ENST00000296280.6_Missense_Mutation_p.M136I|MASP1_ENST00000392470.2_Missense_Mutation_p.M110I	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	136	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.M136I(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TACCCACAGCCATGTAGTGGG	0.512																																					p.M136I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G408A	3						.						69.0	74.0	72.0					3																	186980338		2203	4300	6503	188463032	SO:0001583	missense	5648	exon3			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.408G>A	3.37:g.186980338C>T	ENSP00000336792:p.Met136Ile		188463032	NM_001031849	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520327	0.44866	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470;ENST00000392475	T;T;T;T;T;T	0.81330	1.67;1.67;-1.48;1.67;1.67;1.67	5.45	4.56	0.56223	CUB (4);	0.206543	0.48286	D	0.000193	T	0.56688	0.2002	N	0.02708	-0.52	0.41520	D	0.988398	B;B;B;B;B	0.12013	0.0;0.0;0.005;0.002;0.002	B;B;B;B;B	0.21917	0.003;0.0;0.037;0.008;0.001	T	0.54490	-0.8286	10	0.21014	T	0.42	.	9.0421	0.36325	0.0:0.6582:0.264:0.0778	.	110;136;23;136;136	F8W876;P48740-3;P48740-4;P48740-2;P48740	.;.;.;.;MASP1_HUMAN	I	136;136;23;23;136;110;143	ENSP00000336792:M136I;ENSP00000296280:M136I;ENSP00000376264:M23I;ENSP00000169293:M136I;ENSP00000376262:M110I;ENSP00000376267:M143I	ENSP00000169293:M136I	M	-	3	0	MASP1	188463032	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.698000	0.25571	2.725000	0.93324	0.655000	0.94253	ATG		0.512	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
ANK2	287	broad.mit.edu	37	4	114275049	114275049	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:114275049G>A	ENST00000357077.4	+	38	5328	c.5275G>A	c.(5275-5277)Gaa>Aaa	p.E1759K	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.E1726K|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1759					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.E1759K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCCTTTGATAGAAGAAACTCC	0.458																																					p.E1759K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5275A	4						.						249.0	262.0	257.0					4																	114275049		2203	4300	6503	114494498	SO:0001583	missense	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5275G>A	4.37:g.114275049G>A	ENSP00000349588:p.Glu1759Lys		114494498	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685183	0.88639	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.72942	-0.7;-0.62	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000013	D	0.83027	0.5165	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.68483	0.867;0.958	T	0.81558	-0.0878	9	.	.	.	.	19.8411	0.96685	0.0:0.0:1.0:0.0	.	1726;1759	Q01484;Q01484-4	ANK2_HUMAN;.	K	1759;1726	ENSP00000349588:E1759K;ENSP00000264366:E1726K	.	E	+	1	0	ANK2	114494498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.749000	0.74883	2.683000	0.91414	0.655000	0.94253	GAA		0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
USP53	54532	broad.mit.edu	37	4	120169912	120169912	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:120169912G>A	ENST00000274030.6	+	7	1426	c.247G>A	c.(247-249)Gca>Aca	p.A83T	USP53_ENST00000450251.1_Missense_Mutation_p.A83T	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53									p.A83T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						GACGATATTTGCACAGTTCCA	0.388																																					p.A83T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G247A	4						.						155.0	135.0	141.0					4																	120169912		1916	4123	6039	120389360	SO:0001583	missense	54532	exon6			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.247G>A	4.37:g.120169912G>A	ENSP00000274030:p.Ala83Thr		120389360	NM_019050		Missense_Mutation	SNP	ENST00000274030.6	37	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	G	9.946	1.218713	0.22373	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.31247	1.5;1.5	6.01	6.01	0.97437	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.232074	0.44902	D	0.000413	T	0.17492	0.0420	N	0.12182	0.205	0.32538	N	0.534046	B	0.32324	0.364	B	0.39465	0.3	T	0.29305	-1.0016	10	0.11485	T	0.65	-23.6195	6.256	0.20874	0.1429:0.0:0.6899:0.1672	.	83	Q70EK8	UBP53_HUMAN	T	83	ENSP00000274030:A83T;ENSP00000409906:A83T	ENSP00000274030:A83T	A	+	1	0	USP53	120389360	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.572000	0.36461	2.861000	0.98227	0.650000	0.86243	GCA		0.388	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597	
ANKRD50	57182	broad.mit.edu	37	4	125593090	125593090	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:125593090T>C	ENST00000504087.1	-	4	2379	c.1342A>G	c.(1342-1344)Aca>Gca	p.T448A	ANKRD50_ENST00000515641.1_Missense_Mutation_p.T269A	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	448								p.T448A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TCCAATGGTGTTAAATTCTTG	0.393																																					p.T269A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A805G	4						.						122.0	121.0	121.0					4																	125593090		2203	4300	6503	125812540	SO:0001583	missense	57182	exon3			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1342A>G	4.37:g.125593090T>C	ENSP00000425658:p.Thr448Ala		125812540	NM_001167882	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	5.309	0.242396	0.10077	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.66099	-0.19;-0.15	5.39	4.17	0.49024	.	0.245105	0.41605	D	0.000854	T	0.44746	0.1308	N	0.24115	0.695	0.28916	N	0.892392	B	0.09022	0.002	B	0.06405	0.002	T	0.37009	-0.9724	10	0.40728	T	0.16	.	8.2327	0.31608	0.1325:0.0:0.1385:0.729	.	448	Q9ULJ7	ANR50_HUMAN	A	448;269	ENSP00000425658:T448A;ENSP00000425355:T269A	ENSP00000425658:T448A	T	-	1	0	ANKRD50	125812540	1.000000	0.71417	0.855000	0.33649	0.993000	0.82548	3.595000	0.54016	1.017000	0.39495	0.454000	0.30748	ACA		0.393	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
BOD1L1	259282	broad.mit.edu	37	4	13601771	13601771	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:13601771G>A	ENST00000040738.5	-	10	6888	c.6753C>T	c.(6751-6753)gaC>gaT	p.D2251D		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2251						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D2251D(1)									TGCCACTCCCGTCTTTTTCTT	0.527																																					p.D2251D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6753T	4						.						85.0	73.0	77.0					4																	13601771		2203	4300	6503	13210869	SO:0001819	synonymous_variant	259282	exon10			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6753C>T	4.37:g.13601771G>A			13210869	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																				0.527	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
JADE1	79960	broad.mit.edu	37	4	129782983	129782983	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:129782983G>A	ENST00000226319.6	+	9	1386	c.1106G>A	c.(1105-1107)aGc>aAc	p.S369N	PHF17_ENST00000511647.1_Missense_Mutation_p.S369N|PHF17_ENST00000413543.2_Missense_Mutation_p.S369N|PHF17_ENST00000512960.1_Missense_Mutation_p.S369N|PHF17_ENST00000452328.2_Missense_Mutation_p.S357N	NM_199320.2	NP_955352.1												p.S369N(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCAAAGCACAGCTCACATAGG	0.562																																					p.S369N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1106A	4						.						111.0	124.0	120.0					4																	129782983		2203	4300	6503	130002433	SO:0001583	missense	79960	exon9																														ENST00000226319.6:c.1106G>A	4.37:g.129782983G>A	ENSP00000226319:p.Ser369Asn		130002433	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742789	0.69418	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000413543	T;T;T;T;T	0.51817	0.78;0.69;0.77;0.78;0.69	5.01	4.18	0.49190	Zinc finger, PHD-type (1);	0.142736	0.64402	D	0.000004	T	0.55673	0.1935	L	0.36672	1.1	0.58432	D	0.999994	D;D;D	0.71674	0.998;0.998;0.97	D;D;D	0.69142	0.962;0.91;0.94	T	0.52924	-0.8510	9	.	.	.	.	13.4859	0.61366	0.0751:0.0:0.9249:0.0	.	357;369;369	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	N	369;369;357;369;369;369	ENSP00000226319:S369N;ENSP00000423737:S369N;ENSP00000388015:S357N;ENSP00000425730:S369N;ENSP00000404211:S369N	.	S	+	2	0	PHF17	130002433	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	6.152000	0.71812	1.353000	0.45828	-0.136000	0.14681	AGC		0.562	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
OTUD4	54726	broad.mit.edu	37	4	146073755	146073755	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:146073755A>G	ENST00000447906.2	-	11	1093	c.906T>C	c.(904-906)aaT>aaC	p.N302N	OTUD4_ENST00000455611.2_5'UTR|Y_RNA_ENST00000459374.1_RNA|OTUD4_ENST00000454497.2_Silent_p.N237N			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	302					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.N236N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GAACATCTGCATTCAAAAATT	0.358																																					p.N237N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T711C	4						.						70.0	67.0	68.0					4																	146073755		2203	4300	6503	146293205	SO:0001819	synonymous_variant	54726	exon11				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.906T>C	4.37:g.146073755A>G			146293205	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37																																																																																					0.358	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
ARFIP1	27236	broad.mit.edu	37	4	153750858	153750858	+	Missense_Mutation	SNP	C	C	T	rs145188297		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:153750858C>T	ENST00000451320.2	+	2	237	c.73C>T	c.(73-75)Cgt>Tgt	p.R25C	ARFIP1_ENST00000405727.2_Missense_Mutation_p.R25C|ARFIP1_ENST00000356064.3_Missense_Mutation_p.R25C|ARFIP1_ENST00000429148.2_Missense_Mutation_p.R25C|ARFIP1_ENST00000353617.2_Missense_Mutation_p.R25C			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	25					intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.R25C(1)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TGATGACTCTCGTGAACATAG	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		15742	0.0		0.0	False		,,,				2504	0.001				p.R25C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C73T	4						.	C	CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	135.0	142.0	140.0		73,73,73	5.7	1.0	4	dbSNP_134	140	0,8600		0,0,4300	no	missense,missense,missense	ARFIP1	NM_001025593.1,NM_001025595.1,NM_014447.2	180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	25/342,25/374,25/342	153750858	1,13005	2203	4300	6503	153970308	SO:0001583	missense	27236	exon2			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.73C>T	4.37:g.153750858C>T	ENSP00000395083:p.Arg25Cys		153970308	NM_001025593	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496079	0.44352	2.27E-4	0.0	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	T;T;T;T	0.77229	-1.07;-1.07;-1.08;-1.08	5.65	5.65	0.86999	.	0.283402	0.39544	N	0.001339	T	0.62233	0.2411	N	0.14661	0.345	0.31068	N	0.713398	B;B;B	0.23377	0.03;0.084;0.0	B;B;B	0.14578	0.001;0.011;0.0	T	0.64715	-0.6342	10	0.56958	D	0.05	-6.0122	11.9184	0.52778	0.0:0.9192:0.0:0.0808	.	25;25;25	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	C	25	ENSP00000395083:R25C;ENSP00000296557:R25C;ENSP00000384189:R25C;ENSP00000348360:R25C	ENSP00000296557:R25C	R	+	1	0	ARFIP1	153970308	0.009000	0.17119	0.998000	0.56505	0.870000	0.49936	1.678000	0.37586	2.654000	0.90174	0.557000	0.71058	CGT		0.338	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
DCHS2	54798	broad.mit.edu	37	4	155242025	155242025	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:155242025G>T	ENST00000357232.4	-	14	3160	c.3161C>A	c.(3160-3162)tCt>tAt	p.S1054Y		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1054	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1054Y(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATCCTGGAAAGATGGGGAATG	0.433																																					p.S1054Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3161A	4						.						143.0	137.0	139.0					4																	155242025		2203	4300	6503	155461475	SO:0001583	missense	54798	exon14			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3161C>A	4.37:g.155242025G>T	ENSP00000349768:p.Ser1054Tyr		155461475	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	0.271	-0.992735	0.02162	.	.	ENSG00000197410	ENST00000357232	T	0.60672	0.17	5.69	5.69	0.88448	Cadherin (3);Cadherin-like (1);	0.305164	0.28964	N	0.013562	T	0.39886	0.1095	L	0.48174	1.505	0.80722	D	1	B	0.27351	0.176	B	0.18263	0.021	T	0.32903	-0.9889	10	0.02654	T	1	.	5.8342	0.18597	0.1497:0.0:0.6764:0.1738	.	1054	Q6V1P9	PCD23_HUMAN	Y	1054	ENSP00000349768:S1054Y	ENSP00000349768:S1054Y	S	-	2	0	DCHS2	155461475	0.644000	0.27277	0.959000	0.39883	0.701000	0.40568	0.684000	0.25364	2.683000	0.91414	0.563000	0.77884	TCT		0.433	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
RAPGEF2	9693	broad.mit.edu	37	4	160235806	160235806	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:160235806G>A	ENST00000264431.4	+	3	675	c.256G>A	c.(256-258)Gaa>Aaa	p.E86K	RAPGEF2_ENST00000504604.1_3'UTR	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	86					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.E74K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AGTGGATTCCGAAGACGACGA	0.468																																					p.E86K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G256A	4						.						114.0	121.0	119.0					4																	160235806		2047	4196	6243	160455256	SO:0001583	missense	9693	exon3			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.256G>A	4.37:g.160235806G>A	ENSP00000264431:p.Glu86Lys		160455256	NM_014247	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590908	0.86851	.	.	ENSG00000109756	ENST00000505478;ENST00000511336;ENST00000510510;ENST00000264431;ENST00000514565	T	0.50001	0.76	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.66616	0.2807	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	D	0.64877	0.93	T	0.67772	-0.5584	10	0.62326	D	0.03	.	19.4806	0.95008	0.0:0.0:1.0:0.0	.	86	Q9Y4G8	RPGF2_HUMAN	K	242;14;84;86;67	ENSP00000264431:E86K	ENSP00000264431:E86K	E	+	1	0	RAPGEF2	160455256	1.000000	0.71417	0.984000	0.44739	0.339000	0.28857	9.476000	0.97823	2.591000	0.87537	0.585000	0.79938	GAA		0.468	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
DDX60L	91351	broad.mit.edu	37	4	169393052	169393052	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:169393052T>C	ENST00000511577.1	-	4	357	c.110A>G	c.(109-111)aAt>aGt	p.N37S	DDX60L_ENST00000515088.1_5'UTR|SNORA51_ENST00000384442.1_RNA|DDX60L_ENST00000505890.1_Missense_Mutation_p.N37S|DDX60L_ENST00000260184.7_Missense_Mutation_p.N37S			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	37							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)	p.N37S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CACAAAAAAATTAGATTCCAC	0.343																																					p.N37S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A110G	4						.						59.0	53.0	54.0					4																	169393052		1841	4101	5942	169629627	SO:0001583	missense	91351	exon4			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.110A>G	4.37:g.169393052T>C	ENSP00000422423:p.Asn37Ser		169629627	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	T	13.74	2.325874	0.41197	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505696;ENST00000514748;ENST00000512371	T;T;T	0.17213	2.29;2.29;2.3	4.08	4.08	0.47627	.	0.403609	0.17036	U	0.189535	T	0.18759	0.0450	L	0.44542	1.39	0.20926	N	0.999829	P;P;P	0.41450	0.75;0.731;0.605	B;B;B	0.42030	0.373;0.175;0.108	T	0.06862	-1.0803	10	0.66056	D	0.02	.	12.6696	0.56860	0.0:0.0:0.0:1.0	.	37;37;37	D6RB62;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	S	37	ENSP00000260184:N37S;ENSP00000422423:N37S;ENSP00000422202:N37S	ENSP00000260184:N37S	N	-	2	0	DDX60L	169629627	1.000000	0.71417	0.044000	0.18714	0.966000	0.64601	4.971000	0.63749	1.440000	0.47531	0.383000	0.25322	AAT		0.343	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
GALNTL6	442117	broad.mit.edu	37	4	173734773	173734773	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:173734773A>C	ENST00000506823.1	+	7	1479	c.822A>C	c.(820-822)caA>caC	p.Q274H	GALNTL6_ENST00000508122.1_Missense_Mutation_p.Q257H	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	274					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Q274H(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ATGAGGCACAAGCTGGGGATG	0.498																																					p.Q274H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A822C	4						.						113.0	101.0	105.0					4																	173734773		2203	4300	6503	173971348	SO:0001583	missense	442117	exon7				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.822A>C	4.37:g.173734773A>C	ENSP00000423313:p.Gln274His		173971348	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.374973	0.61735	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.59364	0.27;0.27	5.97	-0.709	0.11237	Glycosyl transferase, family 2 (1);	0.236891	0.30244	N	0.010072	T	0.70684	0.3252	M	0.73598	2.24	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	T	0.70857	-0.4758	10	0.66056	D	0.02	.	10.8607	0.46825	0.448:0.0:0.552:0.0	.	274	Q49A17	GLTL6_HUMAN	H	274;257	ENSP00000423313:Q274H;ENSP00000423827:Q257H	ENSP00000423313:Q274H	Q	+	3	2	GALNTL6	173971348	1.000000	0.71417	0.987000	0.45799	0.894000	0.52154	2.484000	0.45242	-0.061000	0.13110	-0.912000	0.02778	CAA		0.498	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
WDR1	9948	broad.mit.edu	37	4	10080591	10080591	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:10080591C>T	ENST00000499869.2	-	12	1512	c.1319G>A	c.(1318-1320)aGc>aAc	p.S440N	WDR1_ENST00000515743.1_5'UTR|MIR3138_ENST00000585238.1_RNA|WDR1_ENST00000382451.2_Missense_Mutation_p.S300N|WDR1_ENST00000502702.1_Missense_Mutation_p.S300N|WDR1_ENST00000382452.2_Missense_Mutation_p.S440N			O75083	WDR1_HUMAN	WD repeat domain 1	440					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)		p.S440N(1)		endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GTTGTCGATGCTGAAGCACTT	0.612																																					p.S440N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1319A	4						.						74.0	88.0	83.0					4																	10080591		2064	4187	6251	9689689	SO:0001583	missense	9948	exon12			AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1319G>A	4.37:g.10080591C>T	ENSP00000427687:p.Ser440Asn		9689689	NM_017491	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	ENST00000499869.2	37	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640367	0.47153	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.53640	0.61;0.61;0.95;0.95	4.75	3.85	0.44370	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.190652	0.56097	D	0.000035	T	0.33469	0.0864	N	0.21282	0.65	0.32907	D	0.51397	B;B	0.14438	0.01;0.0	B;B	0.10450	0.005;0.0	T	0.41752	-0.9491	10	0.39692	T	0.17	-38.712	13.0087	0.58720	0.0:0.7111:0.2889:0.0	.	300;440	O75083-3;O75083	.;WDR1_HUMAN	N	440;440;300;300;275	ENSP00000427687:S440N;ENSP00000371890:S440N;ENSP00000371889:S300N;ENSP00000426725:S300N	ENSP00000371889:S300N	S	-	2	0	WDR1	9689689	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	1.459000	0.35234	2.348000	0.79779	0.462000	0.41574	AGC		0.612	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
SLIT2	9353	broad.mit.edu	37	4	20598058	20598058	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:20598058C>A	ENST00000504154.1	+	32	3593	c.3341C>A	c.(3340-3342)tCt>tAt	p.S1114Y	SLIT2_ENST00000503837.1_Missense_Mutation_p.S1110Y|SLIT2_ENST00000273739.5_Missense_Mutation_p.S1127Y|SLIT2_ENST00000503823.1_Missense_Mutation_p.S1106Y	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1114					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.S1114Y(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TGTGAGTTTTCTCCACCCATG	0.378																																					p.S1114Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3341A	4						.						77.0	81.0	80.0					4																	20598058		2203	4300	6503	20207156	SO:0001583	missense	9353	exon32			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3341C>A	4.37:g.20598058C>A	ENSP00000422591:p.Ser1114Tyr		20207156	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581409	0.86748	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;T;T	0.81659	-1.51;-1.52;1.13;-1.48	6.08	5.24	0.73138	.	0.097992	0.64402	D	0.000001	T	0.80160	0.4572	L	0.49126	1.545	0.58432	D	0.999999	P;P	0.43973	0.708;0.823	B;B	0.43536	0.346;0.423	T	0.81756	-0.0787	10	0.59425	D	0.04	.	17.6021	0.88028	0.0:0.8769:0.1231:0.0	.	1106;1114	O94813-3;O94813	.;SLIT2_HUMAN	Y	1106;1114;1127;1110;1110	ENSP00000427548:S1106Y;ENSP00000422591:S1114Y;ENSP00000273739:S1127Y;ENSP00000422261:S1110Y	ENSP00000273739:S1127Y	S	+	2	0	SLIT2	20207156	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	5.707000	0.68370	1.578000	0.49821	0.591000	0.81541	TCT		0.378	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
APBB2	323	broad.mit.edu	37	4	40818246	40818246	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:40818246G>A	ENST00000295974.8	-	18	2769	c.2140C>T	c.(2140-2142)Ccg>Tcg	p.P714S	APBB2_ENST00000508593.1_Missense_Mutation_p.P715S|APBB2_ENST00000543538.1_Missense_Mutation_p.P166S|RP11-632F7.3_ENST00000513127.1_RNA|APBB2_ENST00000502841.1_Missense_Mutation_p.P166S|APBB2_ENST00000513140.1_Missense_Mutation_p.P692S|APBB2_ENST00000506352.1_Missense_Mutation_p.P693S|APBB2_ENST00000504305.1_Missense_Mutation_p.P166S	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	714	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)	p.P692S(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						TGAGAAGGCGGCCTGGCTACC	0.398																																					p.P714S	Ovarian(3;20 75 16686 49997)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2140T	4						.						126.0	125.0	125.0					4																	40818246		1947	4135	6082	40513003	SO:0001583	missense	323	exon18			U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.2140C>T	4.37:g.40818246G>A	ENSP00000295974:p.Pro714Ser		40513003	NM_001166050	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	CCDS54761.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.61|10.61	1.398129|1.398129	0.25205|0.25205	.|.	.|.	ENSG00000163697|ENSG00000163697	ENST00000513611|ENST00000295974;ENST00000316212;ENST00000543538;ENST00000513140;ENST00000508593;ENST00000502841;ENST00000506352;ENST00000504305	.|T;T;T;T;T;T;T	.|0.44083	.|2.45;0.93;2.49;2.45;0.93;2.48;0.93	5.41|5.41	4.56|4.56	0.56223|0.56223	.|Phosphotyrosine interaction domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57403|0.57403	0.2051|0.2051	L|L	0.49455|0.49455	1.56|1.56	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	T|T	0.53272|0.53272	-0.8462|-0.8462	5|10	.|0.27082	.|T	.|0.32	-13.7166|-13.7166	15.4864|15.4864	0.75571|0.75571	0.0:0.0:0.8604:0.1396|0.0:0.0:0.8604:0.1396	.|.	.|715;692;714	.|E9PG87;Q92870-2;Q92870	.|.;.;APBB2_HUMAN	V|S	683|714;713;166;692;715;166;693;166	.|ENSP00000295974:P714S;ENSP00000439357:P166S;ENSP00000426018:P692S;ENSP00000427211:P715S;ENSP00000425802:P166S;ENSP00000421539:P693S;ENSP00000423765:P166S	.|ENSP00000295974:P714S	A|P	-|-	2|1	0|0	APBB2|APBB2	40513003|40513003	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.007000|0.007000	0.05969|0.05969	9.869000|9.869000	0.99810|0.99810	1.265000|1.265000	0.44215|0.44215	-0.188000|-0.188000	0.12872|0.12872	GCC|CCG		0.398	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075	
SLC30A9	10463	broad.mit.edu	37	4	42025372	42025372	+	Missense_Mutation	SNP	G	G	A	rs144935504	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:42025372G>A	ENST00000264451.7	+	6	761	c.581G>A	c.(580-582)cGt>cAt	p.R194H		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	194					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R194H(3)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAAAAATTGCGTAAGGAAGCA	0.343													G|||	2	0.000399361	0.0	0.0	5008	,	,		17754	0.0		0.001	False		,,,				2504	0.001				p.R194H												.	.	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)	c.G581A	4						.	G	HIS/ARG	0,4406		0,0,2203	98.0	103.0	101.0		581	5.5	1.0	4	dbSNP_134	101	3,8597	3.7+/-12.6	0,3,4297	yes	missense	SLC30A9	NM_006345.3	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	194/569	42025372	3,13003	2203	4300	6503	41720129	SO:0001583	missense	10463	exon6			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.581G>A	4.37:g.42025372G>A	ENSP00000264451:p.Arg194His		41720129	NM_006345	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	34	5.319460	0.95682	0.0	3.49E-4	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.56444	0.46	5.48	5.48	0.80851	DNA binding domain, putative (1);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.78270	-0.2269	10	0.87932	D	0	-11.4523	19.3393	0.94335	0.0:0.0:1.0:0.0	.	194	Q6PML9	ZNT9_HUMAN	H	194;22	ENSP00000264451:R194H	ENSP00000264451:R194H	R	+	2	0	SLC30A9	41720129	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	9.297000	0.96120	2.556000	0.86216	0.585000	0.79938	CGT		0.343	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
LRRC66	339977	broad.mit.edu	37	4	52862092	52862092	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:52862092C>A	ENST00000343457.3	-	4	1102	c.1096G>T	c.(1096-1098)Ggc>Tgc	p.G366C		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	366						integral component of membrane (GO:0016021)		p.G366C(2)		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TCTTTTTTGCCGGCAGCCTGC	0.592																																					p.G366C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1096T	4						.						34.0	37.0	36.0					4																	52862092		1972	4158	6130	52556849	SO:0001583	missense	339977	exon4			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1096G>T	4.37:g.52862092C>A	ENSP00000341944:p.Gly366Cys		52556849	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.391232	0.42410	.	.	ENSG00000188993	ENST00000343457	T	0.48201	0.82	4.42	-2.55	0.06288	.	1.683770	0.03113	N	0.162707	T	0.47469	0.1447	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	P	0.52881	0.712	T	0.43523	-0.9386	10	0.62326	D	0.03	-0.0036	1.6513	0.02772	0.1348:0.3635:0.1327:0.369	.	366	Q68CR7	LRC66_HUMAN	C	366	ENSP00000341944:G366C	ENSP00000341944:G366C	G	-	1	0	LRRC66	52556849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.838000	0.04372	-0.204000	0.10235	-0.373000	0.07131	GGC		0.592	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
LNX1	84708	broad.mit.edu	37	4	54374387	54374387	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:54374387C>T	ENST00000263925.7	-	3	702	c.388G>A	c.(388-390)Ggt>Agt	p.G130S	LNX1-AS1_ENST00000510785.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1_ENST00000306888.2_Missense_Mutation_p.G34S|LNX1-AS1_ENST00000511989.1_RNA|LNX1-AS1_ENST00000514364.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	130					protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G34S(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGGGAGGCACCTTTACAGCTG	0.542																																					p.G130S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G388A	4						.						46.0	49.0	48.0					4																	54374387		2203	4300	6503	54069144	SO:0001583	missense	84708	exon3			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.388G>A	4.37:g.54374387C>T	ENSP00000263925:p.Gly130Ser		54069144	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	ENST00000263925.7	37	CCDS47057.1	.	.	.	.	.	.	.	.	.	.	C	35	5.597022	0.96602	.	.	ENSG00000072201	ENST00000306888;ENST00000263925	T;T	0.12774	2.65;4.38	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.79784	0.899;0.993	T	0.33111	-0.9881	10	0.66056	D	0.02	.	18.9607	0.92677	0.0:1.0:0.0:0.0	.	130;34	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	S	34;130	ENSP00000302879:G34S;ENSP00000263925:G130S	ENSP00000263925:G130S	G	-	1	0	LNX1	54069144	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	7.398000	0.79919	2.489000	0.83994	0.555000	0.69702	GGT		0.542	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
UBA6	55236	broad.mit.edu	37	4	68543398	68543398	+	Nonsense_Mutation	SNP	G	G	C	rs371915320		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:68543398G>C	ENST00000322244.5	-	6	455	c.396C>G	c.(394-396)taC>taG	p.Y132*	UBA6_ENST00000420827.2_Nonsense_Mutation_p.Y132*	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	132					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.Y132*(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TGACATGAACGTATGGATTTA	0.294																																					p.Y132X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C396G	4						.						156.0	152.0	153.0					4																	68543398		2203	4298	6501	68225993	SO:0001587	stop_gained	55236	exon6			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.396C>G	4.37:g.68543398G>C	ENSP00000313454:p.Tyr132*		68225993	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Nonsense_Mutation	SNP	ENST00000322244.5	37	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	A	19.51	3.840844	0.71488	.	.	ENSG00000033178	ENST00000322244;ENST00000420827	.	.	.	5.16	1.23	0.21249	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9849	9.6125	0.39672	0.7249:0.0:0.2751:0.0	.	.	.	.	X	132	.	ENSP00000313454:Y132X	Y	-	3	2	UBA6	68225993	0.998000	0.40836	0.997000	0.53966	0.886000	0.51366	0.675000	0.25232	-0.153000	0.11137	-1.062000	0.02293	TAC		0.294	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
FRAS1	80144	broad.mit.edu	37	4	79284771	79284771	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:79284771G>A	ENST00000325942.6	+	21	2967	c.2527G>A	c.(2527-2529)Gtt>Att	p.V843I	FRAS1_ENST00000264895.6_Missense_Mutation_p.V843I	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	843					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.V843I(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GGACCACTGTGTTCCTGACTG	0.562																																					p.V843I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2527A	4						.						43.0	44.0	44.0					4																	79284771		2056	4201	6257	79503795	SO:0001583	missense	80144	exon21			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.2527G>A	4.37:g.79284771G>A	ENSP00000326330:p.Val843Ile		79503795	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697986	0.48307	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.32272	1.46;1.47	5.36	3.64	0.41730	.	0.222289	0.36703	N	0.002454	T	0.33323	0.0859	L	0.55834	1.745	0.80722	D	1	P;P	0.41947	0.647;0.766	B;B	0.43680	0.397;0.427	T	0.06770	-1.0808	10	0.56958	D	0.05	.	11.399	0.49860	0.1455:0.0:0.8545:0.0	.	843;843	E9PHH6;A2RRR8	.;.	I	843	ENSP00000326330:V843I;ENSP00000264895:V843I	ENSP00000264895:V843I	V	+	1	0	FRAS1	79503795	1.000000	0.71417	0.031000	0.17742	0.225000	0.24961	1.661000	0.37408	0.652000	0.30806	-0.237000	0.12165	GTT		0.562	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
ANTXR2	118429	broad.mit.edu	37	4	80905088	80905088	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:80905088T>G	ENST00000307333.7	-	14	1125	c.1123A>C	c.(1123-1125)Act>Cct	p.T375P	ANTXR2_ENST00000404191.1_Missense_Mutation_p.T298P|ANTXR2_ENST00000346652.6_Missense_Mutation_p.T272P|ANTXR2_ENST00000403729.2_Missense_Mutation_p.T375P	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	375					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.T375P(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						GCATCCACAGTTGGCCACTTT	0.348									Juvenile Hyaline Fibromatosis																												p.T375P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1123C	4						.						79.0	74.0	75.0					4																	80905088		1808	4072	5880	81124112	SO:0001583	missense	118429	exon14	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.1123A>C	4.37:g.80905088T>G	ENSP00000306185:p.Thr375Pro		81124112	NM_001145794	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Missense_Mutation	SNP	ENST00000307333.7	37	CCDS47086.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928785	0.73327	.	.	ENSG00000163297	ENST00000403729;ENST00000404191;ENST00000346652;ENST00000307333	T;T;T;T	0.53857	2.15;0.6;2.11;2.14	5.8	5.8	0.92144	Anthrax toxin receptor, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74574	0.3734	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.987;0.994	T	0.78476	-0.2189	10	0.87932	D	0	-24.3475	16.1464	0.81575	0.0:0.0:0.0:1.0	.	272;375;375	P58335-2;P58335;P58335-4	.;ANTR2_HUMAN;.	P	375;298;272;375	ENSP00000385575:T375P;ENSP00000384028:T298P;ENSP00000314883:T272P;ENSP00000306185:T375P	ENSP00000306185:T375P	T	-	1	0	ANTXR2	81124112	1.000000	0.71417	0.966000	0.40874	0.553000	0.35397	7.648000	0.83479	2.220000	0.72140	0.383000	0.25322	ACT		0.348	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	
C4orf22	255119	broad.mit.edu	37	4	81504249	81504249	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:81504249C>T	ENST00000358105.3	+	3	294	c.245C>T	c.(244-246)aCg>aTg	p.T82M	C4orf22_ENST00000508675.1_Missense_Mutation_p.T82M|C4orf22_ENST00000512931.1_3'UTR	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	82								p.T82M(1)		NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						TTTTACAGGACGCTAACAAGT	0.378																																					p.T82M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C245T	4						.						69.0	70.0	70.0					4																	81504249		2203	4299	6502	81723273	SO:0001583	missense	255119	exon3			BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.245C>T	4.37:g.81504249C>T	ENSP00000350818:p.Thr82Met		81723273	NM_152770	E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	ENST00000358105.3	37	CCDS3587.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741979	0.30865	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.30981	1.51;1.51	5.55	5.55	0.83447	.	0.292695	0.30311	N	0.009915	T	0.38480	0.1042	M	0.76838	2.35	0.26547	N	0.973975	D;P	0.57571	0.98;0.884	P;P	0.47206	0.472;0.541	T	0.49560	-0.8927	10	0.45353	T	0.12	.	8.2613	0.31786	0.0:0.8397:0.0:0.1603	.	82;82	E7EQ13;Q6V702	.;CD022_HUMAN	M	82	ENSP00000350818:T82M;ENSP00000425786:T82M	ENSP00000350818:T82M	T	+	2	0	C4orf22	81723273	0.847000	0.29606	0.629000	0.29254	0.033000	0.12548	1.353000	0.34045	2.885000	0.99019	0.655000	0.94253	ACG		0.378	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252629.2	NM_152770	
PTPN13	5783	broad.mit.edu	37	4	87672194	87672194	+	Missense_Mutation	SNP	C	C	T	rs529404601		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:87672194C>T	ENST00000411767.2	+	19	3146	c.3083C>T	c.(3082-3084)gCg>gTg	p.A1028V	PTPN13_ENST00000427191.2_Missense_Mutation_p.A1028V|PTPN13_ENST00000316707.6_Intron|PTPN13_ENST00000511467.1_Missense_Mutation_p.A1028V|PTPN13_ENST00000436978.1_Missense_Mutation_p.A1028V			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1028					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.A1028V(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AAGTCTGTTGCGAGTTTAAAT	0.373													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19540	0.0		0.0	False		,,,				2504	0.0				p.A1028V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3083T	4						.						69.0	67.0	68.0					4																	87672194		1838	4087	5925	87891218	SO:0001583	missense	5783	exon19				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.3083C>T	4.37:g.87672194C>T	ENSP00000407249:p.Ala1028Val		87891218	NM_080683	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799946	0.50208	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T	0.54675	0.56;0.64;0.61;0.64	6.01	5.17	0.71159	.	0.123616	0.36200	N	0.002739	T	0.40094	0.1103	L	0.51422	1.61	0.30941	N	0.725865	P;P;P	0.48998	0.863;0.867;0.918	B;B;B	0.34489	0.184;0.131;0.184	T	0.50550	-0.8815	10	0.28530	T	0.3	.	11.0302	0.47767	0.0:0.805:0.128:0.067	.	1028;1028;1028	Q12923-3;Q12923;Q12923-4	.;PTN13_HUMAN;.	V	1028;1028;1028;1028;996	ENSP00000408368:A1028V;ENSP00000394794:A1028V;ENSP00000407249:A1028V;ENSP00000426626:A1028V	ENSP00000349909:A996V	A	+	2	0	PTPN13	87891218	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.035000	0.57297	1.574000	0.49760	-0.127000	0.14921	GCG		0.373	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
KLHL8	57563	broad.mit.edu	37	4	88099711	88099711	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:88099711G>T	ENST00000273963.5	-	5	1355	c.1014C>A	c.(1012-1014)tgC>tgA	p.C338*	KLHL8_ENST00000425278.2_Nonsense_Mutation_p.C155*|KLHL8_ENST00000512111.1_Nonsense_Mutation_p.C338*|KLHL8_ENST00000498875.2_Nonsense_Mutation_p.C262*|KLHL8_ENST00000545252.1_5'UTR	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	338					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.C338*(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TGATAGAATAGCATTCAATAC	0.438																																					p.C338X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1014A	4						.						149.0	135.0	140.0					4																	88099711		2203	4300	6503	88318735	SO:0001587	stop_gained	57563	exon5			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1014C>A	4.37:g.88099711G>T	ENSP00000273963:p.Cys338*		88318735	NM_020803	Q53XA3|Q6N018	Nonsense_Mutation	SNP	ENST00000273963.5	37	CCDS3617.1	.	.	.	.	.	.	.	.	.	.	G	40	8.313069	0.98754	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000512111	.	.	.	5.67	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	11.3137	0.49379	0.1574:0.0:0.8426:0.0	.	.	.	.	X	338;262;155;338	.	ENSP00000273963:C338X	C	-	3	2	KLHL8	88318735	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.173000	0.42472	1.401000	0.46761	0.655000	0.94253	TGC		0.438	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
MEPE	56955	broad.mit.edu	37	4	88766851	88766851	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:88766851A>C	ENST00000424957.3	+	4	904	c.831A>C	c.(829-831)gaA>gaC	p.E277D	MEPE_ENST00000395102.4_Missense_Mutation_p.E308D|MEPE_ENST00000540395.1_Missense_Mutation_p.E164D|MEPE_ENST00000361056.3_Missense_Mutation_p.E277D|MEPE_ENST00000497649.2_Missense_Mutation_p.E253D|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000560249.1_Missense_Mutation_p.E164D	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	277					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.E277D(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		CTGACCTAGAAGGCAAAGATA	0.453																																					p.E164D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A492C	4						.						55.0	55.0	55.0					4																	88766851		2203	4300	6503	88985875	SO:0001583	missense	56955	exon6			AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.831A>C	4.37:g.88766851A>C	ENSP00000416984:p.Glu277Asp		88985875	NM_001184697	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.856839	0.32791	.	.	ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.49720	0.77;0.78;0.77;0.79;0.77	4.48	1.97	0.26223	.	0.408039	0.20900	N	0.083656	T	0.36441	0.0967	L	0.56124	1.755	0.09310	N	1	B	0.18461	0.028	B	0.16289	0.015	T	0.30001	-0.9993	10	0.48119	T	0.1	-10.4072	3.5904	0.07986	0.7027:0.0:0.1046:0.1927	.	277	Q9NQ76	MEPE_HUMAN	D	277;308;253;164;277	ENSP00000416984:E277D;ENSP00000378534:E308D;ENSP00000422747:E253D;ENSP00000443491:E164D;ENSP00000354341:E277D	ENSP00000354341:E277D	E	+	3	2	MEPE	88985875	0.348000	0.24861	0.004000	0.12327	0.197000	0.23852	1.335000	0.33839	0.243000	0.21327	0.459000	0.35465	GAA		0.453	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1		
HERC3	8916	broad.mit.edu	37	4	89591056	89591056	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:89591056T>C	ENST00000402738.1	+	15	1918	c.1679T>C	c.(1678-1680)gTa>gCa	p.V560A	HERC3_ENST00000264345.3_Missense_Mutation_p.V560A|HERC3_ENST00000543130.1_Missense_Mutation_p.V4A	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	560					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.V560A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		ATGAAGCTGGTAAACCTCTAT	0.363																																					p.V560A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1679C	4						.						105.0	107.0	107.0					4																	89591056		2203	4300	6503	89810079	SO:0001583	missense	8916	exon15			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1679T>C	4.37:g.89591056T>C	ENSP00000385684:p.Val560Ala		89810079	NM_014606	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.821850	0.71028	.	.	ENSG00000138641	ENST00000402738;ENST00000264345;ENST00000543130	T;T;T	0.52295	0.67;0.67;1.0	5.08	5.08	0.68730	.	0.062612	0.64402	D	0.000005	T	0.45696	0.1355	L	0.54323	1.7	0.58432	D	0.999999	P	0.35307	0.494	B	0.34138	0.176	T	0.51663	-0.8677	10	0.66056	D	0.02	.	15.313	0.74048	0.0:0.0:0.0:1.0	.	560	Q15034	HERC3_HUMAN	A	560;560;4	ENSP00000385684:V560A;ENSP00000264345:V560A;ENSP00000441703:V4A	ENSP00000264345:V560A	V	+	2	0	HERC3	89810079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.482000	0.81143	2.261000	0.74972	0.533000	0.62120	GTA		0.363	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
SMARCAD1	56916	broad.mit.edu	37	4	95199873	95199873	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:95199873T>A	ENST00000354268.4	+	18	2358	c.2285T>A	c.(2284-2286)aTc>aAc	p.I762N	SMARCAD1_ENST00000509418.1_Missense_Mutation_p.I332N|SMARCAD1_ENST00000457823.2_Missense_Mutation_p.I762N			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	762					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.I762N(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AAAAAATCTATCAATAACTTG	0.353																																					p.I762N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2285A	4						.						60.0	65.0	64.0					4																	95199873		2148	4288	6436	95418896	SO:0001583	missense	56916	exon18			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2285T>A	4.37:g.95199873T>A	ENSP00000346217:p.Ile762Asn		95418896	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.772850	0.31411	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.91	5.91	0.95273	SNF2-related (1);	0.000000	0.50627	D	0.000110	T	0.81758	0.4890	M	0.81942	2.565	0.40501	D	0.980644	P;P	0.44627	0.839;0.806	P;B	0.44422	0.449;0.32	D	0.83383	0.0013	10	0.41790	T	0.15	-14.7376	16.35	0.83199	0.0:0.0:0.0:1.0	.	762;762	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	N	762;762;762;332	ENSP00000351947:I762N;ENSP00000415576:I762N;ENSP00000346217:I762N;ENSP00000423286:I332N	ENSP00000346217:I762N	I	+	2	0	SMARCAD1	95418896	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	2.911000	0.48774	2.270000	0.75569	0.528000	0.53228	ATC		0.353	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
SNX25	83891	broad.mit.edu	37	4	186263256	186263256	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr4:186263256C>T	ENST00000504273.1	+	12	1975	c.1681C>T	c.(1681-1683)Cgg>Tgg	p.R561W	SNX25_ENST00000264694.8_Missense_Mutation_p.R561W|SNX25_ENST00000512853.1_3'UTR			Q9H3E2	SNX25_HUMAN	sorting nexin 25	561	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.R561W(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GAATTTACACCGGAAACTCAG	0.408																																					p.R561W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1681T	4						.						123.0	125.0	124.0					4																	186263256		2203	4300	6503	186500250	SO:0001583	missense	83891	exon12			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1681C>T	4.37:g.186263256C>T	ENSP00000426255:p.Arg561Trp		186500250	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015027	0.75161	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.43294	0.95;0.95	5.36	4.51	0.55191	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.64659	0.2618	M	0.78456	2.415	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;0.981;1.0	T	0.69514	-0.5125	10	0.72032	D	0.01	-17.7528	13.51	0.61506	0.2839:0.7161:0.0:0.0	.	332;94;561	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	W	561;561;94	ENSP00000426255:R561W;ENSP00000264694:R561W	ENSP00000264693:R94W	R	+	1	2	SNX25	186500250	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.396000	0.44468	1.378000	0.46305	0.643000	0.83706	CGG		0.408	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
WDR36	134430	broad.mit.edu	37	5	110448831	110448831	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:110448831C>A	ENST00000513710.2	+	16	1947	c.1943C>A	c.(1942-1944)aCt>aAt	p.T648N	WDR36_ENST00000506538.2_Missense_Mutation_p.T648N			Q8NI36	WDR36_HUMAN	WD repeat domain 36	648					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.T648N(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TCTATTAGGACTTGGGACCTT	0.299																																					p.T648N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1943A	5						.						146.0	146.0	146.0					5																	110448831		2202	4300	6502	110476730	SO:0001583	missense	134430	exon16			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1943C>A	5.37:g.110448831C>A	ENSP00000424628:p.Thr648Asn		110476730	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.792325	0.70452	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.60040	0.22;0.22	5.87	3.86	0.44501	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.282328	0.45606	D	0.000357	T	0.65719	0.2718	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.67635	-0.5620	10	0.87932	D	0	-15.6792	9.0392	0.36307	0.0:0.7323:0.0:0.2677	.	648	Q8NI36	WDR36_HUMAN	N	648	ENSP00000423067:T648N;ENSP00000424628:T648N	ENSP00000423067:T648N	T	+	2	0	WDR36	110476730	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.132000	0.50523	1.488000	0.48433	0.650000	0.86243	ACT		0.299	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
DCP2	167227	broad.mit.edu	37	5	112349152	112349152	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:112349152A>G	ENST00000389063.2	+	11	1432	c.1234A>G	c.(1234-1236)Aat>Gat	p.N412D	DCP2_ENST00000515408.1_Missense_Mutation_p.N377D|DCP2_ENST00000543319.1_Missense_Mutation_p.N201D	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	412					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)	p.N412D(1)		endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		GTTTGACCATAATGCTATAAT	0.443																																					p.N412D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1234G	5						.						191.0	176.0	181.0					5																	112349152		2202	4300	6502	112377051	SO:0001583	missense	167227	exon11			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.1234A>G	5.37:g.112349152A>G	ENSP00000373715:p.Asn412Asp		112377051	NM_152624	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Missense_Mutation	SNP	ENST00000389063.2	37	CCDS34210.1	.	.	.	.	.	.	.	.	.	.	a	10.62	1.400098	0.25291	.	.	ENSG00000172795	ENST00000515408;ENST00000389063;ENST00000543319	T;T	0.38401	1.14;1.14	5.83	3.37	0.38596	.	0.202617	0.52532	N	0.000061	T	0.15782	0.0380	N	0.08118	0	0.30845	N	0.735237	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20207	-1.0282	10	0.09338	T	0.73	.	9.2797	0.37720	0.6874:0.0:0.3126:0.0	.	377;412	Q8IU60-2;Q8IU60	.;DCP2_HUMAN	D	377;412;201	ENSP00000425770:N377D;ENSP00000373715:N412D	ENSP00000373715:N412D	N	+	1	0	DCP2	112377051	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.130000	0.42064	1.003000	0.39130	0.451000	0.29950	AAT		0.443	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370765.3	NM_152624	
ADAMTS19	171019	broad.mit.edu	37	5	128862019	128862019	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:128862019G>T	ENST00000274487.4	+	4	1083	c.938G>T	c.(937-939)aGa>aTa	p.R313I	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	313						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R313K(1)|p.R313I(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GAAAGTGGAAGAGGGAAACGA	0.383																																					p.R313I												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G938T	5						.						84.0	78.0	80.0					5																	128862019		2203	4300	6503	128889918	SO:0001583	missense	171019	exon4			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.938G>T	5.37:g.128862019G>T	ENSP00000274487:p.Arg313Ile		128889918	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239249	0.79800	.	.	ENSG00000145808	ENST00000274487	T	0.69435	-0.4	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000001	T	0.70596	0.3242	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68777	-0.5319	9	.	.	.	.	18.413	0.90558	0.0:0.0:1.0:0.0	.	313	Q8TE59	ATS19_HUMAN	I	313	ENSP00000274487:R313I	.	R	+	2	0	ADAMTS19	128889918	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.094000	0.76944	2.765000	0.95021	0.557000	0.71058	AGA		0.383	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PCDHA4	56144	broad.mit.edu	37	5	140188624	140188624	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:140188624G>A	ENST00000530339.1	+	1	1852	c.1852G>A	c.(1852-1854)Gcg>Acg	p.A618T	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.A618T|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A618T	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	618	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A618T(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACTGGTGGCGCGCGCATCCC	0.677																																					p.A618T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1852A	5						.						83.0	83.0	83.0					5																	140188624		2203	4299	6502	140168808	SO:0001583	missense	56144	exon1			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1852G>A	5.37:g.140188624G>A	ENSP00000435300:p.Ala618Thr		140168808	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	N	0.147	-1.095909	0.01843	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.37752	1.18;1.18;1.18	4.08	-2.7	0.06004	Cadherin (4);Cadherin-like (1);	0.934387	0.08657	N	0.913112	T	0.19406	0.0466	N	0.25485	0.75	0.09310	N	1	B;B;B	0.18166	0.012;0.015;0.026	B;B;B	0.15870	0.008;0.009;0.014	T	0.17137	-1.0379	10	0.38643	T	0.18	.	1.2106	0.01904	0.2755:0.1289:0.3791:0.2166	.	618;618;618	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	618	ENSP00000423470:A618T;ENSP00000349344:A618T;ENSP00000435300:A618T	ENSP00000349344:A618T	A	+	1	0	PCDHA4	140168808	0.033000	0.19621	0.000000	0.03702	0.002000	0.02628	0.000000	0.12993	-1.471000	0.01886	-1.626000	0.00786	GCG		0.677	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PCDHB8	56128	broad.mit.edu	37	5	140558615	140558615	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:140558615G>A	ENST00000239444.2	+	1	1245	c.1000G>A	c.(1000-1002)Gtt>Att	p.V334I	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	334	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V334I(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAAATGCACCGTTCTGATTCA	0.433																																					p.V334I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1000A	5						.						194.0	264.0	240.0					5																	140558615		2203	4300	6503	140538799	SO:0001583	missense	56128	exon1			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1000G>A	5.37:g.140558615G>A	ENSP00000239444:p.Val334Ile		140538799	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	3.782	-0.045407	0.07452	.	.	ENSG00000120322	ENST00000239444	T	0.59906	0.23	4.25	1.33	0.21861	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.51041	0.1651	L	0.53671	1.685	0.09310	N	1	B	0.20780	0.048	B	0.24006	0.05	T	0.43766	-0.9371	9	0.51188	T	0.08	.	8.9355	0.35697	0.1602:0.1251:0.7148:0.0	.	334	Q9UN66	PCDB8_HUMAN	I	334	ENSP00000239444:V334I	ENSP00000239444:V334I	V	+	1	0	PCDHB8	140538799	0.847000	0.29606	0.001000	0.08648	0.221000	0.24807	1.257000	0.32932	-0.323000	0.08602	-1.128000	0.01989	GTT		0.433	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHGA1	56114	broad.mit.edu	37	5	140710513	140710513	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:140710513C>T	ENST00000517417.1	+	1	262	c.262C>T	c.(262-264)Cgc>Tgc	p.R88C	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R88C	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R88C(1)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATCACCGCGCGCAGGATAGA	0.537																																					p.R88C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C262T	5						.						109.0	122.0	117.0					5																	140710513		2203	4300	6503	140690697	SO:0001583	missense	56114	exon1			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.262C>T	5.37:g.140710513C>T	ENSP00000431083:p.Arg88Cys		140690697	NM_031993	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	c	17.05	3.288696	0.59976	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.28255	1.62;1.62	4.37	3.5	0.40072	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.598449	0.14744	N	0.300996	T	0.44726	0.1307	L	0.50333	1.59	0.33399	D	0.577166	P;D	0.57899	0.899;0.981	B;P	0.56788	0.123;0.806	T	0.60627	-0.7226	10	0.87932	D	0	.	14.5302	0.67920	0.0:0.148:0.852:0.0	.	88;88	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	C	88	ENSP00000431083:R88C;ENSP00000367345:R88C	ENSP00000367345:R88C	R	+	1	0	PCDHGA1	140690697	1.000000	0.71417	0.990000	0.47175	0.876000	0.50452	4.896000	0.63222	1.207000	0.43291	-0.128000	0.14901	CGC		0.537	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
PCDHGA2	56113	broad.mit.edu	37	5	140719021	140719021	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:140719021C>T	ENST00000394576.2	+	1	483	c.483C>T	c.(481-483)gaC>gaT	p.D161D	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	161	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D161D(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGATGCAGACGTAGGTGAGA	0.512																																					p.D161D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C483T	5						.						87.0	84.0	85.0					5																	140719021		2203	4300	6503	140699205	SO:0001819	synonymous_variant	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.483C>T	5.37:g.140719021C>T			140699205	NM_032009	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	CCDS47289.1																																																																																				0.512	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
TCERG1	10915	broad.mit.edu	37	5	145838849	145838849	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:145838849T>C	ENST00000296702.5	+	4	879	c.841T>C	c.(841-843)Tct>Cct	p.S281P	TCERG1_ENST00000394421.2_Missense_Mutation_p.S281P	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	281	Thr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.S281P(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACCCCTTCCTCTACCACTTC	0.498																																					p.S281P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T841C	5						.						169.0	158.0	162.0					5																	145838849		2203	4300	6503	145819042	SO:0001583	missense	10915	exon4			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.841T>C	5.37:g.145838849T>C	ENSP00000296702:p.Ser281Pro		145819042	NM_001040006	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738330	0.49045	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.29142	1.58;1.58	5.33	5.33	0.75918	.	0.270340	0.37012	N	0.002289	T	0.44008	0.1273	L	0.39898	1.24	0.36598	D	0.874498	D;D;D	0.57899	0.967;0.981;0.967	D;D;D	0.68621	0.91;0.959;0.91	T	0.41574	-0.9501	10	0.20046	T	0.44	-8.2793	15.266	0.73663	0.0:0.0:0.0:1.0	.	281;281;281	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	P	281	ENSP00000296702:S281P;ENSP00000377943:S281P	ENSP00000296702:S281P	S	+	1	0	TCERG1	145819042	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.338000	0.59316	2.137000	0.66172	0.460000	0.39030	TCT		0.498	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
SYNPO	11346	broad.mit.edu	37	5	150028275	150028275	+	Silent	SNP	G	G	A	rs367801557		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:150028275G>A	ENST00000394243.1	+	3	1544	c.1170G>A	c.(1168-1170)ccG>ccA	p.P390P	SYNPO_ENST00000522122.1_Silent_p.P390P|SYNPO_ENST00000307662.4_Silent_p.P146P|SYNPO_ENST00000518872.1_3'UTR|SYNPO_ENST00000519664.1_Silent_p.P146P	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	390					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)	p.P146P(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCAGGCACCGGCTGAGGAGG	0.567																																					p.P390P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1170A	5						.	G	,,,	1,4405		0,1,2202	136.0	137.0	136.0		438,1170,1170,438	-7.8	0.0	5		136	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SYNPO	NM_001109974.2,NM_001166208.1,NM_001166209.1,NM_007286.5	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	146/686,390/930,390/930,146/904	150028275	1,13005	2203	4300	6503	150008468	SO:0001819	synonymous_variant	11346	exon3			AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1170G>A	5.37:g.150028275G>A			150008468	NM_001166208	A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	ENST00000394243.1	37	CCDS54937.1																																																																																				0.567	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
KIF4B	285643	broad.mit.edu	37	5	154396894	154396894	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:154396894C>T	ENST00000435029.4	+	1	3635	c.3475C>T	c.(3475-3477)Cct>Tct	p.P1159S		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1159	Globular. {ECO:0000250}.|Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.P1159S(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCTTTAACCCTGTCTGTGC	0.527																																					p.P1159S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3475T	5						.						99.0	101.0	101.0					5																	154396894		2203	4300	6503	154377087	SO:0001583	missense	285643	exon1			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.3475C>T	5.37:g.154396894C>T	ENSP00000387875:p.Pro1159Ser		154377087	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	C	6.905	0.536480	0.13188	.	.	ENSG00000226650	ENST00000435029	T	0.60920	0.15	1.48	0.527	0.17084	.	.	.	.	.	T	0.66157	0.2761	M	0.61703	1.905	0.44136	D	0.996928	D	0.89917	1.0	D	0.91635	0.999	T	0.61792	-0.6990	9	0.45353	T	0.12	.	5.462	0.16622	0.0:0.6414:0.3586:0.0	.	1159	Q2VIQ3	KIF4B_HUMAN	S	1159	ENSP00000387875:P1159S	ENSP00000387875:P1159S	P	+	1	0	KIF4B	154377087	0.980000	0.34600	0.419000	0.26584	0.036000	0.12997	2.832000	0.48152	0.172000	0.19760	-0.302000	0.09304	CCT		0.527	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
ITK	3702	broad.mit.edu	37	5	156608025	156608025	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:156608025A>G	ENST00000422843.3	+	1	189	c.37A>G	c.(37-39)Aag>Gag	p.K13E		NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	13	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.K13E(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ACAGCTCATCAAGAAATCCCA	0.443			T	SYK	peripheral T-cell lymphoma																																p.K13E	Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A37G	5						.						101.0	93.0	96.0					5																	156608025		2203	4300	6503	156540603	SO:0001583	missense	3702	exon1			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.37A>G	5.37:g.156608025A>G	ENSP00000398655:p.Lys13Glu		156540603	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.335750	0.81801	.	.	ENSG00000113263	ENST00000422843	D	0.96940	-4.18	5.27	5.27	0.74061	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	M	0.92219	3.285	0.53688	D	0.999974	D	0.69078	0.997	D	0.80764	0.994	D	0.99560	1.0968	10	0.87932	D	0	.	14.0675	0.64839	1.0:0.0:0.0:0.0	.	13	Q08881	ITK_HUMAN	E	13	ENSP00000398655:K13E	ENSP00000398655:K13E	K	+	1	0	ITK	156540603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.943000	0.75934	2.114000	0.64651	0.533000	0.62120	AAG		0.443	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
NIPAL4	348938	broad.mit.edu	37	5	156899705	156899705	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:156899705T>C	ENST00000311946.7	+	6	1254	c.1138T>C	c.(1138-1140)Tac>Cac	p.Y380H	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Missense_Mutation_p.Y361H	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	380						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)	p.Y318H(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CAAGGAGTGGTACAGCATGTC	0.517											OREG0016979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y361H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1081C	5						.						110.0	105.0	107.0					5																	156899705		2134	4237	6371	156832283	SO:0001583	missense	348938	exon5			AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1138T>C	5.37:g.156899705T>C	ENSP00000311687:p.Tyr380His	1782	156832283	NM_001172292	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	37	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	T	8.397	0.840974	0.16891	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.89875	-2.58;-2.58	5.93	-11.8	0.00035	.	1.172390	0.05717	N	0.597039	T	0.75517	0.3860	L	0.36672	1.1	0.24800	N	0.992705	B;B	0.06786	0.001;0.001	B;B	0.10450	0.002;0.005	T	0.54323	-0.8311	10	0.13108	T	0.6	-7.0432	5.0053	0.14284	0.2686:0.4972:0.1319:0.1024	.	361;380	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	H	361;380	ENSP00000406456:Y361H;ENSP00000311687:Y380H	ENSP00000311687:Y380H	Y	+	1	0	NIPAL4	156832283	0.681000	0.27614	0.693000	0.30195	0.554000	0.35429	-0.114000	0.10757	-1.692000	0.01428	-1.272000	0.01410	TAC		0.517	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
GABRB2	2561	broad.mit.edu	37	5	160763657	160763657	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:160763657T>G	ENST00000393959.1	-	6	660	c.661A>C	c.(661-663)Aag>Cag	p.K221Q	GABRB2_ENST00000520240.1_Missense_Mutation_p.K221Q|GABRB2_ENST00000517547.1_Missense_Mutation_p.K61Q|GABRB2_ENST00000517901.1_Missense_Mutation_p.K158Q|GABRB2_ENST00000274547.2_Missense_Mutation_p.K221Q|GABRB2_ENST00000353437.6_Missense_Mutation_p.K221Q			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	221					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.K221Q(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAAACAACCTTCTTGGTGATA	0.348																																					p.K221Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A661C	5						.						93.0	94.0	94.0					5																	160763657		2203	4300	6503	160696235	SO:0001583	missense	2561	exon7				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.661A>C	5.37:g.160763657T>G	ENSP00000377531:p.Lys221Gln		160696235	NM_000813	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004933	0.54254	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28;-1.28	5.23	5.23	0.72850	Neurotransmitter-gated ion-channel ligand-binding (3);	0.382752	0.30252	N	0.010060	T	0.73984	0.3657	L	0.40543	1.245	0.46901	D	0.999242	B;B;B;B	0.27316	0.175;0.0;0.008;0.003	B;B;B;B	0.29440	0.102;0.01;0.016;0.006	T	0.69510	-0.5126	10	0.22109	T	0.4	.	15.1404	0.72607	0.0:0.0:0.0:1.0	.	61;158;221;221	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	Q	221;221;221;221;158;61	ENSP00000377531:K221Q;ENSP00000274547:K221Q;ENSP00000274546:K221Q;ENSP00000429320:K221Q;ENSP00000430532:K158Q;ENSP00000429750:K61Q	ENSP00000274547:K221Q	K	-	1	0	GABRB2	160696235	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.856000	0.86956	1.980000	0.57719	0.533000	0.62120	AAG		0.348	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
TENM2	57451	broad.mit.edu	37	5	167553787	167553787	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:167553787C>T	ENST00000518659.1	+	12	2277	c.2238C>T	c.(2236-2238)caC>caT	p.H746H	TENM2_ENST00000545108.1_Silent_p.H746H|TENM2_ENST00000520394.1_Silent_p.H514H|TENM2_ENST00000519204.1_Silent_p.H625H|TENM2_ENST00000403607.2_Silent_p.H579H|CTB-178M22.1_ENST00000517408.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	746	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.H579H(1)									GTGGCACTCACGGCGTCTGCA	0.597																																					p.H746H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2238T	5						.						38.0	43.0	41.0					5																	167553787		2034	4173	6207	167486365	SO:0001819	synonymous_variant	57451	exon12			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2238C>T	5.37:g.167553787C>T			167486365	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																					0.597	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
SPDL1	54908	broad.mit.edu	37	5	169026014	169026014	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:169026014A>G	ENST00000265295.4	+	10	1454	c.1175A>G	c.(1174-1176)cAg>cGg	p.Q392R		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.Q392R(1)									TTGTCCATACAGCGAATGAAA	0.358																																					p.Q392R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1175G	5						.						69.0	71.0	70.0					5																	169026014		2203	4300	6503	168958592	SO:0001583	missense	54908	exon10			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1175A>G	5.37:g.169026014A>G	ENSP00000265295:p.Gln392Arg		168958592	NM_017785		Missense_Mutation	SNP	ENST00000265295.4	37	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.569780	0.86439	.	.	ENSG00000040275	ENST00000265295;ENST00000274631	T	0.36157	1.27	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	M	0.70275	2.135	0.41617	D	0.988945	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.80764	0.994;0.975;0.975	T	0.57802	-0.7748	10	0.34782	T	0.22	-18.0031	16.4277	0.83824	1.0:0.0:0.0:0.0	.	314;293;392	B4E393;Q96EA4-2;Q96EA4	.;.;SPDLY_HUMAN	R	392;293	ENSP00000265295:Q392R	ENSP00000265295:Q392R	Q	+	2	0	CCDC99	168958592	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.881000	0.69706	2.279000	0.76181	0.533000	0.62120	CAG		0.358	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
THOC3	84321	broad.mit.edu	37	5	175387087	175387087	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:175387087G>A	ENST00000265097.4	-	6	1031	c.941C>T	c.(940-942)gCg>gTg	p.A314V	RP11-91H12.4_ENST00000502813.1_RNA|THOC3_ENST00000514861.1_Missense_Mutation_p.A129V|THOC3_ENST00000510300.1_5'Flank	NM_032361.2	NP_115737.1	Q96J01	THOC3_HUMAN	THO complex 3	314					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.A314V(1)		endometrium(1)|kidney(1)|large_intestine(2)	4	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GGGGTGCCACGCCACTGTGAA	0.502																																					p.A314V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C941T	5						.						70.0	72.0	71.0					5																	175387087		2203	4299	6502	175319693	SO:0001583	missense	84321	exon6			BC006849	CCDS4397.1	5q35.3	2013-02-11			ENSG00000051596	ENSG00000051596		"""WD repeat domain containing"", ""THO complex subunits"""	19072	protein-coding gene	gene with protein product		606929				11979277	Standard	NM_032361		Approved	TEX1, MGC5469	uc003mdg.5	Q96J01	OTTHUMG00000130658	ENST00000265097.4:c.941C>T	5.37:g.175387087G>A	ENSP00000265097:p.Ala314Val		175319693	NM_032361	Q6NZ53	Missense_Mutation	SNP	ENST00000265097.4	37	CCDS4397.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534674	0.64972	.	.	ENSG00000051596	ENST00000265097;ENST00000514861	T;D	0.83163	4.77;-1.69	5.13	5.13	0.70059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	M	0.89968	3.075	0.80722	D	1	D	0.69078	0.997	P	0.56474	0.799	D	0.91793	0.5445	10	0.44086	T	0.13	-3.1398	17.5687	0.87928	0.0:0.0:1.0:0.0	.	314	Q96J01	THOC3_HUMAN	V	314;129	ENSP00000265097:A314V;ENSP00000425039:A129V	ENSP00000265097:A314V	A	-	2	0	THOC3	175319693	1.000000	0.71417	0.971000	0.41717	0.535000	0.34838	9.806000	0.99153	2.380000	0.81148	0.609000	0.83330	GCG		0.502	THOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253148.1		
UIMC1	51720	broad.mit.edu	37	5	176397750	176397750	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:176397750C>A	ENST00000377227.4	-	4	482	c.350G>T	c.(349-351)aGc>aTc	p.S117I	UIMC1_ENST00000377219.2_Missense_Mutation_p.S117I|UIMC1_ENST00000511320.1_Missense_Mutation_p.S117I|UIMC1_ENST00000503273.1_5'Flank|UIMC1_ENST00000506128.1_Missense_Mutation_p.S117I			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	117	Necessary for interaction with NR6A1 N- terminus.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.S117I(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACATTCAGGCTTTCAGCAAT	0.443																																					p.S117I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G350T	5						.						171.0	176.0	174.0					5																	176397750		2203	4300	6503	176330356	SO:0001583	missense	51720	exon4			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.350G>T	5.37:g.176397750C>A	ENSP00000366434:p.Ser117Ile		176330356	NM_001199298	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	CCDS4408.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815191	0.90790	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000506128;ENST00000377220;ENST00000509236	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.65	5.65	0.86999	Ubiquitin interacting motif (1);	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.63843	1.955	0.58432	D	0.999998	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.998	T	0.56751	-0.7927	10	0.87932	D	0	-9.2184	19.718	0.96131	0.0:1.0:0.0:0.0	.	117;117;117	Q96RL1-5;Q96RL1;D6RCF3	.;UIMC1_HUMAN;.	I	117;117;117;117;39;117	ENSP00000366434:S117I;ENSP00000366425:S117I;ENSP00000421926:S117I;ENSP00000427480:S117I;ENSP00000423885:S117I	ENSP00000366425:S117I	S	-	2	0	UIMC1	176330356	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.220000	0.72237	2.669000	0.90835	0.561000	0.74099	AGC		0.443	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290	
C5orf42	65250	broad.mit.edu	37	5	37196023	37196023	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:37196023C>T	ENST00000508244.1	-	20	3841	c.3748G>A	c.(3748-3750)Gca>Aca	p.A1250T	C5orf42_ENST00000425232.2_Missense_Mutation_p.A1250T|C5orf42_ENST00000274258.7_Missense_Mutation_p.A131T			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1250						integral component of membrane (GO:0016021)		p.A131T(1)|p.A1250T(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTAAAAAATGCGATACCTCCT	0.383																																					p.A1250T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3748A	5						.						107.0	103.0	105.0					5																	37196023		2203	4300	6503	37231780	SO:0001583	missense	65250	exon21				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3748G>A	5.37:g.37196023C>T	ENSP00000421690:p.Ala1250Thr		37231780	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	6.122	0.390827	0.11581	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.25414	1.85;1.85;1.8;1.81	5.21	0.283	0.15696	.	1.862560	0.02967	N	0.143909	T	0.13586	0.0329	N	0.12182	0.205	0.09310	N	1	B;B	0.22541	0.021;0.071	B;B	0.15870	0.014;0.014	T	0.15178	-1.0446	10	0.24483	T	0.36	.	3.554	0.07857	0.2388:0.5158:0.1154:0.13	.	1250;131	E9PH94;Q9H799	.;CE042_HUMAN	T	1250;1250;131;298;131	ENSP00000421690:A1250T;ENSP00000389014:A1250T;ENSP00000274258:A131T;ENSP00000424223:A298T	ENSP00000274258:A131T	A	-	1	0	C5orf42	37231780	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.381000	0.20619	-0.176000	0.10707	-0.755000	0.03482	GCA		0.383	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
DAB2	1601	broad.mit.edu	37	5	39383080	39383080	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:39383080C>T	ENST00000320816.6	-	10	1448	c.981G>A	c.(979-981)tcG>tcA	p.S327S	DAB2_ENST00000545653.1_Silent_p.S306S|DAB2_ENST00000509337.1_Silent_p.S306S|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000512525.1_5'Flank	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	327	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.S327S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GCGGAGTAGACGAGCTACTCG	0.478																																					p.S327S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G981A	5						.						100.0	104.0	103.0					5																	39383080		2203	4300	6503	39418837	SO:0001819	synonymous_variant	1601	exon10			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.981G>A	5.37:g.39383080C>T			39418837	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																				0.478	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
CARD6	84674	broad.mit.edu	37	5	40852608	40852608	+	Missense_Mutation	SNP	C	C	T	rs183932779	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:40852608C>T	ENST00000254691.5	+	3	1373	c.1174C>T	c.(1174-1176)Cgc>Tgc	p.R392C	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	392					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)			p.R392C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CTCTTTGCAACGCCAAGTCAT	0.468													C|||	2	0.000399361	0.0008	0.0	5008	,	,		22287	0.0		0.001	False		,,,				2504	0.0				p.R392C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1174T	5						.	C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	80.0	76.0	78.0		1174	1.6	0.0	5		78	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CARD6	NM_032587.3	180	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	392/1038	40852608	3,13003	2203	4300	6503	40888365	SO:0001583	missense	84674	exon3			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.1174C>T	5.37:g.40852608C>T	ENSP00000254691:p.Arg392Cys		40888365	NM_032587	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	C	6.447	0.450680	0.12223	4.54E-4	1.16E-4	ENSG00000132357	ENST00000254691;ENST00000509771	T	0.43688	0.94	5.26	1.57	0.23409	.	0.889296	0.09785	N	0.756141	T	0.38772	0.1053	L	0.60455	1.87	0.31919	N	0.613631	B	0.22541	0.071	B	0.14578	0.011	T	0.43410	-0.9393	10	0.87932	D	0	0.1103	8.647	0.34011	0.0:0.6806:0.0:0.3194	.	392	Q9BX69	CARD6_HUMAN	C	392	ENSP00000254691:R392C	ENSP00000254691:R392C	R	+	1	0	CARD6	40888365	0.486000	0.25980	0.005000	0.12908	0.204000	0.24138	0.995000	0.29706	0.108000	0.17862	0.650000	0.86243	CGC		0.468	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
MAST4	375449	broad.mit.edu	37	5	66427757	66427757	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:66427757C>T	ENST00000403625.2	+	16	2366	c.2071C>T	c.(2071-2073)Cac>Tac	p.H691Y	MAST4_ENST00000403666.1_Missense_Mutation_p.H502Y|MAST4_ENST00000261569.7_Missense_Mutation_p.H497Y|MAST4_ENST00000405643.1_Missense_Mutation_p.H512Y|MAST4_ENST00000404260.3_Missense_Mutation_p.H694Y	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	694	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.H694Y(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TGGAATTGTACACAGGGATTT	0.343																																					p.H502Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1504T	5						.						143.0	143.0	143.0					5																	66427757		1852	4104	5956	66463513	SO:0001583	missense	375449	exon15			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2071C>T	5.37:g.66427757C>T	ENSP00000385727:p.His691Tyr		66463513	NM_015183	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017809	0.93404	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02	6.07	6.07	0.98685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	L	0.42581	1.335	0.80722	D	1	P;D;D;P	0.76494	0.932;0.998;0.999;0.895	D;D;D;P	0.76575	0.944;0.988;0.986;0.83	T	0.75502	-0.3295	10	0.87932	D	0	-22.3197	20.6593	0.99626	0.0:1.0:0.0:0.0	.	512;694;497;502	E7EWQ5;O15021;O15021-2;O15021-3	.;MAST4_HUMAN;.;.	Y	694;691;502;512;512;497;497	ENSP00000385048:H694Y;ENSP00000385727:H691Y;ENSP00000384313:H502Y;ENSP00000384099:H512Y;ENSP00000261569:H497Y	ENSP00000261569:H497Y	H	+	1	0	MAST4	66463513	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CAC		0.343	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
CMYA5	202333	broad.mit.edu	37	5	79025547	79025547	+	Missense_Mutation	SNP	A	A	G	rs371803314		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:79025547A>G	ENST00000446378.2	+	2	990	c.959A>G	c.(958-960)cAt>cGt	p.H320R		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	320					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.H320R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATGTTCAGTCATGAAGATCAA	0.428																																					p.H320R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A959G	5						.						72.0	68.0	69.0					5																	79025547		1923	4123	6046	79061303	SO:0001583	missense	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.959A>G	5.37:g.79025547A>G	ENSP00000394770:p.His320Arg		79061303	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.926557	0.00493	.	.	ENSG00000164309	ENST00000446378	T	0.37752	1.18	5.79	-3.09	0.05331	.	2.723080	0.01086	N	0.005091	T	0.20618	0.0496	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04767	-1.0928	10	0.15952	T	0.53	.	1.1713	0.01826	0.3125:0.3216:0.2141:0.1518	.	320	Q8N3K9	CMYA5_HUMAN	R	320	ENSP00000394770:H320R	ENSP00000394770:H320R	H	+	2	0	CMYA5	79061303	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.346000	0.07760	-0.794000	0.04468	-0.264000	0.10439	CAT		0.428	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
LNPEP	4012	broad.mit.edu	37	5	96315041	96315041	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:96315041A>G	ENST00000231368.5	+	2	911	c.219A>G	c.(217-219)tcA>tcG	p.S73S	LNPEP_ENST00000395770.3_Silent_p.S59S	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	73					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S73S(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		ATGAGTCATCAGCAAAGCTGC	0.547																																					p.S73S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A219G	5						.						75.0	80.0	79.0					5																	96315041		2203	4300	6503	96340797	SO:0001819	synonymous_variant	4012	exon2			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.219A>G	5.37:g.96315041A>G			96340797	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Silent	SNP	ENST00000231368.5	37	CCDS4087.1																																																																																				0.547	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
TRIM41	90933	broad.mit.edu	37	5	180651682	180651682	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr5:180651682C>A	ENST00000315073.5	+	1	1393	c.683C>A	c.(682-684)cCc>cAc	p.P228H	MIR4638_ENST00000581158.1_RNA|CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Missense_Mutation_p.P228H	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	228					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P228H(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCATCTGTCCCAAACACCAA	0.597																																					p.P228H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C683A	5						.						60.0	52.0	55.0					5																	180651682		2203	4300	6503	180584288	SO:0001583	missense	90933	exon1			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.683C>A	5.37:g.180651682C>A	ENSP00000320869:p.Pro228His		180584288	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245747	0.59103	.	.	ENSG00000146063	ENST00000351937;ENST00000315073;ENST00000421508	T;T	0.47869	0.83;0.83	5.08	5.08	0.68730	Zinc finger, B-box (3);	0.284156	0.26016	N	0.026847	T	0.61949	0.2388	L	0.45051	1.395	0.47037	D	0.999293	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.968;0.999;0.999	T	0.64309	-0.6438	10	0.66056	D	0.02	.	15.9814	0.80114	0.0:1.0:0.0:0.0	.	228;228;228	Q8WV44;Q8WV44-2;Q8WV44-4	TRI41_HUMAN;.;.	H	228;228;107	ENSP00000336749:P228H;ENSP00000320869:P228H	ENSP00000320869:P228H	P	+	2	0	TRIM41	180584288	0.003000	0.15002	1.000000	0.80357	0.965000	0.64279	1.267000	0.33050	2.345000	0.79718	0.491000	0.48974	CCC		0.597	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
SIM1	6492	broad.mit.edu	37	6	100838861	100838861	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:100838861A>G	ENST00000369208.3	-	12	2459	c.1677T>C	c.(1675-1677)caT>caC	p.H559H	SIM1_ENST00000262901.4_Silent_p.H559H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	559	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.H559H(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGCTGGGTTCATGTGGGCTAC	0.463																																					p.H559H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1677C	6						.						97.0	100.0	99.0					6																	100838861		2203	4300	6503	100945582	SO:0001819	synonymous_variant	6492	exon11			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1677T>C	6.37:g.100838861A>G			100945582	NM_005068	Q5TDP7	Silent	SNP	ENST00000369208.3	37	CCDS5045.1																																																																																				0.463	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068	
CDC40	51362	broad.mit.edu	37	6	110539001	110539001	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:110539001A>C	ENST00000368932.1	+	11	1186	c.1085A>C	c.(1084-1086)gAg>gCg	p.E362A	CDC40_ENST00000307731.1_Missense_Mutation_p.E362A|CDC40_ENST00000368930.1_Missense_Mutation_p.E362A			O60508	PRP17_HUMAN	cell division cycle 40	362					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.E362A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TGGGACACTGAGACAGGTAAG	0.408																																					p.E362A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1085C	6						.						108.0	92.0	98.0					6																	110539001		2203	4300	6503	110645694	SO:0001583	missense	51362	exon10			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1085A>C	6.37:g.110539001A>C	ENSP00000357928:p.Glu362Ala		110645694	NM_015891	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801870	0.90538	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84588	0.5505	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.84274	0.0490	10	0.41790	T	0.15	-12.1062	16.5582	0.84512	1.0:0.0:0.0:0.0	.	362	O60508	PRP17_HUMAN	A	362	ENSP00000357928:E362A;ENSP00000357929:E362A;ENSP00000357926:E362A;ENSP00000304370:E362A	ENSP00000304370:E362A	E	+	2	0	CDC40	110645694	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.932000	0.92897	2.308000	0.77769	0.533000	0.62120	GAG		0.408	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
FYN	2534	broad.mit.edu	37	6	111995735	111995735	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:111995735C>T	ENST00000354650.3	-	13	1978	c.1372G>A	c.(1372-1374)Gag>Aag	p.E458K	FYN_ENST00000368678.4_Missense_Mutation_p.E455K|FYN_ENST00000356013.2_Missense_Mutation_p.E403K|FYN_ENST00000368667.2_Missense_Mutation_p.E458K|FYN_ENST00000229471.4_Missense_Mutation_p.E403K|FYN_ENST00000368682.3_Missense_Mutation_p.E455K|FYN_ENST00000538466.1_Missense_Mutation_p.E455K|FYN_ENST00000229470.5_Missense_Mutation_p.E406K	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	458	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.E458K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	GTGACCAGCTCTGTGAGTAAG	0.527																																					p.E458K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372A	6						.						171.0	169.0	170.0					6																	111995735		2203	4300	6503	112102428	SO:0001583	missense	2534	exon13			AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.1372G>A	6.37:g.111995735C>T	ENSP00000346671:p.Glu458Lys		112102428	NM_002037	B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Missense_Mutation	SNP	ENST00000354650.3	37	CCDS5094.1	.	.	.	.	.	.	.	.	.	.	C	36	5.875866	0.97055	.	.	ENSG00000010810	ENST00000368682;ENST00000354650;ENST00000229471;ENST00000368667;ENST00000368678;ENST00000229470;ENST00000356013;ENST00000538466;ENST00000544792	D;D;D;D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46	5.67	5.67	0.87782	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98362	0.9456	H	0.96142	3.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99167	1.0863	10	0.87932	D	0	.	19.7691	0.96356	0.0:1.0:0.0:0.0	.	458;403;455	P06241;P06241-3;E1P556	FYN_HUMAN;.;.	K	455;458;403;458;455;406;403;455;406	ENSP00000357671:E455K;ENSP00000346671:E458K;ENSP00000229471:E403K;ENSP00000357656:E458K;ENSP00000357667:E455K;ENSP00000229470:E406K;ENSP00000348295:E403K;ENSP00000440646:E455K	ENSP00000229470:E406K	E	-	1	0	FYN	112102428	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.731000	0.84895	2.689000	0.91719	0.462000	0.41574	GAG		0.527	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043655.1		
EPB41L2	2037	broad.mit.edu	37	6	131220647	131220647	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:131220647T>C	ENST00000337057.3	-	8	1401	c.1220A>G	c.(1219-1221)gAc>gGc	p.D407G	EPB41L2_ENST00000368128.2_Missense_Mutation_p.D407G|EPB41L2_ENST00000527411.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000530148.1_5'UTR|EPB41L2_ENST00000527659.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000530481.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000529208.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000445890.2_Missense_Mutation_p.D407G|EPB41L2_ENST00000525271.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000528282.1_Missense_Mutation_p.D407G|EPB41L2_ENST00000392427.3_Missense_Mutation_p.D407G|EPB41L2_ENST00000525193.1_Missense_Mutation_p.D407G	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	407	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)	p.D407G(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		ATGATGTAGGTCAACACCATA	0.438																																					p.D407G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1220G	6						.						160.0	138.0	145.0					6																	131220647		2203	4300	6503	131262340	SO:0001583	missense	2037	exon8			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1220A>G	6.37:g.131220647T>C	ENSP00000338481:p.Asp407Gly		131262340	NM_001135555	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711536	0.89112	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.31	5.31	0.75309	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.92391	0.7585	M	0.93678	3.445	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	D	0.94343	0.7572	10	0.87932	D	0	.	15.5617	0.76253	0.0:0.0:0.0:1.0	.	407;407;407;407;407	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	G	407	ENSP00000434308:D407G;ENSP00000434576:D407G;ENSP00000402041:D407G;ENSP00000338481:D407G;ENSP00000376222:D407G;ENSP00000357110:D407G;ENSP00000436348:D407G;ENSP00000432803:D407G;ENSP00000431988:D407G;ENSP00000431647:D407G;ENSP00000436641:D407G	ENSP00000338481:D407G	D	-	2	0	EPB41L2	131262340	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.147000	0.66899	0.533000	0.62120	GAC		0.438	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
ECT2L	345930	broad.mit.edu	37	6	139135716	139135716	+	Nonsense_Mutation	SNP	T	T	A	rs577253266	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:139135716T>A	ENST00000423192.1	+	3	316	c.155T>A	c.(154-156)tTa>tAa	p.L52*	ECT2L_ENST00000541398.1_5'UTR|ECT2L_ENST00000367682.2_Nonsense_Mutation_p.L52*			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	52							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L52*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						GCAATTTTTTTAAGATGCACT	0.318			"""N, Splice, Mis"""		ETP ALL																																p.L52X			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T155A	6						.						74.0	71.0	72.0					6																	139135716		1811	4074	5885	139177409	SO:0001587	stop_gained	345930	exon4				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.155T>A	6.37:g.139135716T>A	ENSP00000387388:p.Leu52*		139177409	NM_001077706	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Nonsense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	T	36	5.964098	0.97151	.	.	ENSG00000203734	ENST00000423192;ENST00000401414;ENST00000367682	.	.	.	5.43	-0.406	0.12389	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999978	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	4.7751	0.13175	0.1462:0.2892:0.0:0.5646	.	.	.	.	X	52	.	ENSP00000356655:L52X	L	+	2	0	ECT2L	139177409	0.970000	0.33590	0.844000	0.33320	0.879000	0.50718	0.737000	0.26144	0.071000	0.16664	0.533000	0.62120	TTA		0.318	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
GRM1	2911	broad.mit.edu	37	6	146351085	146351085	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:146351085C>T	ENST00000282753.1	+	1	667	c.432C>T	c.(430-432)ggC>ggT	p.G144G	GRM1_ENST00000507907.1_Silent_p.G144G|GRM1_ENST00000492807.2_Silent_p.G144G|GRM1_ENST00000355289.4_Silent_p.G144G|GRM1_ENST00000392299.2_Silent_p.G144G|GRM1_ENST00000361719.2_Silent_p.G144G			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	144					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.G144G(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TGCCTGACGGCCAGTCCCTCC	0.562																																					p.G144G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C432T	6						.						69.0	71.0	71.0					6																	146351085		2203	4300	6503	146392778	SO:0001819	synonymous_variant	2911	exon2			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.432C>T	6.37:g.146351085C>T			146392778	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																				0.562	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
MTHFD1L	25902	broad.mit.edu	37	6	151270242	151270242	+	Missense_Mutation	SNP	G	G	A	rs139147258	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:151270242G>A	ENST00000367321.3	+	16	1973	c.1699G>A	c.(1699-1701)Gac>Aac	p.D567N		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	567	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.D567N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCTCGACATCGACCCATCTAC	0.507													G|||	4	0.000798722	0.0008	0.0043	5008	,	,		16685	0.0		0.0	False		,,,				2504	0.0				p.D567N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1699A	6						.	G	ASN/ASP,ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	86.0	77.0	80.0		1702,1504,1699	5.0	1.0	6	dbSNP_134	80	0,8600		0,0,4300	no	missense,missense,missense	MTHFD1L	NM_001242767.1,NM_001242768.1,NM_015440.4	23,23,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	568/980,502/914,567/979	151270242	1,13005	2203	4300	6503	151311935	SO:0001583	missense	25902	exon16			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1699G>A	6.37:g.151270242G>A	ENSP00000356290:p.Asp567Asn		151311935	NM_015440	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	12.22	1.872661	0.33069	2.27E-4	0.0	ENSG00000120254	ENST00000367321	T	0.32272	1.46	5.9	5.02	0.67125	.	0.045428	0.85682	N	0.000000	T	0.41213	0.1149	M	0.89353	3.025	0.80722	D	1	P;P;P	0.51933	0.948;0.949;0.749	P;P;B	0.48677	0.46;0.586;0.186	T	0.56232	-0.8013	10	0.62326	D	0.03	.	17.9513	0.89053	0.0641:0.0:0.9359:0.0	.	568;322;567	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	N	567	ENSP00000356290:D567N	ENSP00000356290:D567N	D	+	1	0	MTHFD1L	151311935	1.000000	0.71417	0.959000	0.39883	0.022000	0.10575	6.454000	0.73493	0.846000	0.35142	-0.921000	0.02739	GAC		0.507	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
TMEM181	57583	broad.mit.edu	37	6	158994509	158994509	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:158994509C>T	ENST00000367090.3	+	2	488	c.477C>T	c.(475-477)gtC>gtT	p.V159V		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	159					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)	p.V159V(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TCGTGTTTGTCGTCTTCTTCA	0.582																																					p.V159V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C477T	6						.						104.0	101.0	102.0					6																	158994509		2115	4229	6344	158914497	SO:0001819	synonymous_variant	57583	exon2			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.477C>T	6.37:g.158994509C>T			158914497	NM_020823	Q5VTU1	Silent	SNP	ENST00000367090.3	37	CCDS43520.1																																																																																				0.582	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
SOD2	6648	broad.mit.edu	37	6	160106000	160106000	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:160106000C>T	ENST00000546087.1	-	6	2098	c.271G>A	c.(271-273)Gct>Act	p.A91T	SOD2_ENST00000538183.2_Missense_Mutation_p.A137T|SOD2_ENST00000337404.4_Missense_Mutation_p.A98T|SOD2_ENST00000367055.4_Missense_Mutation_p.A137T|SOD2_ENST00000367054.2_Missense_Mutation_p.A98T|SOD2_ENST00000444946.2_Intron			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial	137					age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)	p.A137T(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		ACAGATGCAGCCGTCAGCTTC	0.453																																					p.A98T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292A	6						.						124.0	112.0	116.0					6																	160106000		2203	4300	6503	160025990	SO:0001583	missense	6648	exon3			M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000546087.1:c.271G>A	6.37:g.160106000C>T	ENSP00000442920:p.Ala91Thr		160025990	NM_001024466	B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	Missense_Mutation	SNP	ENST00000546087.1	37		.	.	.	.	.	.	.	.	.	.	C	13.08	2.129560	0.37630	.	.	ENSG00000112096	ENST00000367055;ENST00000538183;ENST00000367054;ENST00000546087;ENST00000337404;ENST00000545162;ENST00000535561;ENST00000537657;ENST00000401980	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.5	3.61	0.41365	Manganese/iron superoxide dismutase, C-terminal (2);	0.206616	0.51477	N	0.000094	T	0.17450	0.0419	L	0.48260	1.515	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.14578	0.004;0.011;0.003	T	0.04333	-1.0959	10	0.33141	T	0.24	-0.5325	8.4784	0.33027	0.0:0.6931:0.0:0.3069	.	133;98;137	Q7Z7M4;B4DL20;P04179	.;.;SODM_HUMAN	T	137;137;98;91;98;160;160;91;52	ENSP00000356022:A137T;ENSP00000446252:A137T;ENSP00000356021:A98T;ENSP00000442920:A91T;ENSP00000337127:A98T;ENSP00000441362:A160T;ENSP00000445015:A160T;ENSP00000439191:A91T;ENSP00000384196:A52T	ENSP00000337127:A98T	A	-	1	0	SOD2	160025990	0.101000	0.21875	0.061000	0.19648	0.877000	0.50540	0.636000	0.24644	0.711000	0.32018	0.650000	0.86243	GCT		0.453	SOD2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000399943.1	NM_000636	
MAP3K4	4216	broad.mit.edu	37	6	161532985	161532985	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:161532985C>T	ENST00000392142.4	+	24	4662	c.4514C>T	c.(4513-4515)aCa>aTa	p.T1505I	MAP3K4_ENST00000348824.7_Missense_Mutation_p.T1451I|MAP3K4_ENST00000366920.2_Missense_Mutation_p.T1501I|MAP3K4_ENST00000366919.2_Missense_Mutation_p.T1455I	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1505	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.T1504I(1)|p.T1505I(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		ACCCTGGGGACAGCAGGTAGG	0.498																																					p.T1455I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4364T	6						.						149.0	143.0	145.0					6																	161532985		2203	4300	6503	161452975	SO:0001583	missense	4216	exon23			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.4514C>T	6.37:g.161532985C>T	ENSP00000375986:p.Thr1505Ile		161452975	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849760	0.71603	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	H	0.95470	3.675	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.83890	0.0284	10	0.87932	D	0	-26.411	19.2215	0.93799	0.0:1.0:0.0:0.0	.	1501;441;1455;1505	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	I	1455;1505;1455;1501;1451	ENSP00000355886:T1455I;ENSP00000375986:T1505I;ENSP00000355887:T1501I;ENSP00000297332:T1451I	ENSP00000297332:T1451I	T	+	2	0	MAP3K4	161452975	1.000000	0.71417	0.997000	0.53966	0.278000	0.26855	7.720000	0.84759	2.603000	0.88011	0.655000	0.94253	ACA		0.498	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
RIPK1	8737	broad.mit.edu	37	6	3111145	3111145	+	Missense_Mutation	SNP	C	C	T	rs367576973		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:3111145C>T	ENST00000259808.4	+	10	1983	c.1685C>T	c.(1684-1686)aCg>aTg	p.T562M	RIPK1_ENST00000380409.2_Missense_Mutation_p.T562M|RIPK1_ENST00000541791.1_Missense_Mutation_p.T516M			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	562	Interaction with SQSTM1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.T562M(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				AGCACAAATACGAACTTCAAA	0.403																																					p.T562M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1685T	6						.	C	MET/THR	0,4406		0,0,2203	125.0	120.0	121.0		1685	-9.6	0.0	6		121	4,8596	3.7+/-12.6	0,4,4296	no	missense	RIPK1	NM_003804.3	81	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign	562/672	3111145	4,13002	2203	4300	6503	3056144	SO:0001583	missense	8737	exon9			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1685C>T	6.37:g.3111145C>T	ENSP00000259808:p.Thr562Met		3056144	NM_003804	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	ENST00000259808.4	37	CCDS4482.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885955	0.33348	0.0	4.65E-4	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409;ENST00000453483	T;T;T	0.78003	-1.14;-0.59;-1.14	5.45	-9.56	0.00566	.	1.468830	0.03884	N	0.277515	T	0.27559	0.0677	N	0.04959	-0.14	0.09310	N	1	B;B	0.20550	0.032;0.046	B;B	0.13407	0.006;0.009	T	0.26430	-1.0103	10	0.48119	T	0.1	0.013	4.321	0.11016	0.0925:0.4375:0.0922:0.3779	.	516;562	Q13546-2;Q13546	.;RIPK1_HUMAN	M	562;516;562;164	ENSP00000259808:T562M;ENSP00000442294:T516M;ENSP00000369773:T562M	ENSP00000259808:T562M	T	+	2	0	RIPK1	3056144	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-1.051000	0.03507	-1.690000	0.01432	-0.436000	0.05848	ACG		0.403	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2	NM_003804	
TXNDC5	81567	broad.mit.edu	37	6	7891941	7891941	+	Silent	SNP	C	C	T	rs145727157		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:7891941C>T	ENST00000379757.4	-	5	682	c.645G>A	c.(643-645)ccG>ccA	p.P215P	TXNDC5_ENST00000473453.1_Silent_p.P107P|BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR|TXNDC5_ENST00000539054.1_Silent_p.P143P	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	215	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)	p.P215P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					GACCACACCACGGAGCGAAGA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		18177	0.0		0.001	False		,,,				2504	0.0				p.P215P	Ovarian(119;1430 1625 3928 26125 34589)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G645A	6						.	C	,	0,4406		0,0,2203	67.0	64.0	65.0		321,645	-10.5	0.4	6	dbSNP_134	65	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous	TXNDC5	NM_001145549.2,NM_030810.3	,	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	,	107/325,215/433	7891941	4,13002	2203	4300	6503	7836940	SO:0001819	synonymous_variant	81567	exon5			AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.645G>A	6.37:g.7891941C>T			7836940	NM_030810	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Silent	SNP	ENST00000379757.4	37	CCDS4505.1																																																																																				0.532	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1	NM_030810	
HIST1H3E	8353	broad.mit.edu	37	6	26225715	26225715	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:26225715C>T	ENST00000360408.1	+	1	333	c.333C>T	c.(331-333)tgC>tgT	p.C111C		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	111					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.C111C(1)		endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				CCAACCTGTGCGCTATTCATG	0.567											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C111C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C333T	6						.						96.0	96.0	96.0					6																	26225715		2203	4300	6503	26333694	SO:0001819	synonymous_variant	8353	exon1			M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.333C>T	6.37:g.26225715C>T		785	26333694	NM_003532	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000360408.1	37	CCDS4596.1																																																																																				0.567	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040097.1	NM_003532	
ABCF1	23	broad.mit.edu	37	6	30557493	30557493	+	Missense_Mutation	SNP	G	G	A	rs576617500		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:30557493G>A	ENST00000326195.8	+	21	2172	c.2060G>A	c.(2059-2061)cGg>cAg	p.R687Q	ABCF1_ENST00000396515.4_Intron|ABCF1_ENST00000376545.3_Missense_Mutation_p.R649Q	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	687	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.R687Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						AAGAACCACCGGCTGGTAAGT	0.473																																					p.R687Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2060A	6						.						114.0	110.0	111.0					6																	30557493		2203	4300	6503	30665472	SO:0001583	missense	23	exon21			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2060G>A	6.37:g.30557493G>A	ENSP00000313603:p.Arg687Gln		30665472	NM_001025091	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	g	35	5.521714	0.96416	.	.	ENSG00000204574	ENST00000326195;ENST00000376545	D;D	0.94613	-3.47;-3.47	5.94	5.94	0.96194	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.92825	0.7718	L	0.52905	1.665	0.80722	D	1	P;P	0.52061	0.95;0.894	P;P	0.45681	0.459;0.49	D	0.92969	0.6396	10	0.56958	D	0.05	-27.3727	19.1419	0.93449	0.0:0.0:1.0:0.0	.	649;687	Q2L6I2;Q8NE71	.;ABCF1_HUMAN	Q	687;649	ENSP00000313603:R687Q;ENSP00000365728:R649Q	ENSP00000313603:R687Q	R	+	2	0	ABCF1	30665472	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.705000	0.84606	2.821000	0.97095	0.651000	0.88453	CGG		0.473	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
MUC21	394263	broad.mit.edu	37	6	30954670	30954670	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:30954670G>A	ENST00000376296.3	+	2	959	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	240	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A240T(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGCCAGCACAGCCACCAACTC	0.647																																					p.A240T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G718A	6						.						139.0	142.0	141.0					6																	30954670		2203	4299	6502	31062649	SO:0001583	missense	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.718G>A	6.37:g.30954670G>A	ENSP00000365473:p.Ala240Thr		31062649	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.428001	0.25726	.	.	ENSG00000204544	ENST00000376296	T	0.01685	4.69	4.3	-6.7	0.01766	.	.	.	.	.	T	0.00384	0.0012	L	0.27053	0.805	0.09310	N	1	B	0.33022	0.394	B	0.32465	0.146	T	0.44467	-0.9326	8	.	.	.	.	3.1307	0.06423	0.4373:0.11:0.3493:0.1034	.	240	Q5SSG8	MUC21_HUMAN	T	240	ENSP00000365473:A240T	.	A	+	1	0	MUC21	31062649	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.756000	0.01813	-1.718000	0.01383	0.491000	0.48974	GCC		0.647	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC21	394263	broad.mit.edu	37	6	30955421	30955421	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:30955421C>T	ENST00000376296.3	+	2	1710	c.1469C>T	c.(1468-1470)gCg>gTg	p.A490V	MUC21_ENST00000486149.2_Missense_Mutation_p.A36V	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	490					cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A490V(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCGGTTGTGGCGGCCGTGGGG	0.552																																					p.A490V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1469T	6						.						87.0	93.0	91.0					6																	30955421		2203	4300	6503	31063400	SO:0001583	missense	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1469C>T	6.37:g.30955421C>T	ENSP00000365473:p.Ala490Val		31063400	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.059191	0.00386	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.39997	1.05	4.48	-5.16	0.02857	.	.	.	.	.	T	0.02888	0.0086	N	0.02916	-0.46	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30937	-0.9961	9	0.06891	T	0.86	-1.3693	1.3793	0.02227	0.1282:0.1744:0.2612:0.4363	.	490	Q5SSG8	MUC21_HUMAN	V	340;490	ENSP00000365473:A490V	ENSP00000365473:A490V	A	+	2	0	MUC21	31063400	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.655000	0.05348	-0.558000	0.06118	-1.930000	0.00511	GCG		0.552	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
HLA-DOB	3112	broad.mit.edu	37	6	32782938	32782938	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:32782938G>A	ENST00000438763.2	-	2	340	c.244C>T	c.(244-246)Cca>Tca	p.P82S	TAP2_ENST00000452392.2_Missense_Mutation_p.P689S	NM_002120.3	NP_002111.1	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO beta	82	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)	p.P82S(1)|p.P689S(1)		endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	9						TCAGCATCTGGCTGCCCCAGC	0.537																																					p.P82S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C244T	6						.						112.0	93.0	99.0					6																	32782938		2203	4300	6503	32890916	SO:0001583	missense	3112	exon2				CCDS4754.1	6p21.3	2013-01-11			ENSG00000241106	ENSG00000241106		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4937	protein-coding gene	gene with protein product		600629					Standard	NM_002120		Approved			P13765	OTTHUMG00000031213	ENST00000438763.2:c.244C>T	6.37:g.32782938G>A	ENSP00000390020:p.Pro82Ser		32890916	NM_002120	B0V0Y0|Q29746|Q29825|Q6FHC2	Missense_Mutation	SNP	ENST00000438763.2	37	CCDS4754.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.841|9.841	1.191077|1.191077	0.21954|0.21954	.|.	.|.	ENSG00000241106|ENSG00000241106;ENSG00000204267;ENSG00000250264	ENST00000447394|ENST00000438763;ENST00000556934;ENST00000452392	.|T;T	.|0.46063	.|0.88;8.34	4.28|4.28	2.44|2.44	0.29823|0.29823	.|MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	.|0.421413	.|0.23382	.|N	.|0.048781	T|T	0.19446|0.19446	0.0467|0.0467	M|M	0.67700|0.67700	2.07|2.07	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.28783	.|0.11;0.022;0.222	.|B;B;B	.|0.20577	.|0.03;0.007;0.03	T|T	0.14811|0.14811	-1.0459|-1.0459	5|10	.|0.62326	.|D	.|0.03	.|.	7.6088|7.6088	0.28118|0.28118	0.0988:0.1714:0.7298:0.0|0.0988:0.1714:0.7298:0.0	.|.	.|82;689;82	.|B7Z742;E7ENX8;P13765	.|.;.;DOB_HUMAN	V|S	68|82;689;689	.|ENSP00000390020:P82S;ENSP00000391806:P689S	.|ENSP00000390020:P82S	A|P	-|-	2|1	0|0	HLA-DOB|XXbac-BPG246D15.9;TAP2;HLA-DOB	32890916|32890916	0.070000|0.070000	0.21116|0.21116	0.015000|0.015000	0.15790|0.15790	0.035000|0.035000	0.12851|0.12851	1.281000|1.281000	0.33214|0.33214	1.104000|1.104000	0.41587|0.41587	0.596000|0.596000	0.82720|0.82720	GCC|CCA		0.537	HLA-DOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076439.1	NM_002120	
ITPR3	3710	broad.mit.edu	37	6	33636850	33636850	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:33636850G>A	ENST00000374316.5	+	19	3166	c.2106G>A	c.(2104-2106)gaG>gaA	p.E702E	ITPR3_ENST00000605930.1_Silent_p.E702E			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	702					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.E702E(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	AGAATAACGAGCATCATGAGA	0.607																																					p.E702E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2106A	6						.						124.0	107.0	113.0					6																	33636850		2203	4300	6503	33744828	SO:0001819	synonymous_variant	3710	exon18			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2106G>A	6.37:g.33636850G>A			33744828	NM_002224	Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	CCDS4783.1																																																																																				0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
FGD2	221472	broad.mit.edu	37	6	36981534	36981534	+	Missense_Mutation	SNP	G	G	A	rs367888863		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:36981534G>A	ENST00000274963.8	+	5	848	c.677G>A	c.(676-678)cGc>cAc	p.R226H		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	226	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R226H(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						GTTCTCACTCGCATCCAGGTG	0.582																																					p.R226H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	6						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	34.0	32.0	33.0		677	4.8	1.0	6		33	1,8599	1.2+/-3.3	0,1,4299	no	missense	FGD2	NM_173558.3	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	226/656	36981534	2,13004	2203	4300	6503	37089512	SO:0001583	missense	221472	exon5			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.677G>A	6.37:g.36981534G>A	ENSP00000274963:p.Arg226His		37089512	NM_173558	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.776272	0.49786	2.27E-4	1.16E-4	ENSG00000146192	ENST00000274963	T	0.63744	-0.06	5.65	4.78	0.61160	Dbl homology (DH) domain (5);	0.000000	0.46442	D	0.000292	T	0.53061	0.1773	L	0.43646	1.37	0.27084	N	0.963024	D	0.65815	0.995	P	0.56788	0.806	T	0.51387	-0.8712	10	0.62326	D	0.03	-6.5511	8.5204	0.33273	0.2119:0.0:0.7881:0.0	.	226	Q7Z6J4	FGD2_HUMAN	H	226	ENSP00000274963:R226H	ENSP00000274963:R226H	R	+	2	0	FGD2	37089512	1.000000	0.71417	0.995000	0.50966	0.316000	0.28119	2.793000	0.47845	2.662000	0.90505	0.655000	0.94253	CGC		0.582	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
MDGA1	266727	broad.mit.edu	37	6	37631751	37631751	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:37631751G>T	ENST00000434837.3	-	2	1377	c.199C>A	c.(199-201)Cga>Aga	p.R67R	MDGA1_ENST00000505425.1_Silent_p.R67R|MDGA1_ENST00000297153.7_Silent_p.R67R	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	67	Ig-like 1.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)		p.R67R(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						ACCTGGGGTCGAGGGTGCCCT	0.602																																					p.R67R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C199A	6						.						60.0	63.0	62.0					6																	37631751		2122	4225	6347	37739729	SO:0001819	synonymous_variant	266727	exon2			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.199C>A	6.37:g.37631751G>T			37739729	NM_153487	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	37	CCDS47417.1																																																																																				0.602	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
MEA1	4201	broad.mit.edu	37	6	42980325	42980325	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:42980325T>C	ENST00000244711.3	-	4	595	c.441A>G	c.(439-441)ggA>ggG	p.G147G	KLHDC3_ENST00000326974.4_5'Flank|KLHDC3_ENST00000244670.8_5'Flank	NM_014623.2	NP_055438.1	Q16626	MEA1_HUMAN	male-enhanced antigen 1	147					cell differentiation (GO:0030154)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)		p.G147G(1)		central_nervous_system(1)|large_intestine(3)|lung(1)|skin(1)	6			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GCAGGCTTACTCCAGCCATTG	0.572																																					p.G147G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A441G	6						.						57.0	58.0	57.0					6																	42980325		2203	4300	6503	43088303	SO:0001819	synonymous_variant	4201	exon4				CCDS4879.1	6p21.3-p21.1	2008-08-15	2005-06-02	2005-06-02	ENSG00000124733	ENSG00000124733			6986	protein-coding gene	gene with protein product		143170	"""male-enhanced antigen"""	MEA		2813404, 12444059	Standard	NM_014623		Approved		uc003otk.3	Q16626	OTTHUMG00000014717	ENST00000244711.3:c.441A>G	6.37:g.42980325T>C			43088303	NM_014623	Q5TC36|Q9BV01	Silent	SNP	ENST00000244711.3	37	CCDS4879.1																																																																																				0.572	MEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040574.2		
YIPF3	25844	broad.mit.edu	37	6	43481339	43481339	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:43481339A>T	ENST00000372422.2	-	4	610	c.428T>A	c.(427-429)gTc>gAc	p.V143D	LRRC73_ENST00000372441.1_5'Flank|YIPF3_ENST00000506469.1_Missense_Mutation_p.V149D	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	143					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)		p.V143D(1)		large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GGGGAAGTTGACCATCTTGAT	0.572																																					p.V143D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T428A	6						.						54.0	56.0	55.0					6																	43481339		2203	4300	6503	43589317	SO:0001583	missense	25844	exon4			AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.428T>A	6.37:g.43481339A>T	ENSP00000361499:p.Val143Asp		43589317	NM_015388	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	ENST00000372422.2	37	CCDS4899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.32|16.32	3.090159|3.090159	0.55968|0.55968	.|.	.|.	ENSG00000137207|ENSG00000137207	ENST00000500090|ENST00000372422;ENST00000506469;ENST00000503972;ENST00000511831	.|T;T;T	.|0.48522	.|0.98;0.98;0.81	5.65|5.65	4.47|4.47	0.54385|0.54385	.|.	.|0.057187	.|0.64402	.|D	.|0.000001	T|T	0.25121|0.25121	0.0610|0.0610	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|B;P;B	.|0.47191	.|0.0;0.891;0.0	.|B;P;B	.|0.45099	.|0.001;0.469;0.001	T|T	0.10042|0.10042	-1.0647|-1.0647	5|10	.|0.66056	.|D	.|0.02	-38.7828|-38.7828	12.2845|12.2845	0.54786|0.54786	0.8728:0.0:0.0:0.1272|0.8728:0.0:0.0:0.1272	.|.	.|149;108;143	.|E7EQR8;Q5JTD5;Q9GZM5	.|.;.;YIPF3_HUMAN	T|D	81|143;149;143;108	.|ENSP00000361499:V143D;ENSP00000425494:V149D;ENSP00000421461:V143D	.|ENSP00000361499:V143D	S|V	-|-	1|2	0|0	YIPF3|YIPF3	43589317|43589317	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.452000|8.452000	0.90346|0.90346	1.050000|1.050000	0.40346|0.40346	0.533000|0.533000	0.62120|0.62120	TCA|GTC		0.572	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
PKHD1	5314	broad.mit.edu	37	6	51929757	51929757	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:51929757C>T	ENST00000371117.3	-	13	1247	c.972G>A	c.(970-972)caG>caA	p.Q324Q	PKHD1_ENST00000340994.4_Silent_p.Q324Q	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	324	IPT/TIG 3.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.Q324Q(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCTTACCTGGCTGAGGGGTGG	0.463																																					p.Q324Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G972A	6						.						84.0	86.0	86.0					6																	51929757		2203	4300	6503	52037716	SO:0001819	synonymous_variant	5314	exon13			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.972G>A	6.37:g.51929757C>T			52037716	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																				0.463	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
RIMS1	22999	broad.mit.edu	37	6	72960766	72960766	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:72960766C>T	ENST00000521978.1	+	14	2515	c.2515C>T	c.(2515-2517)Caa>Taa	p.Q839*	RIMS1_ENST00000491071.2_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000517827.1_Nonsense_Mutation_p.Q298*|RIMS1_ENST00000425662.2_Nonsense_Mutation_p.Q232*|RIMS1_ENST00000520567.1_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000401910.3_Nonsense_Mutation_p.Q313*|RIMS1_ENST00000264839.7_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000523963.1_Nonsense_Mutation_p.Q313*|RIMS1_ENST00000522291.1_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000517960.1_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000348717.5_Nonsense_Mutation_p.Q839*|RIMS1_ENST00000518273.1_Nonsense_Mutation_p.Q839*	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	839	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.Q839*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACCAAGAGTGCAAGAAGAAGA	0.299																																					p.Q232X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C694T	6						.						76.0	71.0	73.0					6																	72960766		1811	4072	5883	73017487	SO:0001587	stop_gained	22999	exon9			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2515C>T	6.37:g.72960766C>T	ENSP00000428417:p.Gln839*		73017487	NM_001168409	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Nonsense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.032446|10.032446	0.99321|0.99321	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420	.|.	.|.	.|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.087424	.|0.49305	.|D	.|0.000148	T|.	0.60779|.	0.2295|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.54043|.	-0.8352|.	4|.	.|0.20519	.|T	.|0.43	-11.3844|-11.3844	19.7913|19.7913	0.96458|0.96458	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	412|839;839;839;839;839;839;839;839;839;839;839;839;313;313;232;232;298;64	.|.	.|ENSP00000264839:Q839X	A|Q	+|+	2|1	0|0	RIMS1|RIMS1	73017487|73017487	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.606000|0.606000	0.37113|0.37113	7.784000|7.784000	0.85713|0.85713	2.678000|2.678000	0.91216|0.91216	0.585000|0.585000	0.79938|0.79938	GCA|CAA		0.299	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
CD109	135228	broad.mit.edu	37	6	74517808	74517808	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:74517808T>C	ENST00000287097.5	+	26	3304	c.3192T>C	c.(3190-3192)ccT>ccC	p.P1064P	CD109_ENST00000437994.2_Silent_p.P1064P|CD109_ENST00000422508.2_Silent_p.P987P			Q6YHK3	CD109_HUMAN	CD109 molecule	1064					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.P1064P(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTTCCAAGCCTAACATTGATG	0.308																																					p.P1064P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3192C	6						.						64.0	62.0	63.0					6																	74517808		2203	4300	6503	74574529	SO:0001819	synonymous_variant	135228	exon26			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3192T>C	6.37:g.74517808T>C			74574529	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	ENST00000287097.5	37	CCDS4982.1																																																																																				0.308	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
NT5E	4907	broad.mit.edu	37	6	86195018	86195018	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:86195018C>T	ENST00000257770.3	+	4	866	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	NT5E_ENST00000369651.3_Missense_Mutation_p.R273W	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	273					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.R273W(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TGATGATGGGCGGAAGGTTCC	0.473																																					p.R273W	Melanoma(140;797 1765 2035 2752 18208)											.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C817T	6						.						133.0	111.0	118.0					6																	86195018		2203	4300	6503	86251737	SO:0001583	missense	4907	exon4			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.817C>T	6.37:g.86195018C>T	ENSP00000257770:p.Arg273Trp		86251737	NM_002526	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	ENST00000257770.3	37	CCDS5002.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770115	0.69992	.	.	ENSG00000135318	ENST00000369647;ENST00000257770;ENST00000369651	T;T	0.56941	0.44;0.43	5.63	5.63	0.86233	.	0.109420	0.64402	D	0.000007	T	0.68220	0.2977	M	0.90425	3.115	0.34385	D	0.693562	D;D	0.76494	0.999;0.999	P;P	0.58266	0.794;0.836	T	0.76921	-0.2780	10	0.62326	D	0.03	-10.1616	15.3821	0.74664	0.1478:0.8522:0.0:0.0	.	273;273	B3KQI8;P21589	.;5NTD_HUMAN	W	49;273;273	ENSP00000257770:R273W;ENSP00000358665:R273W	ENSP00000257770:R273W	R	+	1	2	NT5E	86251737	0.939000	0.31865	0.875000	0.34327	0.977000	0.68977	2.328000	0.43867	2.646000	0.89796	0.462000	0.41574	CGG		0.473	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1		
RNGTT	8732	broad.mit.edu	37	6	89638748	89638748	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:89638748C>T	ENST00000369485.4	-	4	509	c.323G>A	c.(322-324)cGt>cAt	p.R108H	RNGTT_ENST00000538899.1_Missense_Mutation_p.R48H|RNGTT_ENST00000369475.3_Missense_Mutation_p.R108H|RNGTT_ENST00000265607.6_Missense_Mutation_p.R108H	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	108	TPase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)	p.R108H(1)		endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		CTCACACAGACGAATAAAGGT	0.343																																					p.R108H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G323A	6						.						108.0	110.0	110.0					6																	89638748		2203	4300	6503	89695467	SO:0001583	missense	8732	exon4			AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.323G>A	6.37:g.89638748C>T	ENSP00000358497:p.Arg108His		89695467	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	ENST00000369485.4	37	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386717	0.61956	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.82	5.82	0.92795	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.043067	0.85682	D	0.000000	T	0.69993	0.3173	N	0.20986	0.625	0.80722	D	1	B;B;B;B	0.21381	0.044;0.055;0.044;0.055	B;B;B;B	0.16289	0.007;0.015;0.008;0.015	T	0.64879	-0.6303	10	0.33141	T	0.24	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	48;108;108;108	B4DSJ8;Q5TCW7;O60942-2;O60942	.;.;.;MCE1_HUMAN	H	108;108;48;79;108	ENSP00000358497:R108H;ENSP00000265607:R108H;ENSP00000442609:R48H;ENSP00000358487:R108H	ENSP00000265607:R108H	R	-	2	0	RNGTT	89695467	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.415000	0.59809	2.762000	0.94881	0.561000	0.74099	CGT		0.343	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
DDO	8528	broad.mit.edu	37	6	110714137	110714138	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:110714137_110714138delCT	ENST00000368924.3	-	5	965_966	c.950_951delAG	c.(949-951)gagfs	p.E317fs	DDO_ENST00000368923.3_Frame_Shift_Del_p.E258fs	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	289					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.E317fs*>53(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		GCGCAAGGAGCTCTGTCTGCAG	0.644																																					p.317_317del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.950_951del	6						.																																			110820831	SO:0001589	frameshift_variant	8528	exon5			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.950_951delAG	6.37:g.110714139_110714140delCT	ENSP00000357920:p.Glu317fs		110820830	NM_003649	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Frame_Shift_Del	DEL	ENST00000368924.3	37	CCDS5082.1																																																																																				0.644	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
FRMD1	79981	broad.mit.edu	37	6	168464428	168464428	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr6:168464428G>A	ENST00000283309.6	-	6	721	c.657C>T	c.(655-657)acC>acT	p.T219T	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000440994.2_Silent_p.T151T|FRMD1_ENST00000537786.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	219	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.T219T(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TCCCCCTCTTGGTGATGATCT	0.642																																					p.T151T	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	6						.						95.0	80.0	85.0					6																	168464428		2203	4300	6503	168207277	SO:0001819	synonymous_variant	79981	exon6				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.657C>T	6.37:g.168464428G>A			168207277	NM_001122841	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Silent	SNP	ENST00000283309.6	37	CCDS5306.1																																																																																				0.642	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
KMT2E	55904	broad.mit.edu	37	7	104719405	104719405	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:104719405G>A	ENST00000311117.3	+	12	1788	c.1243G>A	c.(1243-1245)Gca>Aca	p.A415T	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000476671.1_Missense_Mutation_p.A415T|KMT2E_ENST00000334877.4_Missense_Mutation_p.A415T|KMT2E_ENST00000257745.4_Missense_Mutation_p.A415T	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	415	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A415T(1)									TACACCCAATGCAGAGGTAAG	0.438																																					p.A415T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1243A	7						.						100.0	95.0	97.0					7																	104719405		2203	4300	6503	104506641	SO:0001583	missense	55904	exon12			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1243G>A	7.37:g.104719405G>A	ENSP00000312379:p.Ala415Thr		104506641	NM_182931	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055070	0.75960	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.67	5.67	0.87782	SET domain (3);	0.053612	0.64402	D	0.000001	D	0.89083	0.6614	M	0.62154	1.92	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.724	D;D;P	0.85130	0.992;0.997;0.706	D	0.89268	0.3602	10	0.72032	D	0.01	.	19.7557	0.96287	0.0:0.0:1.0:0.0	.	49;415;415	Q86W16;Q8IZD2;Q8IZD2-3	.;MLL5_HUMAN;.	T	415;415;415;415;415;273;415;349	ENSP00000312379:A415T;ENSP00000335599:A415T;ENSP00000257745:A415T;ENSP00000419883:A273T;ENSP00000417888:A415T	ENSP00000257745:A415T	A	+	1	0	MLL5	104506641	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.652000	0.67959	2.681000	0.91329	0.313000	0.20887	GCA		0.438	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
LAMB1	3912	broad.mit.edu	37	7	107580511	107580511	+	Silent	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:107580511G>A	ENST00000222399.6	-	25	3914	c.3684C>T	c.(3682-3684)agC>agT	p.S1228S	CTB-13F3.1_ENST00000608515.1_RNA|LAMB1_ENST00000393561.1_Silent_p.S1252S|LAMB1_ENST00000474380.1_5'Flank	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1228	Domain II.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.S1228S(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CTTTTATCTCGCTGACTTTCC	0.517																																					p.S1228S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3684T	7						.						114.0	101.0	105.0					7																	107580511		2203	4300	6503	107367747	SO:0001819	synonymous_variant	3912	exon25			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3684C>T	7.37:g.107580511G>A			107367747	NM_002291	Q14D91	Silent	SNP	ENST00000222399.6	37	CCDS5750.1																																																																																				0.517	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
LRRN3	54674	broad.mit.edu	37	7	110764096	110764096	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:110764096T>A	ENST00000422987.3	+	2	2099	c.1268T>A	c.(1267-1269)aTa>aAa	p.I423K	IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.I423K|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.I423K|IMMP2L_ENST00000331762.3_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	423	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I423K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CTCCCTCTTATAGCTCCTGAG	0.458																																					p.I423K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1268A	7						.						118.0	117.0	117.0					7																	110764096		2203	4300	6503	110551332	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1268T>A	7.37:g.110764096T>A	ENSP00000412417:p.Ile423Lys		110551332	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	T	15.40	2.822400	0.50739	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.68181	-0.31;-0.31;-0.31	6.01	4.86	0.63082	Immunoglobulin-like (1);	0.000000	0.64402	D	0.000002	T	0.75591	0.3870	H	0.95982	3.75	0.80722	D	1	P	0.41366	0.747	B	0.40782	0.34	T	0.76997	-0.2751	10	0.16896	T	0.51	.	12.0898	0.53719	0.0:0.0667:0.0:0.9332	.	423	Q9H3W5	LRRN3_HUMAN	K	423	ENSP00000312001:I423K;ENSP00000397312:I423K;ENSP00000412417:I423K	ENSP00000312001:I423K	I	+	2	0	LRRN3	110551332	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.040000	0.89188	1.104000	0.41587	-0.263000	0.10527	ATA		0.458	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
TAS2R16	50833	broad.mit.edu	37	7	122635198	122635198	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:122635198C>A	ENST00000249284.2	-	1	556	c.491G>T	c.(490-492)aGc>aTc	p.S164I		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	164					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.S164I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGTTACAGTGCTGTTTCTTGG	0.408																																					p.S164I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491T	7						.						166.0	153.0	158.0					7																	122635198		2203	4300	6503	122422434	SO:0001583	missense	50833	exon1			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.491G>T	7.37:g.122635198C>A	ENSP00000249284:p.Ser164Ile		122422434	NM_016945	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	C	8.032	0.762045	0.15914	.	.	ENSG00000128519	ENST00000249284	T	0.37058	1.22	4.56	-6.87	0.01671	.	2.007800	0.02239	N	0.065610	T	0.25791	0.0628	L	0.50333	1.59	0.09310	N	1	P	0.35468	0.503	B	0.36378	0.223	T	0.18999	-1.0319	10	0.22706	T	0.39	.	1.4142	0.02298	0.2261:0.2117:0.1117:0.4505	.	164	Q9NYV7	T2R16_HUMAN	I	164	ENSP00000249284:S164I	ENSP00000249284:S164I	S	-	2	0	TAS2R16	122422434	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.091000	0.03369	-1.304000	0.02329	0.655000	0.94253	AGC		0.408	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945	
LMOD2	442721	broad.mit.edu	37	7	123301920	123301920	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:123301920G>A	ENST00000458573.2	+	2	437	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	94	Glu-rich.					cytoskeleton (GO:0005856)		p.E94K(1)									TTAGGTTGCAGAAGACAAAGA	0.373																																					p.E94K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	7						.						41.0	39.0	39.0					7																	123301920		1718	3710	5428	123089156	SO:0001583	missense	442721	exon2			AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.280G>A	7.37:g.123301920G>A	ENSP00000411932:p.Glu94Lys		123089156	NM_207163	A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	ENST00000458573.2	37	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.002815	0.54254	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074	T	0.34667	1.35	4.78	3.88	0.44766	.	.	.	.	.	T	0.21145	0.0509	N	0.19112	0.55	0.80722	D	1	B	0.13145	0.007	B	0.17433	0.018	T	0.03662	-1.1015	9	0.06891	T	0.86	-6.9185	12.6962	0.57005	0.0802:0.0:0.9198:0.0	.	94	Q6P5Q4	LMOD2_HUMAN	K	94	ENSP00000411932:E94K	ENSP00000405123:E94K	E	+	1	0	LMOD2	123089156	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.760000	0.74939	2.359000	0.80004	0.655000	0.94253	GAA		0.373	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
CCDC136	64753	broad.mit.edu	37	7	128454762	128454762	+	Missense_Mutation	SNP	G	G	T	rs61730244	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:128454762G>T	ENST00000297788.4	+	15	3201	c.2834G>T	c.(2833-2835)cGg>cTg	p.R945L	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000471729.1_3'UTR|CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	945						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R945L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GAGCAGGGGCGGCTTCTGGTA	0.597																																					p.R945L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2834T	7						.						25.0	28.0	27.0					7																	128454762		1922	4135	6057	128241998	SO:0001583	missense	64753	exon15				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2834G>T	7.37:g.128454762G>T	ENSP00000297788:p.Arg945Leu		128241998	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.4|28.4	4.915890|4.915890	0.92178|0.92178	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000494552|ENST00000297788;ENST00000397697	.|T	.|0.58940	.|0.3	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.64402	.|D	.|0.000014	T|T	0.75576|0.75576	0.3868|0.3868	M|M	0.72894|0.72894	2.215|2.215	0.38008|0.38008	D|D	0.934451|0.934451	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.998	T|T	0.77885|0.77885	-0.2421|-0.2421	5|10	.|0.59425	.|D	.|0.04	-36.4845|-36.4845	16.3599|16.3599	0.83257|0.83257	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|945;945	.|Q96JN2-4;Q96JN2	.|.;CC136_HUMAN	C|L	822|945	.|ENSP00000297788:R945L	.|ENSP00000297788:R945L	G|R	+|+	1|2	0|0	CCDC136|CCDC136	128241998|128241998	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.877000|4.877000	0.63086|0.63086	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGC|CGG		0.597	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
WDR91	29062	broad.mit.edu	37	7	134891927	134891927	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:134891927G>A	ENST00000354475.4	-	4	570	c.539C>T	c.(538-540)gCg>gTg	p.A180V	WDR91_ENST00000344400.5_Missense_Mutation_p.A180V|WDR91_ENST00000423565.1_Missense_Mutation_p.A145V|WDR91_ENST00000485942.1_5'Flank	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	180								p.A180V(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						CTGACACTCCGCATCAAAGTT	0.458																																					p.A180V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C539T	7						.						96.0	87.0	90.0					7																	134891927		2203	4300	6503	134542467	SO:0001583	missense	29062	exon4			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.539C>T	7.37:g.134891927G>A	ENSP00000346466:p.Ala180Val		134542467	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706558	0.68615	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	D;D;D	0.91792	-2.91;-2.91;-2.91	5.87	5.87	0.94306	.	0.262839	0.44688	D	0.000433	D	0.91209	0.7230	L	0.56769	1.78	0.46499	D	0.999074	B	0.14805	0.011	B	0.08055	0.003	D	0.86335	0.1701	10	0.51188	T	0.08	-13.8918	20.2788	0.98501	0.0:0.0:1.0:0.0	.	180	A4D1P6	WDR91_HUMAN	V	180;180;145	ENSP00000340877:A180V;ENSP00000346466:A180V;ENSP00000392555:A145V	ENSP00000340877:A180V	A	-	2	0	WDR91	134542467	1.000000	0.71417	0.967000	0.41034	0.969000	0.65631	6.033000	0.70925	2.788000	0.95919	0.650000	0.86243	GCG		0.458	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
NUP205	23165	broad.mit.edu	37	7	135269736	135269736	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:135269736T>A	ENST00000285968.6	+	8	1225	c.1199T>A	c.(1198-1200)cTt>cAt	p.L400H	NUP205_ENST00000440390.2_Missense_Mutation_p.L194H	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	400					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.L400H(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ACAGATTTCCTTGCACTTATG	0.308																																					p.L400H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1199A	7						.						46.0	46.0	46.0					7																	135269736		2203	4300	6503	134920276	SO:0001583	missense	23165	exon8			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1199T>A	7.37:g.135269736T>A	ENSP00000285968:p.Leu400His		134920276	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.304809	0.81247	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.32753	1.44;1.44	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	T	0.44997	-0.9291	10	0.87932	D	0	-30.3179	15.6385	0.76977	0.0:0.0:0.0:1.0	.	400	Q92621	NU205_HUMAN	H	400;194	ENSP00000285968:L400H;ENSP00000401983:L194H	ENSP00000285968:L400H	L	+	2	0	NUP205	134920276	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.040000	0.89188	2.089000	0.63090	0.482000	0.46254	CTT		0.308	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
SNX8	29886	broad.mit.edu	37	7	2314850	2314850	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:2314850C>T	ENST00000222990.3	-	3	357	c.315G>A	c.(313-315)tcG>tcA	p.S105S		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	105	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.S105S(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GTCTGTATACCGAGGACTTGA	0.557																																					p.S105S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G315A	7						.						190.0	173.0	178.0					7																	2314850		2203	4300	6503	2281376	SO:0001819	synonymous_variant	29886	exon3			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.315G>A	7.37:g.2314850C>T			2281376	NM_013321	A4D207|Q96I67	Silent	SNP	ENST00000222990.3	37	CCDS5331.1																																																																																				0.557	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2		
CARD11	84433	broad.mit.edu	37	7	2956957	2956957	+	Silent	SNP	C	C	T	rs146545469	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:2956957C>T	ENST00000396946.4	-	20	3073	c.2670G>A	c.(2668-2670)tcG>tcA	p.S890S		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	890					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.S883S(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AGCTTGCTCGCGAGAGACGGG	0.562			Mis		DLBCL								C|||	4	0.000798722	0.003	0.0	5008	,	,		15255	0.0		0.0	False		,,,				2504	0.0				p.S890S			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2670A	7						.	C		13,4393	20.2+/-43.8	0,13,2190	38.0	51.0	47.0		2670	-10.0	0.0	7	dbSNP_134	47	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CARD11	NM_032415.4		0,15,6488	TT,TC,CC		0.0233,0.2951,0.1153		890/1155	2956957	15,12991	2203	4300	6503	2923483	SO:0001819	synonymous_variant	84433	exon20			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2670G>A	7.37:g.2956957C>T			2923483	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	CCDS5336.2																																																																																				0.562	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
ANLN	54443	broad.mit.edu	37	7	36462288	36462288	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:36462288C>T	ENST00000265748.2	+	14	2567	c.2346C>T	c.(2344-2346)aaC>aaT	p.N782N	ANLN_ENST00000396068.2_Silent_p.N745N	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	782	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.N782N(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AATTGAAGAACGAAGGACCTC	0.363																																					p.N782N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2346T	7						.						127.0	128.0	127.0					7																	36462288		2203	4300	6503	36428813	SO:0001819	synonymous_variant	54443	exon14			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2346C>T	7.37:g.36462288C>T			36428813	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Silent	SNP	ENST00000265748.2	37	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	C	7.106	0.575006	0.13623	.	.	ENSG00000011426	ENST00000446635	.	.	.	5.97	-4.39	0.03611	.	.	.	.	.	T	0.50205	0.1602	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51663	-0.8677	4	.	.	.	-5.9145	7.6273	0.28220	0.1015:0.3742:0.0:0.5243	.	.	.	.	M	136	.	.	T	+	2	0	ANLN	36428813	0.009000	0.17119	0.205000	0.23548	0.933000	0.57130	0.024000	0.13555	-0.294000	0.08973	-0.423000	0.05987	ACG		0.363	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
VPS41	27072	broad.mit.edu	37	7	38835207	38835207	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:38835207A>G	ENST00000310301.4	-	9	629	c.575T>C	c.(574-576)gTg>gCg	p.V192A	VPS41_ENST00000466017.1_5'UTR|VPS41_ENST00000395969.2_Missense_Mutation_p.V167A	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	192					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.V192A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						AAAAATCTTCACACCCTGGAA	0.443																																					p.V192A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T575C	7						.						78.0	71.0	74.0					7																	38835207		2203	4300	6503	38801732	SO:0001583	missense	27072	exon9			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.575T>C	7.37:g.38835207A>G	ENSP00000309457:p.Val192Ala		38801732	NM_014396	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	A	32	5.112811	0.94339	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000413141	T;T;T	0.62364	0.03;0.03;0.03	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82935	0.5145	M	0.90309	3.105	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	D	0.86656	0.1901	10	0.87932	D	0	-20.8236	16.17	0.81801	1.0:0.0:0.0:0.0	.	167;192	E9PF36;P49754	.;VPS41_HUMAN	A	192;167;118	ENSP00000309457:V192A;ENSP00000379297:V167A;ENSP00000412974:V118A	ENSP00000309457:V192A	V	-	2	0	VPS41	38801732	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.282000	0.95840	2.224000	0.72417	0.459000	0.35465	GTG		0.443	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3		
COBL	23242	broad.mit.edu	37	7	51095669	51095669	+	Missense_Mutation	SNP	G	G	A	rs370348190		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:51095669G>A	ENST00000265136.7	-	10	3289	c.3124C>T	c.(3124-3126)Cgc>Tgc	p.R1042C	COBL_ENST00000395542.2_Missense_Mutation_p.R1124C	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1042					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.R1042C(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CCTGGGGCGCGCACAGAGCCA	0.607																																					p.R1042C	NSCLC(189;2119 2138 12223 30818 34679)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3124T	7						.	G	CYS/ARG	0,4406		0,0,2203	64.0	64.0	64.0		3124	-1.9	0.0	7		64	1,8599	1.2+/-3.3	0,1,4299	no	missense	COBL	NM_015198.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1042/1262	51095669	1,13005	2203	4300	6503	51063163	SO:0001583	missense	23242	exon10			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3124C>T	7.37:g.51095669G>A	ENSP00000265136:p.Arg1042Cys		51063163	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235160	0.22626	0.0	1.16E-4	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.12465	2.69;2.68;2.69;2.69	5.41	-1.94	0.07571	.	1.320060	0.05269	N	0.517168	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.16396	0.0;0.0;0.003;0.004;0.017	B;B;B;B;B	0.10450	0.001;0.001;0.0;0.001;0.005	T	0.37220	-0.9715	10	0.48119	T	0.1	.	0.3558	0.00356	0.3746:0.133:0.234:0.2584	.	1042;1099;1042;1124;584	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	C	1042;934;927;1124	ENSP00000265136:R1042C;ENSP00000401204:R934C;ENSP00000413498:R927C;ENSP00000378912:R1124C	ENSP00000265136:R1042C	R	-	1	0	COBL	51063163	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.079000	0.11357	-0.178000	0.10672	-0.440000	0.05779	CGC		0.607	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
SEPT14	346288	broad.mit.edu	37	7	55886855	55886855	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:55886855A>G	ENST00000388975.3	-	7	898	c.782T>C	c.(781-783)gTc>gCc	p.V261A		NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	261	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.V261A(1)|p.V50A(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACGGCCTCTGACCATCCTTTT	0.418																																					p.V261A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T782C	7						.						67.0	57.0	60.0					7																	55886855		2203	4297	6500	55854349	SO:0001583	missense	346288	exon7			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.782T>C	7.37:g.55886855A>G	ENSP00000373627:p.Val261Ala		55854349	NM_207366	A6NCC2|B4DXD6	Missense_Mutation	SNP	ENST00000388975.3	37	CCDS5519.2	.	.	.	.	.	.	.	.	.	.	A	16.74	3.206300	0.58343	.	.	ENSG00000154997	ENST00000388975	T	0.60171	0.21	3.85	1.52	0.23074	.	0.120578	0.34932	N	0.003565	T	0.75568	0.3867	M	0.91920	3.255	0.32280	N	0.567643	D	0.89917	1.0	D	0.91635	0.999	T	0.76594	-0.2902	10	0.56958	D	0.05	.	6.4142	0.21708	0.7756:0.0:0.2244:0.0	.	261	Q6ZU15	SEP14_HUMAN	A	261	ENSP00000373627:V261A	ENSP00000373627:V261A	V	-	2	0	SEPT14	55854349	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	5.883000	0.69721	0.647000	0.30713	0.460000	0.39030	GTC		0.418	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251489.2	NM_207366	
GBAS	2631	broad.mit.edu	37	7	56046064	56046064	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:56046064G>A	ENST00000322090.3	+	3	283	c.254G>A	c.(253-255)tGc>tAc	p.C85Y	GBAS_ENST00000487370.1_3'UTR|GBAS_ENST00000446778.1_Intron	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	85					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)		p.C85Y(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AAACCGGAATGCCTAGAAGCA	0.323																																					p.C85Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G254A	7						.						159.0	143.0	148.0					7																	56046064		2203	4300	6503	56013558	SO:0001583	missense	2631	exon3			AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.254G>A	7.37:g.56046064G>A	ENSP00000313050:p.Cys85Tyr		56013558	NM_001483	C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	ENST00000322090.3	37	CCDS5521.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030684	0.75504	.	.	ENSG00000146729	ENST00000322090	T	0.42513	0.97	5.8	5.8	0.92144	Dimeric alpha-beta barrel (1);	0.000000	0.85682	D	0.000000	T	0.66519	0.2797	M	0.73430	2.235	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64132	-0.6479	10	0.42905	T	0.14	-19.7756	19.0588	0.93078	0.0:0.0:1.0:0.0	.	85	O75323	NIPS2_HUMAN	Y	85	ENSP00000313050:C85Y	ENSP00000313050:C85Y	C	+	2	0	GBAS	56013558	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.941000	0.56607	2.744000	0.94065	0.655000	0.94253	TGC		0.323	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483	
VKORC1L1	154807	broad.mit.edu	37	7	65419202	65419202	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:65419202A>G	ENST00000360768.3	+	3	551	c.446A>G	c.(445-447)aAc>aGc	p.N149S	VKORC1L1_ENST00000434382.2_Silent_p.E112E	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1	149					cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.N149S(1)		large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	TACGTGCTGAACTTCCTTCTT	0.522																																					p.N149S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A446G	7						.						166.0	130.0	142.0					7																	65419202		2203	4300	6503	65056637	SO:0001583	missense	154807	exon3				CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.446A>G	7.37:g.65419202A>G	ENSP00000353998:p.Asn149Ser		65056637	NM_173517	B4E222|E7ETM5|Q6AHW9|Q6TEK6	Missense_Mutation	SNP	ENST00000360768.3	37	CCDS5529.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.034979	0.75617	.	.	ENSG00000196715	ENST00000360768	D	0.97553	-4.43	5.78	5.78	0.91487	Vitamin K epoxide reductase (2);	0.000000	0.85682	D	0.000000	D	0.98400	0.9468	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99060	1.0830	10	0.54805	T	0.06	.	15.5859	0.76482	1.0:0.0:0.0:0.0	.	149	Q8N0U8	VKORL_HUMAN	S	149	ENSP00000353998:N149S	ENSP00000353998:N149S	N	+	2	0	VKORC1L1	65056637	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.806000	0.91930	2.333000	0.79357	0.482000	0.46254	AAC		0.522	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251612.3	NM_173517	
TRRAP	8295	broad.mit.edu	37	7	98563387	98563387	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:98563387A>G	ENST00000359863.4	+	48	7233	c.7024A>G	c.(7024-7026)Atg>Gtg	p.M2342V	TRRAP_ENST00000355540.3_Missense_Mutation_p.M2324V|TRRAP_ENST00000446306.3_Missense_Mutation_p.M2324V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2342	Interaction with TP53.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.M2324V(1)|p.M2342V(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GAGCATGGAGATGCGGAAGAA	0.537																																					p.M2324V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6970G	7						.						118.0	102.0	107.0					7																	98563387		2203	4300	6503	98401323	SO:0001583	missense	8295	exon47			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7024A>G	7.37:g.98563387A>G	ENSP00000352925:p.Met2342Val		98401323	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.010373	0.54361	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.63255	-0.03;-0.03	6.02	6.02	0.97574	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	M	0.69823	2.125	0.80722	D	1	B;B;B	0.30236	0.274;0.053;0.087	B;B;B	0.26693	0.072;0.015;0.015	T	0.58317	-0.7657	10	0.12430	T	0.62	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	2324;2063;2342	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	V	2342;2324;2323	ENSP00000352925:M2342V;ENSP00000347733:M2324V	ENSP00000347733:M2324V	M	+	1	0	TRRAP	98401323	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.311000	0.77944	0.533000	0.62120	ATG		0.537	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
FLNC	2318	broad.mit.edu	37	7	128484755	128484755	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:128484755delC	ENST00000325888.8	+	21	3497	c.3236delC	c.(3235-3237)accfs	p.T1079fs	FLNC_ENST00000346177.6_Frame_Shift_Del_p.T1079fs	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1079					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.A1081fs*17(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CTGGTAGGCACCCCCGCGCCA	0.647																																					p.T1079fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.3236delC	7						.						51.0	59.0	56.0					7																	128484755		1993	4156	6149	128271991	SO:0001589	frameshift_variant	2318	exon21			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3236delC	7.37:g.128484755delC	ENSP00000327145:p.Thr1079fs		128271991	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Frame_Shift_Del	DEL	ENST00000325888.8	37	CCDS43644.1																																																																																				0.647	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0 	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu		140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
VPS13B	157680	broad.mit.edu	37	8	100050689	100050689	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:100050689T>C	ENST00000358544.2	+	3	297	c.186T>C	c.(184-186)atT>atC	p.I62I	VPS13B_ENST00000355155.1_Silent_p.I62I|VPS13B_ENST00000441350.2_Silent_p.I62I|VPS13B_ENST00000395996.1_Silent_p.I62I|VPS13B_ENST00000357162.2_Silent_p.I62I	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	62					protein transport (GO:0015031)			p.I62I(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTGGACATATTCATGAATTGA	0.299																																					p.I62I	Colon(161;2205 2542 7338 31318)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T186C	8						.						63.0	61.0	62.0					8																	100050689		2203	4296	6499	100119865	SO:0001819	synonymous_variant	157680	exon3			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.186T>C	8.37:g.100050689T>C			100119865	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																				0.299	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
COL14A1	7373	broad.mit.edu	37	8	121220582	121220582	+	Missense_Mutation	SNP	C	C	T	rs200320717		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:121220582C>T	ENST00000297848.3	+	11	1573	c.1303C>T	c.(1303-1305)Cgg>Tgg	p.R435W	COL14A1_ENST00000247781.3_Missense_Mutation_p.R340W|COL14A1_ENST00000309791.4_Missense_Mutation_p.R435W|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000537875.1_Missense_Mutation_p.R435W	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.R435W(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGAAGGCCTACGGGGAACTGA	0.403																																					p.R435W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1303T	8						.	C	TRP/ARG	0,4406		0,0,2203	99.0	91.0	94.0		1303	4.1	1.0	8		94	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL14A1	NM_021110.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	435/1797	121220582	1,13005	2203	4300	6503	121289763	SO:0001583	missense	7373	exon11				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1303C>T	8.37:g.121220582C>T	ENSP00000297848:p.Arg435Trp		121289763	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.70|17.70	3.453600|3.453600	0.63290|0.63290	0.0|0.0	1.16E-4|1.16E-4	ENSG00000187955|ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620|ENST00000523142	T;T;D;D;T|.	0.88277|.	3.59;3.59;-2.28;-2.36;3.59|.	5.01|5.01	4.11|4.11	0.48088|0.48088	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75824|0.75824	0.3902|0.3902	M|M	0.81497|0.81497	2.545|2.545	0.45354|0.45354	D|D	0.998347|0.998347	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.993|.	T|T	0.77993|0.77993	-0.2378|-0.2378	10|5	0.66056|.	D|.	0.02|.	.|.	14.8758|14.8758	0.70493|0.70493	0.1447:0.8553:0.0:0.0|0.1447:0.8553:0.0:0.0	.|.	435;435|.	Q05707-2;Q05707|.	.;COEA1_HUMAN|.	W|M	435;435;435;340;248|191	ENSP00000443974:R435W;ENSP00000311809:R435W;ENSP00000297848:R435W;ENSP00000247781:R340W;ENSP00000409461:R248W|.	ENSP00000247781:R340W|.	R|T	+|+	1|2	2|0	COL14A1|COL14A1	121289763|121289763	0.990000|0.990000	0.36364|0.36364	0.978000|0.978000	0.43139|0.43139	0.991000|0.991000	0.79684|0.79684	2.906000|2.906000	0.48735|0.48735	1.195000|1.195000	0.43115|0.43115	0.561000|0.561000	0.74099|0.74099	CGG|ACG		0.403	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
KIAA1456	57604	broad.mit.edu	37	8	12863856	12863856	+	Missense_Mutation	SNP	G	G	A	rs71207112		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:12863856G>A	ENST00000524591.2	+	3	634	c.145G>A	c.(145-147)Gct>Act	p.A49T	KIAA1456_ENST00000528753.2_Missense_Mutation_p.A49T|KIAA1456_ENST00000447063.2_Missense_Mutation_p.A49T|KIAA1456_ENST00000400069.3_Missense_Mutation_p.A49T	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	49							methyltransferase activity (GO:0008168)	p.A49T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						CAGCCTCATCGCTGACATAGG	0.567																																					p.A49T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G145A	8						.						29.0	32.0	31.0					8																	12863856		2006	4174	6180	12908227	SO:0001583	missense	57604	exon3			BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.145G>A	8.37:g.12863856G>A	ENSP00000432695:p.Ala49Thr		12908227	NM_020844	Q96AW6	Missense_Mutation	SNP	ENST00000524591.2	37	CCDS47808.1	.	.	.	.	.	.	.	.	.	.	G	34	5.302687	0.95601	.	.	ENSG00000250305	ENST00000447063;ENST00000524591;ENST00000532376	T;T	0.44482	0.92;0.92	5.66	5.66	0.87406	.	.	.	.	.	T	0.68531	0.3011	M	0.80508	2.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.955	T	0.69453	-0.5141	9	0.56958	D	0.05	.	20.1454	0.98074	0.0:0.0:1.0:0.0	.	49;49	E9PK20;Q9P272	.;K1456_HUMAN	T	49	ENSP00000443288:A49T;ENSP00000432695:A49T	ENSP00000443288:A49T	A	+	1	0	AC135352.2	12908227	1.000000	0.71417	0.803000	0.32268	0.717000	0.41224	9.782000	0.99034	2.840000	0.97914	0.655000	0.94253	GCT		0.567	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677	
DERL1	79139	broad.mit.edu	37	8	124035970	124035970	+	Silent	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:124035970A>G	ENST00000259512.4	-	4	640	c.340T>C	c.(340-342)Tta>Cta	p.L114L	DERL1_ENST00000523036.1_Silent_p.L14L|DERL1_ENST00000519018.1_Silent_p.L14L|DERL1_ENST00000405944.3_Silent_p.L114L|RP11-557C18.3_ENST00000521258.1_RNA|DERL1_ENST00000419562.2_Intron	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	114					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)	p.L114L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TCCATTGCTAAGCCAGTAATC	0.328																																					p.L114L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T340C	8						.						124.0	109.0	114.0					8																	124035970		2202	4300	6502	124105151	SO:0001819	synonymous_variant	79139	exon4			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.340T>C	8.37:g.124035970A>G			124105151	NM_024295	B3KW41|E9PH19	Silent	SNP	ENST00000259512.4	37	CCDS6337.1																																																																																				0.328	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381714.2	NM_024295	
ASAP1	50807	broad.mit.edu	37	8	131072873	131072873	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:131072873C>T	ENST00000518721.1	-	28	3371	c.3144G>A	c.(3142-3144)acG>acA	p.T1048T	ASAP1_ENST00000357668.1_Silent_p.T1048T	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	1048					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.T1048T(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GCAGAGTAGGCGTGAGGTCGT	0.527																																					p.T1048T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3144A	8						.						220.0	214.0	216.0					8																	131072873		2203	4300	6503	131142055	SO:0001819	synonymous_variant	50807	exon27			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.3144G>A	8.37:g.131072873C>T			131142055	NM_018482	B2RNV3	Silent	SNP	ENST00000518721.1	37	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	C	9.440	1.087875	0.20390	.	.	ENSG00000153317	ENST00000524124;ENST00000519483	.	.	.	5.52	-4.06	0.03986	.	.	.	.	.	T	0.46502	0.1396	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40905	-0.9538	4	.	.	.	.	4.5161	0.11935	0.1015:0.2568:0.1003:0.5413	.	.	.	.	T	869;405	.	.	A	-	1	0	ASAP1	131142055	0.007000	0.16637	0.957000	0.39632	0.979000	0.70002	-1.319000	0.02702	-0.861000	0.04094	-0.123000	0.14984	GCC		0.527	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
FAM135B	51059	broad.mit.edu	37	8	139149483	139149483	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:139149483C>T	ENST00000395297.1	-	19	4092	c.3922G>A	c.(3922-3924)Gtc>Atc	p.V1308I		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1308								p.V1308I(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ACCAGCACGACGTTTTTAAAA	0.428										HNSCC(54;0.14)																											p.V1308I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3922A	8						.						129.0	125.0	126.0					8																	139149483		1861	4106	5967	139218665	SO:0001583	missense	51059	exon19			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3922G>A	8.37:g.139149483C>T	ENSP00000378710:p.Val1308Ile		139218665	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.786164	0.90282	.	.	ENSG00000147724	ENST00000395297	T	0.43688	0.94	5.92	5.92	0.95590	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.64402	D	0.000001	T	0.51787	0.1695	L	0.28274	0.84	0.58432	D	0.999994	D	0.76494	0.999	D	0.64687	0.928	T	0.42224	-0.9464	10	0.36615	T	0.2	-10.8016	19.3054	0.94161	0.0:1.0:0.0:0.0	.	1308	Q49AJ0	F135B_HUMAN	I	1308	ENSP00000378710:V1308I	ENSP00000378710:V1308I	V	-	1	0	FAM135B	139218665	1.000000	0.71417	0.915000	0.36163	0.908000	0.53690	6.034000	0.70933	2.801000	0.96364	0.650000	0.86243	GTC		0.428	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
ARHGEF10	9639	broad.mit.edu	37	8	1833856	1833856	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:1833856G>A	ENST00000398564.1	+	11	1240	c.1240G>A	c.(1240-1242)Ggt>Agt	p.G414S	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.G414S|ARHGEF10_ENST00000398560.1_Missense_Mutation_p.G375S|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.G414S|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.G351S|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.G389S			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	414					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G414S(1)|p.G166S(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GATGCCCGAGGGTTTATCTCA	0.458																																					p.G389S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1165A	8						.						64.0	63.0	63.0					8																	1833856		2203	4300	6503	1821263	SO:0001583	missense	9639	exon11			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1240G>A	8.37:g.1833856G>A	ENSP00000381571:p.Gly414Ser		1821263	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37		.	.	.	.	.	.	.	.	.	.	g	21.2	4.107979	0.77096	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.12	5.12	0.69794	Dbl homology (DH) domain (2);	0.057776	0.64402	D	0.000002	T	0.58991	0.2161	M	0.80982	2.52	0.58432	D	0.999999	D;D;D;D	0.71674	0.973;0.987;0.984;0.998	P;P;P;D	0.71414	0.685;0.87;0.82;0.973	T	0.63116	-0.6709	10	0.52906	T	0.07	-36.2965	18.5413	0.91029	0.0:0.0:1.0:0.0	.	414;375;351;389	O15013;E9PB39;O15013-7;O15013-5	ARHGA_HUMAN;.;.;.	S	389;351;414;375;414;414;62	ENSP00000340297:G389S;ENSP00000427909:G351S;ENSP00000431012:G414S;ENSP00000381568:G375S;ENSP00000381571:G414S;ENSP00000262112:G414S;ENSP00000427768:G62S	ENSP00000262112:G414S	G	+	1	0	ARHGEF10	1821263	1.000000	0.71417	0.068000	0.19968	0.377000	0.30045	8.005000	0.88553	2.367000	0.80283	0.655000	0.94253	GGT		0.458	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			
ARHGEF10	9639	broad.mit.edu	37	8	1876698	1876698	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:1876698A>G	ENST00000398564.1	+	24	2878	c.2878A>G	c.(2878-2880)Atg>Gtg	p.M960V	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.M931V|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.M959V|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.M897V|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.M935V			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	960					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.M960V(1)|p.M712V(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CATCCTGTGCATGCTGTACGT	0.562																																					p.M935V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2803G	8						.						146.0	137.0	140.0					8																	1876698		2203	4300	6503	1864105	SO:0001583	missense	9639	exon24			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.2878A>G	8.37:g.1876698A>G	ENSP00000381571:p.Met960Val		1864105	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37		.	.	.	.	.	.	.	.	.	.	A	16.70	3.195662	0.58126	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.23;0.23	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	M	0.66297	2.02	0.80722	D	1	D;B	0.63046	0.992;0.357	D;B	0.75484	0.986;0.321	T	0.72491	-0.4277	10	0.35671	T	0.21	-65.0388	15.6689	0.77258	1.0:0.0:0.0:0.0	.	897;935	O15013-7;O15013-5	.;.	V	935;897;959;960;931;579	ENSP00000340297:M935V;ENSP00000427909:M897V;ENSP00000431012:M959V;ENSP00000381571:M960V;ENSP00000262112:M931V;ENSP00000427768:M579V	ENSP00000262112:M931V	M	+	1	0	ARHGEF10	1864105	1.000000	0.71417	0.990000	0.47175	0.271000	0.26615	8.528000	0.90598	2.093000	0.63338	0.533000	0.62120	ATG		0.562	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			
CSMD1	64478	broad.mit.edu	37	8	2836296	2836296	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:2836296C>A	ENST00000520002.1	-	56	8962	c.8407G>T	c.(8407-8409)Gtg>Ttg	p.V2803L	CSMD1_ENST00000542608.1_Missense_Mutation_p.V2744L|CSMD1_ENST00000602723.1_Missense_Mutation_p.V2745L|CSMD1_ENST00000400186.3_Missense_Mutation_p.V2745L|CSMD1_ENST00000537824.1_Missense_Mutation_p.V2802L|CSMD1_ENST00000602557.1_Missense_Mutation_p.V2803L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2803	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.V2802L(1)|p.V2531L(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCATTTTCCACAAAGCCTGGA	0.398																																					p.C2802F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G8405T	8						.						65.0	59.0	61.0					8																	2836296		1870	4094	5964	2823703	SO:0001583	missense	64478	exon55					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8407G>T	8.37:g.2836296C>A	ENSP00000430733:p.Val2803Leu		2823703	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.52|16.52	3.145318|3.145318	0.57044|0.57044	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.64260	.|-0.09;-0.09;-0.09;-0.09	5.17|5.17	5.17|5.17	0.71159|0.71159	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.67021|0.67021	0.2849|0.2849	N|N	0.25245|0.25245	0.725|0.725	0.80722|0.80722	D|D	1|1	.|P;B;D	.|0.71674	.|0.906;0.011;0.998	.|P;B;D	.|0.81914	.|0.629;0.05;0.995	T|T	0.61826|0.61826	-0.6983|-0.6983	5|10	.|0.15952	.|T	.|0.53	.|.	18.6748|18.6748	0.91525|0.91525	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2803;2803;2744	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	F|L	2219|2745;2803;2664;2802;2744	.|ENSP00000383047:V2745L;ENSP00000430733:V2803L;ENSP00000441462:V2802L;ENSP00000446243:V2744L	.|ENSP00000320445:V2664L	C|V	-|-	2|1	0|0	CSMD1|CSMD1	2823703|2823703	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.843000|0.843000	0.47879|0.47879	5.503000|5.503000	0.66962|0.66962	2.400000|2.400000	0.81607|0.81607	0.563000|0.563000	0.77884|0.77884	TGT|GTG		0.398	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PCM1	5108	broad.mit.edu	37	8	17804814	17804814	+	Silent	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:17804814T>C	ENST00000519253.1	+	7	1154	c.903T>C	c.(901-903)gcT>gcC	p.A301A	PCM1_ENST00000518537.1_Silent_p.A340A|PCM1_ENST00000524226.1_Silent_p.A301A|PCM1_ENST00000325083.8_Silent_p.A301A			Q15154	PCM1_HUMAN	pericentriolar material 1	301					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)	p.A301A(1)	PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		GACGGCAGGCTGCACTTCTAG	0.398			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.A301A			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T903C	8						.						154.0	150.0	151.0					8																	17804814		1931	4130	6061	17849094	SO:0001819	synonymous_variant	5108	exon7				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.903T>C	8.37:g.17804814T>C			17849094	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Silent	SNP	ENST00000519253.1	37																																																																																					0.398	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
POLR3D	661	broad.mit.edu	37	8	22106000	22106000	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:22106000G>A	ENST00000397802.4	+	5	708	c.493G>A	c.(493-495)Gat>Aat	p.D165N	POLR3D_ENST00000306433.4_Missense_Mutation_p.D165N			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	165					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.D165N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GCAGTTCCTCGATGACCCCGG	0.517																																					p.D165N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G493A	8						.						92.0	101.0	98.0					8																	22106000		2203	4300	6503	22161945	SO:0001583	missense	661	exon6			M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.493G>A	8.37:g.22106000G>A	ENSP00000380904:p.Asp165Asn		22161945	NM_001722	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Missense_Mutation	SNP	ENST00000397802.4	37	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571594	0.86542	.	.	ENSG00000168495	ENST00000306433;ENST00000519237;ENST00000397802	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	M	0.68593	2.085	0.80722	D	1	D	0.62365	0.991	P	0.48488	0.579	T	0.62402	-0.6862	9	0.31617	T	0.26	-12.7203	19.0137	0.92884	0.0:0.0:1.0:0.0	.	165	P05423	RPC4_HUMAN	N	165	.	ENSP00000303088:D165N	D	+	1	0	POLR3D	22161945	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.314000	0.96306	2.782000	0.95742	0.655000	0.94253	GAT		0.517	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722	
ENTPD4	9583	broad.mit.edu	37	8	23294509	23294509	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:23294509T>C	ENST00000358689.4	-	10	1547	c.1312A>G	c.(1312-1314)Acc>Gcc	p.T438A	ENTPD4_ENST00000521321.1_5'Flank|ENTPD4_ENST00000356206.6_Missense_Mutation_p.T430A|ENTPD4_ENST00000417069.2_Missense_Mutation_p.T430A	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	438					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)	p.T438A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		ACATCCTCGGTGCAGTAGTAG	0.478																																					p.T438A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1312G	8						.						128.0	134.0	132.0					8																	23294509		2203	4300	6503	23350454	SO:0001583	missense	9583	exon10			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1312A>G	8.37:g.23294509T>C	ENSP00000351520:p.Thr438Ala		23350454	NM_004901	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	37	CCDS6041.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.669266	0.88348	.	.	ENSG00000197217	ENST00000518471;ENST00000356206;ENST00000358689;ENST00000417069	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	L	0.49571	1.57	0.80722	D	1	P;P;P	0.52170	0.932;0.951;0.932	P;P;P	0.53649	0.731;0.702;0.731	T	0.00487	-1.1710	10	0.40728	T	0.16	-24.7932	14.5787	0.68271	0.0:0.0:0.0:1.0	.	430;430;438	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	A	33;430;438;430	ENSP00000430579:T33A;ENSP00000348536:T430A;ENSP00000351520:T438A;ENSP00000408573:T430A	ENSP00000348536:T430A	T	-	1	0	ENTPD4	23350454	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.125000	0.65367	0.379000	0.24179	ACC		0.478	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
LEPROTL1	23484	broad.mit.edu	37	8	29963355	29963355	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:29963355G>A	ENST00000321250.8	+	4	488	c.373G>A	c.(373-375)Gac>Aac	p.D125N	LEPROTL1_ENST00000523116.1_Intron|LEPROTL1_ENST00000518192.1_Missense_Mutation_p.D148N|LEPROTL1_ENST00000518001.1_Missense_Mutation_p.D64N|LEPROTL1_ENST00000442880.2_Intron	NM_015344.2	NP_056159.2	O95214	LERL1_HUMAN	leptin receptor overlapping transcript-like 1	125						integral component of membrane (GO:0016021)		p.D125N(1)		endometrium(1)|kidney(1)|large_intestine(3)	5				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		AAGCAATGACGACTTCAGCTG	0.448																																					p.D125N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373A	8						.						159.0	151.0	154.0					8																	29963355		2203	4300	6503	30082897	SO:0001583	missense	23484	exon4			AF063605	CCDS6075.1, CCDS47834.1	8p12	2014-09-11			ENSG00000104660	ENSG00000104660			6555	protein-coding gene	gene with protein product		607338				11342119	Standard	NM_015344		Approved	my047, Vps55	uc003xhx.2	O95214	OTTHUMG00000163820	ENST00000321250.8:c.373G>A	8.37:g.29963355G>A	ENSP00000314625:p.Asp125Asn		30082897	NM_015344	E9PHP8|Q9BW48	Missense_Mutation	SNP	ENST00000321250.8	37	CCDS6075.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764084	0.69878	.	.	ENSG00000104660	ENST00000321250;ENST00000518001;ENST00000518192	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84410	0.5466	M	0.88377	2.95	0.54753	D	0.999987	D	0.76494	0.999	D	0.70487	0.969	D	0.87195	0.2237	9	0.87932	D	0	.	17.0544	0.86529	0.0:0.0:1.0:0.0	.	125	O95214	LERL1_HUMAN	N	125;64;148	.	ENSP00000314625:D125N	D	+	1	0	LEPROTL1	30082897	1.000000	0.71417	0.990000	0.47175	0.565000	0.35776	7.572000	0.82409	2.611000	0.88343	0.455000	0.32223	GAC		0.448	LEPROTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375771.2		
TEX15	56154	broad.mit.edu	37	8	30705146	30705146	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:30705146C>A	ENST00000256246.2	-	1	1462	c.1388G>T	c.(1387-1389)aGc>aTc	p.S463I	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	463					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.S463I(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TATATCATTGCTTAACTGTGA	0.338																																					p.S463I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1388T	8						.						176.0	173.0	174.0					8																	30705146		2203	4300	6503	30824688	SO:0001583	missense	56154	exon1			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1388G>T	8.37:g.30705146C>A	ENSP00000256246:p.Ser463Ile		30824688	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075991	0.36662	.	.	ENSG00000133863	ENST00000256246	T	0.10960	2.82	5.61	-1.16	0.09678	.	0.739355	0.13023	N	0.419927	T	0.07369	0.0186	N	0.19112	0.55	0.09310	N	1	B	0.25105	0.118	B	0.27715	0.082	T	0.35076	-0.9803	10	0.87932	D	0	.	9.8359	0.40968	0.0:0.6047:0.0:0.3953	.	463	Q9BXT5	TEX15_HUMAN	I	463	ENSP00000256246:S463I	ENSP00000256246:S463I	S	-	2	0	TEX15	30824688	0.000000	0.05858	0.002000	0.10522	0.154000	0.21943	-0.057000	0.11768	-0.053000	0.13289	-0.295000	0.09555	AGC		0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
PLEKHA2	59339	broad.mit.edu	37	8	38810831	38810831	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:38810831G>A	ENST00000420274.1	+	9	953	c.719G>A	c.(718-720)cGc>cAc	p.R240H	PLEKHA2_ENST00000521746.1_Intron|PLEKHA2_ENST00000388745.4_3'UTR	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	240	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)	p.R240H(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			GAACCACTGCGCACCATATTT	0.463																																					p.R240H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G719A	8						.						232.0	222.0	225.0					8																	38810831		1945	4134	6079	38929988	SO:0001583	missense	59339	exon9			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.719G>A	8.37:g.38810831G>A	ENSP00000393860:p.Arg240His		38929988	NM_021623		Missense_Mutation	SNP	ENST00000420274.1	37		.	.	.	.	.	.	.	.	.	.	G	26.6	4.755599	0.89843	.	.	ENSG00000169499	ENST00000420274;ENST00000535929	T	0.12361	2.69	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.01078	-1.1459	10	0.45353	T	0.12	.	16.7947	0.85598	0.0:0.0:1.0:0.0	.	240;240	Q9HB19;A8K727	PKHA2_HUMAN;.	H	240;190	ENSP00000393860:R240H	ENSP00000393860:R240H	R	+	2	0	PLEKHA2	38929988	1.000000	0.71417	0.986000	0.45419	0.841000	0.47740	6.819000	0.75262	2.778000	0.95560	0.655000	0.94253	CGC		0.463	PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021623	
ANK1	286	broad.mit.edu	37	8	41557016	41557016	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:41557016C>T	ENST00000347528.4	-	23	2595	c.2512G>A	c.(2512-2514)Gat>Aat	p.D838N	ANK1_ENST00000396945.1_Missense_Mutation_p.D838N|ANK1_ENST00000396942.1_Missense_Mutation_p.D838N|ANK1_ENST00000265709.8_Missense_Mutation_p.D879N|ANK1_ENST00000379758.2_Missense_Mutation_p.D838N|ANK1_ENST00000289734.7_Missense_Mutation_p.D838N|ANK1_ENST00000352337.4_Missense_Mutation_p.D838N	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	838					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D838N(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TTCTCTTCATCAACATCCCTG	0.577																																					p.D838N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2512A	8						.						124.0	116.0	119.0					8																	41557016		2203	4300	6503	41676173	SO:0001583	missense	286	exon23			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2512G>A	8.37:g.41557016C>T	ENSP00000339620:p.Asp838Asn		41676173	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432016	0.25813	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66099	-0.15;-0.15;-0.13;-0.11;-0.13;-0.11;-0.19	5.49	4.6	0.57074	.	0.158505	0.56097	D	0.000038	T	0.66317	0.2777	M	0.79693	2.465	0.42388	D	0.992511	B;B;B;B;B;B	0.29508	0.246;0.014;0.003;0.211;0.246;0.009	B;B;B;B;B;B	0.37780	0.258;0.017;0.007;0.187;0.258;0.007	T	0.62671	-0.6805	10	0.18276	T	0.48	.	12.838	0.57784	0.1631:0.8368:0.0:0.0	.	879;838;838;838;838;154	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	N	838;838;838;838;838;838;879;838	ENSP00000339620:D838N;ENSP00000289734:D838N;ENSP00000369082:D838N;ENSP00000380149:D838N;ENSP00000380147:D838N;ENSP00000309131:D838N;ENSP00000265709:D879N	ENSP00000265709:D879N	D	-	1	0	ANK1	41676173	0.945000	0.32115	0.791000	0.31998	0.032000	0.12392	1.969000	0.40510	1.296000	0.44742	0.655000	0.94253	GAT		0.577	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
PRKDC	5591	broad.mit.edu	37	8	48701525	48701525	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:48701525G>A	ENST00000314191.2	-	77	10897	c.10841C>T	c.(10840-10842)gCa>gTa	p.A3614V	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.A3614V	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3615					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.A3615V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ACCCAAGGCTGCATACATTCT	0.428								Non-homologous end-joining																													p.Q3615X	Esophageal Squamous(79;1091 1253 12329 31680 40677)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10843T	8						.						86.0	80.0	82.0					8																	48701525		1796	4064	5860	48864078	SO:0001583	missense	5591	exon76				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10841C>T	8.37:g.48701525G>A	ENSP00000313420:p.Ala3614Val		48864078	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	G	9.001	0.980136	0.18812	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02552	4.33;4.25	5.79	4.86	0.63082	.	0.240058	0.42821	D	0.000647	T	0.05273	0.0140	M	0.65975	2.015	0.09310	N	1	B;B	0.25441	0.126;0.009	B;B	0.24701	0.055;0.016	T	0.19679	-1.0298	10	0.32370	T	0.25	.	14.5456	0.68027	0.0:0.0:0.7896:0.2104	.	3614;3615	E7EUY0;P78527	.;PRKDC_HUMAN	V	3614	ENSP00000313420:A3614V;ENSP00000345182:A3614V	ENSP00000313420:A3614V	A	-	2	0	PRKDC	48864078	0.121000	0.22262	0.016000	0.15963	0.148000	0.21650	2.722000	0.47269	2.891000	0.99171	0.655000	0.94253	GCA		0.428	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PXDNL	137902	broad.mit.edu	37	8	52336137	52336137	+	Missense_Mutation	SNP	G	G	A	rs200870550		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:52336137G>A	ENST00000356297.4	-	14	1893	c.1793C>T	c.(1792-1794)aCg>aTg	p.T598M	PXDNL_ENST00000543296.1_Missense_Mutation_p.T598M	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	598					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.T598M(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ACACCTACCCGTGACTGTAAG	0.443													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14865	0.0		0.0	False		,,,				2504	0.0				p.T598M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1793T	8						.	G	MET/THR	0,4098		0,0,2049	95.0	99.0	98.0		1793	-1.3	0.0	8		98	1,8399		0,1,4199	yes	missense	PXDNL	NM_144651.4	81	0,1,6248	AA,AG,GG		0.0119,0.0,0.0080	possibly-damaging	598/1464	52336137	1,12497	2049	4200	6249	52498690	SO:0001583	missense	137902	exon14				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1793C>T	8.37:g.52336137G>A	ENSP00000348645:p.Thr598Met		52498690	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	12.42	1.932946	0.34096	0.0	1.19E-4	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.77750	-1.12;-1.12	4.59	-1.32	0.09201	.	.	.	.	.	T	0.51584	0.1683	N	0.08118	0	0.09310	N	1	D	0.53885	0.963	B	0.35770	0.21	T	0.49173	-0.8967	9	0.56958	D	0.05	.	9.0395	0.36309	0.3845:0.0:0.6155:0.0	.	598	A1KZ92	PXDNL_HUMAN	M	598	ENSP00000348645:T598M;ENSP00000444865:T598M	ENSP00000348645:T598M	T	-	2	0	PXDNL	52498690	0.052000	0.20516	0.000000	0.03702	0.023000	0.10783	0.243000	0.18106	-0.229000	0.09854	0.650000	0.86243	ACG		0.443	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
CHD7	55636	broad.mit.edu	37	8	61655611	61655611	+	Silent	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:61655611C>A	ENST00000423902.2	+	2	2099	c.1620C>A	c.(1618-1620)ctC>ctA	p.L540L	CHD7_ENST00000524602.1_Silent_p.L540L|CHD7_ENST00000525508.1_Silent_p.L540L	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	540	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.L540L(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGGCACAGCTCCACCCATCAC	0.567																																					p.L540L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1620A	8						.						76.0	88.0	84.0					8																	61655611		2121	4227	6348	61818165	SO:0001819	synonymous_variant	55636	exon2			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1620C>A	8.37:g.61655611C>A			61818165	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	CCDS47865.1																																																																																				0.567	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
CRISPLD1	83690	broad.mit.edu	37	8	75927084	75927084	+	Missense_Mutation	SNP	C	C	T	rs566911502		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:75927084C>T	ENST00000262207.4	+	6	1132	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	CRISPLD1_ENST00000517786.1_Missense_Mutation_p.R36W|CRISPLD1_ENST00000523524.1_Missense_Mutation_p.R34W	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	222					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R222W(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CAAACATGGGCGGCCCTGTTC	0.423																																					p.R222W												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C664T	8						.						52.0	48.0	50.0					8																	75927084		2203	4300	6503	76089639	SO:0001583	missense	83690	exon6			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.664C>T	8.37:g.75927084C>T	ENSP00000262207:p.Arg222Trp		76089639	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702661	0.68501	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;D	0.83250	0.2;-1.34;-1.7	4.6	3.69	0.42338	.	0.171361	0.46442	D	0.000284	T	0.79747	0.4499	L	0.49126	1.545	0.38547	D	0.949369	D;P	0.56968	0.978;0.903	B;B	0.43623	0.425;0.2	T	0.83052	-0.0152	10	0.72032	D	0.01	.	13.595	0.61984	0.1616:0.8384:0.0:0.0	.	36;222	B7Z929;Q9H336	.;CRLD1_HUMAN	W	222;34;36	ENSP00000262207:R222W;ENSP00000430105:R34W;ENSP00000429746:R36W	ENSP00000262207:R222W	R	+	1	2	CRISPLD1	76089639	0.107000	0.21998	0.873000	0.34254	0.895000	0.52256	1.508000	0.35769	1.085000	0.41206	0.460000	0.39030	CGG		0.423	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
CDH17	1015	broad.mit.edu	37	8	95164230	95164230	+	Silent	SNP	C	C	T	rs149027046		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:95164230C>T	ENST00000027335.3	-	13	1786	c.1662G>A	c.(1660-1662)acG>acA	p.T554T	CDH17_ENST00000450165.2_Silent_p.T554T|CDH17_ENST00000441892.2_Silent_p.T340T	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	554	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.T554T(2)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCACAATAAGCGTGAACTTGG	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		22297	0.0		0.001	False		,,,				2504	0.0				p.T554T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G1662A	8						.	C	,	1,4405	2.1+/-5.4	0,1,2202	157.0	135.0	142.0		1662,1662	-5.9	0.0	8	dbSNP_134	142	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CDH17	NM_001144663.1,NM_004063.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	554/833,554/833	95164230	1,13005	2203	4300	6503	95233406	SO:0001819	synonymous_variant	1015	exon13			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1662G>A	8.37:g.95164230C>T			95233406	NM_001144663	Q15336|Q2M2E0	Silent	SNP	ENST00000027335.3	37	CCDS6260.1																																																																																				0.423	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
ESRP1	54845	broad.mit.edu	37	8	95690487	95690487	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:95690487G>A	ENST00000433389.2	+	13	1898	c.1708G>A	c.(1708-1710)Gct>Act	p.A570T	ESRP1_ENST00000454170.2_Missense_Mutation_p.A570T|ESRP1_ENST00000423620.2_Missense_Mutation_p.A566T|ESRP1_ENST00000358397.5_Missense_Mutation_p.A566T	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	570					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)	p.A570T(1)	ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TCCTACAGAAGCTGCCATTTA	0.488																																					p.A566T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1696A	8						.						106.0	104.0	104.0					8																	95690487		1982	4168	6150	95759663	SO:0001583	missense	54845	exon13			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1708G>A	8.37:g.95690487G>A	ENSP00000405738:p.Ala570Thr		95759663	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.83|17.83	3.484752|3.484752	0.63962|0.63962	.|.	.|.	ENSG00000104413|ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610|ENST00000519505	T;T;T;T;T|.	0.13089|.	2.84;2.81;2.81;2.83;2.62|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.047260|.	0.85682|.	D|.	0.000000|.	T|T	0.67002|0.67002	0.2847|0.2847	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	P;P;B;B;B;P|.	0.47545|.	0.897;0.526;0.123;0.409;0.184;0.598|.	P;B;B;B;B;B|.	0.54346|.	0.749;0.386;0.144;0.168;0.165;0.316|.	T|T	0.61787|0.61787	-0.6991|-0.6991	10|5	0.27082|.	T|.	0.32|.	-14.4282|-14.4282	19.4592|19.4592	0.94910|0.94910	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	570;570;570;566;566;570|.	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1|.	.;.;.;.;.;ESRP1_HUMAN|.	T|N	566;570;566;570;429|435	ENSP00000407349:A566T;ENSP00000405738:A570T;ENSP00000351168:A566T;ENSP00000402766:A570T;ENSP00000429125:A429T|.	ENSP00000351168:A566T|.	A|S	+|+	1|2	0|0	ESRP1|ESRP1	95759663|95759663	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	7.719000|7.719000	0.84751|0.84751	2.656000|2.656000	0.90262|0.90262	0.655000|0.655000	0.94253|0.94253	GCT|AGC		0.488	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
ZNF34	80778	broad.mit.edu	37	8	145998821	145998821	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr8:145998821A>G	ENST00000343459.4	-	6	1578	c.1513T>C	c.(1513-1515)Tgc>Cgc	p.C505R	ZNF34_ENST00000429371.2_Missense_Mutation_p.C484R			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C505R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		CAATCGCTGCATCTGTAGGGT	0.562																																					p.C505R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1513C	8						.						143.0	137.0	139.0					8																	145998821		2203	4300	6503	145969625	SO:0001583	missense	80778	exon6			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.1513T>C	8.37:g.145998821A>G	ENSP00000341528:p.Cys505Arg		145969625	NM_030580	D3DWN1|Q9BSZ0	Missense_Mutation	SNP	ENST00000343459.4	37	CCDS47945.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545719	0.45280	.	.	ENSG00000196378	ENST00000449516;ENST00000527190;ENST00000343459;ENST00000429371	D;D	0.85258	-1.96;-1.96	3.54	3.54	0.40534	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35207	N	0.003364	D	0.94555	0.8246	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95552	0.8621	10	0.87932	D	0	.	11.9837	0.53133	1.0:0.0:0.0:0.0	.	464;505	E7EN25;Q8IZ26	.;ZNF34_HUMAN	R	464;434;505;484	ENSP00000341528:C505R;ENSP00000396894:C484R	ENSP00000341528:C505R	C	-	1	0	ZNF34	145969625	0.995000	0.38212	0.027000	0.17364	0.331000	0.28603	4.188000	0.58351	1.818000	0.53035	0.460000	0.39030	TGC		0.562	ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580	
COL15A1	1306	broad.mit.edu	37	9	101765754	101765754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:101765754C>T	ENST00000375001.3	+	8	1508	c.1085C>T	c.(1084-1086)gCg>gTg	p.A362V		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	362	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.A362V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GCAACAGCAGCGGGGCTGGCC	0.582																																					p.A362V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1085T	9						.						77.0	82.0	80.0					9																	101765754		2203	4300	6503	100805575	SO:0001583	missense	1306	exon8			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1085C>T	9.37:g.101765754C>T	ENSP00000364140:p.Ala362Val		100805575	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	3.922	-0.017883	0.07681	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90900	-2.75	3.57	1.63	0.23807	.	3.066200	0.00843	N	0.001768	D	0.82637	0.5080	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.68345	-0.5433	10	0.25106	T	0.35	-0.7227	6.7373	0.23417	0.1731:0.7209:0.0:0.1059	.	362	P39059	COFA1_HUMAN	V	362;332	ENSP00000364140:A362V	ENSP00000364140:A362V	A	+	2	0	COL15A1	100805575	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.889000	0.28282	0.121000	0.18284	-1.134000	0.01955	GCG		0.582	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
ZNF462	58499	broad.mit.edu	37	9	109687976	109687976	+	Missense_Mutation	SNP	G	G	A	rs201536868		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:109687976G>A	ENST00000277225.5	+	3	2072	c.1783G>A	c.(1783-1785)Gca>Aca	p.A595T	ZNF462_ENST00000457913.1_Missense_Mutation_p.A595T|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	595					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A595T(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CACACAAGCCGCACCTCTGCA	0.547																																					p.A595T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1783A	9						.						176.0	171.0	173.0					9																	109687976		2203	4300	6503	108727797	SO:0001583	missense	58499	exon3			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1783G>A	9.37:g.109687976G>A	ENSP00000277225:p.Ala595Thr		108727797	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	8.905	0.957328	0.18507	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.23754	1.89;1.89	5.49	3.59	0.41128	.	0.337088	0.26126	N	0.026200	T	0.13157	0.0319	N	0.08118	0	0.80722	D	1	B;B	0.20052	0.041;0.024	B;B	0.16289	0.015;0.007	T	0.06698	-1.0812	9	.	.	.	.	14.2048	0.65728	0.0:0.7015:0.2985:0.0	.	595;595	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	T	595	ENSP00000277225:A595T;ENSP00000414570:A595T	.	A	+	1	0	ZNF462	108727797	0.039000	0.19947	0.998000	0.56505	0.464000	0.32679	0.486000	0.22340	0.745000	0.32763	-0.165000	0.13383	GCA		0.547	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
KIAA0368	23392	broad.mit.edu	37	9	114184268	114184268	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:114184268G>A	ENST00000338205.5	-	14	1607	c.1388C>T	c.(1387-1389)gCg>gTg	p.A463V	KIAA0368_ENST00000259335.4_Missense_Mutation_p.A641V			Q5VYK3	ECM29_HUMAN	KIAA0368	469					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.A641V(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						AGTACTATACGCTCCAACCAT	0.453																																					p.A641V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1922T	9						.						81.0	75.0	77.0					9																	114184268		1886	4115	6001	113224089	SO:0001583	missense	23392	exon16			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1388C>T	9.37:g.114184268G>A	ENSP00000339889:p.Ala463Val		113224089	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	G	35	5.538349	0.96460	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.52754	0.65	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69296	0.3095	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.64508	-0.6391	10	0.30854	T	0.27	.	19.9052	0.97004	0.0:0.0:1.0:0.0	.	469	Q5VYK3	ECM29_HUMAN	V	463;641	ENSP00000259335:A641V	ENSP00000259335:A641V	A	-	2	0	KIAA0368	113224089	1.000000	0.71417	0.970000	0.41538	0.834000	0.47266	9.420000	0.97426	2.776000	0.95493	0.655000	0.94253	GCG		0.453	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
PTBP3	9991	broad.mit.edu	37	9	115030439	115030439	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:115030439T>C	ENST00000374255.2	-	5	472	c.325A>G	c.(325-327)Act>Gct	p.T109A	PTBP3_ENST00000343327.2_Missense_Mutation_p.T14A|PTBP3_ENST00000334318.6_Missense_Mutation_p.T112A|PTBP3_ENST00000487997.1_5'UTR|PTBP3_ENST00000374257.1_Missense_Mutation_p.T81A|PTBP3_ENST00000458258.1_Missense_Mutation_p.T115A			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	109	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T109A(1)									TTCACCATAGTAACGGCAGCT	0.368																																					p.T112A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A334G	9						.						81.0	81.0	81.0					9																	115030439		2203	4300	6503	114070260	SO:0001583	missense	9991	exon5			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.325A>G	9.37:g.115030439T>C	ENSP00000363373:p.Thr109Ala		114070260	NM_001163790	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	ENST00000374255.2	37	CCDS6784.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.879953	0.51801	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327;ENST00000210227	T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.48	5.48	0.80851	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.152797	0.64402	D	0.000020	T	0.65291	0.2677	L	0.42245	1.32	0.42767	D	0.993829	B;B;B;B;B;B	0.26195	0.014;0.039;0.005;0.144;0.006;0.013	B;B;B;B;B;B	0.27608	0.057;0.037;0.043;0.081;0.038;0.023	T	0.60687	-0.7214	10	0.16896	T	0.51	-5.698	11.8592	0.52457	0.1307:0.0:0.0:0.8693	.	81;81;14;112;109;115	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	A	81;112;115;109;14;115	ENSP00000363375:T81A;ENSP00000334499:T112A;ENSP00000414921:T115A;ENSP00000363373:T109A;ENSP00000340705:T14A;ENSP00000210227:T115A	ENSP00000210227:T115A	T	-	1	0	ROD1	114070260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.901000	0.56303	2.063000	0.61619	0.528000	0.53228	ACT		0.368	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053679.1		
PAPPA	5069	broad.mit.edu	37	9	118949512	118949512	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:118949512C>A	ENST00000328252.3	+	2	864	c.495C>A	c.(493-495)aaC>aaA	p.N165K	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	165					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N165K(2)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ACCAAGACAACAAAGACCCAC	0.527																																					p.N165K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C495A	9						.						87.0	85.0	86.0					9																	118949512		2203	4300	6503	117989333	SO:0001583	missense	5069	exon2				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.495C>A	9.37:g.118949512C>A	ENSP00000330658:p.Asn165Lys		117989333	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	1.610	-0.524298	0.04141	.	.	ENSG00000182752	ENST00000328252	T	0.74526	-0.85	6.07	5.08	0.68730	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.124726	0.64402	D	0.000001	T	0.62429	0.2427	L	0.45698	1.435	0.80722	D	1	B	0.17038	0.02	B	0.27796	0.083	T	0.51903	-0.8646	10	0.02654	T	1	-31.7104	8.7578	0.34656	0.0:0.7201:0.1542:0.1256	.	165	Q13219	PAPP1_HUMAN	K	165	ENSP00000330658:N165K	ENSP00000330658:N165K	N	+	3	2	PAPPA	117989333	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.258000	0.32944	2.884000	0.98904	0.655000	0.94253	AAC		0.527	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
DENND1A	57706	broad.mit.edu	37	9	126392730	126392730	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:126392730G>A	ENST00000373624.2	-	10	845	c.644C>T	c.(643-645)gCg>gTg	p.A215V	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394215.2_Missense_Mutation_p.A185V|DENND1A_ENST00000394219.3_Missense_Mutation_p.A183V|DENND1A_ENST00000373618.1_Missense_Mutation_p.A183V|DENND1A_ENST00000373620.3_Missense_Mutation_p.A215V|DENND1A_ENST00000542603.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	215	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A215V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GAGCATCGCCGCAGACCCGTG	0.562																																					p.A215V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C644T	9						.						33.0	30.0	31.0					9																	126392730		2203	4299	6502	125432551	SO:0001583	missense	57706	exon10			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.644C>T	9.37:g.126392730G>A	ENSP00000362727:p.Ala215Val		125432551	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678000	0.68042	.	.	ENSG00000119522	ENST00000373624;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	5.44	5.44	0.79542	DENN (3);	0.055824	0.64402	D	0.000001	T	0.08223	0.0205	L	0.28274	0.84	0.58432	D	0.999999	P;B;P;P;P;B;P	0.43788	0.498;0.115;0.474;0.817;0.676;0.411;0.767	B;B;B;B;B;B;B	0.37451	0.053;0.043;0.026;0.25;0.078;0.082;0.224	T	0.30995	-0.9959	10	0.09084	T	0.74	-15.9706	18.2509	0.90002	0.0:0.0:1.0:0.0	.	183;215;183;185;215;215;113	Q8TEH3-6;Q8TEH3-7;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3;Q9HCG4	.;.;.;.;.;DEN1A_HUMAN;.	V	215;183;215;185;183	ENSP00000362727:A215V;ENSP00000377766:A183V;ENSP00000362722:A215V;ENSP00000377763:A185V;ENSP00000362720:A183V	ENSP00000362720:A183V	A	-	2	0	DENND1A	125432551	1.000000	0.71417	0.524000	0.27887	0.910000	0.53928	9.627000	0.98412	2.536000	0.85505	0.655000	0.94253	GCG		0.562	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
ANGPTL2	23452	broad.mit.edu	37	9	129870365	129870365	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:129870365G>A	ENST00000373425.3	-	2	1263	c.646C>T	c.(646-648)Cca>Tca	p.P216S	RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000373436.1_Intron|ANGPTL2_ENST00000491991.1_5'Flank|RALGPS1_ENST00000394022.3_Intron|ANGPTL2_ENST00000373417.1_Intron|RALGPS1_ENST00000259351.5_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	216					multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.P216S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						GCGGGGGGTGGCTGGGGGACG	0.632																																					p.P216S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C646T	9						.						23.0	24.0	23.0					9																	129870365		2203	4300	6503	128910186	SO:0001583	missense	23452	exon2			AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.646C>T	9.37:g.129870365G>A	ENSP00000362524:p.Pro216Ser		128910186	NM_012098	Q5JT58|Q8NCH7	Missense_Mutation	SNP	ENST00000373425.3	37	CCDS6868.1	.	.	.	.	.	.	.	.	.	.	G	7.619	0.676359	0.14841	.	.	ENSG00000136859	ENST00000373425	T	0.45276	0.9	4.93	4.93	0.64822	.	0.162018	0.56097	D	0.000033	T	0.32793	0.0841	L	0.42245	1.32	0.80722	D	1	B	0.14805	0.011	B	0.12837	0.008	T	0.11179	-1.0598	10	0.07482	T	0.82	.	14.3478	0.66678	0.0:0.0:0.8424:0.1576	.	216	Q9UKU9	ANGL2_HUMAN	S	216	ENSP00000362524:P216S	ENSP00000362524:P216S	P	-	1	0	ANGPTL2	128910186	1.000000	0.71417	0.999000	0.59377	0.190000	0.23558	7.447000	0.80620	2.447000	0.82792	0.655000	0.94253	CCA		0.632	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054129.1	NM_012098	
ODF2	4957	broad.mit.edu	37	9	131246313	131246313	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:131246313C>T	ENST00000434106.3	+	11	1447	c.1084C>T	c.(1084-1086)Cgc>Tgc	p.R362C	ODF2_ENST00000448249.3_Missense_Mutation_p.R281C|ODF2_ENST00000351030.3_Missense_Mutation_p.R357C|ODF2_ENST00000372791.3_Missense_Mutation_p.R343C|ODF2_ENST00000546203.1_Missense_Mutation_p.R343C|ODF2_ENST00000372807.5_Missense_Mutation_p.R357C|ODF2_ENST00000604420.1_Missense_Mutation_p.R362C|ODF2_ENST00000393527.3_Missense_Mutation_p.R338C|ODF2_ENST00000372814.3_Missense_Mutation_p.R406C|ODF2_ENST00000393533.2_Missense_Mutation_p.R362C|ODF2_ENST00000444119.2_Missense_Mutation_p.R338C	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	362					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.R338C(2)|p.R362C(1)|p.R406C(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						TGAGAACAGTCGCCTGTGCAT	0.542																																					p.R387C												.	.	4	Substitution - Missense(4)	breast(3)|large_intestine(1)	c.C1159T	9						.						92.0	85.0	87.0					9																	131246313		2203	4300	6503	130286134	SO:0001583	missense	4957	exon10			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1084C>T	9.37:g.131246313C>T	ENSP00000403453:p.Arg362Cys		130286134	NM_153439	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344427	0.61073	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;1.21;0.86;0.86;0.86	5.8	3.98	0.46160	.	0.093544	0.85682	D	0.000000	T	0.62816	0.2459	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0;1.0;1.0;0.999;1.0;0.999	T	0.64149	-0.6475	10	0.87932	D	0	-12.0641	11.3762	0.49730	0.0:0.8526:0.0:0.1474	.	343;357;281;296;362;406;357;343;362;338	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	C	362;406;357;362;338;281;343;343	ENSP00000377166:R362C;ENSP00000361901:R406C;ENSP00000342581:R357C;ENSP00000361882:R362C;ENSP00000307781:R338C;ENSP00000396687:R281C;ENSP00000437579:R343C;ENSP00000361877:R343C	ENSP00000307781:R338C	R	+	1	0	ODF2	130286134	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	4.617000	0.61204	0.816000	0.34421	-0.140000	0.14226	CGC		0.542	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
PTPRD	5789	broad.mit.edu	37	9	8733791	8733791	+	Missense_Mutation	SNP	G	G	A	rs376714429		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:8733791G>A	ENST00000381196.4	-	9	596	c.53C>T	c.(52-54)aCg>aTg	p.T18M	PTPRD_ENST00000397606.3_Missense_Mutation_p.T18M|PTPRD_ENST00000397617.3_Missense_Mutation_p.T18M|PTPRD_ENST00000540109.1_Missense_Mutation_p.T18M|PTPRD_ENST00000355233.5_Missense_Mutation_p.T18M|PTPRD_ENST00000356435.5_Missense_Mutation_p.T18M|PTPRD_ENST00000486161.1_Missense_Mutation_p.T18M|PTPRD_ENST00000358503.5_Missense_Mutation_p.T18M|PTPRD_ENST00000360074.4_Missense_Mutation_p.T18M|PTPRD_ENST00000463477.1_Missense_Mutation_p.T18M|PTPRD_ENST00000537002.1_Missense_Mutation_p.T18M|PTPRD_ENST00000397611.3_Missense_Mutation_p.T18M	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	18					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T18M(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTCAGCATCCGTGCGGAGGAA	0.572										TSP Lung(15;0.13)																											p.T18M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C53T	9						.	G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	2,4332		0,2,2165	66.0	53.0	58.0		53,53,53,53,53,53	3.7	0.1	9		58	0,8458		0,0,4229	no	missense,missense,missense,missense,missense,missense	PTPRD	NM_001040712.2,NM_001171025.1,NM_002839.3,NM_130391.3,NM_130392.3,NM_130393.3	81,81,81,81,81,81	0,2,6394	AA,AG,GG		0.0,0.0461,0.0156	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	18/1503,18/1506,18/1913,18/1506,18/1507,18/1497	8733791	2,12790	2167	4229	6396	8723791	SO:0001583	missense	5789	exon1			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.53C>T	9.37:g.8733791G>A	ENSP00000370593:p.Thr18Met		8723791	NM_001040712	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077347	0.36662	4.61E-4	0.0	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606;ENST00000463477;ENST00000481079	T;T;T;T;T;T;T;T;T;T;T;T;T	0.73897	0.61;0.61;0.65;0.7;0.77;0.91;0.65;0.56;0.61;0.77;0.91;-0.51;-0.79	5.56	3.73	0.42828	.	0.559521	0.17373	N	0.176612	T	0.58821	0.2149	N	0.19112	0.55	0.23862	N	0.996636	B;B;B;B;B;B;B;B;B;B	0.30021	0.173;0.173;0.173;0.173;0.173;0.265;0.265;0.265;0.173;0.173	B;B;B;B;B;B;B;B;B;B	0.30646	0.045;0.045;0.045;0.045;0.045;0.098;0.098;0.118;0.055;0.024	T	0.43637	-0.9379	9	.	.	.	.	11.6434	0.51246	0.1427:0.0:0.8573:0.0	.	18;18;18;18;18;18;18;18;18;18	C9J8S8;Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;.;PTPRD_HUMAN	M	18	ENSP00000370593:T18M;ENSP00000348812:T18M;ENSP00000353187:T18M;ENSP00000351293:T18M;ENSP00000347373:T18M;ENSP00000380741:T18M;ENSP00000380735:T18M;ENSP00000440515:T18M;ENSP00000438164:T18M;ENSP00000417093:T18M;ENSP00000380731:T18M;ENSP00000417661:T18M;ENSP00000417890:T18M	.	T	-	2	0	PTPRD	8723791	0.845000	0.29573	0.081000	0.20488	0.946000	0.59487	3.829000	0.55760	0.712000	0.32039	0.655000	0.94253	ACG		0.572	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
BNC2	54796	broad.mit.edu	37	9	16436764	16436764	+	Nonsense_Mutation	SNP	G	G	T	rs373312409		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:16436764G>T	ENST00000380672.4	-	6	1485	c.1428C>A	c.(1426-1428)tgC>tgA	p.C476*	BNC2_ENST00000380667.2_Nonsense_Mutation_p.C409*|BNC2_ENST00000380666.2_Nonsense_Mutation_p.C476*|BNC2_ENST00000545497.1_Nonsense_Mutation_p.C381*	NM_017637.5	NP_060107.3			basonuclin 2									p.C476*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		AGACCATGTTGCAACCTTCAA	0.433																																					p.C476X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1428A	9						.						149.0	138.0	142.0					9																	16436764		2203	4300	6503	16426764	SO:0001587	stop_gained	54796	exon6			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1428C>A	9.37:g.16436764G>T	ENSP00000370047:p.Cys476*		16426764	NM_017637		Nonsense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	37	6.072988	0.97256	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	.	.	.	5.88	5.88	0.94601	.	0.040327	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1881	10.5802	0.45250	0.1421:0.0:0.8579:0.0	.	.	.	.	X	476;433;409;381;302;476;476	.	ENSP00000370041:C476X	C	-	3	2	BNC2	16426764	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.951000	0.63610	2.782000	0.95742	0.655000	0.94253	TGC		0.433	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
LINGO2	158038	broad.mit.edu	37	9	27950347	27950347	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:27950347C>T	ENST00000379992.2	-	6	772	c.323G>A	c.(322-324)cGt>cAt	p.R108H	LINGO2_ENST00000308675.3_Missense_Mutation_p.R108H	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	108						integral component of membrane (GO:0016021)		p.R108H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GCGGAGGGAACGCAGGTTAAA	0.438																																					p.R108H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G323A	9						.						167.0	166.0	166.0					9																	27950347		2203	4300	6503	27940347	SO:0001583	missense	158038	exon7			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.323G>A	9.37:g.27950347C>T	ENSP00000369328:p.Arg108His		27940347	NM_152570	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239637	0.58995	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.59772	0.24;0.24	5.87	5.87	0.94306	.	0.051038	0.85682	D	0.000000	T	0.50684	0.1630	L	0.57536	1.79	0.58432	D	0.999998	P	0.35793	0.521	B	0.28916	0.096	T	0.48658	-0.9016	9	.	.	.	.	13.7487	0.62894	0.0:0.9299:0.0:0.0701	.	108	Q7L985	LIGO2_HUMAN	H	108	ENSP00000369328:R108H;ENSP00000310126:R108H	.	R	-	2	0	LINGO2	27940347	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.769000	0.62300	2.941000	0.99782	0.655000	0.94253	CGT		0.438	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
DDX58	23586	broad.mit.edu	37	9	32457301	32457301	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:32457301C>T	ENST00000379883.2	-	18	2754	c.2597G>A	c.(2596-2598)cGa>cAa	p.R866Q	DDX58_ENST00000379868.1_Missense_Mutation_p.R663Q|DDX58_ENST00000542096.1_Missense_Mutation_p.R795Q|DDX58_ENST00000379882.1_Missense_Mutation_p.R821Q	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	866	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.R866Q(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		GCAGTTCTGTCGGGCACAGAA	0.403																																					p.R866Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2597A	9						.						116.0	110.0	112.0					9																	32457301		2203	4300	6503	32447301	SO:0001583	missense	23586	exon18			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2597G>A	9.37:g.32457301C>T	ENSP00000369213:p.Arg866Gln		32447301	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001002	0.35320	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.83	0.86	0.19042	C-terminal domain of RIG-I (1);	0.427403	0.21591	N	0.072089	T	0.25344	0.0616	L	0.60455	1.87	0.09310	N	1	D;D	0.55605	0.963;0.972	B;B	0.31547	0.126;0.132	T	0.35798	-0.9774	10	0.13853	T	0.58	-7.3219	8.0584	0.30619	0.0:0.4979:0.0:0.5021	.	795;866	B3KWW1;O95786	.;DDX58_HUMAN	Q	821;866;663;795	ENSP00000369212:R821Q;ENSP00000369213:R866Q;ENSP00000369197:R663Q;ENSP00000442160:R795Q	ENSP00000369197:R663Q	R	-	2	0	DDX58	32447301	0.000000	0.05858	0.125000	0.21846	0.902000	0.53008	-0.379000	0.07437	0.233000	0.21120	0.650000	0.86243	CGA		0.403	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
NOL6	65083	broad.mit.edu	37	9	33472349	33472349	+	Missense_Mutation	SNP	C	C	T	rs369599517		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:33472349C>T	ENST00000379471.2	-	2	203	c.116G>A	c.(115-117)cGt>cAt	p.R39H	NOL6_ENST00000455041.2_Missense_Mutation_p.R39H|NOL6_ENST00000464829.1_5'UTR			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	39					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R39H(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGCCAATGTACGCTTCCTGGA	0.552																																					p.R39H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G116A	9						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	126.0	102.0	110.0		116,116	1.1	0.0	9		110	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	NOL6	NM_022917.4,NM_139235.3	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	39/1147,39/700	33472349	2,13004	2203	4300	6503	33462349	SO:0001583	missense	65083	exon2			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.116G>A	9.37:g.33472349C>T	ENSP00000368784:p.Arg39His		33462349	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		.	.	.	.	.	.	.	.	.	.	C	12.96	2.093956	0.36952	0.0	2.33E-4	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.48836	0.8;1.4;1.39;1.34	5.04	1.07	0.20283	.	0.385127	0.30556	N	0.009368	T	0.32071	0.0817	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.20368	0.004;0.009;0.019;0.044;0.011	B;B;B;B;B	0.16289	0.002;0.002;0.009;0.015;0.002	T	0.23940	-1.0174	10	0.51188	T	0.08	.	9.3956	0.38401	0.0:0.6088:0.0:0.3912	.	39;39;39;39;39	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	H	39	ENSP00000313978:R39H;ENSP00000297990:R39H;ENSP00000368784:R39H;ENSP00000395915:R39H	ENSP00000297990:R39H	R	-	2	0	NOL6	33462349	0.002000	0.14202	0.003000	0.11579	0.036000	0.12997	0.184000	0.16939	0.255000	0.21593	0.655000	0.94253	CGT		0.552	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
VPS13A	23230	broad.mit.edu	37	9	79934521	79934521	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:79934521G>A	ENST00000360280.3	+	42	5607	c.5347G>A	c.(5347-5349)Gag>Aag	p.E1783K	VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376636.3_Missense_Mutation_p.E1744K|VPS13A_ENST00000357409.5_Missense_Mutation_p.E1783K|VPS13A_ENST00000376634.4_Missense_Mutation_p.E1783K	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1783					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.E1783K(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGGTGTATGGGAGCCTTTGCT	0.333																																					p.E1744K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5230A	9						.						82.0	83.0	82.0					9																	79934521		2203	4299	6502	79124341	SO:0001583	missense	23230	exon41			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5347G>A	9.37:g.79934521G>A	ENSP00000353422:p.Glu1783Lys		79124341	NM_001018037	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	G	35	5.578983	0.96565	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.998;0.999;0.999	T	0.55192	-0.8179	10	0.87932	D	0	.	19.9023	0.96990	0.0:0.0:1.0:0.0	.	35;1744;1783;1783;1783	B1ALW4;Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;.;VP13A_HUMAN;.;.	K	1783;1744;1783;1783	ENSP00000365821:E1783K;ENSP00000365823:E1744K;ENSP00000353422:E1783K;ENSP00000349985:E1783K	ENSP00000349985:E1783K	E	+	1	0	VPS13A	79124341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.002000	0.93572	2.693000	0.91896	0.650000	0.86243	GAG		0.333	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
PTCH1	5727	broad.mit.edu	37	9	98211549	98211549	+	Frame_Shift_Del	DEL	G	G	-	rs138240178	byFrequency	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:98211549delG	ENST00000331920.6	-	22	3905	c.3606delC	c.(3604-3606)cccfs	p.P1202fs	PTCH1_ENST00000430669.2_Frame_Shift_Del_p.P1136fs|PTCH1_ENST00000429896.2_Frame_Shift_Del_p.P1051fs|PTCH1_ENST00000418258.1_Frame_Shift_Del_p.P1051fs|PTCH1_ENST00000375274.2_Frame_Shift_Del_p.P1201fs|PTCH1_ENST00000421141.1_Frame_Shift_Del_p.P1051fs|PTCH1_ENST00000437951.1_Frame_Shift_Del_p.P1136fs	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1202					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.S1203fs*52(2)|p.S1202fs*52(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GGACCACGCTGGGGGGTGGCT	0.597																																					p.P1051fs												PTCH1,skin,NS,Substitution - Missense,-1 	.	3	Deletion - Frameshift(3)	large_intestine(3)	c.3153delC	9						.						23.0	28.0	26.0					9																	98211549		2188	4275	6463	97251370	SO:0001589	frameshift_variant	5727	exon22			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3606delC	9.37:g.98211549delG	ENSP00000332353:p.Pro1202fs		97251370	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Frame_Shift_Del	DEL	ENST00000331920.6	37	CCDS6714.1																																																																																				0.597	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
HEMGN	55363	broad.mit.edu	37	9	100693490	100693490	+	Missense_Mutation	SNP	G	G	A	rs142085732		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:100693490G>A	ENST00000259456.3	-	4	330	c.187C>T	c.(187-189)Cgc>Tgc	p.R63C		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	63	Necessary for nuclear localization.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)		p.R63C(1)		NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TGCTGCTTGCGTTTTTTCTGT	0.428																																					p.R63C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C187T	9						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	103.0	103.0		187,187	-3.4	0.0	9	dbSNP_134	103	0,8598		0,0,4299	no	missense,missense	HEMGN	NM_018437.3,NM_197978.1	180,180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	63/485,63/485	100693490	1,13003	2203	4299	6502	99733311	SO:0001583	missense	55363	exon3			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.187C>T	9.37:g.100693490G>A	ENSP00000259456:p.Arg63Cys		99733311	NM_197978	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	ENST00000259456.3	37	CCDS6731.1	.	.	.	.	.	.	.	.	.	.	G	5.718	0.316931	0.10845	2.27E-4	0.0	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.99	-3.43	0.04810	.	0.906055	0.09618	N	0.777878	T	0.14485	0.0350	N	0.05383	-0.06	0.25264	N	0.989575	B	0.06786	0.001	B	0.04013	0.001	T	0.19095	-1.0316	9	0.35671	T	0.21	4.8297	3.6986	0.08374	0.3559:0.0:0.2245:0.4196	.	63	Q9BXL5	HEMGN_HUMAN	C	63	.	ENSP00000259456:R63C	R	-	1	0	HEMGN	99733311	0.041000	0.20044	0.016000	0.15963	0.372000	0.29890	-0.581000	0.05820	-0.403000	0.07622	-0.282000	0.10007	CGC		0.428	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053344.2	NM_197978	
SEC16A	9919	broad.mit.edu	37	9	139358049	139358049	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chr9:139358049C>T	ENST00000371706.3	-	9	4012	c.3979G>A	c.(3979-3981)Gac>Aac	p.D1327N	SEC16A_ENST00000313050.7_Missense_Mutation_p.D1505N|SEC16A_ENST00000431893.2_Missense_Mutation_p.D1327N|SEC16A_ENST00000290037.6_Missense_Mutation_p.D1327N			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1327					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.D1505N(1)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TTATGGGTGTCGTCTCTGCAG	0.448																																					p.D1505N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4513A	9						.						90.0	93.0	92.0					9																	139358049		1941	4152	6093	138477870	SO:0001583	missense	9919	exon11			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3979G>A	9.37:g.139358049C>T	ENSP00000360771:p.Asp1327Asn		138477870	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	C	25.3	4.628958	0.87560	.	.	ENSG00000148396	ENST00000313050;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	6.06	6.06	0.98353	.	0.094661	0.64402	D	0.000001	T	0.60945	0.2308	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.994	D;P;P;P	0.65684	0.937;0.808;0.808;0.797	T	0.50841	-0.8780	10	0.30854	T	0.27	-33.3602	19.6012	0.95563	0.0:1.0:0.0:0.0	.	1505;1327;1327;895	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	N	1505;227;1327;1327;1327;895	ENSP00000325827:D1505N;ENSP00000403525:D227N;ENSP00000360771:D1327N;ENSP00000290037:D1327N;ENSP00000387583:D1327N	ENSP00000290037:D1327N	D	-	1	0	SEC16A	138477870	1.000000	0.71417	0.562000	0.28370	0.418000	0.31294	7.710000	0.84655	2.876000	0.98609	0.655000	0.94253	GAC		0.448	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
GPRASP2	114928	broad.mit.edu	37	X	101971055	101971055	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:101971055G>A	ENST00000535209.1	+	4	2089	c.1258G>A	c.(1258-1260)Gga>Aga	p.G420R	GPRASP2_ENST00000332262.5_Missense_Mutation_p.G420R|GPRASP2_ENST00000543253.1_Missense_Mutation_p.G420R			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	420						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)	p.G420R(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						GGCCATTGGCGGATCCGCGTA	0.562																																					p.G420R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1258A	X						.						66.0	69.0	68.0					X																	101971055		2203	4300	6503	101857711	SO:0001583	missense	114928	exon5			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1258G>A	X.37:g.101971055G>A	ENSP00000437394:p.Gly420Arg		101857711	NM_001004051	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008249	0.35415	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08546	3.08;3.08;3.08	4.44	2.66	0.31614	.	0.367125	0.20017	N	0.100985	T	0.16428	0.0395	M	0.68593	2.085	0.30859	N	0.733714	D	0.89917	1.0	P	0.58970	0.849	T	0.07790	-1.0754	10	0.37606	T	0.19	.	3.914	0.09214	0.2177:0.197:0.5854:0.0	.	420	Q96D09	GASP2_HUMAN	R	420	ENSP00000437872:G420R;ENSP00000437394:G420R;ENSP00000339057:G420R	ENSP00000339057:G420R	G	+	1	0	GPRASP2	101857711	0.985000	0.35326	0.199000	0.23439	0.738000	0.42128	1.791000	0.38744	0.607000	0.29982	0.600000	0.82982	GGA		0.562	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
TCEAL5	340543	broad.mit.edu	37	X	102529121	102529121	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:102529121G>A	ENST00000372680.1	-	3	665	c.371C>T	c.(370-372)aCg>aTg	p.T124M		NM_001012979.2	NP_001012997.1	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.T124M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						GGAATCGTCCGTCCCCCTGTC	0.577																																					p.T124M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C371T	X						.						142.0	128.0	133.0					X																	102529121		2203	4300	6503	102415777	SO:0001583	missense	340543	exon3				CCDS35356.1	Xq22.2	2014-03-21			ENSG00000204065	ENSG00000204065			22282	protein-coding gene	gene with protein product						16221301	Standard	NM_001012979		Approved	WEX4	uc004ejz.2	Q5H9L2	OTTHUMG00000022092	ENST00000372680.1:c.371C>T	X.37:g.102529121G>A	ENSP00000361765:p.Thr124Met		102415777	NM_001012979	A2RUJ4	Missense_Mutation	SNP	ENST00000372680.1	37	CCDS35356.1	.	.	.	.	.	.	.	.	.	.	G	7.608	0.674236	0.14841	.	.	ENSG00000204065	ENST00000372680	T	0.10192	2.9	2.93	2.06	0.26882	.	0.181681	0.26967	N	0.021590	T	0.26846	0.0657	M	0.79258	2.445	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02885	-1.1098	10	0.52906	T	0.07	.	5.2163	0.15344	0.1687:0.0:0.8313:0.0	.	124	Q5H9L2	TCAL5_HUMAN	M	124	ENSP00000361765:T124M	ENSP00000361765:T124M	T	-	2	0	TCEAL5	102415777	0.138000	0.22547	0.001000	0.08648	0.132000	0.20833	2.067000	0.41461	0.644000	0.30656	0.292000	0.19580	ACG		0.577	TCEAL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057696.1	XM_291334	
H2BFWT	158983	broad.mit.edu	37	X	103267817	103267817	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:103267817C>T	ENST00000217926.5	-	1	442	c.416G>A	c.(415-417)cGg>cAg	p.R139Q	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	139						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R139Q(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						CACAGCCATCCGGGTCTCCCA	0.642																																					p.R139Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	X						.						28.0	28.0	28.0					X																	103267817		2203	4299	6502	103154473	SO:0001583	missense	158983	exon1			BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.416G>A	X.37:g.103267817C>T	ENSP00000354723:p.Arg139Gln		103154473	NM_001002916	B1AK72|Q147W3	Missense_Mutation	SNP	ENST00000217926.5	37	CCDS35362.1	.	.	.	.	.	.	.	.	.	.	.	0.977	-0.698370	0.03279	.	.	ENSG00000123569	ENST00000217926	T	0.09163	3.01	2.84	-3.28	0.05033	Histone-fold (2);Histone core (1);	0.159419	0.22860	N	0.054743	T	0.00967	0.0032	N	0.00019	-2.795	0.25095	N	0.990823	B	0.06786	0.001	B	0.01281	0.0	T	0.39333	-0.9619	10	0.02654	T	1	.	4.3474	0.11139	0.1541:0.2207:0.0:0.6251	.	139	Q7Z2G1	H2BWT_HUMAN	Q	139	ENSP00000354723:R139Q	ENSP00000354723:R139Q	R	-	2	0	H2BFWT	103154473	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	2.785000	0.47782	-0.794000	0.04468	-2.219000	0.00296	CGG		0.642	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057756.2	NM_001002916	
COL4A5	1287	broad.mit.edu	37	X	107911576	107911576	+	Missense_Mutation	SNP	G	G	T	rs104886247		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:107911576G>T	ENST00000361603.2	+	41	3876	c.3632G>T	c.(3631-3633)gGg>gTg	p.G1211V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1211V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1211	Triple-helical region.		G -> E (in APSX; found on the same allele as variant Val-953).|G -> R (in APSX).		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G1211V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGATTACCTGGGATTCCAGGA	0.488									Alport syndrome with Diffuse Leiomyomatosis																												p.G1211V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3632T	X	GRCh37	CM960390	COL4A5	M	rs104886247	.						61.0	57.0	59.0					X																	107911576		2203	4300	6503	107798232	SO:0001583	missense	1287	exon41	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3632G>T	X.37:g.107911576G>T	ENSP00000354505:p.Gly1211Val		107798232	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505095	0.64410	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99353	-5.77;-5.77	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97541	1.0086	10	0.87932	D	0	.	19.2739	0.94023	0.0:0.0:1.0:0.0	.	1211;1211	E7EVY4;P29400	.;CO4A5_HUMAN	V	1211	ENSP00000331902:G1211V;ENSP00000354505:G1211V	ENSP00000331902:G1211V	G	+	2	0	COL4A5	107798232	1.000000	0.71417	0.997000	0.53966	0.721000	0.41392	9.334000	0.96470	2.504000	0.84457	0.594000	0.82650	GGG		0.488	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
GUCY2F	2986	broad.mit.edu	37	X	108708430	108708430	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:108708430G>A	ENST00000218006.2	-	3	1264	c.973C>T	c.(973-975)Caa>Taa	p.Q325*		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	325					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.Q325*(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GTGAAGGCTTGATAGAAGGTC	0.488																																					p.Q325X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C973T	X						.						157.0	134.0	142.0					X																	108708430		2203	4300	6503	108595086	SO:0001587	stop_gained	2986	exon3			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.973C>T	X.37:g.108708430G>A	ENSP00000218006:p.Gln325*		108595086	NM_001522	Q9UJF1	Nonsense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	37	6.574368	0.97676	.	.	ENSG00000101890	ENST00000218006	.	.	.	4.18	2.33	0.28932	.	0.380211	0.28382	N	0.015547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	11.2898	0.49244	0.0:0.5711:0.4289:0.0	.	.	.	.	X	325	.	ENSP00000218006:Q325X	Q	-	1	0	GUCY2F	108595086	1.000000	0.71417	0.997000	0.53966	0.571000	0.35966	1.575000	0.36493	0.482000	0.27582	0.600000	0.82982	CAA		0.488	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
AMELX	265	broad.mit.edu	37	X	11316902	11316902	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:11316902T>C	ENST00000380714.3	+	5	447	c.379T>C	c.(379-381)Tac>Cac	p.Y127H	ARHGAP6_ENST00000380736.1_Intron|ARHGAP6_ENST00000380732.3_Intron|ARHGAP6_ENST00000380718.1_Intron|AMELX_ENST00000380712.3_Missense_Mutation_p.Y141H|ARHGAP6_ENST00000337414.4_Intron|ARHGAP6_ENST00000413512.3_Intron|AMELX_ENST00000348912.4_Missense_Mutation_p.Y111H	NM_001142.2	NP_001133.1	Q99217	AMELX_HUMAN	amelogenin, X-linked	127					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|enamel mineralization (GO:0070166)|epithelial to mesenchymal transition (GO:0001837)|ion homeostasis (GO:0050801)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of tooth mineralization (GO:0070172)|signal transduction (GO:0007165)|tooth mineralization (GO:0034505)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|structural constituent of tooth enamel (GO:0030345)	p.Y141H(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	15						CCAGCAGCCCTACCAGCCCCA	0.662																																					p.Y127H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T379C	X						.						72.0	64.0	67.0					X																	11316902		2203	4300	6503	11226823	SO:0001583	missense	265	exon5				CCDS14144.1, CCDS14145.1, CCDS14146.1	Xp22.31-p22.1	2010-04-20	2010-04-20		ENSG00000125363	ENSG00000125363			461	protein-coding gene	gene with protein product	"""amelogenesis imperfecta 1"""	300391	"""amelogenin (X chromosome, amelogenesis imperfecta 1)"""	AMG, AIH1		1734713	Standard	NM_182680		Approved		uc004cus.3	Q99217	OTTHUMG00000021130	ENST00000380714.3:c.379T>C	X.37:g.11316902T>C	ENSP00000370090:p.Tyr127His		11226823	NM_001142	Q96NW6|Q9UCA7	Missense_Mutation	SNP	ENST00000380714.3	37	CCDS14144.1	.	.	.	.	.	.	.	.	.	.	T	9.418	1.082176	0.20309	.	.	ENSG00000125363	ENST00000380714;ENST00000380712;ENST00000348912	D;D;D	0.88431	-2.38;-2.38;-2.38	4.85	3.67	0.42095	.	0.749920	0.12467	N	0.466362	T	0.82015	0.4945	L	0.39898	1.24	0.22796	N	0.998729	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.002;0.004;0.002	T	0.67542	-0.5644	10	0.31617	T	0.26	3.1086	5.4859	0.16749	0.0:0.092:0.1741:0.7339	.	111;127;141	Q99217-2;Q99217;Q99217-3	.;AMELX_HUMAN;.	H	127;141;111	ENSP00000370090:Y127H;ENSP00000370088:Y141H;ENSP00000335312:Y111H	ENSP00000335312:Y111H	Y	+	1	0	AMELX	11226823	0.973000	0.33851	0.964000	0.40570	0.897000	0.52465	1.701000	0.37825	0.634000	0.30469	0.339000	0.21740	TAC		0.662	AMELX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055746.1	NM_001142	
AMOT	154796	broad.mit.edu	37	X	112022857	112022857	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:112022857G>T	ENST00000524145.1	-	11	2599	c.2525C>A	c.(2524-2526)tCg>tAg	p.S842*	AMOT_ENST00000371959.3_Nonsense_Mutation_p.S842*|AMOT_ENST00000371962.1_Nonsense_Mutation_p.S610*|AMOT_ENST00000304758.1_Nonsense_Mutation_p.S433*|MIR4329_ENST00000582643.1_RNA			Q4VCS5	AMOT_HUMAN	angiomotin	842					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.S842*(1)|p.S433*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TGGCACAGGCGAGGGTGTGGA	0.512																																					p.S433X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1298A	X						.						104.0	82.0	89.0					X																	112022857		2203	4300	6503	111909513	SO:0001587	stop_gained	154796	exon11			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2525C>A	X.37:g.112022857G>T	ENSP00000429013:p.Ser842*		111909513	NM_133265	Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	G	37	6.632637	0.97722	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214	.	.	.	4.58	4.58	0.56647	.	0.122556	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1557	16.1928	0.82004	0.0:0.0:1.0:0.0	.	.	.	.	X	433;842;610;842;82	.	ENSP00000305557:S433X	S	-	2	0	AMOT	111909513	1.000000	0.71417	0.548000	0.28192	0.983000	0.72400	7.691000	0.84191	2.218000	0.71995	0.523000	0.50628	TCG		0.512	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
ZBTB33	10009	broad.mit.edu	37	X	119388771	119388771	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:119388771A>G	ENST00000326624.2	+	2	1729	c.1501A>G	c.(1501-1503)Agg>Ggg	p.R501G	ZBTB33_ENST00000557385.1_Missense_Mutation_p.R501G	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	501	Interaction with CTNND1. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)	p.R501G(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGTATGCAAAAGGTCATATGT	0.393																																					p.R501G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1501G	X						.						99.0	96.0	97.0					X																	119388771		2203	4299	6502	119272799	SO:0001583	missense	10009	exon2			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1501A>G	X.37:g.119388771A>G	ENSP00000314153:p.Arg501Gly		119272799	NM_006777	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	.	.	.	.	.	.	.	.	.	.	A	14.72	2.620715	0.46736	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.11604	2.76;2.76	5.55	5.55	0.83447	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.045111	0.85682	D	0.000000	T	0.20941	0.0504	L	0.32530	0.975	0.54753	D	0.999986	D	0.76494	0.999	D	0.80764	0.994	T	0.01280	-1.1397	10	0.87932	D	0	-9.8472	10.0009	0.41929	0.8329:0.1671:0.0:0.0	.	501	Q86T24	KAISO_HUMAN	G	501	ENSP00000314153:R501G;ENSP00000450969:R501G	ENSP00000314153:R501G	R	+	1	2	ZBTB33;AC002086.1	119272799	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.473000	0.73572	1.846000	0.53633	0.417000	0.27973	AGG		0.393	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777	
FRMPD4	9758	broad.mit.edu	37	X	12734434	12734434	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:12734434A>C	ENST00000380682.1	+	15	2362	c.1856A>C	c.(1855-1857)gAg>gCg	p.E619A		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	619					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E609A(1)|p.E619A(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCCCCCTGTGAGGCAGACTAC	0.532																																					p.E619A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1856C	X						.						79.0	79.0	79.0					X																	12734434		2203	4300	6503	12644355	SO:0001583	missense	9758	exon15			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.1856A>C	X.37:g.12734434A>C	ENSP00000370057:p.Glu619Ala		12644355	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.703337	0.30232	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.25085	1.82	5.86	4.71	0.59529	.	0.401550	0.28470	N	0.015224	T	0.14399	0.0348	L	0.33485	1.01	0.09310	N	1	B;B	0.14012	0.009;0.0	B;B	0.09377	0.004;0.001	T	0.16660	-1.0395	10	0.18710	T	0.47	.	2.1577	0.03816	0.5455:0.2284:0.0884:0.1377	.	611;619	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	A	619;610;608	ENSP00000370057:E619A	ENSP00000304583:E608A	E	+	2	0	FRMPD4	12644355	1.000000	0.71417	0.873000	0.34254	0.930000	0.56654	1.384000	0.34396	1.974000	0.57490	0.486000	0.48141	GAG		0.532	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
TENM1	10178	broad.mit.edu	37	X	123554201	123554201	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:123554201C>T	ENST00000371130.3	-	24	4984	c.4921G>A	c.(4921-4923)Gct>Act	p.A1641T	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.A1648T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1641					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A1643T(1)									CTTTTGGTAGCCAGAAGCCCT	0.393																																					p.A1641T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4921A	X						.						108.0	100.0	103.0					X																	123554201		2203	4300	6503	123381882	SO:0001583	missense	10178	exon24			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4921G>A	X.37:g.123554201C>T	ENSP00000360171:p.Ala1641Thr		123381882	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	c	15.85	2.954510	0.53293	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.84944	-1.92;-1.89	5.49	2.66	0.31614	Six-bladed beta-propeller, TolB-like (1);	0.176862	0.49305	D	0.000142	T	0.79707	0.4492	M	0.64170	1.965	0.52099	D	0.999949	B;B;B	0.11235	0.003;0.001;0.004	B;B;B	0.08055	0.003;0.001;0.003	T	0.69658	-0.5086	10	0.27082	T	0.32	.	7.7135	0.28692	0.1313:0.7225:0.0:0.1462	.	1647;1648;1641	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	1641;1648	ENSP00000360171:A1641T;ENSP00000403954:A1648T	ENSP00000360171:A1641T	A	-	1	0	ODZ1	123381882	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	3.245000	0.51407	0.470000	0.27294	0.553000	0.69018	GCT		0.393	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SMARCA1	6594	broad.mit.edu	37	X	128605243	128605243	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:128605243T>A	ENST00000371122.4	-	20	2632	c.2503A>T	c.(2503-2505)Att>Ttt	p.I835F	SMARCA1_ENST00000371121.3_Missense_Mutation_p.I823F|SMARCA1_ENST00000371123.1_Missense_Mutation_p.I823F	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	835					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.I835F(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GCTCCATCAATCTTTTTTTGC	0.358																																					p.I835F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2503T	X						.						144.0	133.0	136.0					X																	128605243		2203	4300	6503	128432924	SO:0001583	missense	6594	exon20			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2503A>T	X.37:g.128605243T>A	ENSP00000360163:p.Ile835Phe		128432924	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.435863	0.83885	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.96	5.47	5.47	0.80525	ATPase, nucleosome remodelling ISWI, HAND domain (2);	0.000000	0.64402	D	0.000011	D	0.95050	0.8397	M	0.94021	3.485	0.80722	D	1	P;P;P;P	0.45176	0.852;0.852;0.821;0.852	P;P;B;P	0.45998	0.5;0.5;0.367;0.5	D	0.95798	0.8830	10	0.87932	D	0	-14.1188	14.6397	0.68714	0.0:0.0:0.0:1.0	.	814;835;823;835	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	F	823;823;835;814	ENSP00000360162:I823F;ENSP00000360164:I823F;ENSP00000360163:I835F;ENSP00000404275:I814F	ENSP00000360162:I823F	I	-	1	0	SMARCA1	128432924	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.830000	0.86741	1.837000	0.53436	0.441000	0.28932	ATT		0.358	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
GABRE	2564	broad.mit.edu	37	X	151123901	151123901	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:151123901G>A	ENST00000370328.3	-	8	1129	c.1076C>T	c.(1075-1077)gCt>gTt	p.A359V	GABRE_ENST00000483564.1_5'UTR|GABRE_ENST00000370325.1_Missense_Mutation_p.A359V|AF274855.1_ENST00000582865.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	359					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A246V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTGAGCACAGCAAACTCCAA	0.488																																					p.A359V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1076T	X						.						122.0	105.0	111.0					X																	151123901		2203	4300	6503	150874557	SO:0001583	missense	2564	exon8			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1076C>T	X.37:g.151123901G>A	ENSP00000359353:p.Ala359Val		150874557	NM_004961	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.383909	0.61845	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	D;D	0.89939	-2.59;-2.59	5.78	5.78	0.91487	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.108971	0.40908	D	0.000997	D	0.89646	0.6775	L	0.52364	1.645	0.80722	D	1	P	0.52692	0.955	P	0.52424	0.698	D	0.90347	0.4363	10	0.87932	D	0	.	11.9681	0.53047	0.0:0.17:0.83:0.0	.	359	P78334	GBRE_HUMAN	V	359	ENSP00000359353:A359V;ENSP00000359350:A359V	ENSP00000359350:A359V	A	-	2	0	GABRE	150874557	1.000000	0.71417	0.790000	0.31976	0.427000	0.31564	3.333000	0.52090	2.428000	0.82296	0.600000	0.82982	GCT		0.488	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
XG	7499	broad.mit.edu	37	X	2700137	2700137	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:2700137A>T	ENST00000381174.5	+	4	383	c.158A>T	c.(157-159)tAc>tTc	p.Y53F	XG_ENST00000426774.1_Missense_Mutation_p.Y53F|XG_ENST00000419513.2_Missense_Mutation_p.Y53F			P55808	XG_HUMAN	Xg blood group	53						integral component of plasma membrane (GO:0005887)		p.Y53F(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CCACCTTACTACCCACAGCCC	0.448																																					p.Y53F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A158T	X						.						132.0	110.0	117.0					X																	2700137		2203	4299	6502	2710137	SO:0001583	missense	7499	exon4			AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.158A>T	X.37:g.2700137A>T	ENSP00000370566:p.Tyr53Phe		2710137	NM_001141919	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	A	2.346	-0.349961	0.05173	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	1.16	1.16	0.20824	.	2.289270	0.02782	U	0.121108	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B;B	0.31193	0.165;0.312	B;B	0.18871	0.022;0.023	T	0.20773	-1.0265	10	0.10111	T	0.7	.	4.2473	0.10677	1.0:0.0:0.0:0.0	.	53;53	P55808;P55808-3	XG_HUMAN;.	F	53;53;53;31	ENSP00000370566:Y53F;ENSP00000411004:Y53F;ENSP00000398503:Y53F;ENSP00000430005:Y31F	ENSP00000370566:Y53F	Y	+	2	0	XG	2710137	0.000000	0.05858	0.027000	0.17364	0.206000	0.24218	-0.791000	0.04599	0.732000	0.32470	0.158000	0.16466	TAC		0.448	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569	
ACE2	59272	broad.mit.edu	37	X	15599443	15599443	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:15599443G>C	ENST00000252519.3	-	8	1073	c.971C>G	c.(970-972)aCt>aGt	p.T324S	ACE2_ENST00000427411.1_Missense_Mutation_p.T324S			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	324					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.T324S(1)		endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	GAATCCTTGAGTCATATTAGG	0.483																																					p.T324S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C971G	X						.						137.0	124.0	129.0					X																	15599443		2203	4300	6503	15509364	SO:0001583	missense	59272	exon9			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.971C>G	X.37:g.15599443G>C	ENSP00000252519:p.Thr324Ser		15509364	NM_021804	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	CCDS14169.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793588	0.31685	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.32272	1.46;1.46	5.44	4.56	0.56223	.	0.301944	0.37348	N	0.002125	T	0.30947	0.0781	M	0.74881	2.28	0.26540	N	0.974099	P	0.39326	0.668	B	0.36666	0.23	T	0.31052	-0.9957	10	0.36615	T	0.2	-14.2763	8.7528	0.34629	0.0791:0.0:0.7738:0.1472	.	324	Q9BYF1	ACE2_HUMAN	S	324	ENSP00000252519:T324S;ENSP00000389326:T324S	ENSP00000252519:T324S	T	-	2	0	ACE2	15509364	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	3.191000	0.50981	2.270000	0.75569	0.594000	0.82650	ACT		0.483	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1		
NHS	4810	broad.mit.edu	37	X	17745047	17745047	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:17745047G>A	ENST00000380060.3	+	6	3096	c.2758G>A	c.(2758-2760)Gaa>Aaa	p.E920K	NHS_ENST00000398097.3_Missense_Mutation_p.E764K	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	941					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E920K(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TGAAGTTGCCGAATCCACACA	0.433																																					p.E764K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2290A	X						.						174.0	165.0	168.0					X																	17745047		2203	4300	6503	17654968	SO:0001583	missense	4810	exon7				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2758G>A	X.37:g.17745047G>A	ENSP00000369400:p.Glu920Lys		17654968	NM_001136024	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282098	0.59867	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.48522	0.81;0.81	5.93	5.93	0.95920	.	0.205916	0.51477	D	0.000098	T	0.65995	0.2745	M	0.62723	1.935	0.50632	D	0.999886	P;P;P;D	0.89917	0.948;0.846;0.846;1.0	B;B;B;D	0.80764	0.325;0.187;0.187;0.994	T	0.58645	-0.7600	10	0.17832	T	0.49	-13.5514	19.2927	0.94108	0.0:0.0:1.0:0.0	.	941;762;764;920	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	K	920;764;762	ENSP00000369400:E920K;ENSP00000381170:E764K	ENSP00000369397:E762K	E	+	1	0	NHS	17654968	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	7.571000	0.82399	2.509000	0.84616	0.538000	0.68166	GAA		0.433	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
YY2	404281	broad.mit.edu	37	X	21875175	21875175	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:21875175C>T	ENST00000429584.2	+	1	1071	c.573C>T	c.(571-573)aaC>aaT	p.N191N	MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N191N(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						GGTCCCCTAACGATAACAATG	0.542																																					p.N191N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	X						.						146.0	151.0	149.0					X																	21875175		2203	4300	6503	21785096	SO:0001819	synonymous_variant	404281	exon1			AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.573C>T	X.37:g.21875175C>T			21785096	NM_206923	B2RP10|Q6Q1S4	Silent	SNP	ENST00000429584.2	37	CCDS14202.1																																																																																				0.542	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
DMD	1756	broad.mit.edu	37	X	32536245	32536245	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:32536245C>A	ENST00000357033.4	-	18	2378	c.2172G>T	c.(2170-2172)ttG>ttT	p.L724F	DMD_ENST00000288447.4_Missense_Mutation_p.L716F|DMD_ENST00000378677.2_Missense_Mutation_p.L720F	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	724					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L719F(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TATCAACATCCAACCTAAGAC	0.338																																					p.L724F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2172T	X						.						51.0	46.0	47.0					X																	32536245		2202	4299	6501	32446166	SO:0001583	missense	1756	exon18			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2172G>T	X.37:g.32536245C>A	ENSP00000354923:p.Leu724Phe		32446166	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	2.345	-0.350238	0.05173	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.71222	1.87;1.87;-0.55	5.14	4.18	0.49190	.	0.323257	0.16821	U	0.198179	T	0.36936	0.0985	N	0.01228	-0.945	0.80722	D	1	B;B;B;B	0.12013	0.0;0.001;0.005;0.001	B;B;B;B	0.16289	0.001;0.004;0.015;0.007	T	0.42548	-0.9445	10	0.02654	T	1	.	11.2748	0.49161	0.3338:0.6662:0.0:0.0	.	716;716;724;720	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	F	716;720;724;724;601;716	ENSP00000367948:L720F;ENSP00000354923:L724F;ENSP00000288447:L716F	ENSP00000288447:L716F	L	-	3	2	DMD	32446166	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.333000	0.43912	2.110000	0.64415	0.583000	0.79449	TTG		0.338	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
PORCN	64840	broad.mit.edu	37	X	48372643	48372643	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:48372643C>T	ENST00000326194.6	+	8	778	c.735C>T	c.(733-735)taC>taT	p.Y245Y	PORCN_ENST00000537758.1_Silent_p.Y245Y|PORCN_ENST00000367574.4_Silent_p.Y163Y|PORCN_ENST00000355961.4_Silent_p.Y240Y|PORCN_ENST00000361988.3_Silent_p.Y234Y|PORCN_ENST00000355092.3_Silent_p.Y239Y|PORCN_ENST00000359882.4_Silent_p.Y239Y	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	245					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)	p.Y245Y(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGCGAGCCTACGAGAGTGCTG	0.602																																					p.Y239Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C717T	X						.						114.0	92.0	99.0					X																	48372643		2203	4300	6503	48257587	SO:0001819	synonymous_variant	64840	exon7			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.735C>T	X.37:g.48372643C>T			48257587	NM_203474	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	ENST00000326194.6	37	CCDS14299.1																																																																																				0.602	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825	
EBP	10682	broad.mit.edu	37	X	48382420	48382420	+	Silent	SNP	C	C	T	rs145509273		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:48382420C>T	ENST00000495186.1	+	2	1084	c.261C>T	c.(259-261)taC>taT	p.Y87Y	EBP_ENST00000276096.6_3'UTR	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	87					cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)	p.Y87Y(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	TTCTCTACTACGAAGACCTGC	0.537													c|||	1	0.000264901	0.0008	0.0	3775	,	,		10936	0.0		0.0	False		,,,				2504	0.0				p.Y87Y	Ovarian(41;550 1000 33077 33474 52335)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C261T	X						.						149.0	124.0	133.0					X																	48382420		2203	4300	6503	48267364	SO:0001819	synonymous_variant	10682	exon2			Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.261C>T	X.37:g.48382420C>T			48267364	NM_006579	Q6FGL3|Q6IBI9	Silent	SNP	ENST00000495186.1	37	CCDS14300.1																																																																																				0.537	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083372.1	NM_006579	
PRICKLE3	4007	broad.mit.edu	37	X	49034779	49034779	+	Missense_Mutation	SNP	G	G	A	rs376861498		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:49034779G>A	ENST00000376317.3	-	6	704	c.610C>T	c.(610-612)Cgt>Tgt	p.R204C	PRICKLE3_ENST00000540849.1_Missense_Mutation_p.R136C|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.R191C|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.R123C	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	204	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)	p.R204C(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						AGGCCTGCACGGCTGGCAAAC	0.557																																					p.R204C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C610T	X						.	G	CYS/ARG	0,3835		0,0,0,1632,571	82.0	56.0	65.0		610	5.1	1.0	X		65	1,6726		0,0,1,2428,1870	no	missense	PRICKLE3	NM_006150.3	180	0,0,1,4060,2441	AA,AG,A,GG,G		0.0149,0.0,0.0095	probably-damaging	204/616	49034779	1,10561	2203	4299	6502	48921723	SO:0001583	missense	4007	exon6			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.610C>T	X.37:g.49034779G>A	ENSP00000365494:p.Arg204Cys		48921723	NM_006150	B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	ENST00000376317.3	37	CCDS14320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.723393|4.723393	0.89298|0.89298	0.0|0.0	1.49E-4|1.49E-4	ENSG00000012211|ENSG00000012211	ENST00000453382;ENST00000432913|ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114	.|D;D;D;D	.|0.88277	.|-2.36;-2.36;-2.36;-2.36	5.14|5.14	5.14|5.14	0.70334|0.70334	.|Zinc finger, LIM-type (5);	.|0.000000	.|0.38217	.|N	.|0.001766	D|D	0.94732|0.94732	0.8300|0.8300	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.993;0.995;0.996;0.999	D|D	0.95505|0.95505	0.8581|0.8581	5|10	.|0.87932	.|D	.|0	1.7574|1.7574	14.962|14.962	0.71164|0.71164	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|204;166;123;204	.|B2RBS3;B7Z6S4;B7Z8F2;O43900	.|.;.;.;PRIC3_HUMAN	L|C	216;214|204;123;136;191	.|ENSP00000365494:R204C;ENSP00000441385:R123C;ENSP00000446051:R136C;ENSP00000441743:R191C	.|ENSP00000365494:R204C	P|R	-|-	2|1	0|0	PRICKLE3|PRICKLE3	48921723|48921723	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	4.727000|4.727000	0.61993|0.61993	2.119000|2.119000	0.64992|0.64992	0.511000|0.511000	0.50034|0.50034	CCG|CGT		0.557	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
SHROOM4	57477	broad.mit.edu	37	X	50339761	50339761	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:50339761G>T	ENST00000289292.7	-	9	4699	c.4416C>A	c.(4414-4416)atC>atA	p.I1472I	SHROOM4_ENST00000483955.1_5'Flank|SHROOM4_ENST00000460112.3_Silent_p.I1356I|SHROOM4_ENST00000376020.2_Silent_p.I1472I			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1472	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)	p.I1472I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CCCCGAGCTTGATCTTCTCCT	0.522																																					p.I1472I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4416A	X						.						82.0	63.0	69.0					X																	50339761		2203	4300	6503	50356501	SO:0001819	synonymous_variant	57477	exon9			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.4416C>A	X.37:g.50339761G>T			50356501	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																				0.522	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
HUWE1	10075	broad.mit.edu	37	X	53563202	53563202	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:53563202A>G	ENST00000342160.3	-	79	12894	c.12437T>C	c.(12436-12438)aTg>aCg	p.M4146T	HUWE1_ENST00000262854.6_Missense_Mutation_p.M4146T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4146	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.M4036T(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTCACTCTCCATATCTGTATA	0.463																																					p.M4146T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12437C	X						.						124.0	90.0	102.0					X																	53563202		2203	4300	6503	53579927	SO:0001583	missense	10075	exon80			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12437T>C	X.37:g.53563202A>G	ENSP00000340648:p.Met4146Thr		53579927	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	12.98	2.101101	0.37048	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.43294	0.95;0.95	5.57	5.57	0.84162	HECT (4);	0.000000	0.85682	D	0.000000	T	0.70718	0.3256	M	0.93062	3.375	0.80722	D	1	P;P	0.52170	0.816;0.951	D;D	0.65140	0.911;0.932	T	0.78526	-0.2170	10	0.87932	D	0	.	13.8509	0.63496	1.0:0.0:0.0:0.0	.	4146;4130	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	T	4146	ENSP00000340648:M4146T;ENSP00000262854:M4146T	ENSP00000262854:M4146T	M	-	2	0	HUWE1	53579927	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.644000	0.91044	1.984000	0.57885	0.481000	0.45027	ATG		0.463	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
DLG3	1741	broad.mit.edu	37	X	69699035	69699035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:69699035C>T	ENST00000374360.3	+	10	1674	c.1441C>T	c.(1441-1443)Cga>Tga	p.R481*	DLG3_ENST00000194900.4_Nonsense_Mutation_p.R499*|DLG3_ENST00000542398.1_5'UTR|DLG3_ENST00000374355.3_Nonsense_Mutation_p.R144*	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	481					axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)	p.R481*(1)		endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					ACATGACTTACGAGAACAAAT	0.468																																					p.R481X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1441T	X						.						184.0	161.0	169.0					X																	69699035		2203	4300	6503	69615760	SO:0001587	stop_gained	1741	exon10			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.1441C>T	X.37:g.69699035C>T	ENSP00000363480:p.Arg481*		69615760	NM_021120	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Nonsense_Mutation	SNP	ENST00000374360.3	37	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	C	38	6.743748	0.97805	.	.	ENSG00000082458	ENST00000194900;ENST00000374360;ENST00000374355	.	.	.	5.28	0.0486	0.14285	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2343	0.37457	0.5625:0.3641:0.0:0.0734	.	.	.	.	X	499;481;144	.	.	R	+	1	2	DLG3	69615760	1.000000	0.71417	0.995000	0.50966	0.566000	0.35808	0.807000	0.27140	-0.036000	0.13669	-2.190000	0.00312	CGA		0.468	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120	
SNX12	29934	broad.mit.edu	37	X	70288022	70288022	+	Silent	SNP	C	C	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:70288022C>T	ENST00000374274.3	-	1	251	c.135G>A	c.(133-135)gcG>gcA	p.A45A	SNX12_ENST00000465030.1_5'UTR|SNX12_ENST00000276105.3_Silent_p.A45A	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	45	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)	p.A45A(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					TGGTGAAGCGCGCGCGTCCCA	0.647																																					p.A45A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G135A	X						.						50.0	38.0	42.0					X																	70288022		2203	4300	6503	70204747	SO:0001819	synonymous_variant	29934	exon1			AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.135G>A	X.37:g.70288022C>T			70204747	NM_013346	F8W8K5|Q8WUG9	Silent	SNP	ENST00000374274.3	37	CCDS14405.1																																																																																				0.647	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346	
FOXO4	4303	broad.mit.edu	37	X	70316385	70316385	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:70316385C>G	ENST00000374259.3	+	1	339	c.7C>G	c.(7-9)Ccg>Gcg	p.P3A	FOXO4_ENST00000466874.1_3'UTR|FOXO4_ENST00000341558.3_Missense_Mutation_p.P3A	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	3				MDPGNENSATE -> MRIQPQK (in Ref. 2; CAA63819). {ECO:0000305}.	cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.P3A(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					ACGTATGGATCCGGGGAATGA	0.637																																					p.P3A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7G	X						.						18.0	21.0	20.0					X																	70316385		2077	4204	6281	70233110	SO:0001583	missense	4303	exon1				CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.7C>G	X.37:g.70316385C>G	ENSP00000363377:p.Pro3Ala		70233110	NM_001170931	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	ENST00000374259.3	37	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013926	0.35511	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.96491	-3.67;-4.03	3.43	3.43	0.39272	.	0.000000	0.34067	N	0.004284	D	0.92580	0.7643	L	0.36672	1.1	0.27445	N	0.953611	B;B;B	0.29531	0.162;0.116;0.247	B;B;B	0.28553	0.023;0.051;0.091	D	0.88525	0.3099	10	0.54805	T	0.06	.	12.0348	0.53418	0.0:1.0:0.0:0.0	.	3;3;3	B4DTB6;P98177-2;P98177	.;.;FOXO4_HUMAN	A	3	ENSP00000363377:P3A;ENSP00000342209:P3A	ENSP00000342209:P3A	P	+	1	0	FOXO4	70233110	0.999000	0.42202	0.998000	0.56505	0.936000	0.57629	1.268000	0.33062	1.984000	0.57885	0.523000	0.50628	CCG		0.637	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
TBX22	50945	broad.mit.edu	37	X	79283562	79283562	+	Silent	SNP	C	C	T	rs376686839		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:79283562C>T	ENST00000373294.5	+	7	964	c.936C>T	c.(934-936)ggC>ggT	p.G312G	TBX22_ENST00000373296.3_Silent_p.G312G|TBX22_ENST00000373291.1_Silent_p.G192G|TBX22_ENST00000442340.1_Silent_p.G192G	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	312					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G312G(2)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AAACCTTTGGCGCAGACACAC	0.388																																					p.G312G												.	.	2	Substitution - coding silent(2)	large_intestine(1)|central_nervous_system(1)	c.C936T	X						.	C	,,	1,3834		0,1,1631,571	82.0	75.0	77.0		936,576,936	-0.1	0.9	X		77	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	TBX22	NM_001109878.1,NM_001109879.1,NM_016954.2	,,	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	,,	312/521,192/401,312/521	79283562	1,10562	2203	4300	6503	79170218	SO:0001819	synonymous_variant	50945	exon8			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.936C>T	X.37:g.79283562C>T			79170218	NM_001109878	Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	ENST00000373294.5	37	CCDS14445.1																																																																																				0.388	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
FAM46D	169966	broad.mit.edu	37	X	79698524	79698524	+	Silent	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:79698524G>T	ENST00000308293.5	+	3	725	c.486G>T	c.(484-486)gtG>gtT	p.V162V	FAM46D_ENST00000538312.1_Silent_p.V162V	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	162								p.V162V(1)		kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						TAAAATTTGTGAGTTCACTCA	0.373																																					p.V162V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G486T	X						.						82.0	80.0	81.0					X																	79698524		2202	4299	6501	79585180	SO:0001819	synonymous_variant	169966	exon5			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.486G>T	X.37:g.79698524G>T			79585180	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Silent	SNP	ENST00000308293.5	37	CCDS14446.1																																																																																				0.373	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
BRWD3	254065	broad.mit.edu	37	X	79984354	79984354	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:79984354A>G	ENST00000373275.4	-	14	1499	c.1283T>C	c.(1282-1284)aTg>aCg	p.M428T		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	428					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.M428T(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CCAGGCCACCATAGTCACCTT	0.348																																					p.M428T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1283C	X						.						107.0	90.0	96.0					X																	79984354		2203	4300	6503	79871010	SO:0001583	missense	254065	exon14				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1283T>C	X.37:g.79984354A>G	ENSP00000362372:p.Met428Thr		79871010	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.635924	0.67130	.	.	ENSG00000165288	ENST00000373275	T	0.47177	0.85	4.7	4.7	0.59300	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	M	0.87682	2.9	0.54753	D	0.999987	P	0.36712	0.566	B	0.41202	0.35	T	0.63088	-0.6715	9	.	.	.	-5.8443	13.4033	0.60896	1.0:0.0:0.0:0.0	.	428	Q6RI45	BRWD3_HUMAN	T	428	ENSP00000362372:M428T	.	M	-	2	0	BRWD3	79871010	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.705000	0.91357	1.737000	0.51674	0.345000	0.21793	ATG		0.348	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
CYLC1	1538	broad.mit.edu	37	X	83129490	83129490	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:83129490G>A	ENST00000329312.4	+	4	1811	c.1774G>A	c.(1774-1776)Ggg>Agg	p.G592R		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	592					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G591R(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						CAATGAAAAAGGGGAAAAAGC	0.423																																					p.G592R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1774A	X						.						68.0	60.0	62.0					X																	83129490		2202	4299	6501	83016146	SO:0001583	missense	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1774G>A	X.37:g.83129490G>A	ENSP00000331556:p.Gly592Arg		83016146	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	9.194	1.026857	0.19512	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.55760	0.5	3.61	1.76	0.24704	.	.	.	.	.	T	0.65375	0.2685	M	0.74881	2.28	0.09310	N	1	D;D	0.71674	0.997;0.998	D;D	0.69307	0.963;0.934	T	0.52675	-0.8544	9	0.87932	D	0	1.1541	4.2292	0.10596	0.1363:0.2341:0.6296:0.0	.	592;592	P35663;F5H4V5	CYLC1_HUMAN;.	R	592	ENSP00000331556:G592R	ENSP00000331556:G592R	G	+	1	0	CYLC1	83016146	0.013000	0.17824	0.000000	0.03702	0.005000	0.04900	2.049000	0.41288	0.333000	0.23563	-0.192000	0.12808	GGG		0.423	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
KLHL4	56062	broad.mit.edu	37	X	86880632	86880632	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:86880632G>T	ENST00000373119.4	+	6	1305	c.1160G>T	c.(1159-1161)aGt>aTt	p.S387I	KLHL4_ENST00000373114.4_Missense_Mutation_p.S387I	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	387						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S387I(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						CTTGAAACCAGTTCCATGTTT	0.393																																					p.S387I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1160T	X						.						92.0	78.0	83.0					X																	86880632		2203	4300	6503	86767288	SO:0001583	missense	56062	exon6			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1160G>T	X.37:g.86880632G>T	ENSP00000362211:p.Ser387Ile		86767288	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879439	0.33162	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.75367	-0.93;-0.89	4.89	2.11	0.27256	.	0.387651	0.30742	N	0.008965	T	0.59115	0.2170	N	0.22421	0.69	0.41181	D	0.986234	B;B	0.14438	0.003;0.01	B;B	0.19391	0.007;0.025	T	0.54234	-0.8324	10	0.59425	D	0.04	.	9.6143	0.39681	0.2552:0.0:0.7448:0.0	.	387;387	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	I	387	ENSP00000362211:S387I;ENSP00000362206:S387I	ENSP00000362206:S387I	S	+	2	0	KLHL4	86767288	1.000000	0.71417	0.976000	0.42696	0.859000	0.49053	3.966000	0.56795	0.422000	0.26005	0.513000	0.50165	AGT		0.393	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
PCDH11X	27328	broad.mit.edu	37	X	91134077	91134077	+	Silent	SNP	T	T	A			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:91134077T>A	ENST00000373094.1	+	2	3683	c.2838T>A	c.(2836-2838)ccT>ccA	p.P946P	PCDH11X_ENST00000361655.2_Silent_p.P946P|PCDH11X_ENST00000504220.2_Silent_p.P946P|PCDH11X_ENST00000373097.1_Silent_p.P946P|PCDH11X_ENST00000406881.1_Silent_p.P946P|PCDH11X_ENST00000361724.1_Silent_p.P946P|PCDH11X_ENST00000298274.8_Silent_p.P946P|PCDH11X_ENST00000395337.2_Silent_p.P946P|PCDH11X_ENST00000373088.1_Silent_p.P946P	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	946					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P946P(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTCCACAGCCTGCCTTCCAAA	0.488																																					p.P946P	NSCLC(38;925 1092 2571 38200 45895)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2838A	X						.						174.0	156.0	162.0					X																	91134077		2203	4300	6503	91020733	SO:0001819	synonymous_variant	27328	exon2			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2838T>A	X.37:g.91134077T>A			91020733	NM_032968	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																				0.488	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
TSPAN6	7105	broad.mit.edu	37	X	99891633	99891633	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:99891633A>G	ENST00000373020.4	-	1	170	c.59T>C	c.(58-60)gTt>gCt	p.V20A	TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	20					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.V20A(1)		endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						GATTAGCAGAACGCTCTTGAA	0.577																																					p.V20A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T59C	X						.						78.0	63.0	68.0					X																	99891633		2203	4300	6503	99778289	SO:0001583	missense	7105	exon1			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.59T>C	X.37:g.99891633A>G	ENSP00000362111:p.Val20Ala		99778289	NM_003270	Q54A42|Q6IAN9	Missense_Mutation	SNP	ENST00000373020.4	37	CCDS14470.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.259323	0.39995	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	T	0.80738	-1.41	4.09	4.09	0.47781	.	0.285769	0.33477	N	0.004871	T	0.76140	0.3946	L	0.61218	1.895	0.52501	D	0.99995	B	0.10296	0.003	B	0.16722	0.016	T	0.71262	-0.4645	9	.	.	.	.	11.5762	0.50862	1.0:0.0:0.0:0.0	.	20	O43657	TSN6_HUMAN	A	20	ENSP00000362111:V20A	.	V	-	2	0	TSPAN6	99778289	1.000000	0.71417	0.887000	0.34795	0.335000	0.28730	5.793000	0.69060	1.641000	0.50575	0.430000	0.28490	GTT		0.577	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057483.1		
L1CAM	3897	broad.mit.edu	37	X	153129362	153129362	+	Missense_Mutation	SNP	G	G	A	rs200798819		TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Illumina			Illumina HiSeq	TCGA-AA-A01P-01A-21W-A096-10	TCGA-AA-A01P-11A-11W-A096-10	g.chrX:153129362G>A	ENST00000370060.1	-	26	3622	c.3433C>T	c.(3433-3435)Cgc>Tgc	p.R1145C	L1CAM_ENST00000361981.3_Missense_Mutation_p.R1140C|L1CAM_ENST00000370055.1_Missense_Mutation_p.R1140C|L1CAM_ENST00000370057.3_Missense_Mutation_p.R1145C|L1CAM_ENST00000361699.4_Missense_Mutation_p.R1145C|L1CAM_ENST00000543994.1_Missense_Mutation_p.R1147C|L1CAM_ENST00000538883.1_Missense_Mutation_p.R1147C	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1145					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.R1145C(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCTTGCTGCGCTTGATGAAG	0.627																																					p.R1140C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3418T	X						.						83.0	64.0	70.0					X																	153129362		2203	4300	6503	152782556	SO:0001583	missense	3897	exon24			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3433C>T	X.37:g.153129362G>A	ENSP00000359077:p.Arg1145Cys		152782556	NM_001143963	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042600	0.75732	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	D;D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	4.11	4.11	0.48088	.	0.000000	0.53938	D	0.000044	D	0.93897	0.8047	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.94737	0.7915	10	0.87932	D	0	.	14.4461	0.67349	0.0:0.0:1.0:0.0	.	1140;1145;1145	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	C	1145;1147;1145;1147;1140;1140;1145	ENSP00000359077:R1145C;ENSP00000438430:R1147C;ENSP00000359074:R1145C;ENSP00000439645:R1147C;ENSP00000354712:R1140C;ENSP00000359072:R1140C;ENSP00000355380:R1145C	ENSP00000355380:R1145C	R	-	1	0	L1CAM	152782556	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.803000	0.38863	1.899000	0.54978	0.529000	0.55759	CGC		0.627	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
