Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	isArtifactMode	oxoGCut
PAX7	5081	broad.mit.edu	37	1	19029673	19029673	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:19029673C>T	uc001bay.2	+	7	1636	c.1038C>T	c.(1036-1038)GCC>GCT	p.A346A	PAX7_uc001baz.2_Silent_p.A344A|PAX7_uc010oct.1_Silent_p.A346A	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	346	Poly-Ala.				anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CTGCAGCCGCCGACACCAGCT	0.667		NA	T	FOXO1A	alveolar rhabdomyosarcoma								4	16					0	0	0	0
TMEM39B	55116	broad.mit.edu	37	1	32542920	32542920	+	Splice_Site	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:32542920G>A	uc010ogv.1	+	5	736	c.590_splice	c.e5+1	p.P197_splice	TMEM39B_uc010ogt.1_Intron|TMEM39B_uc010ogu.1_Splice_Site_p.P70_splice|TMEM39B_uc001bue.3_Splice_Site_p.P197_splice|TMEM39B_uc001buf.3_Intron|TMEM39B_uc010ogw.1_Intron	NM_018056	NP_060526	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B							integral to membrane					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TCTGCTATCCGTGAGTACCCC	0.597		NA											19	75					0	0	0	0
RIMKLA	284716	broad.mit.edu	37	1	42880192	42880192	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:42880192C>T	uc001chi.2	+	5	861	c.723C>T	c.(721-723)GGC>GGT	p.G241G		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	241	ATP-grasp.				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CAGAACAAGGCAAGCAGTTGG	0.502		NA											60	351					0	0	0	0
ELOVL1	64834	broad.mit.edu	37	1	43830980	43830980	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:43830980G>A	uc001ciz.2	-	4	357	c.114C>T	c.(112-114)TAC>TAT	p.Y38Y	ELOVL1_uc001cja.2_Silent_p.Y38Y|ELOVL1_uc001cjb.2_Silent_p.Y38Y|ELOVL1_uc001cjc.2_RNA|ELOVL1_uc010okh.1_Silent_p.Y38Y	NM_022821	NP_073732	Q9BW60	ELOV1_HUMAN	elongation of very long chain fatty acids-like	38	Helical; (Potential).				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|sphingolipid biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	fatty acid elongase activity|protein binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGAAGTACACGTAGGTCAGGA	0.527		NA											14	40					0	0	0	0
LRRC8D	55144	broad.mit.edu	37	1	90400812	90400812	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:90400812C>T	uc001dnm.2	+	3	2610	c.2185C>T	c.(2185-2187)CAG>TAG	p.Q729*	LRRC8D_uc001dnn.2_Nonsense_Mutation_p.Q729*	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member	729						integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ATTTAGTTTACAGAAACTCAG	0.378		NA											22	140					0	0	0	0
S100A7A	338324	broad.mit.edu	37	1	153390659	153390659	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:153390659C>T	uc001fbt.1	+	2	158	c.101C>T	c.(100-102)ACG>ATG	p.T34M		NM_176823	NP_789793	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7-like 1	34	EF-hand 1.					cytoplasm	calcium ion binding			skin(1)	1	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCCTGCTGACGATGATGAAG	0.483		NA											81	190					0	0	0	0
FCRL5	83416	broad.mit.edu	37	1	157514262	157514262	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:157514262C>T	uc001fqu.2	-	5	792	c.634G>A	c.(634-636)GAG>AAG	p.E212K	FCRL5_uc009wsm.2_Missense_Mutation_p.E212K|FCRL5_uc010phv.1_Missense_Mutation_p.E212K|FCRL5_uc010phw.1_Missense_Mutation_p.E127K|FCRL5_uc001fqv.1_Missense_Mutation_p.E212K|FCRL5_uc010phx.1_5'UTR	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	212	Extracellular (Potential).|Ig-like C2-type 2.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGCTGGGTCTCACAGGTCAGG	0.562		NA											57	238					0	0	0	0
CD1A	909	broad.mit.edu	37	1	158226598	158226598	+	Silent	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:158226598C>G	uc001frt.2	+	4	1160	c.627C>G	c.(625-627)TCC>TCG	p.S209S		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	209	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CCTGGCTGTCCCATGGCCCCA	0.522		NA											37	178					0	0	0	0
SPTA1	6708	broad.mit.edu	37	1	158615002	158615002	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:158615002G>A	uc001fst.1	-	29	4369	c.4170C>T	c.(4168-4170)ATC>ATT	p.I1390I		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1390	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ACTGGTCTAGGATCTTCTTGC	0.438		NA											46	300					0	0	0	0
DDR2	4921	broad.mit.edu	37	1	162748507	162748507	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:162748507C>T	uc001gcf.2	+	18	2886	c.2421C>T	c.(2419-2421)GAC>GAT	p.D807D	DDR2_uc001gcg.2_Silent_p.D807D	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	807	Cytoplasmic (Potential).|Protein kinase.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			TCTTCCGAGACCAAGGGAGGC	0.498		NA											23	135					0	0	0	0
ILDR2	387597	broad.mit.edu	37	1	166905901	166905901	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:166905901C>T	uc001gdx.1	-	5	686	c.630G>A	c.(628-630)CAG>CAA	p.Q210Q		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	210	Cys-rich.|Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						GAGGGCAGCACTGGCACCAGC	0.592		NA											9	68					0	0	0	0
FAIM3	9214	broad.mit.edu	37	1	207087230	207087230	+	Missense_Mutation	SNP	G	G	A	rs138817695	byFrequency	TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:207087230G>A	uc001hey.2	-	2	426	c.247C>T	c.(247-249)CGC>TGC	p.R83C	FAIM3_uc010prz.1_Intron|FAIM3_uc010psa.1_Missense_Mutation_p.T26M|FAIM3_uc010psb.1_Missense_Mutation_p.R83C	NM_005449	NP_005440	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3 isoform a	83	Ig-like.|Extracellular (Potential).				anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)					AGATTCTTGCGTGGGTATTGC	0.537		NA											27	220					0	0	0	0
ESRRG	2104	broad.mit.edu	37	1	216850620	216850620	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:216850620G>C	uc001hkw.1	-	2	436	c.270C>G	c.(268-270)ATC>ATG	p.I90M	ESRRG_uc001hky.1_Missense_Mutation_p.I67M|ESRRG_uc009xdp.1_Missense_Mutation_p.I67M|ESRRG_uc001hkz.1_Missense_Mutation_p.I67M|ESRRG_uc010puc.1_Missense_Mutation_p.I67M|ESRRG_uc001hla.1_Missense_Mutation_p.I67M|ESRRG_uc001hlb.1_Missense_Mutation_p.I67M|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.I67M|ESRRG_uc001hld.1_Missense_Mutation_p.I67M|ESRRG_uc001hkx.1_Missense_Mutation_p.I95M|ESRRG_uc009xdo.1_Missense_Mutation_p.I67M|ESRRG_uc001hle.1_Missense_Mutation_p.I67M	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	90					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TACCTCCCAGGATAGGAGCAG	0.537		NA											28	198					0	0	0	0
OR11L1	391189	broad.mit.edu	37	1	248004602	248004602	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:248004602G>A	uc001idn.1	-	1	597	c.597C>T	c.(595-597)ATC>ATT	p.I199I		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACAGGATGAAGATGGTCACCT	0.483		NA											29	180					0	0	0	0
TUBB8	347688	broad.mit.edu	37	10	94647	94647	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr10:94647C>T	uc001ifi.2	-	3	185	c.185G>A	c.(184-186)CGC>CAC	p.R62H	TUBB8_uc009xhe.2_Intron|TUBB8_uc010pzs.1_5'UTR	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 isoform 1	62					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GAGCACAGCGCGGGGCACGTA	0.697		NA											14	53					0	0	0	0
LRRC4C	57689	broad.mit.edu	37	11	40137559	40137559	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr11:40137559C>A	uc001mxa.1	-	2	2248	c.284G>T	c.(283-285)AGC>ATC	p.S95I	LRRC4C_uc001mxc.1_Missense_Mutation_p.S91I|LRRC4C_uc001mxd.1_Missense_Mutation_p.S91I|LRRC4C_uc001mxb.1_Missense_Mutation_p.S91I	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	95	LRR 1.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTGCTTGAAGCTGTTCACTTT	0.473		NA											32	90					7.73e-29	9.16e-29	1	0
OR5T3	390154	broad.mit.edu	37	11	56020434	56020434	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr11:56020434G>T	uc010rjd.1	+	1	759	c.759G>T	c.(757-759)TTG>TTT	p.L253F		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	253	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					TCATTCTGTTGTCCATTCTGA	0.423		NA											58	380					6.18e-18	7.23e-18	1	0
MAP3K11	4296	broad.mit.edu	37	11	65380600	65380600	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr11:65380600C>T	uc001oew.2	-	1	1121	c.628G>A	c.(628-630)GTG>ATG	p.V210M	MAP3K11_uc010rol.1_5'Flank	NM_002419	NP_002410	Q16584	M3K11_HUMAN	mitogen-activated protein kinase kinase kinase	210	Protein kinase.				activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity	p.V210M(1)		breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						TGGGGAGGCACGCGCCGCCCG	0.657		NA											14	72					0	0	0	0
ROBO3	64221	broad.mit.edu	37	11	124743756	124743756	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr11:124743756C>T	uc001qbc.2	+	11	1974	c.1782C>T	c.(1780-1782)TTC>TTT	p.F594F	ROBO3_uc010saq.1_5'Flank|ROBO3_uc001qbd.2_5'Flank|ROBO3_uc010sar.1_5'Flank|ROBO3_uc001qbe.2_5'Flank	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	594	Fibronectin type-III 1.|Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TAGAGGCCTTCAGGTATGGAG	0.498		NA											15	14					0	0	0	0
DDX47	51202	broad.mit.edu	37	12	12966313	12966313	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:12966313C>T	uc001rav.2	+	4	610	c.12C>T	c.(10-12)CCC>CCT	p.P4P	DDX47_uc009zhw.1_Silent_p.P4P|DDX47_uc001rax.2_Silent_p.P4P|DDX47_uc001ray.2_Silent_p.P4P|DDX47_uc010shn.1_Silent_p.P4P	NM_016355	NP_057439	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	4						nucleolus|nucleolus	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding				0		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		TGGCGGCACCCGAGGAACACG	0.567		NA									OREG0021680	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	42					0	0	0	0
EMP1	2012	broad.mit.edu	37	12	13364446	13364446	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:13364446T>A	uc001rbr.2	+	2	249	c.2T>A	c.(1-3)ATG>AAG	p.M1K	EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Missense_Mutation_p.M1K	NM_001423	NP_001414	P54849	EMP1_HUMAN	epithelial membrane protein 1	1	Helical; (Potential).				cell growth|cell proliferation|epidermis development	integral to membrane|membrane fraction					0		Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		AGAGCCAACATGTTGGTATTG	0.373		NA											158	164					0	0	0	0
BICD1	636	broad.mit.edu	37	12	32260449	32260449	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:32260449C>T	uc001rku.2	+	1	265	c.184C>T	c.(184-186)CTC>TTC	p.L62F	BICD1_uc001rkv.2_Missense_Mutation_p.L62F|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	62	Potential.				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GTACGACAGCCTCAAACAGGA	0.587		NA											9	9					0	0	0	0
DNM1L	10059	broad.mit.edu	37	12	32895604	32895604	+	Silent	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:32895604A>G	uc001rld.2	+	19	2237	c.2076A>G	c.(2074-2076)AAA>AAG	p.K692K	DNM1L_uc001rle.2_Silent_p.K666K|DNM1L_uc001rlf.2_Silent_p.K655K|DNM1L_uc010skh.1_Silent_p.K758K|DNM1L_uc001rlg.2_Silent_p.K747K|DNM1L_uc001rlh.2_Silent_p.K734K|DNM1L_uc010ski.1_Silent_p.K489K	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1	692	GED.				cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGCTGTATAAATCATCCTTAT	0.408		NA											147	135					0	0	0	0
MYF5	4617	broad.mit.edu	37	12	81112691	81112691	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:81112691T>C	uc001szg.2	+	3	764	c.629T>C	c.(628-630)ATA>ACA	p.I210T		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	210					muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						TTATCCAACATAGTGGACCGG	0.458		NA											38	115					0	0	0	0
RHOF	54509	broad.mit.edu	37	12	122219075	122219075	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:122219075G>A	uc001ubb.2	-	3	305	c.250C>T	c.(250-252)CGG>TGG	p.R84W	TMEM120B_uc001ubc.3_3'UTR|TMEM120B_uc009zxh.2_3'UTR|TMEM120B_uc001uba.1_Intron|RHOF_uc001ubd.3_Missense_Mutation_p.R84W	NM_019034	NP_061907	Q9HBH0	RHOF_HUMAN	ras homolog gene family, member F precursor	84					actin filament organization|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity			ovary(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GACAGGGGCCGCAGCCGGTCA	0.617		NA											10	65					0	0	0	0
WDR66	144406	broad.mit.edu	37	12	122413558	122413558	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr12:122413558G>A	uc009zxk.2	+	19	3115	c.2973G>A	c.(2971-2973)ATG>ATA	p.M991I		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	991							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTTTTGTCATGAGAGCAATTG	0.443		NA											15	102					0	0	0	0
ATP8A2	51761	broad.mit.edu	37	13	26273327	26273327	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr13:26273327T>G	uc001uqk.2	+	25	2370	c.2228T>G	c.(2227-2229)ATT>AGT	p.I743S	ATP8A2_uc010tdi.1_Missense_Mutation_p.I703S|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.I293S	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	703	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AGGGCAGCCATTACTCAGCAC	0.428		NA											11	101					0	0	0	0
PCDH20	64881	broad.mit.edu	37	13	61986457	61986457	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr13:61986457G>A	uc001vid.3	-	2	2139	c.1775C>T	c.(1774-1776)ACA>ATA	p.T592I	PCDH20_uc010thj.1_Missense_Mutation_p.T592I	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	565	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AGTAGAAACTGTCAGAATTCC	0.473		NA											22	213					0	0	0	0
LMO7	4008	broad.mit.edu	37	13	76391321	76391321	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr13:76391321C>T	uc001vjv.2	+	9	2032	c.1272C>T	c.(1270-1272)AGC>AGT	p.S424S	LMO7_uc010thv.1_Silent_p.S375S|LMO7_uc001vjt.1_Silent_p.S323S|LMO7_uc010thw.1_Silent_p.S274S|LMO7_uc001vjw.1_Silent_p.S330S	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	709						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GTGATGTCAGCGCAGAAGATG	0.408		NA											30	112					0	0	0	0
MDGA2	161357	broad.mit.edu	37	14	47426843	47426843	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr14:47426843G>C	uc001wwj.3	-	9	1812	c.1616C>G	c.(1615-1617)CCC>CGC	p.P539R	MDGA2_uc001wwi.3_Missense_Mutation_p.P310R|MDGA2_uc010ani.2_Missense_Mutation_p.P99R	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	539					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CACTGCAGGGGGATCTGTAGA	0.438		NA											18	128					0	0	0	0
TRIP11	9321	broad.mit.edu	37	14	92472287	92472287	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr14:92472287T>A	uc001xzy.2	-	11	2821	c.2033A>T	c.(2032-2034)GAA>GTA	p.E678V	TRIP11_uc010auf.1_Missense_Mutation_p.E414V	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	678	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		CTTTTCATTTTCCATTTTGAC	0.318		NA	T	PDGFRB	AML								21	128					0	0	0	0
KIAA0284	283638	broad.mit.edu	37	14	105359860	105359860	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr14:105359860C>G	uc010axb.2	+	15	4263	c.4039C>G	c.(4039-4041)CTG>GTG	p.L1347V	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Missense_Mutation_p.L1277V|KIAA0284_uc001yps.2_Missense_Mutation_p.L1288V|KIAA0284_uc001ypt.2_Missense_Mutation_p.L15V	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	1382						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CCTCTTGCAGCTGGTGCAGCG	0.672		NA											2	1					0	0	0	0
CRTC3	64784	broad.mit.edu	37	15	91181740	91181740	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr15:91181740G>A	uc002bpp.2	+	12	1435	c.1329G>A	c.(1327-1329)TCG>TCA	p.S443S	CRTC3_uc002bpo.2_Silent_p.S443S	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform	443					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CCCAGGTGTCGCCGCCACCCC	0.632		NA	T	MAML2	salivary gland mucoepidermoid								14	93					0	0	0	0
CHD2	1106	broad.mit.edu	37	15	93510590	93510590	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr15:93510590G>T	uc002bsp.2	+	17	2611	c.2036G>T	c.(2035-2037)GGG>GTG	p.G679V	CHD2_uc002bso.1_Missense_Mutation_p.G679V	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	679					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GAAGACCATGGGAAGGGGAGA	0.398		NA											11	72					1.5e-05	1.64e-05	1	0
PRSS36	146547	broad.mit.edu	37	16	31154165	31154165	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr16:31154165C>T	uc002ebd.2	-	9	1309	c.1250G>A	c.(1249-1251)CGC>CAC	p.R417H	PRSS36_uc010vff.1_Missense_Mutation_p.R192H|PRSS36_uc010vfg.1_Missense_Mutation_p.R417H|PRSS36_uc010vfh.1_Missense_Mutation_p.R417H	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	417	Peptidase S1 2.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						CACGGGCGTGCGCAGCTGCAG	0.751		NA											6	18					0	0	0	0
ADCY7	113	broad.mit.edu	37	16	50339755	50339755	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr16:50339755C>T	uc002egd.1	+	13	2015	c.1747C>T	c.(1747-1749)CGC>TGC	p.R583C	ADCY7_uc002egc.1_Missense_Mutation_p.R583C	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	583	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	GGGCTTTGAGCGCGAGGTGAG	0.677		NA											9	53					0	0	0	0
DPEP3	64180	broad.mit.edu	37	16	68011603	68011603	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr16:68011603C>T	uc002evc.3	-	6	1055	c.961G>A	c.(961-963)GTG>ATG	p.V321M	DPEP3_uc010cex.2_Missense_Mutation_p.V321M	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN	dipeptidase 3 isoform a	296					meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		TTGTCACACACAGCTCTGGCA	0.483		NA											9	36					0	0	0	0
PLCG2	5336	broad.mit.edu	37	16	81927341	81927341	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr16:81927341C>T	uc002fgt.2	+	12	1166	c.1014C>T	c.(1012-1014)AGC>AGT	p.S338S	PLCG2_uc010chg.1_Silent_p.S338S	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	338	PI-PLC X-box.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						AGCTGCGGAGCGAGTCGTCCC	0.617		NA											11	78					0	0	0	0
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr17:7578265A>G	uc002gim.2	-	6	778	c.584T>C	c.(583-585)ATC>ACC	p.I195T	TP53_uc002gig.1_Missense_Mutation_p.I195T|TP53_uc002gih.2_Missense_Mutation_p.I195T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63T|TP53_uc010cng.1_Missense_Mutation_p.I63T|TP53_uc002gii.1_Missense_Mutation_p.I63T|TP53_uc010cnh.1_Missense_Mutation_p.I195T|TP53_uc010cni.1_Missense_Mutation_p.I195T|TP53_uc002gij.2_Missense_Mutation_p.I195T|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102T|TP53_uc002gio.2_Missense_Mutation_p.I63T|TP53_uc010vug.1_Missense_Mutation_p.I156T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	195	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCACTCGGATAAGATGCTG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			25	50					0	0	0	0
ARSG	22901	broad.mit.edu	37	17	66366598	66366598	+	Silent	SNP	G	G	A	rs149931351	by1000genomes	TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr17:66366598G>A	uc002jhc.2	+	8	1711	c.915G>A	c.(913-915)CCG>CCA	p.P305P	ARSG_uc002jhb.1_Silent_p.P141P	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor	305					sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACAATGGCCCGTGGGCTCAGA	0.552		NA											10	61					0	0	0	0
CASKIN2	57513	broad.mit.edu	37	17	73497569	73497569	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr17:73497569A>C	uc002joc.2	-	19	4048	c.3498T>G	c.(3496-3498)ATT>ATG	p.I1166M	CASKIN2_uc010wsc.1_Missense_Mutation_p.I1084M	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	1166						cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTTGGTGCCAATGCTCTTCT	0.647		NA											24	146					0	0	0	0
CEP192	55125	broad.mit.edu	37	18	13056573	13056573	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr18:13056573C>T	uc010xac.1	+	19	4064	c.3984C>T	c.(3982-3984)CTC>CTT	p.L1328L	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Silent_p.L853L|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Silent_p.L1069L	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1328										ovary(4)|pancreas(1)	5						CCTCTTCCCTCTGTAACCCAT	0.468		NA											36	218					0	0	0	0
POTEC	388468	broad.mit.edu	37	18	14542737	14542737	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr18:14542737G>A	uc010dln.2	-	1	863	c.409C>T	c.(409-411)CGA>TGA	p.R137*	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	137										skin(3)	3						AGATCTTCTCGACGGACGTGG	0.602		NA											28	159					0	0	0	0
ZNF414	84330	broad.mit.edu	37	19	8577310	8577310	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr19:8577310G>A	uc002mkf.2	-	4	609	c.491C>T	c.(490-492)GCT>GTT	p.A164V	ZNF414_uc002mke.3_Missense_Mutation_p.A164V|ZNF414_uc010dwf.2_Missense_Mutation_p.A153V	NM_032370	NP_115746	Q96IQ9	ZN414_HUMAN	zinc finger protein 414 isoform 2	164	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTTGCTGTGAGCCACCAGCTC	0.587		NA											36	96					0	0	0	0
CCDC97	90324	broad.mit.edu	37	19	41825480	41825480	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr19:41825480G>A	uc002oqg.2	+	3	626	c.504G>A	c.(502-504)GGG>GGA	p.G168G	CYP2F1_uc010xvw.1_Intron	NM_052848	NP_443080	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	168											0						TCTGTGCAGGGGGCGAGTACT	0.572		NA											23	176					0	0	0	0
TPRX1	284355	broad.mit.edu	37	19	48305393	48305393	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr19:48305393C>A	uc002php.1	-	2	946	c.875G>T	c.(874-876)CGG>CTG	p.R292L		NM_198479	NP_940881	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox	292	Gly-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GCTTCGCATCCGGCCAGGACT	0.383		NA											37	53					6.97e-18	8.13e-18	1	0
NTSR2	23620	broad.mit.edu	37	2	11802234	11802234	+	Missense_Mutation	SNP	G	G	A	rs148798482	byFrequency	TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:11802234G>A	uc002rbq.3	-	2	831	c.757C>T	c.(757-759)CGC>TGC	p.R253C		NM_012344	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	253	Cytoplasmic (Potential).				sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	AGCTCCAGGCGGCTGGGGGTG	0.597		NA											51	153					0	0	0	0
ADCY3	109	broad.mit.edu	37	2	25059788	25059788	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:25059788G>A	uc002rfs.3	-	8	1859	c.1660C>T	c.(1660-1662)CAG>TAG	p.Q554*	ADCY3_uc002rfr.3_Nonsense_Mutation_p.Q187*|ADCY3_uc010ykm.1_Nonsense_Mutation_p.Q554*	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	554	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCACATACCTGGGCATCCTGC	0.522		NA											9	78					0	0	0	0
DNAJC27	51277	broad.mit.edu	37	2	25170613	25170613	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:25170613C>T	uc002rft.1	-	7	745	c.694G>A	c.(694-696)GAA>AAA	p.E232K	DNAJC27_uc010ykn.1_Missense_Mutation_p.E161K|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Silent_p.*178*	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	232	J.				protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						TTATTGACTTCATCCCTGGGA	0.453		NA											21	100					0	0	0	0
TTC7A	57217	broad.mit.edu	37	2	47278895	47278895	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:47278895G>A	uc002rvo.2	+	18	2396	c.2028G>A	c.(2026-2028)CGG>CGA	p.R676R	TTC7A_uc002rvm.2_Silent_p.R642R|TTC7A_uc010fbb.2_Silent_p.R700R|TTC7A_uc010fbc.2_Silent_p.R322R|TTC7A_uc002rvp.2_Silent_p.R557R|TTC7A_uc002rvq.2_Silent_p.R416R|TTC7A_uc002rvr.2_Silent_p.R125R	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	676							binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GCTCCCGGCGGGCTTCGTCCA	0.667		NA											17	105					0	0	0	0
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809175	48809175	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:48809175A>T	uc010yol.1	+	1	1450	c.1403A>T	c.(1402-1404)GAA>GTA	p.E468V	STON1_uc002rwo.3_Missense_Mutation_p.E468V|STON1_uc010fbm.2_Missense_Mutation_p.E468V|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.E468V|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.E468V	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	468					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AAGCGAGATGAATCCTATTAT	0.373		NA											32	197					0	0	0	0
MYO7B	4648	broad.mit.edu	37	2	128387389	128387389	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:128387389G>A	uc002top.2	+	34	4769	c.4716G>A	c.(4714-4716)TCG>TCA	p.S1572S	MYO7B_uc002tor.1_Silent_p.S425S	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1572						apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTAAGCCCTCGGCACAGCTGC	0.642		NA											9	43					0	0	0	0
XIRP2	129446	broad.mit.edu	37	2	168105922	168105922	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:168105922G>A	uc002udx.2	+	8	8038	c.8020G>A	c.(8020-8022)GAA>AAA	p.E2674K	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2499K|XIRP2_uc010fpq.2_Missense_Mutation_p.E2452K|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.E20K	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2499					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATCAGCTTGCGAAATTAAACA	0.398		NA											38	121					0	0	0	0
TTN	7273	broad.mit.edu	37	2	179435824	179435824	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:179435824C>T	uc010zfg.1	-	275	67555	c.67331G>A	c.(67330-67332)CGG>CAG	p.R22444Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R16139Q|TTN_uc010zfi.1_Missense_Mutation_p.R16072Q|TTN_uc010zfj.1_Missense_Mutation_p.R15947Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23371							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCTCTGGCCGTCCTGGTGG	0.463		NA											41	256					0	0	0	0
CXCR2	3579	broad.mit.edu	37	2	219000234	219000234	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:219000234C>T	uc002vgz.1	+	4	935	c.710C>T	c.(709-711)ACG>ATG	p.T237M	CXCR2_uc002vha.1_Missense_Mutation_p.T237M|CXCR2_uc002vhb.1_Missense_Mutation_p.T237M	NM_001557	NP_001548	P25025	CXCR2_HUMAN	interleukin 8 receptor beta	237	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity			lung(1)|breast(1)	2						ACCCTGCGTACGCTGTTTAAG	0.577		NA											54	312					0	0	0	0
ANKZF1	55139	broad.mit.edu	37	2	220098637	220098637	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr2:220098637C>T	uc002vkg.2	+	8	1194	c.1020C>T	c.(1018-1020)CTC>CTT	p.L340L	ANKZF1_uc010zkv.1_Silent_p.L284L|ANKZF1_uc010zkw.1_Silent_p.L130L|ANKZF1_uc002vkh.2_Silent_p.L130L|ANKZF1_uc002vki.2_Silent_p.L340L|ANKZF1_uc002vkj.1_Silent_p.L328L	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing	340						intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCGTGTGCTCCATAAGCTGA	0.557		NA											12	61					0	0	0	0
PTPRT	11122	broad.mit.edu	37	20	40713412	40713412	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr20:40713412G>A	uc002xkg.2	-	29	4230	c.4046C>T	c.(4045-4047)TCC>TTC	p.S1349F	PTPRT_uc010ggj.2_Missense_Mutation_p.S1368F|PTPRT_uc010ggi.2_Missense_Mutation_p.S552F	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1349	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGAGCGCTTGGAGGGGGGCGT	0.587		NA											11	37					0	0	0	0
CEBPB	1051	broad.mit.edu	37	20	48807602	48807602	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr20:48807602G>C	uc002xvi.1	+	1	227	c.32G>C	c.(31-33)TGT>TCT	p.C11S	CEBPB_uc002xvh.2_RNA	NM_005194	NP_005185	P17676	CEBPB_HUMAN	CCAAT/enhancer binding protein beta	11	Required for Lys-174 sumoylation.				acute-phase response|immune response		sequence-specific enhancer binding RNA polymerase II transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19)			GACCCAGCATGTCTCCCCCTG	0.701		NA											4	8					0	0	0	0
CDH26	60437	broad.mit.edu	37	20	58587740	58587740	+	Silent	SNP	G	G	A	rs141182679		TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr20:58587740G>A	uc002ybe.2	+	18	2754	c.2454G>A	c.(2452-2454)GCG>GCA	p.A818A	CDH26_uc002ybf.1_Intron|CDH26_uc010zzy.1_RNA|CDH26_uc002ybg.2_Silent_p.A309A|CDH26_uc002ybh.2_Silent_p.A151A|CDH26_uc002ybi.2_Silent_p.A110A	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a	Error:Variant_position_missing_in_Q8IXH8_after_alignment					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GTTCAAAAGCGACTCCGTTTG	0.458		NA											36	110					0	0	0	0
KRTAP10-10	353333	broad.mit.edu	37	21	46057890	46057890	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr21:46057890C>T	uc002zfq.2	+	1	618	c.556C>T	c.(556-558)CCC>TCC	p.P186S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181688	NP_859016	P60014	KR10A_HUMAN	keratin associated protein 10-10	186	15 X 5 AA repeats of C-C-X(3).|13.					keratin filament					0						CTGCTGCAGACCCTCCTCCTC	0.652		NA											40	162					0	0	0	0
UBE2L3	7332	broad.mit.edu	37	22	21975875	21975875	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr22:21975875G>A	uc002zva.1	+	4	459	c.382G>A	c.(382-384)GAA>AAA	p.E128K	UBE2L3_uc011aig.1_Missense_Mutation_p.E96K|UBE2L3_uc002zuz.1_3'UTR|UBE2L3_uc010gti.1_RNA	NM_003347	NP_003338	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	128					cell proliferation|cellular response to glucocorticoid stimulus|protein K11-linked ubiquitination|regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	ATP binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0	Colorectal(54;0.105)					CCTAGCTGAAGAATACTCTAA	0.488		NA											9	45					0	0	0	0
EFCAB6	64800	broad.mit.edu	37	22	43985982	43985982	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr22:43985982C>T	uc003bdy.1	-	24	3219	c.3004G>A	c.(3004-3006)GAA>AAA	p.E1002K	EFCAB6_uc003bdz.1_Missense_Mutation_p.E850K|EFCAB6_uc010gzi.1_Missense_Mutation_p.E850K|EFCAB6_uc010gzj.1_Missense_Mutation_p.E228K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1002					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				AGCTCCCCTTCGGTAAGAGAA	0.408		NA											84	99					0	0	0	0
CNTN4	152330	broad.mit.edu	37	3	2924854	2924854	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:2924854A>T	uc003bpc.2	+	8	899	c.678A>T	c.(676-678)AAA>AAT	p.K226N	CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Missense_Mutation_p.K226N	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	226	Ig-like C2-type 3.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		ATGAGCCCAAAATAGAAGTGC	0.383		NA											9	40					0	0	0	0
TTC21A	199223	broad.mit.edu	37	3	39170768	39170768	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:39170768T>G	uc003cjc.2	+	15	2300	c.2123T>G	c.(2122-2124)CTC>CGC	p.L708R	TTC21A_uc003cje.2_Missense_Mutation_p.L709R|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.L660R	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	708							binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTGCAGACCCTCAGAGACAGG	0.517		NA											24	157					0	0	0	0
BSN	8927	broad.mit.edu	37	3	49691010	49691010	+	Missense_Mutation	SNP	C	C	T	rs142305207		TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:49691010C>T	uc003cxe.3	+	5	4135	c.4021C>T	c.(4021-4023)CGT>TGT	p.R1341C		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1341					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCCCGATGTCCGTGTCACTCA	0.612		NA											50	90					0	0	0	0
ITIH3	3699	broad.mit.edu	37	3	52841096	52841096	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:52841096G>C	uc003dfv.2	+	19	2272	c.2236G>C	c.(2236-2238)GAC>CAC	p.D746H	ITIH3_uc011bek.1_Missense_Mutation_p.D554H	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	746					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CAGCTGGCTGGACACAGTCAC	0.418		NA											3	12					0	0	0	0
CD200R1L	344807	broad.mit.edu	37	3	112548233	112548233	+	Splice_Site	SNP	T	T	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:112548233T>C	uc003dzi.1	-	2	273	c.47_splice	c.e2-1	p.A16_splice	CD200R1L_uc011bhw.1_Splice_Site|CD200R1L_uc010hqf.1_Splice_Site	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2							integral to membrane	receptor activity			ovary(1)	1						TACTTGAAGCTAGAAAACATT	0.373		NA											31	75					0	0	0	0
KALRN	8997	broad.mit.edu	37	3	124418822	124418822	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:124418822C>A	uc003ehg.2	+	56	8065	c.7938C>A	c.(7936-7938)AAC>AAA	p.N2646K	KALRN_uc003ehk.2_Missense_Mutation_p.N949K	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2645	Fibronectin type-III.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GTGCCAGTAACCCCTGGGGAA	0.582		NA											73	238					1.52e-38	1.81e-38	1	0
EIF2A	83939	broad.mit.edu	37	3	150289839	150289839	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:150289839C>T	uc003eya.2	+	10	922	c.906C>T	c.(904-906)TTC>TTT	p.F302F	SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Silent_p.F175F|EIF2A_uc003eyc.2_Silent_p.F175F|EIF2A_uc011bnv.1_Silent_p.F277F|EIF2A_uc011bnw.1_Silent_p.F241F|EIF2A_uc003eyd.2_Silent_p.F77F|uc003eye.1_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A	302					regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGACAATTTTCAACTTGAAAT	0.378		NA											12	68					0	0	0	0
DRD5	1816	broad.mit.edu	37	4	9783799	9783799	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr4:9783799T>A	uc003gmb.3	+	1	542	c.146T>A	c.(145-147)CTA>CAA	p.L49Q		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	49	Helical; Name=1; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	CTGCTGACCCTACTCATCATC	0.677		NA											7	23					0	0	0	0
MUC7	4589	broad.mit.edu	37	4	71346528	71346528	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr4:71346528C>T	uc011cat.1	+	4	355	c.67C>T	c.(67-69)CGA>TGA	p.R23*	MUC7_uc011cau.1_Nonsense_Mutation_p.R23*|MUC7_uc003hfj.2_Nonsense_Mutation_p.R23*	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	23						extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			CAGTGAAGGTCGAGAAAGGGA	0.249		NA											20	162					0	0	0	0
BTF3	689	broad.mit.edu	37	5	72798376	72798376	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr5:72798376C>G	uc003kcr.1	+	3	508	c.265C>G	c.(265-267)CAG>GAG	p.Q89E	BTF3_uc003kcq.1_Missense_Mutation_p.Q45E|BTF3_uc003kcs.1_RNA|BTF3_uc003kct.1_RNA	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A	89	NAC-A/B.			Missing (in Ref. 2; AAA58398).	regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		CAAAAAACTTCAGTTCTCCTT	0.383		NA											6	35					0	0	0	0
FAM172A	83989	broad.mit.edu	37	5	93300198	93300198	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr5:93300198C>G	uc010jbd.2	-	5	547	c.340G>C	c.(340-342)GAA>CAA	p.E114Q	FAM172A_uc011cuf.1_Missense_Mutation_p.E68Q|FAM172A_uc011cug.1_Missense_Mutation_p.E68Q|FAM172A_uc011cuh.1_Missense_Mutation_p.E31Q|FAM172A_uc011cui.1_RNA|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Missense_Mutation_p.E114Q	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1	114						endoplasmic reticulum|extracellular region					0						CAATCCTTTTCCAGGAGCTCA	0.264		NA											3	19					0	0	0	0
KCNN2	3781	broad.mit.edu	37	5	113798815	113798815	+	Silent	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr5:113798815C>G	uc003kqo.2	+	4	1528	c.1071C>G	c.(1069-1071)CTC>CTG	p.L357L	KCNN2_uc003kqp.2_Silent_p.L9L|KCNN2_uc010jcg.2_RNA|uc003kqq.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	357						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TAACTTTTCTCTCCATTGGTT	0.383		NA											30	247					0	0	0	0
MICB	4277	broad.mit.edu	37	6	31477569	31477569	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:31477569C>T	uc003ntn.3	+	6	1151	c.1035C>T	c.(1033-1035)AGC>AGT	p.S345S	MICB_uc011dnm.1_Silent_p.S313S|MICB_uc003nto.3_Silent_p.S302S	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	345	Cytoplasmic (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						AGCTTGTGAGCCTGCAGGTCC	0.522		NA											32	166					0	0	0	0
ZFAND3	60685	broad.mit.edu	37	6	38084398	38084398	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:38084398G>A	uc003onx.2	+	5	827	c.412G>A	c.(412-414)GAG>AAG	p.E138K		NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3	138							DNA binding|zinc ion binding			ovary(1)	1						ACGACTACTTGAGAATACGGA	0.498		NA											18	116					0	0	0	0
DEFB113	245927	broad.mit.edu	37	6	49937338	49937338	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:49937338T>C	uc011dwq.1	-	1	1	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_001037729	NP_001032818	Q30KQ7	DB113_HUMAN	beta-defensin 113 precursor	1					defense response to bacterium	extracellular region					0	Lung NSC(77;0.042)					AGTATCTTCATTGCTGATGCA	0.343		NA											16	89					0	0	0	0
KLHL31	401265	broad.mit.edu	37	6	53519101	53519101	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:53519101G>A	uc003pcb.3	-	2	1111	c.970C>T	c.(970-972)CGC>TGC	p.R324C		NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1	324	Kelch 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					AGGCCTGGGCGTCCCCCAACA	0.478		NA											54	116					0	0	0	0
DST	667	broad.mit.edu	37	6	56426989	56426989	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:56426989A>G	uc003pdf.2	-	50	7686	c.7658T>C	c.(7657-7659)GTA>GCA	p.V2553A	DST_uc003pcz.3_Missense_Mutation_p.V2375A|DST_uc011dxj.1_Missense_Mutation_p.V2404A|DST_uc011dxk.1_Missense_Mutation_p.V2415A|DST_uc003pcy.3_Missense_Mutation_p.V2049A	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	4461					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACCATTTAATACTGCTCCACC	0.303		NA											2	5					0	0	0	0
OSTM1	28962	broad.mit.edu	37	6	108395463	108395463	+	Silent	SNP	T	T	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:108395463T>A	uc003psd.2	-	1	479	c.393A>T	c.(391-393)CGA>CGT	p.R131R		NM_014028	NP_054747	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	131	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CCCCCGCGGCTCGGCTGATGT	0.597		NA											8	23					0	0	0	0
MICAL1	64780	broad.mit.edu	37	6	109774946	109774946	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:109774946G>A	uc003ptj.2	-	2	615	c.361C>T	c.(361-363)CGC>TGC	p.R121C	MICAL1_uc003ptk.2_Missense_Mutation_p.R121C|MICAL1_uc010kdr.2_Missense_Mutation_p.R121C|MICAL1_uc011eaq.1_Missense_Mutation_p.R140C	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	121					cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		ACGTTGTGGCGAGAGAACTTG	0.662		NA											10	51					0	0	0	0
LAMA2	3908	broad.mit.edu	37	6	129468119	129468119	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:129468119A>G	uc003qbn.2	+	6	940	c.835A>G	c.(835-837)AAG>GAG	p.K279E	LAMA2_uc003qbo.2_Missense_Mutation_p.K279E	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	279	Laminin N-terminal.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTACTCGGTCAAGGATATTTC	0.403		NA											31	227					0	0	0	0
LAMA2	3908	broad.mit.edu	37	6	129774131	129774131	+	Splice_Site	SNP	A	A	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:129774131A>C	uc003qbn.2	+	45	6535	c.6430_splice	c.e45-2	p.I2144_splice	LAMA2_uc003qbo.2_Splice_Site_p.I2144_splice	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTTTTTTTAAAGATCAAAGTA	0.343		NA											13	65					0	0	0	0
RAB32	10981	broad.mit.edu	37	6	146865133	146865133	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr6:146865133C>G	uc003qln.1	+	1	306	c.126C>G	c.(124-126)ATC>ATG	p.I42M		NM_006834	NP_006825	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	42					protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		CCAGCATCATCAAGCGCTACG	0.522		NA											13	36					0	0	0	0
DGKB	1607	broad.mit.edu	37	7	14622703	14622703	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr7:14622703G>A	uc003ssz.2	-	17	1683	c.1496C>T	c.(1495-1497)ACC>ATC	p.T499I	DGKB_uc011jxt.1_Missense_Mutation_p.T480I|DGKB_uc003sta.2_Missense_Mutation_p.T499I|DGKB_uc011jxu.1_Missense_Mutation_p.T498I	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	499	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CCAGCCCACGGTTCCATCTCC	0.398		NA											8	55					0	0	0	0
BAZ1B	9031	broad.mit.edu	37	7	72865288	72865288	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr7:72865288G>A	uc003tyc.2	-	14	3814	c.3469C>T	c.(3469-3471)CGG>TGG	p.R1157W		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1157					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				TGAGCTTCCCGGATTGCTGTC	0.488		NA											31	114					0	0	0	0
SEMA3E	9723	broad.mit.edu	37	7	83014715	83014715	+	Silent	SNP	A	A	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr7:83014715A>T	uc003uhy.1	-	16	2236	c.1770T>A	c.(1768-1770)GCT>GCA	p.A590A		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	590	Ig-like C2-type.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				CTATGCCATAAGCCAGATGTT	0.373		NA											29	281					0	0	0	0
PARP12	64761	broad.mit.edu	37	7	139741627	139741627	+	Silent	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr7:139741627A>G	uc003vvl.1	-	6	1873	c.999T>C	c.(997-999)TCT>TCC	p.S333S	PARP12_uc003vvk.1_Silent_p.S119S|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	333	WWE 1.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					TGGCTGACTCAGAGCACAGGA	0.527		NA											56	111					0	0	0	0
CSMD3	114788	broad.mit.edu	37	8	113812428	113812428	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr8:113812428T>A	uc003ynu.2	-	13	2094	c.1935A>T	c.(1933-1935)GAA>GAT	p.E645D	CSMD3_uc003ynt.2_Missense_Mutation_p.E605D|CSMD3_uc011lhx.1_Missense_Mutation_p.E541D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	645	Extracellular (Potential).|CUB 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATCCAACACTTTCGTCCGTTT	0.378		NA								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			37	90					0	0	0	0
KCNV2	169522	broad.mit.edu	37	9	2717793	2717793	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:2717793G>A	uc003zho.1	+	1	268	c.54G>A	c.(52-54)ACG>ACA	p.T18T		NM_133497	NP_598004	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	18	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(50;0.0257)		CCTGGAACACGACGGAGAATG	0.607		NA											74	158					0	0	0	0
ORM1	5004	broad.mit.edu	37	9	117087155	117087155	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:117087155G>C	uc004bik.3	+	4	525	c.414G>C	c.(412-414)AAG>AAC	p.K138N	ORM1_uc011lxo.1_Missense_Mutation_p.K138N	NM_000607	NP_000598	P02763	A1AG1_HUMAN	orosomucoid 1 precursor	138					acute-phase response|regulation of immune system process|transport	extracellular space	protein binding				0		Myeloproliferative disorder(63;0.163)			Acenocoumarol(DB01418)|Alfentanil(DB00802)|Aprindine(DB01429)|Disopyramide(DB00280)|Penbutolol(DB01359)|Phenprocoumon(DB00946)|Quinidine(DB00908)|Tamsulosin(DB00706)	ACGATGAGAAGAACTGGGGGC	0.567		NA											10	73					0	0	0	0
TLR4	7099	broad.mit.edu	37	9	120470945	120470945	+	Silent	SNP	G	G	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:120470945G>A	uc004bjz.2	+	2	489	c.198G>A	c.(196-198)CTG>CTA	p.L66L	TLR4_uc004bka.2_Silent_p.L26L|TLR4_uc004bkb.2_Intron	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	66	LRR 1.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TTAATCCCCTGAGGCATTTAG	0.438		NA											29	212					0	0	0	0
PHF19	26147	broad.mit.edu	37	9	123629194	123629194	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:123629194C>T	uc004bks.1	-	7	917	c.664G>A	c.(664-666)GAG>AAG	p.E222K	PHF19_uc011lyf.1_Missense_Mutation_p.E13K|PHF19_uc004bkr.2_RNA	NM_015651	NP_056466	Q5T6S3	PHF19_HUMAN	PHD finger protein 19 isoform a	222	PHD-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|breast(1)	2						GTGCAGGCCTCGTGGAACCAC	0.607		NA											18	92					0	0	0	0
GOLGA1	2800	broad.mit.edu	37	9	127685430	127685430	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:127685430C>T	uc004bpc.2	-	8	847	c.505G>A	c.(505-507)GAA>AAA	p.E169K	GOLGA1_uc010mws.2_RNA|GOLGA1_uc010mwt.1_Missense_Mutation_p.E144K	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	169	Potential.					Golgi cisterna membrane				ovary(1)	1						TCATCCATTTCATCTCTCCTT	0.348		NA											34	182					0	0	0	0
SNAPC4	6621	broad.mit.edu	37	9	139272877	139272877	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:139272877C>A	uc004chh.2	-	21	3411	c.3402G>T	c.(3400-3402)TGG>TGT	p.W1134C		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	1134	Pro-rich.				snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CTGGGGGCTGCCAAGAGCTGC	0.687		NA											5	17					5.94e-07	6.6e-07	1	0
IL1RAPL1	11141	broad.mit.edu	37	X	29938080	29938080	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:29938080A>G	uc004dby.2	+	8	1434	c.926A>G	c.(925-927)CAT>CGT	p.H309R		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	309	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						CTTAAGGAGCATCTTGGGGAA	0.363		NA											42	107					0	0	0	0
TEX11	56159	broad.mit.edu	37	X	69749731	69749731	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:69749731C>T	uc004dyl.2	-	30	2846	c.2684G>A	c.(2683-2685)CGT>CAT	p.R895H	TEX11_uc004dyk.2_Missense_Mutation_p.R570H|TEX11_uc004dym.2_Missense_Mutation_p.R880H	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	895							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					GTTAAGGAAACGCAAGGCCAG	0.498		NA											7	59					0	0	0	0
TCEAL5	340543	broad.mit.edu	37	X	102528984	102528984	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:102528984A>C	uc004ejz.1	-	3	803	c.508T>G	c.(508-510)TGG>GGG	p.W170G		NM_001012979	NP_001012997	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	170					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(1)|breast(1)	2						CTTTGCATCCAATGAAAACCA	0.512		NA											43	106					0	0	0	0
MID2	11043	broad.mit.edu	37	X	107170195	107170195	+	Silent	SNP	C	C	A			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:107170195C>A	uc004enl.2	+	10	2673	c.2100C>A	c.(2098-2100)ATC>ATA	p.I700I	MID2_uc004enk.2_Silent_p.I670I	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	700	B30.2/SPRY.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						CCCTAATGATCCTGTCTGGCT	0.443		NA											36	94					9.73e-26	1.15e-25	1	0
LUZP4	51213	broad.mit.edu	37	X	114536558	114536558	+	Silent	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:114536558C>T	uc004eqa.2	+	2	127	c.93C>T	c.(91-93)GAC>GAT	p.D31D	LUZP4_uc004eqb.2_Translation_Start_Site	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	31						nucleus		p.D31Y(1)		ovary(2)	2						CTAATACAGACGACATTATAA	0.299		NA											17	36					0	0	0	0
MAP7D3	79649	broad.mit.edu	37	X	135314215	135314215	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chrX:135314215C>T	uc004ezt.2	-	8	992	c.901G>A	c.(901-903)GCA>ACA	p.A301T	MAP7D3_uc004ezs.2_Missense_Mutation_p.A265T|MAP7D3_uc011mwc.1_Missense_Mutation_p.A283T|MAP7D3_uc010nsa.1_Missense_Mutation_p.A259T	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	301						cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TCCACACTTGCCTTGGGAGGT	0.517		NA											72	239					0	0	0	0
CACNA1E	777	broad.mit.edu	37	1	181680102	181680103	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr1:181680102_181680103delAG	uc001gow.2	+	8	1233_1234	c.1068_1069delAG	c.(1066-1071)AAAGAGfs	p.K356fs	CACNA1E_uc009wxs.2_Frame_Shift_Del_p.K263fs	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	356_357	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AATTTGCCAAAGAGAGAGAGAG	0.51		NA											8	157	---	---	---	---	NA	NA	NA	NA
JUB	84962	broad.mit.edu	37	14	23451267	23451268	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr14:23451267_23451268insG	uc001whz.2	-	1	584_585	c.208_209insC	c.(208-210)CTGfs	p.L70fs		NM_032876	NP_116265	Q96IF1	JUB_HUMAN	ajuba isoform 1	70	PreLIM.				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding				0	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0122)		CTCAGCGTCCAGGGAACCTTGC	0.693		NA											12	14	---	---	---	---	NA	NA	NA	NA
LINS1	55180	broad.mit.edu	37	15	101120736	101120737	+	Frame_Shift_Ins	INS	-	-	AATA	rs61741890	byFrequency	TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr15:101120736_101120737insAATA	uc002bwe.2	-	3	602_603	c.311_312insTATT	c.(310-312)TTGfs	p.L104fs	LINS1_uc002bwf.2_Frame_Shift_Ins_p.L104fs|LINS1_uc002bwg.2_Frame_Shift_Ins_p.L104fs|LINS1_uc002bwh.2_Frame_Shift_Ins_p.L104fs|LINS1_uc010usa.1_Intron|LINS1_uc002bwi.2_Frame_Shift_Ins_p.L104fs	NM_001040614	NP_001035704	Q8NG48	LINES_HUMAN	lines homolog 1	104											0	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TTTTGACAGACAATATCCGGGT	0.406		NA											12	122	---	---	---	---	NA	NA	NA	NA
CEP97	79598	broad.mit.edu	37	3	101476041	101476042	+	Splice_Site	INS	-	-	T			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr3:101476041_101476042insT	uc003dvk.1	+	8	1054	c.1027_splice	c.e8+1	p.E343_splice	CEP97_uc010hpm.1_Splice_Site_p.E309_splice|CEP97_uc011bhf.1_Splice_Site_p.E343_splice|CEP97_uc003dvl.1_Splice_Site_p.E39_splice|CEP97_uc003dvm.1_Splice_Site_p.E181_splice	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2						CAGGAAAGTGGTAAGAAATGAA	0.371		NA											33	200	---	---	---	---	NA	NA	NA	NA
DOLK	22845	broad.mit.edu	37	9	131708357	131708357	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CV-5431-01A-01D-1512-08	TCGA-CV-5431-11A-01D-1512-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f1a234f0-8890-4cf3-891f-c7a7423b1e75	9fd15bac-b77c-4246-b8d7-895e9cd0e4d3	g.chr9:131708357delA	uc004bwr.2	-	1	1656	c.1226delT	c.(1225-1227)ATCfs	p.I409fs	NUP188_uc004bws.1_5'Flank|NUP188_uc004bwq.1_Intron	NM_014908	NP_055723	Q9UPQ8	DOLK_HUMAN	dolichol kinase	409	Helical; (Potential).				dolichyl diphosphate biosynthetic process|dolichyl monophosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to endoplasmic reticulum membrane|membrane fraction	dolichol kinase activity				0						GAGCAGGTAGATGTGTGTCAG	0.577		NA											20	91	---	---	---	---	NA	NA	NA	NA
