#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
RLF	6018	broad.mit.edu	37	1	40703344	40703344	+	Silent	SNP	G	G	A	rs549341072		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr1:40703344G>A	ENST00000372771.4	+	8	2997	c.2970G>A	c.(2968-2970)acG>acA	p.T990T		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	990					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AGATAAAGACGAAAGATCTGT	0.408																																						uc001cfc.3		NA																	0				ovary(2)|pancreas(1)	3						c.(2968-2970)ACG>ACA		rearranged L-myc fusion							76.0	75.0	75.0					1																	40703344		2203	4300	6503	SO:0001819	synonymous_variant	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40703344G>A		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.2970G>A	1.37:g.40703344G>A						RLF_uc001cfd.3_Silent_p.T681T	p.T990T	NM_012421	NP_036553	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		8	3001	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	990					Q14CQ1|Q9NU60	Silent	SNP	ENST00000372771.4	37	c.2970G>A	CCDS448.1																																																																																				0.408	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		12	55	0	0	0	0	12	55				
HMCN1	83872	broad.mit.edu	37	1	186072800	186072800	+	Splice_Site	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr1:186072800G>A	ENST00000271588.4	+	69	10999	c.10770G>A	c.(10768-10770)caG>caA	p.Q3590Q	HMCN1_ENST00000367492.2_Splice_Site_p.Q3590Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3590	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTACTGCTCAGGTAAGTGTCA	0.393																																						uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(10768-10770)CAG>CAA		hemicentin 1 precursor							41.0	43.0	42.0					1																	186072800		2203	4299	6502	SO:0001630	splice_region_variant	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186072800G>A	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10770+1G>A	1.37:g.186072800G>A							p.Q3590Q	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			69	10999	+			3590			Ig-like C2-type 34.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	c.10770G>A	CCDS30956.1																																																																																				0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Silent	7	30	0	0	0	0	7	30				
HIF1AN	55662	broad.mit.edu	37	10	102296171	102296171	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr10:102296171C>A	ENST00000299163.6	+	2	281	c.181C>A	c.(181-183)Cct>Act	p.P61T	HIF1AN_ENST00000528044.1_3'UTR	NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	61	Interaction with VHL.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		CATTTAGGAGCCTGTGGTGCT	0.458																																						uc001krj.3		NA																	0					0						c.(181-183)CCT>ACT		hypoxia-inducible factor 1, alpha subunit							119.0	126.0	124.0					10																	102296171		2203	4300	6503	SO:0001583	missense	55662				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding	g.chr10:102296171C>A	AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.181C>A	10.37:g.102296171C>A	ENSP00000299163:p.Pro61Thr						p.P61T	NM_017902	NP_060372	Q9NWT6	HIF1N_HUMAN		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)	2	256	+		Colorectal(252;0.234)	61			Interaction with VHL.		D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	c.181C>A	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851781	0.91355	.	.	ENSG00000166135	ENST00000299163;ENST00000442724	D	0.95103	-3.61	4.71	4.71	0.59529	.	0.213853	0.51477	D	0.000098	D	0.97657	0.9232	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98423	1.0578	10	0.87932	D	0	-26.964	18.2106	0.89868	0.0:1.0:0.0:0.0	.	61	Q9NWT6	HIF1N_HUMAN	T	61;94	ENSP00000299163:P61T	ENSP00000299163:P61T	P	+	1	0	HIF1AN	102286161	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.487000	0.81328	2.603000	0.88011	0.650000	0.86243	CCT		0.458	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902		22	104	1	0	1.5e-11	1.73e-11	22	104				
LBX1	10660	broad.mit.edu	37	10	102987175	102987175	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr10:102987175C>T	ENST00000370193.2	-	2	1676	c.698G>A	c.(697-699)gGc>gAc	p.G233D	LBX1-AS1_ENST00000546988.1_RNA|LBX1-AS1_ENST00000547077.1_RNA	NM_006562.4	NP_006553.2	P52954	LBX1_HUMAN	ladybird homeobox 1	233					anatomical structure morphogenesis (GO:0009653)|heart looping (GO:0001947)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neuron fate determination (GO:0048664)|regulation of transcription from RNA polymerase II promoter involved in spinal cord association neuron specification (GO:0021920)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(4)|ovary(1)	7		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		GACCGGAGAGCCGGGCCTCGA	0.756																																						uc001ksx.2		NA																	0					0						c.(697-699)GGC>GAC		ladybird homeobox 1							7.0	10.0	9.0					10																	102987175		2121	4112	6233	SO:0001583	missense	10660				muscle organ development		sequence-specific DNA binding	g.chr10:102987175C>T	X90828	CCDS31270.1	10q24.32	2011-06-20	2007-02-15		ENSG00000138136	ENSG00000138136		"""Homeoboxes / ANTP class : NKL subclass"""	16960	protein-coding gene	gene with protein product		604255	"""ladybird homeobox homolog 1 (Drosophila)"""			8645601	Standard	XM_005269443		Approved	LBX1H, HPX6	uc001ksx.3	P52954	OTTHUMG00000018927	ENST00000370193.2:c.698G>A	10.37:g.102987175C>T	ENSP00000359212:p.Gly233Asp					uc010qpy.1_5'Flank	p.G233D	NM_006562	NP_006553	P52954	LBX1_HUMAN		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)	2	843	-		Colorectal(252;0.234)	233					B9EGA2|Q05BB2	Missense_Mutation	SNP	ENST00000370193.2	37	c.698G>A	CCDS31270.1	.	.	.	.	.	.	.	.	.	.	C	5.105	0.204987	0.09704	.	.	ENSG00000138136	ENST00000370193	D	0.94497	-3.44	5.54	3.35	0.38373	.	0.369581	0.28612	N	0.014739	D	0.87700	0.6243	N	0.19112	0.55	0.31631	N	0.649087	B	0.02656	0.0	B	0.01281	0.0	D	0.83665	0.0163	10	0.30078	T	0.28	.	10.34	0.43873	0.0:0.7618:0.0:0.2382	.	233	P52954	LBX1_HUMAN	D	233	ENSP00000359212:G233D	ENSP00000359212:G233D	G	-	2	0	LBX1	102977165	0.950000	0.32346	0.965000	0.40720	0.626000	0.37791	0.192000	0.17096	1.341000	0.45600	0.561000	0.74099	GGC		0.756	LBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049928.3	NM_006562		6	21	0	0	0	0	6	21				
CYB5R2	51700	broad.mit.edu	37	11	7689764	7689764	+	Silent	SNP	C	C	A	rs188062300		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr11:7689764C>A	ENST00000533558.1	-	6	973	c.417G>T	c.(415-417)acG>acT	p.T139T	CYB5R2_ENST00000528585.1_5'UTR|CYB5R2_ENST00000299498.6_Silent_p.T139T|CYB5R2_ENST00000299497.9_Silent_p.T139T|CYB5R2_ENST00000524790.1_Silent_p.T139T			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	139					oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAGGCTCACTCGTCTGGTCTG	0.507																																						uc001mfm.2		NA																	0					0						c.(415-417)ACG>ACT		cytochrome b5 reductase b5R.2							203.0	194.0	197.0					11																	7689764		2201	4296	6497	SO:0001819	synonymous_variant	51700				sterol biosynthetic process	membrane|soluble fraction	cytochrome-b5 reductase activity	g.chr11:7689764C>A	AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.417G>T	11.37:g.7689764C>A						CYB5R2_uc001mfn.2_RNA|CYB5R2_uc009yfk.2_Silent_p.T139T|CYB5R2_uc009yfl.1_3'UTR	p.T139T	NM_016229	NP_057313	Q6BCY4	NB5R2_HUMAN		Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	6	655	-			139					Q9BVA3|Q9UF68|Q9UHJ0	Silent	SNP	ENST00000533558.1	37	c.417G>T	CCDS7780.1																																																																																				0.507	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385679.1	NM_016229		27	104	1	0	9.65e-13	1.12e-12	27	104				
RASGRP2	10235	broad.mit.edu	37	11	64508502	64508502	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr11:64508502C>T	ENST00000354024.3	-	5	541	c.289G>A	c.(289-291)Gct>Act	p.A97T	RASGRP2_ENST00000394430.1_Missense_Mutation_p.A97T|RASGRP2_ENST00000394428.1_3'UTR|RASGRP2_ENST00000377497.3_Missense_Mutation_p.A97T|RASGRP2_ENST00000394429.1_3'UTR|RASGRP2_ENST00000377487.1_Missense_Mutation_p.A97T|RASGRP2_ENST00000394432.3_Missense_Mutation_p.A97T|RASGRP2_ENST00000377489.1_Missense_Mutation_p.A97T|RASGRP2_ENST00000377494.1_Missense_Mutation_p.A97T|RASGRP2_ENST00000377486.3_Missense_Mutation_p.A97T	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	97	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATCTGCTCAGCCAACTCCGGG	0.597											OREG0004006	type=REGULATORY REGION|Gene=RASGRP2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										uc009ypu.2		NA																	0					0						c.(289-291)GCT>ACT		RAS guanyl releasing protein 2							58.0	48.0	51.0					11																	64508502		2201	4297	6498	SO:0001583	missense	10235				platelet activation|Ras protein signal transduction|regulation of cell growth|regulation of small GTPase mediated signal transduction	cell junction|cytosol|ruffle membrane|synapse|synaptosome	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity	g.chr11:64508502C>T	U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.289G>A	11.37:g.64508502C>T	ENSP00000338864:p.Ala97Thr		OREG0004006	type=REGULATORY REGION|Gene=RASGRP2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1077	RASGRP2_uc001oat.2_5'Flank|RASGRP2_uc001oau.2_5'UTR|RASGRP2_uc009ypv.2_Missense_Mutation_p.A97T|RASGRP2_uc009ypw.2_Missense_Mutation_p.A97T	p.A97T	NM_001098671	NP_001092141	Q7LDG7	GRP2_HUMAN			5	516	-			97			N-terminal Ras-GEF.		A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	ENST00000354024.3	37	c.289G>A	CCDS31598.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961374	0.34565	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024;ENST00000431822;ENST00000377486;ENST00000377487;ENST00000377489;ENST00000394430;ENST00000439594;ENST00000377485	T;T;T;T;T;T;T;T;T;T	0.54866	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.55	4.32	4.32	0.51571	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.121637	0.53938	D	0.000041	T	0.48352	0.1495	L	0.38175	1.15	0.48901	D	0.999726	B	0.34200	0.441	B	0.43251	0.413	T	0.34700	-0.9818	10	0.13853	T	0.58	-2.1821	14.6766	0.68983	0.0:1.0:0.0:0.0	.	97	Q7LDG7	GRP2_HUMAN	T	97	ENSP00000366714:A97T;ENSP00000377953:A97T;ENSP00000366717:A97T;ENSP00000338864:A97T;ENSP00000399114:A97T;ENSP00000366706:A97T;ENSP00000366707:A97T;ENSP00000366709:A97T;ENSP00000377951:A97T;ENSP00000366705:A97T	ENSP00000338864:A97T	A	-	1	0	RASGRP2	64265078	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	2.254000	0.43214	2.117000	0.64856	0.313000	0.20887	GCT		0.597	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142062.1	NM_153819		9	35	0	0	0	0	9	35				
KLRC2	3822	broad.mit.edu	37	12	10584759	10584759	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr12:10584759C>A	ENST00000381902.2	-	5	536	c.530G>T	c.(529-531)cGt>cTt	p.R177L	NKG2-E_ENST00000539033.1_Intron|KLRC2_ENST00000536833.2_Missense_Mutation_p.R118L|KLRC2_ENST00000381901.1_Missense_Mutation_p.R177L	NM_002260.3	NP_002251.2	P26717	NKG2C_HUMAN	killer cell lectin-like receptor subfamily C, member 2	177	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11						ACTGCTGTTACGAAACACACC	0.294																																						uc001qyk.2		NA																	0					0						c.(529-531)CGT>CTT		killer cell lectin-like receptor subfamily C,							43.0	43.0	43.0					12																	10584759		2057	4153	6210	SO:0001583	missense	3822				cellular defense response	integral to plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:10584759C>A	X54869	CCDS31745.1	12p13	2009-12-03				ENSG00000205809		"""Killer cell lectin-like receptors"", ""CD molecules"""	6375	protein-coding gene	gene with protein product		602891				9598306	Standard	NM_002260		Approved	NKG2-C, CD159c		P26717		ENST00000381902.2:c.530G>T	12.37:g.10584759C>A	ENSP00000371327:p.Arg177Leu					KLRC3_uc001qyh.2_Intron|KLRC2_uc010she.1_Missense_Mutation_p.R177L	p.R177L	NM_002260	NP_002251	P26717	NKG2C_HUMAN			5	537	-			177			Extracellular (Potential).|C-type lectin.		O43802|Q52M74|Q9NR42	Missense_Mutation	SNP	ENST00000381902.2	37	c.530G>T	CCDS31745.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	13.18|13.18	2.161455|2.161455	0.38119|0.38119	.|.	.|.	ENSG00000205809|ENSG00000205809	ENST00000381902;ENST00000381901;ENST00000396433;ENST00000536833|ENST00000537017	T;T;T|.	0.06933|.	3.24;3.24;3.24|.	2.53|2.53	0.48|0.48	0.16804|0.16804	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);|.	0.000000|.	0.37095|.	N|.	0.002248|.	T|T	0.55146|0.55146	0.1902|0.1902	M|M	0.85859|0.85859	2.78|2.78	0.09310|0.09310	N|N	1|1	D;D|.	0.76494|.	0.991;0.999|.	D;D|.	0.69824|.	0.92;0.966|.	T|T	0.51434|0.51434	-0.8706|-0.8706	10|5	0.87932|.	D|.	0|.	.|.	3.501|3.501	0.07673|0.07673	0.2451:0.5997:0.0:0.1552|0.2451:0.5997:0.0:0.1552	.|.	163;177|.	Q3KQS7;P26717|.	.;NKG2C_HUMAN|.	L|L	177;177;70;118|55	ENSP00000371327:R177L;ENSP00000371326:R177L;ENSP00000444754:R118L|.	ENSP00000371326:R177L|.	R|V	-|-	2|1	0|0	KLRC2|KLRC2	10476026|10476026	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.038000|0.038000	0.13279|0.13279	0.169000|0.169000	0.16641|0.16641	-0.040000|-0.040000	0.13580|0.13580	0.484000|0.484000	0.47621|0.47621	CGT|GTA		0.294	KLRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400111.1	NM_002260		11	26	1	0	2.49e-13	2.9e-13	11	26				
HIST4H4	121504	broad.mit.edu	37	12	14923918	14923918	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr12:14923918G>A	ENST00000539745.1	-	1	147	c.101C>T	c.(100-102)gCg>gTg	p.A34V	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	34					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						ACGGCGAATCGCCGGCTTTGT	0.607											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001rcf.3		NA																	0				ovary(2)	2						c.(100-102)GCG>GTG		histone cluster 4, H4							52.0	55.0	54.0					12																	14923918		2203	4300	6503	SO:0001583	missense	121504				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr12:14923918G>A	AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.101C>T	12.37:g.14923918G>A	ENSP00000443017:p.Ala34Val		OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	698	HIST4H4_uc001rce.2_RNA	p.A34V	NM_175054	NP_778224	P62805	H4_HUMAN			1	148	-			34					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000539745.1	37	c.101C>T	CCDS8665.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587984	0.46110	.	.	ENSG00000197837	ENST00000539745	T	0.68479	-0.33	4.18	2.34	0.29019	.	0.000000	0.52532	U	0.000074	T	0.70465	0.3227	.	.	.	0.51767	D	0.999933	.	.	.	.	.	.	T	0.69053	-0.5247	7	0.56958	D	0.05	.	8.5172	0.33253	0.1901:0.0:0.8099:0.0	.	.	.	.	V	34	ENSP00000443017:A34V	ENSP00000350767:A34V	A	-	2	0	HIST4H4	14815185	1.000000	0.71417	0.013000	0.15412	0.023000	0.10783	5.026000	0.64103	0.531000	0.28639	0.650000	0.86243	GCG		0.607	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400844.1	NM_175054		32	52	0	0	0	0	32	52				
OR4M1	441670	broad.mit.edu	37	14	20249043	20249043	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr14:20249043G>T	ENST00000315957.4	+	1	643	c.562G>T	c.(562-564)Gcc>Tcc	p.A188S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTCCGGATTGCCTGTGCCAA	0.458																																						uc010tku.1		NA																	0					0						c.(562-564)GCC>TCC		olfactory receptor, family 4, subfamily M,							297.0	262.0	274.0					14																	20249043		2203	4297	6500	SO:0001583	missense	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20249043G>T		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.562G>T	14.37:g.20249043G>T	ENSP00000319654:p.Ala188Ser						p.A188S	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	562	+	all_cancers(95;0.00108)		188			Extracellular (Potential).		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	c.562G>T	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	16.49	3.138593	0.56936	.	.	ENSG00000176299	ENST00000315957	T	0.00021	9.02	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000144	T	0.00109	0.0003	L	0.39085	1.19	0.28329	N	0.921887	B	0.29909	0.261	B	0.33392	0.163	T	0.21552	-1.0242	10	0.72032	D	0.01	-11.7863	10.0384	0.42142	0.0:0.0:0.7989:0.2011	.	188	Q8NGD0	OR4M1_HUMAN	S	188	ENSP00000319654:A188S	ENSP00000319654:A188S	A	+	1	0	OR4M1	19318883	0.028000	0.19301	1.000000	0.80357	0.980000	0.70556	0.573000	0.23699	2.464000	0.83262	0.506000	0.49869	GCC		0.458	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			21	268	1	0	1.64e-13	1.93e-13	21	268				
OCA2	4948	broad.mit.edu	37	15	28230313	28230313	+	Missense_Mutation	SNP	G	G	A	rs372899234		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr15:28230313G>A	ENST00000354638.3	-	13	1416	c.1261C>T	c.(1261-1263)Cgg>Tgg	p.R421W	OCA2_ENST00000353809.5_Missense_Mutation_p.R397W|OCA2_ENST00000382996.2_Missense_Mutation_p.R421W	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	421					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.R421W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GCCCACACCCGTCCCCGGGAG	0.572									Oculocutaneous Albinism				G|||	1	0.000199681	0.0	0.0	5008	,	,		19287	0.0		0.0	False		,,,				2504	0.001					uc001zbh.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|breast(1)|pancreas(1)	5						c.(1261-1263)CGG>TGG		oculocutaneous albinism II		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	107.0	79.0	89.0		1261	0.1	0.0	15		89	0,8600		0,0,4300	no	missense	OCA2	NM_000275.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	421/839	28230313	1,13005	2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28230313G>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1261C>T	15.37:g.28230313G>A	ENSP00000346659:p.Arg421Trp					OCA2_uc010ayv.2_Missense_Mutation_p.R397W	p.R421W	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	13	1371	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	421			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1261C>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486431	0.63962	2.27E-4	0.0	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.82344	-1.6;-1.6;-1.6	5.35	0.0772	0.14407	Divalent ion symporter (1);	0.140477	0.64402	D	0.000009	D	0.88463	0.6443	M	0.69358	2.11	0.37669	D	0.923076	D;D	0.89917	1.0;1.0	D;D	0.72625	0.971;0.978	D	0.88999	0.3420	10	0.87932	D	0	-4.0634	14.1846	0.65598	0.0:0.0:0.5266:0.4734	.	397;421	Q04671-2;Q04671	.;P_HUMAN	W	421;397;421	ENSP00000346659:R421W;ENSP00000261276:R397W;ENSP00000372457:R421W	ENSP00000261276:R397W	R	-	1	2	OCA2	25903908	0.951000	0.32395	0.017000	0.16124	0.790000	0.44656	3.001000	0.49488	-0.172000	0.10779	-0.262000	0.10625	CGG		0.572	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		4	11	0	0	0	0	4	11				
SEZ6L2	26470	broad.mit.edu	37	16	29891363	29891363	+	Silent	SNP	G	G	A	rs112977823		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr16:29891363G>A	ENST00000308713.5	-	9	1922	c.1395C>T	c.(1393-1395)ttC>ttT	p.F465F	SEZ6L2_ENST00000350527.3_Silent_p.F395F|SEZ6L2_ENST00000537485.1_Silent_p.F421F|SEZ6L2_ENST00000346932.5_Silent_p.F351F	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	465	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGAAGGGGGCGAAGCAGCGAT	0.547																																						uc002duq.3		NA																	0				ovary(1)|skin(1)	2						c.(1393-1395)TTC>TTT		seizure related 6 homolog (mouse)-like 2 isoform							60.0	48.0	52.0					16																	29891363		2197	4300	6497	SO:0001819	synonymous_variant	26470					endoplasmic reticulum membrane|integral to membrane|plasma membrane		g.chr16:29891363G>A	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1395C>T	16.37:g.29891363G>A						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Silent_p.F395F|SEZ6L2_uc002dur.3_Silent_p.F395F|SEZ6L2_uc002dus.3_Silent_p.F351F|SEZ6L2_uc010vec.1_Silent_p.F465F|SEZ6L2_uc010ved.1_Silent_p.F421F	p.F465F	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN			9	1635	-			465			Sushi 2.|Extracellular (Potential).		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Silent	SNP	ENST00000308713.5	37	c.1395C>T	CCDS10659.1																																																																																				0.547	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410		10	29	0	0	0	0	10	29				
DDX19A	55308	broad.mit.edu	37	16	70404240	70404240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr16:70404240C>T	ENST00000302243.7	+	10	1298	c.1135C>T	c.(1135-1137)Cga>Tga	p.R379*	DDX19A_ENST00000443119.2_Nonsense_Mutation_p.R289*|DDX19A_ENST00000417604.2_Nonsense_Mutation_p.R348*	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	379	C-terminal lobe. {ECO:0000250}.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				TGAGCGCTTCCGAGAGGGCAA	0.622																																						uc002eyv.2		NA																	0					0						c.(1135-1137)CGA>TGA		DDX19-like protein							139.0	116.0	124.0					16																	70404240		2198	4300	6498	SO:0001587	stop_gained	55308				mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr16:70404240C>T	AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.1135C>T	16.37:g.70404240C>T	ENSP00000306117:p.Arg379*					DDX19B_uc010vly.1_Nonsense_Mutation_p.R380*|DDX19A_uc002eys.2_Nonsense_Mutation_p.R380*|DDX19A_uc010cfq.1_Nonsense_Mutation_p.R134*|DDX19A_uc010cfr.2_Nonsense_Mutation_p.R229*|DDX19A_uc010cfs.2_Nonsense_Mutation_p.R202*|DDX19A_uc010vlz.1_Nonsense_Mutation_p.R348*|DDX19A_uc010vma.1_Nonsense_Mutation_p.R289*	p.R379*	NM_018332	NP_060802	Q9NUU7	DD19A_HUMAN			10	1206	+		Ovarian(137;0.221)	379			Helicase C-terminal.		B2RPL0|B4DRZ7|Q53FM0	Nonsense_Mutation	SNP	ENST00000302243.7	37	c.1135C>T	CCDS10889.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178412	0.78564	.	.	ENSG00000168872	ENST00000302243;ENST00000302227;ENST00000417604;ENST00000443119	.	.	.	5.19	-1.15	0.09709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9872	0.19440	0.3872:0.4646:0.0:0.1481	.	.	.	.	X	379;271;348;289	.	ENSP00000306209:R271X	R	+	1	2	DDX19A	68961741	0.998000	0.40836	0.999000	0.59377	0.997000	0.91878	0.609000	0.24238	0.139000	0.18822	0.491000	0.48974	CGA		0.622	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268967.2	NM_018332		3	29	0	0	0	0	3	29				
GGNBP2	79893	broad.mit.edu	37	17	34935802	34935802	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr17:34935802C>T	ENST00000304718.4	+	8	1289	c.973C>T	c.(973-975)Cag>Tag	p.Q325*		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	325					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCAGACATGGCAGATGCTTTT	0.433																																						uc002hnb.2		NA																	0				ovary(2)	2						c.(973-975)CAG>TAG		zinc finger protein 403							181.0	176.0	178.0					17																	34935802		2203	4300	6503	SO:0001587	stop_gained	79893				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle		g.chr17:34935802C>T	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.973C>T	17.37:g.34935802C>T	ENSP00000307617:p.Gln325*					GGNBP2_uc002hna.2_Nonsense_Mutation_p.Q325*|GGNBP2_uc002hnc.1_Nonsense_Mutation_p.Q154*	p.Q325*	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)	8	1222	+		Breast(25;0.00957)|Ovarian(249;0.17)	325					B2RPK7|Q96T90|Q9GZR8|Q9H767	Nonsense_Mutation	SNP	ENST00000304718.4	37	c.973C>T	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	C	40	8.057207	0.98632	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-11.0422	19.973	0.97292	0.0:1.0:0.0:0.0	.	.	.	.	X	325	.	ENSP00000307617:Q325X	Q	+	1	0	GGNBP2	32009915	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.183000	0.77697	2.725000	0.93324	0.460000	0.39030	CAG		0.433	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835		7	120	0	0	0	0	7	120				
CWC25	54883	broad.mit.edu	37	17	36963178	36963178	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr17:36963178G>C	ENST00000225428.5	-	7	1039	c.742C>G	c.(742-744)Caa>Gaa	p.Q248E	CWC25_ENST00000536127.1_Missense_Mutation_p.Q185E	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	248										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						CCTCTCTTTTGCTCTGCTGTC	0.507																																						uc002hqu.2		NA																	0					0						c.(742-744)CAA>GAA		coiled-coil domain containing 49							105.0	103.0	104.0					17																	36963178		1945	4135	6080	SO:0001583	missense	54883							g.chr17:36963178G>C	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.742C>G	17.37:g.36963178G>C	ENSP00000225428:p.Gln248Glu					CWC25_uc010wdv.1_Missense_Mutation_p.Q185E|CWC25_uc010wdw.1_RNA|CWC25_uc010wdx.1_RNA	p.Q248E	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN			7	895	-			248					A0JLM3|Q68DK5	Missense_Mutation	SNP	ENST00000225428.5	37	c.742C>G	CCDS45663.1	.	.	.	.	.	.	.	.	.	.	G	0.099	-1.155054	0.01700	.	.	ENSG00000108296	ENST00000225428;ENST00000536127	T;T	0.45668	0.89;0.89	5.04	0.629	0.17687	.	1.730930	0.02678	N	0.109312	T	0.21801	0.0525	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.21827	-1.0234	10	0.05436	T	0.98	.	8.7954	0.34876	0.0:0.2555:0.4824:0.2621	.	185;248	B4DJK2;Q9NXE8	.;CWC25_HUMAN	E	248;185	ENSP00000225428:Q248E;ENSP00000438566:Q185E	ENSP00000225428:Q248E	Q	-	1	0	CWC25	34216704	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.195000	0.17155	0.708000	0.31955	-0.475000	0.04921	CAA		0.507	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748		13	57	0	0	0	0	13	57				
GRN	2896	broad.mit.edu	37	17	42430078	42430078	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr17:42430078G>T	ENST00000053867.3	+	13	1756	c.1694G>T	c.(1693-1695)tGc>tTc	p.C565F	GRN_ENST00000589265.1_Missense_Mutation_p.C408F	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	565					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GGCTTCCGCTGCGCAGCCAGG	0.667																																						uc002igp.1		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(1693-1695)TGC>TTC		granulin precursor							49.0	52.0	51.0					17																	42430078		2203	4300	6503	SO:0001583	missense	2896				signal transduction	extracellular space	cytokine activity|growth factor activity	g.chr17:42430078G>T	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.1694G>T	17.37:g.42430078G>T	ENSP00000053867:p.Cys565Phe					GRN_uc002igr.1_3'UTR	p.C565F	NM_002087	NP_002078	P28799	GRN_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	13	1913	+		Prostate(33;0.0181)	565					D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	ENST00000053867.3	37	c.1694G>T	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766632	0.90020	.	.	ENSG00000030582	ENST00000053867;ENST00000357351;ENST00000393566	D	0.96716	-4.1	5.53	5.53	0.82687	Granulin (3);	0.000000	0.85682	D	0.000000	D	0.98729	0.9573	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99667	1.0995	10	0.87932	D	0	-11.5599	16.9417	0.86220	0.0:0.0:1.0:0.0	.	565	P28799	GRN_HUMAN	F	565;410;385	ENSP00000053867:C565F	ENSP00000053867:C565F	C	+	2	0	GRN	39785604	1.000000	0.71417	0.619000	0.29118	0.045000	0.14185	8.258000	0.89853	2.599000	0.87857	0.561000	0.74099	TGC		0.667	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087		10	62	1	0	7.48e-07	8.39e-07	10	62				
ABCA8	10351	broad.mit.edu	37	17	66883568	66883568	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr17:66883568G>A	ENST00000269080.2	-	23	3241	c.3104C>T	c.(3103-3105)tCc>tTc	p.S1035F	ABCA8_ENST00000586539.1_Missense_Mutation_p.S1075F|ABCA8_ENST00000430352.2_Missense_Mutation_p.S1075F	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1035					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GAAGTACAGGGAAACATCCAC	0.418																																						uc002jhp.2		NA																	0				ovary(2)|skin(1)	3						c.(3103-3105)TCC>TTC		ATP-binding cassette, sub-family A member 8							116.0	134.0	128.0					17																	66883568		2203	4300	6503	SO:0001583	missense	10351					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr17:66883568G>A	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3104C>T	17.37:g.66883568G>A	ENSP00000269080:p.Ser1035Phe					ABCA8_uc002jhq.2_Missense_Mutation_p.S1075F|ABCA8_uc010wqq.1_Missense_Mutation_p.S1075F|ABCA8_uc010wqr.1_Missense_Mutation_p.S1014F	p.S1035F	NM_007168	NP_009099	O94911	ABCA8_HUMAN			23	3283	-	Breast(10;4.56e-13)		1035			Helical; (Potential).		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	c.3104C>T	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616238	0.87359	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	D;D	0.86297	-2.1;-2.1	4.5	4.5	0.54988	.	0.132210	0.34223	N	0.004142	D	0.87030	0.6076	L	0.39245	1.2	0.37797	D	0.927565	P;P;P;P	0.50617	0.937;0.88;0.481;0.708	P;P;P;P	0.56163	0.601;0.793;0.601;0.722	D	0.83835	0.0254	10	0.09843	T	0.71	.	16.2822	0.82697	0.0:0.0:1.0:0.0	.	1014;1075;1075;1035	F5H6Z4;A1L3U3;C9JQE6;O94911	.;.;.;ABCA8_HUMAN	F	1035;1075;1014	ENSP00000269080:S1035F;ENSP00000402814:S1075F	ENSP00000269080:S1035F	S	-	2	0	ABCA8	64395163	1.000000	0.71417	0.042000	0.18584	0.456000	0.32438	7.175000	0.77632	2.501000	0.84356	0.655000	0.94253	TCC		0.418	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168		11	104	0	0	0	0	11	104				
LPIN2	9663	broad.mit.edu	37	18	2923796	2923796	+	Silent	SNP	T	T	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr18:2923796T>A	ENST00000261596.4	-	16	2389	c.2151A>T	c.(2149-2151)gcA>gcT	p.A717A	RP11-737O24.5_ENST00000608032.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	717	C-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GGTAGAGCTTTGCTATACCCT	0.478																																						uc002klo.2		NA																	0				ovary(1)|skin(1)	2						c.(2149-2151)GCA>GCT		lipin 2							178.0	156.0	163.0					18																	2923796		2203	4300	6503	SO:0001819	synonymous_variant	9663				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity	g.chr18:2923796T>A	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.2151A>T	18.37:g.2923796T>A							p.A717A	NM_014646	NP_055461	Q92539	LPIN2_HUMAN		READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)	16	2390	-			717			C-LIP.		A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	37	c.2151A>T	CCDS11829.1																																																																																				0.478	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646		21	81	0	0	0	0	21	81				
RFX2	5990	broad.mit.edu	37	19	6004277	6004277	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr19:6004277T>A	ENST00000303657.5	-	13	1584	c.1435A>T	c.(1435-1437)Aag>Tag	p.K479*	RFX2_ENST00000592546.1_Nonsense_Mutation_p.K454*|CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000359161.3_Nonsense_Mutation_p.K479*	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TCCAAGCTCTTGGCAAAGTTA	0.547																																					Colon(38;171 817 19800 47433 48051)	uc002meb.2		NA																	0				breast(4)|ovary(1)|skin(1)	6						c.(1435-1437)AAG>TAG		regulatory factor X2 isoform a							178.0	153.0	161.0					19																	6004277		2203	4300	6503	SO:0001587	stop_gained	5990				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr19:6004277T>A		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1435A>T	19.37:g.6004277T>A	ENSP00000306335:p.Lys479*					RFX2_uc002mec.2_Nonsense_Mutation_p.K454*	p.K479*	NM_000635	NP_000626	P48378	RFX2_HUMAN			13	1704	-			479					A8K581|B3KNC4|Q6IQ44|Q8SNA2	Nonsense_Mutation	SNP	ENST00000303657.5	37	c.1435A>T	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	T	41	8.823397	0.98968	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-47.4418	14.0709	0.64858	0.0:0.0:0.0:1.0	.	.	.	.	X	479;454;266	.	ENSP00000306335:K479X	K	-	1	0	RFX2	5955277	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.832000	0.86757	2.057000	0.61298	0.533000	0.62120	AAG		0.547	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635		29	101	0	0	0	0	29	101				
CILP2	148113	broad.mit.edu	37	19	19655208	19655208	+	Silent	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr19:19655208G>A	ENST00000291495.5	+	8	1939	c.1854G>A	c.(1852-1854)gcG>gcA	p.A618A	CILP2_ENST00000586018.1_Silent_p.A624A	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	618						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TCACCTCGGCGGCGTCTGCCC	0.697																																						uc002nmv.3		NA																	0				ovary(1)	1						c.(1852-1854)GCG>GCA		cartilage intermediate layer protein 2							45.0	53.0	50.0					19																	19655208		2196	4292	6488	SO:0001819	synonymous_variant	148113					proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity	g.chr19:19655208G>A	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1854G>A	19.37:g.19655208G>A						CILP2_uc002nmw.3_Silent_p.A624A	p.A618A	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN			8	1939	+			618					Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	c.1854G>A	CCDS12405.1																																																																																				0.697	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221		7	118	0	0	0	0	7	118				
WNT10A	80326	broad.mit.edu	37	2	219755048	219755048	+	Missense_Mutation	SNP	C	C	T	rs201578578		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr2:219755048C>T	ENST00000258411.3	+	3	1352	c.719C>T	c.(718-720)gCg>gTg	p.A240V		NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	240					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GACATCCACGCGAGAATGAGG	0.617																																						uc002vjd.1		NA																	0				lung(1)|skin(1)	2						c.(718-720)GCG>GTG		wingless-type MMTV integration site family,		C	VAL/ALA	0,4392		0,0,2196	32.0	39.0	37.0		719	4.5	0.9	2		37	3,8589		0,3,4293	yes	missense	WNT10A	NM_025216.2	64	0,3,6489	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	240/418	219755048	3,12981	2196	4296	6492	SO:0001583	missense	80326				anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr2:219755048C>T	AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.719C>T	2.37:g.219755048C>T	ENSP00000258411:p.Ala240Val						p.A240V	NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	3	1182	+		Renal(207;0.0474)	240					Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	ENST00000258411.3	37	c.719C>T	CCDS2426.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972240	0.92919	0.0	3.49E-4	ENSG00000135925	ENST00000258411	T	0.76968	-1.06	4.46	4.46	0.54185	.	0.192641	0.45606	D	0.000350	T	0.76062	0.3935	L	0.59436	1.845	0.58432	D	0.999994	P	0.38020	0.615	B	0.40199	0.322	T	0.74893	-0.3509	10	0.28530	T	0.3	.	16.6424	0.85129	0.0:1.0:0.0:0.0	.	240	Q9GZT5	WN10A_HUMAN	V	240	ENSP00000258411:A240V	ENSP00000258411:A240V	A	+	2	0	WNT10A	219463292	1.000000	0.71417	0.926000	0.36857	0.718000	0.41266	7.530000	0.81962	2.478000	0.83669	0.655000	0.94253	GCG		0.617	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256730.2	NM_025216		6	31	0	0	0	0	6	31				
UGT1A7	54577	broad.mit.edu	37	2	234590879	234590879	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr2:234590879C>T	ENST00000373426.3	+	1	296	c.296C>T	c.(295-297)aCg>aTg	p.T99M	UGT1A1_ENST00000609637.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	99					cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)	p.T99M(1)		NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	GCTCGCTGGACGGCACCATTG	0.418																																						uc002vut.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(1)	1						c.(295-297)ACG>ATG		UDP glycosyltransferase 1 family, polypeptide A7							109.0	107.0	108.0					2																	234590879		2203	4300	6503	SO:0001583	missense	54577				drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding	g.chr2:234590879C>T	U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	ENST00000373426.3:c.296C>T	2.37:g.234590879C>T	ENSP00000362525:p.Thr99Met					UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Missense_Mutation_p.T99M	p.T99M	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	1	296	+		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)	99					B8K293|O00473	Missense_Mutation	SNP	ENST00000373426.3	37	c.296C>T	CCDS2506.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821540	0.32237	.	.	ENSG00000244122	ENST00000373426	T	0.59083	0.29	4.51	2.08	0.27032	.	.	.	.	.	T	0.44808	0.1311	L	0.27053	0.805	0.09310	N	1	P;P	0.35780	0.52;0.52	B;B	0.40444	0.329;0.329	T	0.34950	-0.9808	9	0.49607	T	0.09	.	6.2348	0.20756	0.5955:0.3226:0.0818:0.0	.	99;99	Q5DSZ7;Q9HAW7	.;UD17_HUMAN	M	99	ENSP00000362525:T99M	ENSP00000362525:T99M	T	+	2	0	UGT1A7	234255618	0.936000	0.31750	0.758000	0.31321	0.001000	0.01503	1.218000	0.32467	0.748000	0.32831	-0.641000	0.03968	ACG		0.418	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130614.1	NM_019077		6	105	0	0	0	0	6	105				
BPIFB6	128859	broad.mit.edu	37	20	31626754	31626754	+	Missense_Mutation	SNP	C	C	T	rs150580944		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr20:31626754C>T	ENST00000349552.1	+	9	886	c.886C>T	c.(886-888)Cgc>Tgc	p.R296C		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	296			R -> H (de novo variant found in a patient with mental retardation; dbSNP:rs79809934). {ECO:0000269|PubMed:21076407}.			extracellular region (GO:0005576)	lipid binding (GO:0008289)										GACCCTGGCTCGCTTCATTCC	0.557													c|||	1	0.000199681	0.0	0.0014	5008	,	,		17440	0.0		0.0	False		,,,				2504	0.0					uc010zuc.1		NA																	0				ovary(1)|pancreas(1)	2						c.(886-888)CGC>TGC		bactericidal/permeability-increasing			CYS/ARG	0,4406		0,0,2203	185.0	180.0	182.0		886	-3.2	0.7	20	dbSNP_134	182	7,8593	5.7+/-21.5	0,7,4293	yes	missense	BPIFB6	NM_174897.2	180	0,7,6496	TT,TC,CC		0.0814,0.0,0.0538	benign	296/454	31626754	7,12999	2203	4300	6503	SO:0001583	missense	128859					extracellular region	lipid binding	g.chr20:31626754C>T	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.886C>T	20.37:g.31626754C>T	ENSP00000344929:p.Arg296Cys					BPIL3_uc010zud.1_Missense_Mutation_p.R235C	p.R296C	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN			9	886	+			296		R -> H (de novo variant found in a patient with mental retardation).				Missense_Mutation	SNP	ENST00000349552.1	37	c.886C>T	CCDS13211.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	c	10.38	1.334338	0.24253	0.0	8.14E-4	ENSG00000167104	ENST00000349552	T	0.09073	3.02	4.48	-3.18	0.05186	.	0.926816	0.09010	N	0.861698	T	0.05686	0.0149	N	0.14661	0.345	0.19300	N	0.999975	P	0.40050	0.7	B	0.42112	0.376	T	0.40384	-0.9566	10	0.54805	T	0.06	.	8.0402	0.30517	0.168:0.5274:0.3046:0.0	.	296	Q8NFQ5	BPIB6_HUMAN	C	296	ENSP00000344929:R296C	ENSP00000344929:R296C	R	+	1	0	BPIFB6	31090415	0.261000	0.24063	0.727000	0.30756	0.326000	0.28443	-0.058000	0.11750	-0.348000	0.08286	-0.235000	0.12190	CGC		0.557	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897		37	136	0	0	0	0	37	136				
SOX18	54345	broad.mit.edu	37	20	62680604	62680604	+	Missense_Mutation	SNP	A	A	C			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr20:62680604A>C	ENST00000340356.7	-	1	390	c.266T>G	c.(265-267)aTg>aGg	p.M89R	ZNF512B_ENST00000450537.1_5'Flank	NM_018419.2	NP_060889.1	P35713	SOX18_HUMAN	SRY (sex determining region Y)-box 18	89					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|cell maturation (GO:0048469)|embryonic heart tube development (GO:0035050)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|establishment of endothelial barrier (GO:0061028)|hair cycle process (GO:0022405)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell proliferation (GO:0072091)|stem cell fate specification (GO:0048866)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)	nuclear chromatin (GO:0000790)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			lung(3)	3	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GAAGGCGTTCATGGGCCGCCG	0.721																																					GBM(27;64 690 17108 39708)	uc002yhs.2		NA																	0					0						c.(265-267)ATG>AGG		SRY-box 18							26.0	30.0	29.0					20																	62680604		2192	4294	6486	SO:0001583	missense	54345				angiogenesis|blood vessel endothelial cell migration|endocardial cell differentiation|endocardium formation|establishment of endothelial barrier|heart looping|lymphangiogenesis|lymphatic endothelial cell differentiation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|positive regulation of transcription from RNA polymerase II promoter|vasculogenesis	nucleus	transcription regulatory region DNA binding	g.chr20:62680604A>C	AB033888	CCDS13552.1	20q13.33	2008-07-28			ENSG00000203883	ENSG00000203883		"""SRY (sex determining region Y)-boxes"""	11194	protein-coding gene	gene with protein product		601618				10807548	Standard	NM_018419		Approved		uc002yhs.3	P35713	OTTHUMG00000033017	ENST00000340356.7:c.266T>G	20.37:g.62680604A>C	ENSP00000341815:p.Met89Arg						p.M89R	NM_018419	NP_060889	P35713	SOX18_HUMAN			1	376	-	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)		89			HMG box.		Q0VGA9|Q9NPH8	Missense_Mutation	SNP	ENST00000340356.7	37	c.266T>G	CCDS13552.1	.	.	.	.	.	.	.	.	.	.	a	18.33	3.600947	0.66332	.	.	ENSG00000203883	ENST00000340356	D	0.94138	-3.36	2.44	2.44	0.29823	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.94938	0.8363	M	0.80982	2.52	0.58432	D	0.999999	P	0.49862	0.929	P	0.56216	0.794	D	0.94447	0.7664	10	0.87932	D	0	.	9.9672	0.41732	1.0:0.0:0.0:0.0	.	89	P35713	SOX18_HUMAN	R	89	ENSP00000341815:M89R	ENSP00000341815:M89R	M	-	2	0	SOX18	62151048	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	6.645000	0.74343	0.988000	0.38734	0.157000	0.16456	ATG		0.721	SOX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080265.1			16	30	0	0	0	0	16	30				
IL17RA	23765	broad.mit.edu	37	22	17578691	17578691	+	Silent	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr22:17578691C>T	ENST00000319363.6	+	3	301	c.168C>T	c.(166-168)acC>acT	p.T56T	IL17RA_ENST00000477874.1_3'UTR	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	56					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TGCCAGGTACCTGCCTGGATG	0.567																																						uc002zly.2		NA																	0				skin(2)	2						c.(166-168)ACC>ACT		interleukin 17A receptor precursor							96.0	76.0	83.0					22																	17578691		2203	4300	6503	SO:0001819	synonymous_variant	23765				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity	g.chr22:17578691C>T	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.168C>T	22.37:g.17578691C>T						IL17RA_uc010gqt.2_Silent_p.T56T	p.T56T	NM_014339	NP_055154	Q96F46	I17RA_HUMAN		Colorectal(9;0.241)	3	301	+		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)	56			Extracellular (Potential).		O43844|Q20WK1	Silent	SNP	ENST00000319363.6	37	c.168C>T	CCDS13739.1																																																																																				0.567	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339		9	38	0	0	0	0	9	38				
KIAA0930	23313	broad.mit.edu	37	22	45601760	45601760	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr22:45601760G>A	ENST00000336156.5	-	3	315	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W	KIAA0930_ENST00000251993.7_Missense_Mutation_p.R89W|KIAA0930_ENST00000391627.2_Missense_Mutation_p.R50W|KIAA0930_ENST00000443310.3_Missense_Mutation_p.R66W	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	84										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						GAGTCCCGCCGGTACACCTCC	0.617																																						uc003bfx.1		NA																	0					0						c.(250-252)CGG>TGG		hypothetical protein LOC23313 isoform b							60.0	57.0	58.0					22																	45601760		2203	4300	6503	SO:0001583	missense	23313						protein binding	g.chr22:45601760G>A	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.250C>T	22.37:g.45601760G>A	ENSP00000336720:p.Arg84Trp					C22orf9_uc010gzw.1_5'UTR|C22orf9_uc003bfv.1_Missense_Mutation_p.R93W|C22orf9_uc003bfw.1_Missense_Mutation_p.R89W|C22orf9_uc010gzx.2_Missense_Mutation_p.R66W	p.R84W	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)	3	316	-		Ovarian(80;0.00965)|all_neural(38;0.0244)	84					B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Missense_Mutation	SNP	ENST00000336156.5	37	c.250C>T	CCDS33665.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112041	0.77210	.	.	ENSG00000100364	ENST00000336156;ENST00000251993;ENST00000391627;ENST00000443310;ENST00000414854;ENST00000424508	.	.	.	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.927;0.994;0.986	D	0.84940	0.0865	9	0.87932	D	0	-13.8458	16.989	0.86348	0.0:0.0:1.0:0.0	.	66;84;89;155	B0AZU2;Q6ICG6;Q6ICG6-2;Q8IUY4	.;K0930_HUMAN;.;.	W	84;89;50;66;50;66	.	ENSP00000251993:R89W	R	-	1	2	KIAA0930	43980424	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.711000	0.54868	2.095000	0.63458	0.561000	0.74099	CGG		0.617	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880		10	49	0	0	0	0	10	49				
RBM5	10181	broad.mit.edu	37	3	50145726	50145726	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr3:50145726C>T	ENST00000347869.3	+	14	1356	c.1181C>T	c.(1180-1182)tCa>tTa	p.S394L	RBM5_ENST00000441812.2_3'UTR	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	394	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCTGATGCATCATCTGCATCA	0.373																																						uc003cyg.2		NA																	0				lung(1)	1						c.(1180-1182)TCA>TTA		RNA binding motif protein 5							158.0	150.0	153.0					3																	50145726		2203	4300	6503	SO:0001583	missense	10181				apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding	g.chr3:50145726C>T	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1181C>T	3.37:g.50145726C>T	ENSP00000343054:p.Ser394Leu					RBM5_uc011bdj.1_Missense_Mutation_p.S338L|RBM5_uc011bdk.1_Missense_Mutation_p.S222L	p.S394L	NM_005778	NP_005769	P52756	RBM5_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	14	1329	+			394			Required for interaction with U2AF2.		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	c.1181C>T	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041239	0.55003	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.14766	2.48	5.83	5.83	0.93111	.	0.855898	0.10558	N	0.660651	T	0.08935	0.0221	N	0.03608	-0.345	0.80722	D	1	B;B	0.26935	0.164;0.043	B;B	0.21917	0.037;0.018	T	0.46911	-0.9157	10	0.37606	T	0.19	-2.7403	18.2852	0.90112	0.0:1.0:0.0:0.0	.	84;394	Q59HE6;P52756	.;RBM5_HUMAN	L	394;393;84	ENSP00000343054:S394L	ENSP00000343054:S394L	S	+	2	0	RBM5	50120730	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.504000	0.53347	2.762000	0.94881	0.655000	0.94253	TCA		0.373	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778		9	49	0	0	0	0	9	49				
ALPK1	80216	broad.mit.edu	37	4	113353310	113353310	+	Silent	SNP	C	C	T	rs553837857		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr4:113353310C>T	ENST00000458497.1	+	11	2886	c.2607C>T	c.(2605-2607)caC>caT	p.H869H	ALPK1_ENST00000177648.9_Silent_p.H869H|ALPK1_ENST00000504176.2_Silent_p.H791H	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	869							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CAAATGGGCACGGCTCTCATA	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		20700	0.0		0.0	False		,,,				2504	0.001					uc003iap.3		NA																	0				ovary(5)	5						c.(2605-2607)CAC>CAT		alpha-kinase 1							62.0	59.0	60.0					4																	113353310		2203	4300	6503	SO:0001819	synonymous_variant	80216						ATP binding|protein serine/threonine kinase activity	g.chr4:113353310C>T	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2607C>T	4.37:g.113353310C>T						ALPK1_uc003ian.3_Silent_p.H869H|ALPK1_uc011cfx.1_Silent_p.H791H|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Silent_p.H697H	p.H869H	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00325)	11	2886	+		Ovarian(17;0.0446)|Hepatocellular(203;0.217)	869					B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	ENST00000458497.1	37	c.2607C>T	CCDS3697.1																																																																																				0.597	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144		13	22	0	0	0	0	13	22				
CCRN4L	25819	broad.mit.edu	37	4	139966007	139966007	+	Silent	SNP	A	A	C			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr4:139966007A>C	ENST00000280614.2	+	3	868	c.675A>C	c.(673-675)ctA>ctC	p.L225L	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	225					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					CACCTTGTCTAGATGTAGAAC	0.463																																					Ovarian(144;566 1842 19130 21379 22209)	uc003ihl.2		NA																	0				ovary(1)	1						c.(673-675)CTA>CTC		CCR4 carbon catabolite repression 4-like							122.0	104.0	110.0					4																	139966007		2203	4300	6503	SO:0001819	synonymous_variant	25819				rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:139966007A>C	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.675A>C	4.37:g.139966007A>C							p.L225L	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN			3	868	+	all_hematologic(180;0.162)		225					D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Silent	SNP	ENST00000280614.2	37	c.675A>C	CCDS3743.1																																																																																				0.463	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118		26	51	0	0	0	0	26	51				
C5orf49	134121	broad.mit.edu	37	5	7832094	7832094	+	Missense_Mutation	SNP	G	G	A	rs187132919	byFrequency	TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr5:7832094G>A	ENST00000399810.2	-	3	781	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	C5orf49_ENST00000509627.1_Missense_Mutation_p.R103C	NM_001089584.2	NP_001083053.1	A4QMS7	CE049_HUMAN	chromosome 5 open reading frame 49	105								p.R105C(1)		large_intestine(3)|lung(5)|skin(1)	9						TGATTGATGCGCTTCCCATAG	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		19571	0.002		0.0	False		,,,				2504	0.0					uc003jea.3		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(313-315)CGC>TGC		hypothetical protein LOC134121							156.0	162.0	160.0					5																	7832094		2036	4183	6219	SO:0001583	missense	134121							g.chr5:7832094G>A		CCDS43300.1	5p15.31	2008-07-16			ENSG00000215217	ENSG00000215217			27028	protein-coding gene	gene with protein product						12477932	Standard	NM_001089584		Approved	LOC134121	uc003jea.5	A4QMS7	OTTHUMG00000161897	ENST00000399810.2:c.313C>T	5.37:g.7832094G>A	ENSP00000382708:p.Arg105Cys						p.R105C	NM_001089584	NP_001083053	A4QMS7	CE049_HUMAN			3	443	-			105						Missense_Mutation	SNP	ENST00000399810.2	37	c.313C>T	CCDS43300.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	15.82	2.945505	0.53079	.	.	ENSG00000215217	ENST00000399810;ENST00000509627	T;T	0.32753	1.44;1.44	4.72	3.85	0.44370	.	.	.	.	.	T	0.30293	0.0760	M	0.61703	1.905	0.50039	D	0.999847	B	0.25521	0.128	B	0.17722	0.019	T	0.13710	-1.0499	9	0.72032	D	0.01	-32.1385	10.3946	0.44192	0.0945:0.0:0.9055:0.0	.	105	A4QMS7	CE049_HUMAN	C	105;103	ENSP00000382708:R105C;ENSP00000426019:R103C	ENSP00000382708:R105C	R	-	1	0	C5orf49	7885094	0.998000	0.40836	0.994000	0.49952	0.457000	0.32468	3.291000	0.51764	1.117000	0.41842	0.555000	0.69702	CGC		0.542	C5orf49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366322.1	NM_001089584		9	156	0	0	0	0	9	156				
EDIL3	10085	broad.mit.edu	37	5	83402601	83402601	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr5:83402601G>T	ENST00000296591.5	-	6	935	c.517C>A	c.(517-519)Caa>Aaa	p.Q173K	EDIL3_ENST00000380138.3_Missense_Mutation_p.Q163K	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	173	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GCTGTGATTTGCTGGTTTGAT	0.393																																						uc003kio.1		NA																	0				skin(2)	2						c.(517-519)CAA>AAA		EGF-like repeats and discoidin I-like							175.0	185.0	182.0					5																	83402601		2203	4300	6503	SO:0001583	missense	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83402601G>T	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.517C>A	5.37:g.83402601G>T	ENSP00000296591:p.Gln173Lys					EDIL3_uc003kip.1_Missense_Mutation_p.Q163K	p.Q173K	NM_005711	NP_005702	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	6	936	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	173			F5/8 type C 1.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.517C>A	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642208	0.87859	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.98362	-4.89;-4.89	5.76	4.88	0.63580	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.180844	0.52532	N	0.000078	D	0.99121	0.9697	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	0.982;1.0	D;D	0.77557	0.968;0.99	D	0.99201	1.0873	10	0.87932	D	0	-18.1969	16.0539	0.80782	0.0:0.0:0.8646:0.1354	.	163;173	O43854-2;O43854	.;EDIL3_HUMAN	K	173;163	ENSP00000296591:Q173K;ENSP00000369483:Q163K	ENSP00000296591:Q173K	Q	-	1	0	EDIL3	83438357	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.209000	0.95087	1.418000	0.47098	0.650000	0.86243	CAA		0.393	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		17	105	1	0	6.94e-10	7.94e-10	17	105				
PCDHGB2	56103	broad.mit.edu	37	5	140741082	140741082	+	Silent	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr5:140741082C>T	ENST00000522605.1	+	1	1380	c.1380C>T	c.(1378-1380)caC>caT	p.H460H	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	460	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATGGTTCACGTGGCAGAGA	0.557																																						uc003ljs.1		NA																	0					0						c.(1378-1380)CAC>CAT		protocadherin gamma subfamily B, 2 isoform 1							90.0	92.0	92.0					5																	140741082		2036	4195	6231	SO:0001819	synonymous_variant	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741082C>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1380C>T	5.37:g.140741082C>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Silent_p.H460H|PCDHGA5_uc011das.1_5'Flank	p.H460H	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1380	+			460			Extracellular (Potential).|Cadherin 5.		Q3MIJ3|Q9UN65	Silent	SNP	ENST00000522605.1	37	c.1380C>T	CCDS54924.1																																																																																				0.557	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		26	67	0	0	0	0	26	67				
KIAA0141	9812	broad.mit.edu	37	5	141316762	141316762	+	Splice_Site	SNP	G	G	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr5:141316762G>T	ENST00000432126.2	+	11	1283		c.e11-1		KIAA0141_ENST00000194118.4_Splice_Site	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141						extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCTCCTTAGGACTCACAGA	0.498																																						uc003lls.2		NA																	0				skin(1)	1						c.e11-1		hypothetical protein LOC9812 precursor							179.0	168.0	172.0					5																	141316762		2203	4300	6503	SO:0001630	splice_region_variant	9812				apoptosis|regulation of caspase activity	mitochondrion	protein binding	g.chr5:141316762G>T	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1150-1G>T	5.37:g.141316762G>T						KIAA0141_uc003llt.2_Splice_Site_p.D384_splice|KIAA0141_uc003llu.1_Splice_Site	p.D384_splice	NM_001142603	NP_001136075	Q14154	DELE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		11	1272	+		all_hematologic(541;0.118)						Q969R4|Q96EU9	Splice_Site	SNP	ENST00000432126.2	37	c.1150_splice	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122216	0.56613	.	.	ENSG00000081791	ENST00000432126;ENST00000194118;ENST00000507481	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1108	0.72355	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0141	141296946	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	6.961000	0.76042	2.648000	0.89879	0.655000	0.94253	.		0.498	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	Intron	14	86	1	0	1.36e-06	1.52e-06	14	86				
FOXP4	116113	broad.mit.edu	37	6	41566645	41566645	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr6:41566645G>A	ENST00000307972.4	+	16	2026	c.2014G>A	c.(2014-2016)Gag>Aag	p.E672K	MIR4641_ENST00000578353.1_RNA|FOXP4_ENST00000373057.3_Missense_Mutation_p.E670K|FOXP4_ENST00000373060.1_Missense_Mutation_p.E672K|FOXP4_ENST00000373063.3_Missense_Mutation_p.E659K|FOXP4_ENST00000409208.1_Missense_Mutation_p.E660K			Q8IVH2	FOXP4_HUMAN	forkhead box P4	672					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GGACCTGGAGGAGGAGCTGCC	0.687																																						uc003oql.2		NA																	0				breast(1)	1						c.(2014-2016)GAG>AAG		forkhead box P4 isoform 1							24.0	29.0	27.0					6																	41566645		2202	4298	6500	SO:0001583	missense	116113				embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr6:41566645G>A	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.2014G>A	6.37:g.41566645G>A	ENSP00000309823:p.Glu672Lys					FOXP4_uc003oqm.2_Missense_Mutation_p.E670K|FOXP4_uc003oqn.2_Missense_Mutation_p.E659K	p.E672K	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN			17	2472	+	Ovarian(28;0.0327)|Colorectal(47;0.196)		672					Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	37	c.2014G>A	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827620	0.71143	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.91631	-2.81;-2.88;-2.83;-2.82;-2.81	4.36	4.36	0.52297	.	0.235838	0.33631	N	0.004701	D	0.85217	0.5646	L	0.50333	1.59	0.49915	D	0.999833	P;B;B	0.40970	0.734;0.083;0.083	B;B;B	0.34652	0.187;0.02;0.02	D	0.88720	0.3229	10	0.72032	D	0.01	.	15.206	0.73180	0.0:0.0:1.0:0.0	.	659;670;672	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	K	672;659;660;670;672	ENSP00000362151:E672K;ENSP00000362154:E659K;ENSP00000386958:E660K;ENSP00000362148:E670K;ENSP00000309823:E672K	ENSP00000309823:E672K	E	+	1	0	FOXP4	41674623	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	8.373000	0.90131	2.435000	0.82474	0.462000	0.41574	GAG		0.687	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457		5	14	0	0	0	0	5	14				
CD109	135228	broad.mit.edu	37	6	74440235	74440235	+	Missense_Mutation	SNP	C	C	T	rs137899447		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr6:74440235C>T	ENST00000287097.5	+	4	557	c.445C>T	c.(445-447)Cgc>Tgc	p.R149C	CD109_ENST00000437994.2_Missense_Mutation_p.R149C|CD109_ENST00000422508.2_Intron			Q6YHK3	CD109_HUMAN	CD109 molecule	149					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.R149C(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGTGAAGTTTCGCATTGTTAC	0.373																																						uc003php.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)	4						c.(445-447)CGC>TGC		CD109 antigen isoform 1 precursor							93.0	89.0	90.0					6																	74440235		2203	4300	6503	SO:0001583	missense	135228					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr6:74440235C>T	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.445C>T	6.37:g.74440235C>T	ENSP00000287097:p.Arg149Cys					CD109_uc010kaz.2_Missense_Mutation_p.R149C|CD109_uc003phq.2_Missense_Mutation_p.R149C|CD109_uc010kba.2_Intron	p.R149C	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN			4	870	+			149					A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	c.445C>T	CCDS4982.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.79	2.936917	0.52972	.	.	ENSG00000156535	ENST00000437994;ENST00000287097	T;T	0.77489	-1.1;-1.1	4.27	3.39	0.38822	Alpha-2-macroglobulin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88930	0.6571	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91568	0.5269	10	0.87932	D	0	.	12.6082	0.56535	0.1676:0.8324:0.0:0.0	.	149;149;149	Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	C	149	ENSP00000388062:R149C;ENSP00000287097:R149C	ENSP00000287097:R149C	R	+	1	0	CD109	74496956	1.000000	0.71417	0.986000	0.45419	0.605000	0.37080	3.440000	0.52886	1.114000	0.41781	0.650000	0.86243	CGC		0.373	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493		3	35	0	0	0	0	3	35				
TIAM2	26230	broad.mit.edu	37	6	155458480	155458480	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr6:155458480G>A	ENST00000461783.3	+	7	2637	c.1364G>A	c.(1363-1365)cGg>cAg	p.R455Q	TIAM2_ENST00000360366.4_Missense_Mutation_p.R455Q|TIAM2_ENST00000318981.5_Missense_Mutation_p.R455Q|TIAM2_ENST00000529824.2_Missense_Mutation_p.R455Q|TIAM2_ENST00000456144.1_Missense_Mutation_p.R455Q|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	455					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GATCCCCTCCGGCAGAACATT	0.512																																						uc003qqb.2		NA																	0				ovary(3)|breast(1)	4						c.(1363-1365)CGG>CAG		T-cell lymphoma invasion and metastasis 2							97.0	103.0	101.0					6																	155458480		2203	4300	6503	SO:0001583	missense	26230				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr6:155458480G>A		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1364G>A	6.37:g.155458480G>A	ENSP00000437188:p.Arg455Gln					TIAM2_uc003qqe.2_Missense_Mutation_p.R455Q|TIAM2_uc010kjj.2_5'UTR	p.R455Q	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	7	2637	+		Ovarian(120;0.196)	455					B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	c.1364G>A	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636178	0.47049	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.07908	3.23;3.15;3.2;3.23;3.29;3.2	6.08	-0.131	0.13494	.	0.371811	0.27927	N	0.017299	T	0.02342	0.0072	L	0.37561	1.115	0.80722	D	1	B	0.27192	0.171	B	0.17979	0.02	T	0.44143	-0.9347	10	0.46703	T	0.11	.	10.6896	0.45862	0.3767:0.0:0.6233:0.0	.	455	Q8IVF5	TIAM2_HUMAN	Q	455;701;455;455;455;455;455	ENSP00000437188:R455Q;ENSP00000434901:R455Q;ENSP00000407746:R455Q;ENSP00000327315:R455Q;ENSP00000353528:R455Q;ENSP00000433348:R455Q	ENSP00000327315:R455Q	R	+	2	0	TIAM2	155500172	0.996000	0.38824	0.008000	0.14137	0.969000	0.65631	2.498000	0.45363	-0.332000	0.08489	0.655000	0.94253	CGG		0.512	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		5	91	0	0	0	0	5	91				
DDX56	54606	broad.mit.edu	37	7	44612540	44612540	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr7:44612540C>T	ENST00000258772.5	-	3	438	c.332G>A	c.(331-333)cGg>cAg	p.R111Q	DDX56_ENST00000485367.1_5'UTR|DDX56_ENST00000431640.1_Missense_Mutation_p.R111Q	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	111	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						TCGGACATCCCGAGCACAGTA	0.527																																						uc003tlg.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(331-333)CGG>CAG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 56							148.0	134.0	138.0					7																	44612540		2203	4300	6503	SO:0001583	missense	54606				rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding	g.chr7:44612540C>T	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.332G>A	7.37:g.44612540C>T	ENSP00000258772:p.Arg111Gln					DDX56_uc003tle.2_RNA|DDX56_uc003tlf.2_Missense_Mutation_p.R47Q|DDX56_uc003tlh.2_RNA|DDX56_uc010kyg.2_Missense_Mutation_p.R111Q|DDX56_uc010kyh.1_Intron	p.R111Q	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN			3	975	-			111			Helicase ATP-binding.		A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	c.332G>A	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	35	5.514627	0.96402	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.14766	2.48;2.48	5.13	5.13	0.70059	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	L	0.28274	0.84	0.58432	D	0.999995	D;P	0.76494	0.999;0.894	D;B	0.69142	0.962;0.389	T	0.01492	-1.1341	10	0.45353	T	0.12	-12.7289	16.0888	0.81076	0.0:1.0:0.0:0.0	.	111;111	C9JV95;Q9NY93	.;DDX56_HUMAN	Q	111	ENSP00000258772:R111Q;ENSP00000393488:R111Q	ENSP00000258772:R111Q	R	-	2	0	DDX56	44579065	0.997000	0.39634	0.999000	0.59377	0.905000	0.53344	3.565000	0.53798	2.394000	0.81467	0.563000	0.77884	CGG		0.527	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082		38	82	0	0	0	0	38	82				
POM121L12	285877	broad.mit.edu	37	7	53103492	53103492	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr7:53103492C>T	ENST00000408890.4	+	1	144	c.128C>T	c.(127-129)aCg>aTg	p.T43M		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	43								p.T43M(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCCCAGACCACGCCATCTCCC	0.682																																						uc003tpz.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(127-129)ACG>ATG		POM121 membrane glycoprotein-like 12							25.0	32.0	30.0					7																	53103492		2044	4185	6229	SO:0001583	missense	285877							g.chr7:53103492C>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.128C>T	7.37:g.53103492C>T	ENSP00000386133:p.Thr43Met						p.T43M	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	144	+			43					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.128C>T	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	C	7.782	0.709661	0.15239	.	.	ENSG00000221900	ENST00000408890	T	0.23754	1.89	1.94	-0.0254	0.13935	.	.	.	.	.	T	0.10551	0.0258	N	0.08118	0	0.09310	N	1	B	0.18013	0.025	B	0.11329	0.006	T	0.26087	-1.0113	9	0.44086	T	0.13	.	2.3727	0.04334	0.2961:0.5188:0.0:0.1851	.	43	Q8N7R1	P1L12_HUMAN	M	43	ENSP00000386133:T43M	ENSP00000386133:T43M	T	+	2	0	POM121L12	53070986	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.196000	0.17176	-0.012000	0.14223	0.462000	0.41574	ACG		0.682	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		4	39	0	0	0	0	4	39				
IQUB	154865	broad.mit.edu	37	7	123101543	123101543	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr7:123101543A>T	ENST00000466202.1	-	11	2451	c.1875T>A	c.(1873-1875)tgT>tgA	p.C625*	IQUB_ENST00000324698.6_Nonsense_Mutation_p.C625*|RP11-332K15.1_ENST00000419832.1_RNA	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	625					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TGCAGTTACGACACCGGTATA	0.368																																						uc003vkn.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(1873-1875)TGT>TGA		IQ motif and ubiquitin domain containing							95.0	90.0	92.0					7																	123101543		2203	4299	6502	SO:0001587	stop_gained	154865							g.chr7:123101543A>T	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1875T>A	7.37:g.123101543A>T	ENSP00000417769:p.Cys625*					IQUB_uc011kny.1_5'UTR|IQUB_uc003vko.2_Nonsense_Mutation_p.C625*|IQUB_uc010lkt.2_RNA	p.C625*	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN			11	2452	-			625					A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	ENST00000466202.1	37	c.1875T>A	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	A	31	5.085270	0.94100	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	.	.	.	5.94	-0.594	0.11664	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0252	0.42068	0.6423:0.0:0.3577:0.0	.	.	.	.	X	625	.	ENSP00000324882:C625X	C	-	3	2	IQUB	122888779	0.997000	0.39634	0.735000	0.30896	0.126000	0.20510	0.505000	0.22642	-0.316000	0.08690	-0.427000	0.05922	TGT		0.368	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827		7	40	0	0	0	0	7	40				
PHKA2	5256	broad.mit.edu	37	X	18972425	18972425	+	Missense_Mutation	SNP	G	G	A	rs201643189		TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chrX:18972425G>A	ENST00000379942.4	-	2	849	c.184C>T	c.(184-186)Cgt>Tgt	p.R62C		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	62					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCATTCTTACGGTAGGCCATG	0.597													G|||	1	0.000264901	0.0	0.0	3775	,	,		14860	0.001		0.0	False		,,,				2504	0.0					uc004cyv.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(184-186)CGT>TGT		phosphorylase kinase, alpha 2 (liver)							134.0	96.0	109.0					X																	18972425		2203	4300	6503	SO:0001583	missense	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18972425G>A		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.184C>T	X.37:g.18972425G>A	ENSP00000369274:p.Arg62Cys					PHKA2_uc010nfh.1_RNA|PHKA2_uc010nfi.1_Missense_Mutation_p.R4C	p.R62C	NM_000292	NP_000283	P46019	KPB2_HUMAN			2	614	-	Hepatocellular(33;0.183)		62					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	c.184C>T	CCDS14190.1	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	25.2	4.611438	0.87258	.	.	ENSG00000044446	ENST00000379942	D	0.91686	-2.89	5.65	5.65	0.86999	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.96944	0.9002	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97787	1.0236	10	0.87932	D	0	-16.721	14.384	0.66931	0.0:0.0:0.852:0.148	.	62	P46019	KPB2_HUMAN	C	62	ENSP00000369274:R62C	ENSP00000369274:R62C	R	-	1	0	PHKA2	18882346	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	3.859000	0.55987	2.381000	0.81170	0.600000	0.82982	CGT		0.597	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		19	77	0	0	0	0	19	77				
MAGEB18	286514	broad.mit.edu	37	X	26157441	26157441	+	Silent	SNP	G	G	A			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chrX:26157441G>A	ENST00000325250.1	+	2	526	c.339G>A	c.(337-339)tcG>tcA	p.S113S		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	113	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						AAGTAGTGTCGCTGGTGCATT	0.413																																						uc004dbq.1		NA																	0				central_nervous_system(1)	1						c.(337-339)TCG>TCA		melanoma antigen family B, 18							37.0	30.0	32.0					X																	26157441		2202	4299	6501	SO:0001819	synonymous_variant	286514						protein binding	g.chrX:26157441G>A	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.339G>A	X.37:g.26157441G>A							p.S113S	NM_173699	NP_775970	Q96M61	MAGBI_HUMAN			2	526	+			113			MAGE.			Silent	SNP	ENST00000325250.1	37	c.339G>A	CCDS14216.1																																																																																				0.413	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		8	11	0	0	0	0	8	11				
CXorf22	170063	broad.mit.edu	37	X	35974175	35974175	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chrX:35974175T>G	ENST00000297866.5	+	8	1338	c.1272T>G	c.(1270-1272)tgT>tgG	p.C424W		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	424										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TTAAACCTTGTTTCATGGGTG	0.368																																						uc004ddj.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(1270-1272)TGT>TGG		hypothetical protein LOC170063							82.0	77.0	79.0					X																	35974175		2202	4300	6502	SO:0001583	missense	170063							g.chrX:35974175T>G	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1272T>G	X.37:g.35974175T>G	ENSP00000297866:p.Cys424Trp					CXorf22_uc010ngv.2_RNA	p.C424W	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN			8	1331	+			424					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.1272T>G	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	11.73	1.724545	0.30593	.	.	ENSG00000165164	ENST00000297866	T	0.60040	0.22	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.73079	0.3541	M	0.78049	2.395	0.53005	D	0.999963	D	0.89917	1.0	D	0.91635	0.999	T	0.75733	-0.3214	10	0.66056	D	0.02	-31.3158	8.1839	0.31326	0.0:0.0913:0.0:0.9087	.	424	Q6ZTR5	CX022_HUMAN	W	424	ENSP00000297866:C424W	ENSP00000297866:C424W	C	+	3	2	CXorf22	35884096	0.999000	0.42202	0.753000	0.31225	0.093000	0.18481	3.628000	0.54259	1.818000	0.53035	0.486000	0.48141	TGT		0.368	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		10	104	0	0	0	0	10	104				
HEPH	9843	broad.mit.edu	37	X	65413378	65413378	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chrX:65413378C>T	ENST00000343002.2	+	7	1931	c.1267C>T	c.(1267-1269)Cga>Tga	p.R423*	HEPH_ENST00000336279.5_Nonsense_Mutation_p.R156*|HEPH_ENST00000519389.1_Nonsense_Mutation_p.R477*|HEPH_ENST00000374727.3_Nonsense_Mutation_p.R426*|HEPH_ENST00000419594.1_Nonsense_Mutation_p.R426*|HEPH_ENST00000441993.2_Nonsense_Mutation_p.R426*			Q9BQS7	HEPH_HUMAN	hephaestin	423	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GAGCTCCAGCCGAATTGGGGG	0.393																																						uc011moz.1		NA																	0				lung(5)|ovary(4)	9						c.(1276-1278)CGA>TGA		hephaestin isoform a							42.0	38.0	39.0					X																	65413378		2203	4300	6503	SO:0001587	stop_gained	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65413378C>T	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1267C>T	X.37:g.65413378C>T	ENSP00000343939:p.Arg423*					HEPH_uc004dwn.2_Nonsense_Mutation_p.R426*|HEPH_uc004dwo.2_Nonsense_Mutation_p.R156*|HEPH_uc010nkr.2_Nonsense_Mutation_p.R426*|HEPH_uc011mpa.1_Nonsense_Mutation_p.R426*	p.R426*	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN			8	1336	+			423			Extracellular (Potential).|Plastocyanin-like 3.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Nonsense_Mutation	SNP	ENST00000343002.2	37	c.1276C>T		.	.	.	.	.	.	.	.	.	.	C	35	5.473973	0.96291	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	.	.	.	5.39	1.07	0.20283	.	0.122272	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.467	0.61260	0.6131:0.3869:0.0:0.0	.	.	.	.	X	477;426;156;426;426;423;423	.	ENSP00000337418:R156X	R	+	1	2	HEPH	65330103	0.000000	0.05858	0.576000	0.28549	0.992000	0.81027	-1.070000	0.03440	0.446000	0.26666	-0.245000	0.11935	CGA		0.393	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		9	17	0	0	0	0	9	17				
KCNN3	3782	broad.mit.edu	37	1	154842200	154842202	+	In_Frame_Del	DEL	GCT	GCT	-	rs58327065|rs367921715|rs572995536	byFrequency	TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr1:154842200_154842202delGCT	ENST00000271915.4	-	1	554_556	c.239_241delAGC	c.(238-243)cagcca>cca	p.Q80del	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGATGCGGTGgctgctgctgctg	0.7																																						uc001ffp.2		NA																	2	Insertion - In frame(2)		prostate(2)	lung(1)	1						c.(238-243)CAGCCA>CCA		small conductance calcium-activated potassium																																				SO:0001651	inframe_deletion	3782					integral to membrane	calmodulin binding	g.chr1:154842200_154842202delGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.239_241delAGC	1.37:g.154842209_154842211delGCT	ENSP00000271915:p.Gln80del					KCNN3_uc009wox.1_In_Frame_Del_p.Q80del	p.Q80del	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00819)		1	553_555	-	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		80			Poly-Gln.		B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Del	DEL	ENST00000271915.4	37	c.239_241delAGC	CCDS30880.1																																																																																				0.700	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249		2	4	NA	NA	NA	NA	2	4	---	---	---	---
ADAMTS7	11173	broad.mit.edu	37	15	79059020	79059021	+	Frame_Shift_Ins	INS	-	-	A	rs199873382	byFrequency	TCGA-CR-6488-01A-12D-2078-08	TCGA-CR-6488-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8bfa9606-b24d-4803-b551-2e86fb02ae5e	89b37386-4cde-4b98-9870-d1357d03d251	g.chr15:79059020_79059021insA	ENST00000388820.4	-	19	3442_3443	c.3232_3233insT	c.(3232-3234)tacfs	p.Y1078fs	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1078					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						AGAGGGCCCGTAGGACAGATCC	0.624																																						uc002bej.3		NA																	0					0						c.(3232-3234)TACfs		ADAM metallopeptidase with thrombospondin type 1				42,4206		0,42,2082						4.4	0.0			24	197,8007		1,195,3906	no	frameshift	ADAMTS7	NM_014272.3		1,237,5988	A1A1,A1R,RR		2.4013,0.9887,1.9194				239,12213				SO:0001589	frameshift_variant	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79059020_79059021insA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3233dupT	15.37:g.79059021_79059021dupA	ENSP00000373472:p.Tyr1078fs					ADAMTS7_uc010und.1_3'UTR	p.Y1078fs	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN			19	3443_3444	-			1078					Q14F51|Q6P7J9	Frame_Shift_Ins	INS	ENST00000388820.4	37	c.3232_3233insT	CCDS32303.1																																																																																				0.624	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		9	35	NA	NA	NA	NA	9	35	---	---	---	---
