#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLEKHM2	23207	broad.mit.edu	37	1	16046240	16046240	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:16046240C>T	ENST00000375799.3	+	6	704	c.477C>T	c.(475-477)taC>taT	p.Y159Y	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Silent_p.Y159Y	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	159	Interaction with KIF5B.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ATGCCCCTTACCTAGACCTGG	0.607																																						uc010obo.1		NA																	0				ovary(1)	1						c.(475-477)TAC>TAT		pleckstrin homology domain containing, family M							86.0	85.0	85.0					1																	16046240		1963	4148	6111	SO:0001819	synonymous_variant	23207				Golgi organization	cytoplasm	kinesin binding	g.chr1:16046240C>T	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.477C>T	1.37:g.16046240C>T							p.Y159Y	NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)	6	704	+		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	159			Interaction with KIF5B.		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	ENST00000375799.3	37	c.477C>T	CCDS44063.1																																																																																				0.607	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164		27	20	0	0	0	0	27	20				
SRRM1	10250	broad.mit.edu	37	1	24978993	24978993	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:24978993C>G	ENST00000323848.9	+	7	1109	c.794C>G	c.(793-795)tCc>tGc	p.S265C	SRRM1_ENST00000537199.1_Missense_Mutation_p.S134C|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.S265C|SRRM1_ENST00000374389.4_Missense_Mutation_p.S265C	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	265	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAAAAAAATTCCAAAAAAGAA	0.448																																					Ovarian(68;897 1494 3282 17478)	uc001bjm.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(793-795)TCC>TGC		serine/arginine repetitive matrix 1							27.0	31.0	30.0					1																	24978993		2203	4300	6503	SO:0001583	missense	10250				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding	g.chr1:24978993C>G	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.794C>G	1.37:g.24978993C>G	ENSP00000326261:p.Ser265Cys					SRRM1_uc010oel.1_Missense_Mutation_p.S265C|SRRM1_uc009vrh.1_Missense_Mutation_p.S226C|SRRM1_uc009vri.1_Missense_Mutation_p.S182C|SRRM1_uc010oem.1_RNA	p.S265C	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)	7	1018	+		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)	265			Pro-rich.|Arg-rich.		O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	c.794C>G	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422420	0.62622	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.51574	0.74;0.71;0.7;0.77	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000017	T	0.55178	0.1904	L	0.46157	1.445	0.50313	D	0.99986	D;D	0.57257	0.979;0.964	P;B	0.50192	0.634;0.431	T	0.55451	-0.8139	10	0.72032	D	0.01	-1.9292	20.2117	0.98287	0.0:1.0:0.0:0.0	.	265;265	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	C	265;265;265;134	ENSP00000326261:S265C;ENSP00000391430:S265C;ENSP00000363510:S265C;ENSP00000441776:S134C	ENSP00000326261:S265C	S	+	2	0	SRRM1	24851580	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.999000	0.49473	2.878000	0.98634	0.650000	0.86243	TCC		0.448	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839		10	11	0	0	0	0	10	11				
COL16A1	1307	broad.mit.edu	37	1	32140630	32140630	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:32140630G>C	ENST00000373672.3	-	44	3353	c.2837C>G	c.(2836-2838)cCa>cGa	p.P946R	COL16A1_ENST00000271069.6_Intron	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	946	Nonhelical region 4 (NC4).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTGTTCAATTGGTAAGGATCC	0.542																																					Colon(143;498 1786 21362 25193 36625)	uc001btk.1		NA																	0				ovary(8)	8						c.(2836-2838)CCA>CGA		alpha 1 type XVI collagen precursor							65.0	67.0	66.0					1																	32140630		1982	4169	6151	SO:0001583	missense	1307				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity	g.chr1:32140630G>C	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2837C>G	1.37:g.32140630G>C	ENSP00000362776:p.Pro946Arg					COL16A1_uc001btj.1_Missense_Mutation_p.P759R	p.P946R	NM_001856	NP_001847	Q07092	COGA1_HUMAN		STAD - Stomach adenocarcinoma(196;0.059)	44	3202	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)	946			Nonhelical region 4 (NC4).		Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	c.2837C>G	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566194	0.45694	.	.	ENSG00000084636	ENST00000373672;ENST00000458715	D;D	0.96685	-4.09;-4.09	4.48	4.48	0.54585	.	.	.	.	.	D	0.95573	0.8561	L	0.61218	1.895	0.80722	D	1	P;P	0.48016	0.845;0.904	B;P	0.46718	0.326;0.525	D	0.95146	0.8268	9	0.49607	T	0.09	.	13.3794	0.60759	0.0:0.0:1.0:0.0	.	946;946	Q07092;Q07092-2	COGA1_HUMAN;.	R	946;151	ENSP00000362776:P946R;ENSP00000411457:P151R	ENSP00000362776:P946R	P	-	2	0	COL16A1	31913217	1.000000	0.71417	0.961000	0.40146	0.928000	0.56348	4.494000	0.60347	2.453000	0.82957	0.561000	0.74099	CCA		0.542	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		7	11	0	0	0	0	7	11				
ACOT11	26027	broad.mit.edu	37	1	55064970	55064970	+	Splice_Site	SNP	C	C	T	rs148238018	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:55064970C>T	ENST00000371316.3	+	8	848	c.766C>T	c.(766-768)Cgg>Tgg	p.R256W	ACOT11_ENST00000343744.2_Splice_Site_p.R256W|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	256	Acyl coenzyme A hydrolase 2.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						CCTCCTCAGCCGGCTCTGCCG	0.522													C|||	18	0.00359425	0.0	0.0072	5008	,	,		7803	0.0		0.0109	False		,,,				2504	0.002				Ovarian(148;1440 1861 22015 32453 51933)	uc001cxm.1		NA																	0				central_nervous_system(1)	1						c.(766-768)CGG>TGG		thioesterase, adipose associated isoform BFIT1		C	TRP/ARG,TRP/ARG	16,4390	23.3+/-48.9	0,16,2187	64.0	65.0	65.0		766,766	5.3	1.0	1	dbSNP_134	65	174,8426	78.6+/-141.3	0,174,4126	yes	missense-near-splice,missense-near-splice	ACOT11	NM_015547.3,NM_147161.3	101,101	0,190,6313	TT,TC,CC		2.0233,0.3631,1.4609	probably-damaging,probably-damaging	256/608,256/595	55064970	190,12816	2203	4300	6503	SO:0001630	splice_region_variant	26027				fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity	g.chr1:55064970C>T	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.765-1C>T	1.37:g.55064970C>T						ACOT11_uc001cxj.1_Missense_Mutation_p.R134W|ACOT11_uc001cxl.1_Missense_Mutation_p.R256W	p.R256W	NM_015547	NP_056362	Q8WXI4	ACO11_HUMAN			8	848	+			256			Acyl coenzyme A hydrolase 2.		B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	ENST00000371316.3	37	c.766C>T	CCDS592.1	19	0.0086996336996337	3	0.006097560975609756	3	0.008287292817679558	2	0.0034965034965034965	11	0.014511873350923483	C	28.2	4.898406	0.91962	0.003631	0.020233	ENSG00000162390	ENST00000343744;ENST00000371316	T;T	0.25085	1.82;1.82	5.27	5.27	0.74061	Thioesterase superfamily (1);	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72401	-0.4305	10	0.87932	D	0	-16.8139	18.8862	0.92379	0.0:1.0:0.0:0.0	.	256;256	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	W	256	ENSP00000340260:R256W;ENSP00000360366:R256W	ENSP00000340260:R256W	R	+	1	2	ACOT11	54837558	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	7.545000	0.82128	2.456000	0.83038	0.561000	0.74099	CGG		0.522	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547	Missense_Mutation	18	27	0	0	0	0	18	27				
CYP2J2	1573	broad.mit.edu	37	1	60392390	60392390	+	Missense_Mutation	SNP	G	G	A	rs146801076	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:60392390G>A	ENST00000371204.3	-	1	72	c.29C>T	c.(28-30)gCt>gTt	p.A10V		NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	10					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)			NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	CCAGAGGGCAGCCGCCAGAGA	0.657																																						uc001czq.2		NA																	0				ovary(1)	1						c.(28-30)GCT>GTT		cytochrome P450, family 2, subfamily J,							16.0	21.0	20.0					1																	60392390		2186	4271	6457	SO:0001583	missense	1573				epoxygenase P450 pathway|linoleic acid metabolic process|regulation of heart contraction|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	arachidonic acid 11,12-epoxygenase activity|arachidonic acid 14,15-epoxygenase activity|aromatase activity|electron carrier activity|heme binding|linoleic acid epoxygenase activity	g.chr1:60392390G>A	BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.29C>T	1.37:g.60392390G>A	ENSP00000360247:p.Ala10Val						p.A10V	NM_000775	NP_000766	P51589	CP2J2_HUMAN			1	34	-	all_cancers(7;0.000396)		10					B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	c.29C>T	CCDS613.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665052	0.47677	.	.	ENSG00000134716	ENST00000371204	T	0.69435	-0.4	5.2	3.29	0.37713	.	1.366540	0.04314	N	0.349514	T	0.48572	0.1507	N	0.08118	0	0.09310	N	1	B	0.18013	0.025	B	0.12837	0.008	T	0.41645	-0.9497	10	0.62326	D	0.03	.	6.7718	0.23598	0.0948:0.1806:0.7246:0.0	.	10	P51589	CP2J2_HUMAN	V	10	ENSP00000360247:A10V	ENSP00000360247:A10V	A	-	2	0	CYP2J2	60164978	0.000000	0.05858	0.002000	0.10522	0.193000	0.23685	0.570000	0.23653	1.319000	0.45190	0.561000	0.74099	GCT		0.657	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775		4	9	0	0	0	0	4	9				
ASPM	259266	broad.mit.edu	37	1	197091324	197091324	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:197091324G>T	ENST00000367409.4	-	15	3962	c.3706C>A	c.(3706-3708)Cat>Aat	p.H1236N	ASPM_ENST00000294732.7_Missense_Mutation_p.H1236N|ASPM_ENST00000367408.1_Missense_Mutation_p.H486N	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1236					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATATCTGAATGATTAATCATA	0.308																																						uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(3706-3708)CAT>AAT		asp (abnormal spindle)-like, microcephaly							39.0	40.0	40.0					1																	197091324		2201	4296	6497	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197091324G>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3706C>A	1.37:g.197091324G>T	ENSP00000356379:p.His1236Asn					ASPM_uc001gtv.2_Missense_Mutation_p.H1236N|ASPM_uc001gtw.3_Intron	p.H1236N	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			15	3963	-			1236					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.3706C>A	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080857	0.76528	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	D;D;D	0.83673	-1.75;-1.75;-1.75	5.74	5.74	0.90152	Calponin homology domain (3);	0.159829	0.42294	D	0.000734	D	0.88005	0.6321	M	0.63428	1.95	0.36055	D	0.841042	D;D	0.71674	0.998;0.997	P;P	0.59115	0.852;0.806	D	0.89045	0.3451	10	0.35671	T	0.21	.	16.894	0.86095	0.0:0.1278:0.8722:0.0	.	1236;1236	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	N	1236;1236;486	ENSP00000356379:H1236N;ENSP00000294732:H1236N;ENSP00000356378:H486N	ENSP00000294732:H1236N	H	-	1	0	ASPM	195357947	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.419000	0.66435	2.714000	0.92807	0.585000	0.79938	CAT		0.308	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		10	40	1	0	0.000978159	0.00104388	10	40				
ZC3H11A	9877	broad.mit.edu	37	1	203786208	203786208	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:203786208C>G	ENST00000545588.1	+	2	3837	c.10C>G	c.(10-12)Caa>Gaa	p.Q4E	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.Q4E|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.Q4E|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.Q4E|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.Q4E	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	4					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CATGCCTAATCAAGGAGAAGA	0.388																																						uc001hac.2		NA																	0				lung(1)|central_nervous_system(1)	2						c.(10-12)CAA>GAA		zinc finger CCCH-type containing 11A							88.0	88.0	88.0					1																	203786208		2203	4300	6503	SO:0001583	missense	9877						nucleic acid binding|protein binding|zinc ion binding	g.chr1:203786208C>G		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.10C>G	1.37:g.203786208C>G	ENSP00000438527:p.Gln4Glu					ZC3H11A_uc001had.2_Missense_Mutation_p.Q4E|ZC3H11A_uc001hae.2_Missense_Mutation_p.Q4E|ZC3H11A_uc001haf.2_Missense_Mutation_p.Q4E|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Missense_Mutation_p.Q4E	p.Q4E	NM_014827	NP_055642	O75152	ZC11A_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		5	626	+	all_cancers(21;0.0904)|all_epithelial(62;0.234)		4			C3H1-type 1.		Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	c.10C>G	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458629	0.84317	.	.	ENSG00000058673	ENST00000432282;ENST00000453771;ENST00000367214;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.64	5.64	0.86602	Zinc finger, CCCH-type (2);	0.108901	0.64402	D	0.000004	T	0.59838	0.2223	L	0.59436	1.845	0.51233	D	0.999912	D	0.62365	0.991	P	0.56434	0.798	T	0.61806	-0.6987	10	0.66056	D	0.02	-6.2205	15.1985	0.73116	0.0:1.0:0.0:0.0	.	4	O75152	ZC11A_HUMAN	E	4	ENSP00000356183:Q4E;ENSP00000356181:Q4E;ENSP00000333253:Q4E;ENSP00000438527:Q4E;ENSP00000356179:Q4E	ENSP00000333253:Q4E	Q	+	1	0	ZC3H11A	202052831	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.136000	0.64783	2.658000	0.90341	0.655000	0.94253	CAA		0.388	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827		16	89	0	0	0	0	16	89				
TMCC2	9911	broad.mit.edu	37	1	205210771	205210771	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:205210771G>T	ENST00000358024.3	+	2	735	c.346G>T	c.(346-348)Gac>Tac	p.D116Y	TMCC2_ENST00000545499.1_Missense_Mutation_p.D38Y|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	116						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGGTATGTCCGACCATGACTC	0.637																																						uc001hbz.1		NA																	0				pancreas(1)	1						c.(346-348)GAC>TAC		transmembrane and coiled-coil domain family 2							84.0	66.0	72.0					1																	205210771		2203	4300	6503	SO:0001583	missense	9911					integral to membrane	protein binding	g.chr1:205210771G>T	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.346G>T	1.37:g.205210771G>T	ENSP00000350718:p.Asp116Tyr					TMCC2_uc010prf.1_Missense_Mutation_p.D38Y	p.D116Y	NM_014858	NP_055673	O75069	TMCC2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)		3	790	+	Breast(84;0.0871)		116					A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	c.346G>T	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948080	0.73787	.	.	ENSG00000133069	ENST00000358024;ENST00000545499	T;T	0.36340	1.26;1.3	4.78	4.78	0.61160	.	0.000000	0.64402	D	0.000008	T	0.42131	0.1189	N	0.08118	0	0.52501	D	0.999951	D	0.89917	1.0	D	0.83275	0.996	T	0.56768	-0.7924	10	0.87932	D	0	.	17.7739	0.88501	0.0:0.0:1.0:0.0	.	116	O75069	TMCC2_HUMAN	Y	116;38	ENSP00000350718:D116Y;ENSP00000437943:D38Y	ENSP00000350718:D116Y	D	+	1	0	TMCC2	203477394	1.000000	0.71417	0.960000	0.40013	0.903000	0.53119	4.568000	0.60857	2.360000	0.80028	0.462000	0.41574	GAC		0.637	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858		6	38	1	0	0.00116845	0.00124053	6	38				
NID1	4811	broad.mit.edu	37	1	236205526	236205526	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:236205526G>A	ENST00000264187.6	-	4	901	c.819C>T	c.(817-819)ggC>ggT	p.G273G	NID1_ENST00000366595.3_Silent_p.G273G	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	273					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CAGGCACCACGCCATTGGTGG	0.557																																						uc001hxo.2		NA																	0				large_intestine(1)|pancreas(1)	2						c.(817-819)GGC>GGT		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)						203.0	200.0	201.0					1																	236205526		2203	4300	6503	SO:0001819	synonymous_variant	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236205526G>A	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.819C>T	1.37:g.236205526G>A						NID1_uc009xgd.2_Silent_p.G273G	p.G273G	NM_002508	NP_002499	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		4	921	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	273					Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	c.819C>T	CCDS1608.1																																																																																				0.557	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		59	152	0	0	0	0	59	152				
OR2M3	127062	broad.mit.edu	37	1	248367254	248367254	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:248367254G>A	ENST00000456743.1	+	1	923	c.885G>A	c.(883-885)aaG>aaA	p.K295K		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCCGCAACAAGGAGGTGACCA	0.458																																						uc010pzg.1		NA																	0				ovary(1)|skin(1)	2						c.(883-885)AAG>AAA		olfactory receptor, family 2, subfamily M,							112.0	106.0	108.0					1																	248367254		2203	4300	6503	SO:0001819	synonymous_variant	127062				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248367254G>A		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.885G>A	1.37:g.248367254G>A							p.K295K	NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	885	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		295			Cytoplasmic (Potential).		B9EH06|Q6IEY0	Silent	SNP	ENST00000456743.1	37	c.885G>A	CCDS31107.1																																																																																				0.458	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689		30	83	0	0	0	0	30	83				
OR2T1	26696	broad.mit.edu	37	1	248569576	248569576	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:248569576T>A	ENST00000366474.1	+	1	281	c.281T>A	c.(280-282)gTt>gAt	p.V94D		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCAATGGGGTTATGATCTTC	0.428																																						uc010pzm.1		NA																	0				pancreas(1)	1						c.(280-282)GTT>GAT		olfactory receptor, family 2, subfamily T,							167.0	149.0	155.0					1																	248569576		2203	4300	6503	SO:0001583	missense	26696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248569576T>A	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.281T>A	1.37:g.248569576T>A	ENSP00000355430:p.Val94Asp						p.V94D	NM_030904	NP_112166	O43869	OR2T1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	281	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		94			Helical; Name=1; (Potential).		Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	37	c.281T>A	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	t	13.71	2.317738	0.40996	.	.	ENSG00000175143	ENST00000366474	T	0.21361	2.01	4.71	-0.541	0.11858	GPCR, rhodopsin-like superfamily (1);	0.745223	0.10974	U	0.613538	T	0.27933	0.0688	M	0.64404	1.975	0.09310	N	1	P	0.45044	0.849	P	0.50537	0.643	T	0.18650	-1.0330	10	0.87932	D	0	.	5.2264	0.15397	0.0:0.2433:0.1414:0.6152	.	94	O43869	OR2T1_HUMAN	D	94	ENSP00000355430:V94D	ENSP00000355430:V94D	V	+	2	0	OR2T1	246636199	0.000000	0.05858	0.078000	0.20375	0.547000	0.35210	-0.285000	0.08410	0.031000	0.15407	0.455000	0.32223	GTT		0.428	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2			20	136	0	0	0	0	20	136				
MICU1	10367	broad.mit.edu	37	10	74234891	74234891	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:74234891C>T	ENST00000361114.5	-	8	996	c.900G>A	c.(898-900)caG>caA	p.Q300Q	MICU1_ENST00000401998.3_Silent_p.Q300Q|MICU1_ENST00000418483.2_Silent_p.Q102Q|MICU1_ENST00000398763.4_Silent_p.Q102Q|MICU1_ENST00000398761.4_Silent_p.Q302Q	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	300					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										GCAGTTTACGCTGAAATTCGA	0.468																																						uc001jtb.1		NA																	0				ovary(1)	1						c.(904-906)CAG>CAA		calcium binding atopy-related autoantigen 1							82.0	81.0	81.0					10																	74234891		2022	4197	6219	SO:0001819	synonymous_variant	10367				calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding	g.chr10:74234891C>T	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.900G>A	10.37:g.74234891C>T						CBARA1_uc010qjw.1_Silent_p.Q102Q|CBARA1_uc010qjx.1_Silent_p.Q102Q|CBARA1_uc009xqo.1_RNA	p.Q302Q	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN			9	1039	-			300					A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Silent	SNP	ENST00000361114.5	37	c.906G>A	CCDS55715.1																																																																																				0.468	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077		4	10	0	0	0	0	4	10				
CC2D2B	387707	broad.mit.edu	37	10	97779477	97779477	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:97779477C>G	ENST00000344386.3	+	8	840	c.676C>G	c.(676-678)Caa>Gaa	p.Q226E	ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|CC2D2B_ENST00000371198.2_Intron|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000449197.1_RNA|RP11-690P14.4_ENST00000475252.2_Intron|CC2D2B_ENST00000410012.2_Missense_Mutation_p.Q226E	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B	226										large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		TAATATTCAACAAAATAATAC	0.333																																						uc001kll.2		NA																	0				ovary(1)	1						c.(676-678)CAA>GAA		coiled-coil and C2 domain containing 2B isoform							145.0	146.0	145.0					10																	97779477		1810	4074	5884	SO:0001583	missense	387707							g.chr10:97779477C>G	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.676C>G	10.37:g.97779477C>G	ENSP00000343747:p.Gln226Glu					uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Missense_Mutation_p.Q226E|uc009xvb.1_RNA	p.Q226E	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)	8	875	+		Colorectal(252;0.158)	226					A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Missense_Mutation	SNP	ENST00000344386.3	37	c.676C>G	CCDS41555.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663199	0.29515	.	.	ENSG00000188649	ENST00000451649;ENST00000410012;ENST00000344386	T;T	0.72051	-0.62;-0.62	5.06	4.12	0.48240	.	.	.	.	.	T	0.58163	0.2103	L	0.45137	1.4	0.23859	N	0.996648	B;B	0.25809	0.135;0.001	B;B	0.25291	0.059;0.004	T	0.46596	-0.9180	9	0.02654	T	1	.	12.3891	0.55348	0.1671:0.8329:0.0:0.0	.	226;226	E9PCC3;Q6DHV5	.;C2D2B_HUMAN	E	226	ENSP00000386988:Q226E;ENSP00000343747:Q226E	ENSP00000343747:Q226E	Q	+	1	0	CC2D2B	97769467	0.954000	0.32549	1.000000	0.80357	0.968000	0.65278	0.793000	0.26944	2.631000	0.89168	0.650000	0.86243	CAA		0.333	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049573.3	NM_001001732		34	126	0	0	0	0	34	126				
TM9SF3	56889	broad.mit.edu	37	10	98292908	98292908	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:98292908G>C	ENST00000371142.4	-	10	1441	c.1225C>G	c.(1225-1227)Cta>Gta	p.L409V		NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	409						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		ACAAGATTTAGAGGAAGAATA	0.363																																						uc001kmm.3		NA																	0					0						c.(1225-1227)CTA>GTA		transmembrane 9 superfamily member 3 precursor							113.0	102.0	106.0					10																	98292908		2203	4300	6503	SO:0001583	missense	56889					integral to membrane	binding	g.chr10:98292908G>C	AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1225C>G	10.37:g.98292908G>C	ENSP00000360184:p.Leu409Val					TM9SF3_uc010qot.1_Missense_Mutation_p.L409V	p.L409V	NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)	10	1442	-		Colorectal(252;0.158)	409			Helical; (Potential).		Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Missense_Mutation	SNP	ENST00000371142.4	37	c.1225C>G	CCDS7450.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953800	0.73902	.	.	ENSG00000077147	ENST00000371142	T	0.63255	-0.03	5.63	3.55	0.40652	.	0.000000	0.85682	D	0.000000	D	0.85864	0.5796	H	0.99058	4.415	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.88967	0.3398	10	0.87932	D	0	-6.5281	10.3545	0.43956	0.2087:0.0:0.7913:0.0	.	409	Q9HD45	TM9S3_HUMAN	V	409	ENSP00000360184:L409V	ENSP00000360184:L409V	L	-	1	2	TM9SF3	98282898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.787000	0.47798	1.379000	0.46325	0.563000	0.77884	CTA		0.363	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049610.2	NM_020123		17	31	0	0	0	0	17	31				
C10orf12	26148	broad.mit.edu	37	10	98744407	98744407	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:98744407G>A	ENST00000286067.2	+	1	3367	c.3260G>A	c.(3259-3261)aGt>aAt	p.S1087N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	1087										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GAAGTTCAGAGTAAACGCAAG	0.488																																						uc001kmv.2		NA																	0				skin(2)	2						c.(3259-3261)AGT>AAT		hypothetical protein LOC26148							69.0	69.0	69.0					10																	98744407		2203	4300	6503	SO:0001583	missense	26148							g.chr10:98744407G>A	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.3260G>A	10.37:g.98744407G>A	ENSP00000286067:p.Ser1087Asn						p.S1087N	NM_015652	NP_056467	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	3367	+		Colorectal(252;0.172)	1087					Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	c.3260G>A	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.422776	0.01126	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.06849	3.25	5.37	0.576	0.17380	.	0.737524	0.11745	N	0.533583	T	0.02012	0.0063	N	0.01352	-0.895	0.21553	N	0.999644	B	0.02656	0.0	B	0.04013	0.001	T	0.45571	-0.9252	10	0.02654	T	1	-5.9933	4.5522	0.12117	0.3097:0.0:0.4186:0.2717	.	1087	Q8N655	CJ012_HUMAN	N	1087;921	ENSP00000286067:S1087N	ENSP00000286067:S1087N	S	+	2	0	C10orf12	98734397	0.037000	0.19845	0.996000	0.52242	0.946000	0.59487	0.731000	0.26058	0.070000	0.16634	-0.258000	0.10820	AGT		0.488	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		20	24	0	0	0	0	20	24				
PDCD11	22984	broad.mit.edu	37	10	105174033	105174033	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:105174033T>C	ENST00000369797.3	+	11	1411	c.1317T>C	c.(1315-1317)atT>atC	p.I439I		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	439					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTAGGTCTATTATTGAAGCTC	0.438																																						uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(1315-1317)ATT>ATC		programmed cell death 11							152.0	136.0	141.0					10																	105174033		2203	4300	6503	SO:0001819	synonymous_variant	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105174033T>C	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1317T>C	10.37:g.105174033T>C							p.I439I	NM_014976	NP_055791	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	11	1404	+		Colorectal(252;0.0747)|Breast(234;0.128)	439					Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	c.1317T>C	CCDS31276.1																																																																																				0.438	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			7	19	0	0	0	0	7	19				
SORCS3	22986	broad.mit.edu	37	10	106982948	106982948	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:106982948G>A	ENST00000369701.3	+	20	3036	c.2809G>A	c.(2809-2811)Gtg>Atg	p.V937M	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	937					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CAGTGCAGTCGTGTGGCCCAG	0.448																																					NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(2809-2811)GTG>ATG		VPS10 domain receptor protein SORCS 3 precursor							197.0	187.0	191.0					10																	106982948		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106982948G>A	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2809G>A	10.37:g.106982948G>A	ENSP00000358715:p.Val937Met					SORCS3_uc010qqz.1_RNA	p.V937M	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	20	3036	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	937			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.2809G>A	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490461	0.84962	.	.	ENSG00000156395	ENST00000369701	T	0.45276	0.9	5.06	5.06	0.68205	PKD domain (1);	0.138940	0.47852	D	0.000207	T	0.59404	0.2191	M	0.66939	2.045	0.51767	D	0.999931	D	0.64830	0.994	P	0.58077	0.832	T	0.59268	-0.7486	9	.	.	.	.	18.7786	0.91922	0.0:0.0:1.0:0.0	.	937	Q9UPU3	SORC3_HUMAN	M	937	ENSP00000358715:V937M	.	V	+	1	0	SORCS3	106972938	1.000000	0.71417	0.951000	0.38953	0.977000	0.68977	4.845000	0.62853	2.516000	0.84829	0.563000	0.77884	GTG		0.448	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		50	53	0	0	0	0	50	53				
KIAA1598	57698	broad.mit.edu	37	10	118713583	118713583	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:118713583C>A	ENST00000355371.4	-	5	903	c.406G>T	c.(406-408)Gtc>Ttc	p.V136F	KIAA1598_ENST00000392903.2_Missense_Mutation_p.V136F|KIAA1598_ENST00000392901.4_Missense_Mutation_p.V76F|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000260777.10_Missense_Mutation_p.V136F	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	136					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		TGTACTGAGACACAAGTCTCG	0.418																																						uc009xyw.2		NA																	0					0						c.(406-408)GTC>TTC		shootin1 isoform a							128.0	113.0	118.0					10																	118713583		2203	4300	6503	SO:0001583	missense	57698				axon guidance	axon		g.chr10:118713583C>A	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.406G>T	10.37:g.118713583C>A	ENSP00000347532:p.Val136Phe					KIAA1598_uc001lcz.3_Missense_Mutation_p.V136F|KIAA1598_uc010qso.1_Missense_Mutation_p.V76F|KIAA1598_uc010qsp.1_Missense_Mutation_p.V136F|KIAA1598_uc010qsq.1_Missense_Mutation_p.V76F|KIAA1598_uc001lcy.3_Missense_Mutation_p.V106F	p.V136F	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN		all cancers(201;0.00494)	5	904	-			136			Potential.		A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Missense_Mutation	SNP	ENST00000355371.4	37	c.406G>T	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	C	9.972	1.225694	0.22542	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	T;T;T;T	0.74209	2.86;2.67;2.86;-0.82	5.87	4.03	0.46877	.	0.682962	0.15365	N	0.266171	T	0.58538	0.2129	L	0.29908	0.895	0.24681	N	0.993361	B;P;B	0.37276	0.141;0.589;0.374	B;B;B	0.33960	0.073;0.173;0.045	T	0.53563	-0.8421	10	0.56958	D	0.05	-4.1312	5.956	0.19273	0.1342:0.6446:0.0:0.2212	.	136;136;106	A0MZ66;A0MZ66-2;A0MZ66-6	SHOT1_HUMAN;.;.	F	136;136;136;76	ENSP00000376636:V136F;ENSP00000260777:V136F;ENSP00000347532:V136F;ENSP00000376635:V76F	ENSP00000260777:V136F	V	-	1	0	KIAA1598	118703573	0.728000	0.28080	0.913000	0.36048	0.987000	0.75469	0.562000	0.23531	0.947000	0.37659	0.655000	0.94253	GTC		0.418	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330		19	26	1	0	6.45e-10	7.54e-10	19	26				
PDZD8	118987	broad.mit.edu	37	10	119044328	119044328	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr10:119044328A>G	ENST00000334464.5	-	5	2155	c.1916T>C	c.(1915-1917)gTg>gCg	p.V639A	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	639					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TATGGCATCCACATTTTTTGC	0.453																																						uc001lde.1		NA																	0					0						c.(1915-1917)GTG>GCG		PDZ domain containing 8							82.0	81.0	81.0					10																	119044328		2203	4300	6503	SO:0001583	missense	118987				intracellular signal transduction		metal ion binding	g.chr10:119044328A>G	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1916T>C	10.37:g.119044328A>G	ENSP00000334642:p.Val639Ala						p.V639A	NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2115	-		Colorectal(252;0.19)	639					Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	c.1916T>C	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	A	8.637	0.895035	0.17613	.	.	ENSG00000165650	ENST00000334464	D	0.85339	-1.97	5.93	-0.225	0.13111	.	2.090980	0.01739	N	0.029288	T	0.70701	0.3254	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.56932	-0.7897	10	0.13470	T	0.59	5.2968	3.5991	0.08018	0.2962:0.1791:0.4135:0.1112	.	639	Q8NEN9	PDZD8_HUMAN	A	639	ENSP00000334642:V639A	ENSP00000334642:V639A	V	-	2	0	PDZD8	119034318	0.000000	0.05858	0.000000	0.03702	0.528000	0.34623	-0.467000	0.06664	-0.058000	0.13177	0.482000	0.46254	GTG		0.453	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		6	55	0	0	0	0	6	55				
ODF3	113746	broad.mit.edu	37	11	197593	197593	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:197593G>A	ENST00000325113.4	+	3	459	c.142G>A	c.(142-144)Gca>Aca	p.A48T	BET1L_ENST00000410108.1_Intron|ODF3_ENST00000342593.5_Missense_Mutation_p.A48T|ODF3_ENST00000525282.1_Missense_Mutation_p.A48T	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	48					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAAGCTGCGTGCACCGGCCTA	0.637																																						uc001lob.2		NA																	0				ovary(1)	1						c.(142-144)GCA>ACA		outer dense fiber of sperm tails 3							42.0	41.0	41.0					11																	197593		2203	4300	6503	SO:0001583	missense	113746				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm		g.chr11:197593G>A	AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.142G>A	11.37:g.197593G>A	ENSP00000325868:p.Ala48Thr					ODF3_uc010qvk.1_Missense_Mutation_p.A48T|ODF3_uc001loc.2_Missense_Mutation_p.A48T	p.A48T	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)	3	436	+		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	48					B7ZLT0|Q69YX0	Missense_Mutation	SNP	ENST00000325113.4	37	c.142G>A	CCDS7688.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820755	0.32145	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000342593;ENST00000525282	T;T;T	0.35048	1.39;1.33;1.41	4.49	3.57	0.40892	.	0.222808	0.31082	N	0.008293	T	0.54695	0.1874	M	0.67700	2.07	0.09310	N	1	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.91635	0.999;0.866;0.999	T	0.44050	-0.9353	10	0.56958	D	0.05	-14.7394	10.6984	0.45913	0.0:0.1933:0.8067:0.0	.	48;48;48	B7ZLT0;F8W6Z3;Q96PU9	.;.;ODF3A_HUMAN	T	48	ENSP00000325868:A48T;ENSP00000339623:A48T;ENSP00000436588:A48T	ENSP00000325868:A48T	A	+	1	0	ODF3	187593	0.996000	0.38824	0.009000	0.14445	0.000000	0.00434	4.354000	0.59417	1.238000	0.43771	-0.304000	0.09214	GCA		0.637	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239287.1			20	23	0	0	0	0	20	23				
TNNI2	7136	broad.mit.edu	37	11	1862048	1862048	+	Splice_Site	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:1862048G>A	ENST00000381906.1	+	6	255		c.e6-1		TNNI2_ENST00000381911.1_Splice_Site|TNNI2_ENST00000252898.7_Splice_Site|TNNI2_ENST00000381905.3_Splice_Site	NM_001145829.1	NP_001139301.1	P48788	TNNI2_HUMAN	troponin I type 2 (skeletal, fast)						muscle filament sliding (GO:0030049)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|nucleus (GO:0005634)|troponin complex (GO:0005861)	troponin T binding (GO:0031014)			lung(8)|prostate(1)|urinary_tract(1)	10		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCACCCCTAGGAGCTCTGCA	0.637																																						uc010qxe.1		NA																	0					0						c.e4-1		fast-twitch skeletal muscle troponin I isoform							44.0	39.0	41.0					11																	1862048		2196	4298	6494	SO:0001630	splice_region_variant	7136				muscle filament sliding|positive regulation of transcription, DNA-dependent|skeletal muscle contraction	cytosol|nucleus|troponin complex	actin binding|troponin T binding	g.chr11:1862048G>A	L21715	CCDS31333.1, CCDS53594.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130598	ENSG00000130598			11946	protein-coding gene	gene with protein product	"""troponin I, fast-twitch skeletal muscle isoform"", ""troponin I fast twitch 2"""	191043	"""troponin I, skeletal, fast"", ""arthrogryposis multiplex congenita, distal, type 2B"""	AMCD2B		9016781, 12592607	Standard	NM_001145829		Approved	FSSV, DA2B	uc010qxe.1	P48788	OTTHUMG00000012253	ENST00000381906.1:c.187-1G>A	11.37:g.1862048G>A						TNNI2_uc010qxc.1_Splice_Site_p.E61_splice|TNNI2_uc010qxd.1_Splice_Site_p.E61_splice	p.E63_splice	NM_001145841	NP_001139313	P48788	TNNI2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	4	209	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)						A6NIV8|A6NJU5	Splice_Site	SNP	ENST00000381906.1	37	c.187_splice	CCDS31333.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530202	0.27387	.	.	ENSG00000130598	ENST00000381911;ENST00000381906;ENST00000252898;ENST00000381905	.	.	.	2.67	2.67	0.31697	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4828	0.67594	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNNI2	1818624	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	6.787000	0.75099	1.812000	0.52913	0.205000	0.17691	.		0.637	TNNI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034046.2	NM_003282	Intron	7	10	0	0	0	0	7	10				
KCNJ11	3767	broad.mit.edu	37	11	17409554	17409554	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:17409554G>A	ENST00000339994.4	-	1	652	c.85C>T	c.(85-87)Cgc>Tgc	p.R29C	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Intron	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	29					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	CTCCGCTGGCGGGCACGGTAC	0.652																																						uc001mna.2		NA																	0				ovary(1)	1						c.(85-87)CGC>TGC		potassium inwardly-rectifying channel J11							68.0	72.0	71.0					11																	17409554		2200	4293	6493	SO:0001583	missense	3767					integral to membrane	ATP-activated inward rectifier potassium channel activity	g.chr11:17409554G>A	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.85C>T	11.37:g.17409554G>A	ENSP00000345708:p.Arg29Cys					KCNJ11_uc001mnb.3_Intron	p.R29C	NM_000525	NP_000516	B4DWI4	B4DWI4_HUMAN		READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	1	653	-			29					B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	37	c.85C>T	CCDS31436.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470273	0.26423	.	.	ENSG00000187486	ENST00000339994	D	0.88741	-2.42	4.57	4.57	0.56435	.	0.324741	0.23803	N	0.044419	D	0.89781	0.6814	L	0.39898	1.24	0.58432	D	0.999999	D	0.76494	0.999	P	0.59288	0.855	D	0.90566	0.4519	10	0.87932	D	0	.	12.1305	0.53940	0.0:0.0:0.8283:0.1717	.	29	B2RC52	.	C	29	ENSP00000345708:R29C	ENSP00000345708:R29C	R	-	1	0	KCNJ11	17366130	0.948000	0.32251	0.576000	0.28549	0.168000	0.22595	3.392000	0.52537	2.084000	0.62774	0.462000	0.41574	CGC		0.652	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525		24	50	0	0	0	0	24	50				
HRASLS2	54979	broad.mit.edu	37	11	63325937	63325937	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:63325937G>A	ENST00000255695.1	-	3	372	c.314C>T	c.(313-315)cCt>cTt	p.P105L		NM_017878.1	NP_060348.1	Q9NWW9	HRSL2_HUMAN	HRAS-like suppressor 2	105					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6						CAGCGAATAAGGCAACTCCTG	0.547																																						uc001nxg.1		NA																	0					0						c.(313-315)CCT>CTT		HRAS-like suppressor 2							258.0	184.0	209.0					11																	63325937		2201	4298	6499	SO:0001583	missense	54979				lipid catabolic process	cytoplasm	acyltransferase activity|hydrolase activity	g.chr11:63325937G>A		CCDS8046.1	11q12.2	2008-07-18			ENSG00000133328	ENSG00000133328			17824	protein-coding gene	gene with protein product		613866					Standard	NM_017878		Approved	FLJ20556	uc001nxg.1	Q9NWW9	OTTHUMG00000167851	ENST00000255695.1:c.314C>T	11.37:g.63325937G>A	ENSP00000255695:p.Pro105Leu						p.P105L	NM_017878	NP_060348	Q9NWW9	HRSL2_HUMAN			3	373	-			105					B9A7L8	Missense_Mutation	SNP	ENST00000255695.1	37	c.314C>T	CCDS8046.1	.	.	.	.	.	.	.	.	.	.	G	0.620	-0.821677	0.02755	.	.	ENSG00000133328	ENST00000255695	T	0.22539	1.95	4.28	-8.56	0.00904	NC (1);	0.748871	0.11550	N	0.552904	T	0.08802	0.0218	N	0.26162	0.8	0.09310	N	1	B	0.14012	0.009	B	0.21151	0.033	T	0.17837	-1.0356	10	0.24483	T	0.36	-40.6079	1.6368	0.02743	0.3172:0.1916:0.3385:0.1528	.	105	Q9NWW9	HRSL2_HUMAN	L	105	ENSP00000255695:P105L	ENSP00000255695:P105L	P	-	2	0	HRASLS2	63082513	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.647000	0.05397	-3.118000	0.00239	-1.177000	0.01723	CCT		0.547	HRASLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396631.1	NM_017878		12	46	0	0	0	0	12	46				
SLC25A45	283130	broad.mit.edu	37	11	65144112	65144112	+	Silent	SNP	T	T	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:65144112T>A	ENST00000527174.1	-	6	688	c.633A>T	c.(631-633)gcA>gcT	p.A211A	SLC25A45_ENST00000377152.2_Silent_p.A107A|RP11-867O8.5_ENST00000533886.1_RNA|SLC25A45_ENST00000398802.1_Silent_p.A211A|SLC25A45_ENST00000360662.3_Silent_p.A187A|SLC25A45_ENST00000294187.6_Silent_p.A169A|SLC25A45_ENST00000534028.1_Silent_p.A187A|SLC25A45_ENST00000417511.2_Silent_p.A169A|SLC25A45_ENST00000526432.1_Silent_p.A149A			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	211					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						AAGCAATGCCTGCAAAGCCCC	0.612																																						uc001odp.1		NA																	0					0						c.(631-633)GCA>GCT		solute carrier family 25, member 45 isoform b							53.0	58.0	56.0					11																	65144112		2119	4224	6343	SO:0001819	synonymous_variant	283130				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr11:65144112T>A	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.633A>T	11.37:g.65144112T>A						SLC25A45_uc009yqi.1_Silent_p.A149A|SLC25A45_uc001odq.1_Silent_p.A187A|SLC25A45_uc001odr.1_Silent_p.A211A|SLC25A45_uc001ods.1_Silent_p.A169A|SLC25A45_uc001odt.1_Silent_p.A169A	p.A211A	NM_001077241	NP_001070709	Q8N413	S2545_HUMAN			6	1055	-			211			Helical; Name=5; (Potential).|Solcar 3.		Q6PL49|Q8IW29	Silent	SNP	ENST00000527174.1	37	c.633A>T	CCDS41670.1																																																																																				0.612	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556		30	19	0	0	0	0	30	19				
CD248	57124	broad.mit.edu	37	11	66083244	66083244	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083244C>T	ENST00000311330.3	-	1	1271	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	419	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						ATCTGTGGCTCTCTGTCCTCT	0.657																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1255-1257)GAG>AAG		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						91.0	94.0	93.0					11																	66083244		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083244C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1255G>A	11.37:g.66083244C>T	ENSP00000308117:p.Glu419Lys						p.E419K	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	1272	-			419			Pro-rich.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.1255G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	7.044	0.563087	0.13498	.	.	ENSG00000174807	ENST00000311330	D	0.87103	-2.21	3.79	3.79	0.43588	.	1.036430	0.07624	N	0.927442	T	0.77961	0.4209	N	0.24115	0.695	0.09310	N	1	B	0.26635	0.155	B	0.18263	0.021	T	0.62632	-0.6813	10	0.22109	T	0.4	-5.8942	9.6172	0.39698	0.0:0.7863:0.2137:0.0	.	419	Q9HCU0	CD248_HUMAN	K	419	ENSP00000308117:E419K	ENSP00000308117:E419K	E	-	1	0	CD248	65839820	0.016000	0.18221	0.047000	0.18901	0.005000	0.04900	1.927000	0.40094	2.403000	0.81681	0.455000	0.32223	GAG		0.657	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		28	107	0	0	0	0	28	107				
CD248	57124	broad.mit.edu	37	11	66083246	66083246	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083246C>T	ENST00000311330.3	-	1	1269	c.1253G>A	c.(1252-1254)aGa>aAa	p.R418K	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	418	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CTGTGGCTCTCTGTCCTCTGG	0.652																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1252-1254)AGA>AAA		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						91.0	94.0	93.0					11																	66083246		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083246C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1253G>A	11.37:g.66083246C>T	ENSP00000308117:p.Arg418Lys						p.R418K	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	1270	-			418			Pro-rich.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.1253G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.925153	0.00493	.	.	ENSG00000174807	ENST00000311330	D	0.86562	-2.14	3.79	0.142	0.14816	.	2.137030	0.02326	N	0.073517	T	0.70561	0.3238	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.64415	-0.6413	10	0.05620	T	0.96	6.3061	5.0133	0.14324	0.0:0.3459:0.4383:0.2158	.	418	Q9HCU0	CD248_HUMAN	K	418	ENSP00000308117:R418K	ENSP00000308117:R418K	R	-	2	0	CD248	65839822	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.260000	0.08708	0.046000	0.15833	0.455000	0.32223	AGA		0.652	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		28	107	0	0	0	0	28	107				
CD248	57124	broad.mit.edu	37	11	66083267	66083267	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083267C>G	ENST00000311330.3	-	1	1248	c.1232G>C	c.(1231-1233)aGa>aCa	p.R411T	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	411	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GAAGCTCGGTCTATAGGCCAG	0.647																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1231-1233)AGA>ACA		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						87.0	89.0	88.0					11																	66083267		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083267C>G	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1232G>C	11.37:g.66083267C>G	ENSP00000308117:p.Arg411Thr						p.R411T	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	1249	-			411			Pro-rich.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.1232G>C	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	7.192	0.591695	0.13812	.	.	ENSG00000174807	ENST00000311330	D	0.86865	-2.18	4.64	3.73	0.42828	.	1.149780	0.06172	N	0.677885	T	0.76772	0.4034	N	0.24115	0.695	0.09310	N	1	B	0.30482	0.281	B	0.19946	0.027	T	0.61773	-0.6994	10	0.13470	T	0.59	0.0121	8.4403	0.32812	0.0:0.8932:0.0:0.1068	.	411	Q9HCU0	CD248_HUMAN	T	411	ENSP00000308117:R411T	ENSP00000308117:R411T	R	-	2	0	CD248	65839843	0.004000	0.15560	0.009000	0.14445	0.175000	0.22909	0.577000	0.23758	1.169000	0.42739	0.455000	0.32223	AGA		0.647	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		24	95	0	0	0	0	24	95				
CD248	57124	broad.mit.edu	37	11	66083379	66083379	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083379C>T	ENST00000311330.3	-	1	1136	c.1120G>A	c.(1120-1122)Gat>Aat	p.D374N	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	374					anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						TCTTCCTCATCCTCCCCGTCA	0.622																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1120-1122)GAT>AAT		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						80.0	76.0	77.0					11																	66083379		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083379C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1120G>A	11.37:g.66083379C>T	ENSP00000308117:p.Asp374Asn						p.D374N	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	1137	-			374			Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.1120G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561543	0.45590	.	.	ENSG00000174807	ENST00000311330	D	0.87491	-2.26	4.65	4.65	0.58169	.	1.088530	0.07152	N	0.849242	T	0.78830	0.4345	N	0.14661	0.345	0.28738	N	0.902121	B	0.30482	0.281	B	0.24848	0.056	T	0.65228	-0.6219	10	0.24483	T	0.36	-1.5094	15.0649	0.71986	0.0:1.0:0.0:0.0	.	374	Q9HCU0	CD248_HUMAN	N	374	ENSP00000308117:D374N	ENSP00000308117:D374N	D	-	1	0	CD248	65839955	0.275000	0.24201	0.912000	0.35992	0.673000	0.39480	1.500000	0.35682	2.407000	0.81776	0.462000	0.41574	GAT		0.622	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		41	55	0	0	0	0	41	55				
CD248	57124	broad.mit.edu	37	11	66083463	66083463	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083463C>G	ENST00000311330.3	-	1	1052	c.1036G>C	c.(1036-1038)Gat>Cat	p.D346H	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	346	EGF-like; calcium-binding. {ECO:0000255}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CTGATGCCATCAGCCTCCAGC	0.577																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(1036-1038)GAT>CAT		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						63.0	54.0	57.0					11																	66083463		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083463C>G	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1036G>C	11.37:g.66083463C>G	ENSP00000308117:p.Asp346His						p.D346H	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	1053	-			346			EGF-like; calcium-binding (Potential).|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.1036G>C	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442495	0.63067	.	.	ENSG00000174807	ENST00000311330	D	0.88354	-2.37	4.65	4.65	0.58169	EGF-like calcium-binding (2);	0.127433	0.50627	D	0.000113	D	0.95554	0.8555	M	0.92367	3.3	0.49483	D	0.999795	D	0.89917	1.0	D	0.97110	1.0	D	0.96469	0.9347	10	0.87932	D	0	-22.4628	15.0649	0.71986	0.0:1.0:0.0:0.0	.	346	Q9HCU0	CD248_HUMAN	H	346	ENSP00000308117:D346H	ENSP00000308117:D346H	D	-	1	0	CD248	65840039	0.990000	0.36364	0.100000	0.21137	0.987000	0.75469	3.746000	0.55127	2.407000	0.81776	0.462000	0.41574	GAT		0.577	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		29	33	0	0	0	0	29	33				
CD248	57124	broad.mit.edu	37	11	66083527	66083527	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083527C>T	ENST00000311330.3	-	1	988	c.972G>A	c.(970-972)caG>caA	p.Q324Q	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	324	EGF-like; calcium-binding. {ECO:0000255}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						TGACACACATCTGCTGGCACA	0.602																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(970-972)CAG>CAA		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						68.0	53.0	58.0					11																	66083527		2200	4295	6495	SO:0001819	synonymous_variant	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083527C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.972G>A	11.37:g.66083527C>T							p.Q324Q	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	989	-			324			EGF-like; calcium-binding (Potential).|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Silent	SNP	ENST00000311330.3	37	c.972G>A	CCDS8134.1																																																																																				0.602	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		17	31	0	0	0	0	17	31				
CD248	57124	broad.mit.edu	37	11	66083548	66083548	+	Missense_Mutation	SNP	C	C	G	rs369118303		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083548C>G	ENST00000311330.3	-	1	967	c.951G>C	c.(949-951)caG>caC	p.Q317H	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	317	EGF-like; calcium-binding. {ECO:0000255}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CACCGGCAATCTGGCACTCAT	0.597																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(949-951)CAG>CAC		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						65.0	52.0	56.0					11																	66083548		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083548C>G	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.951G>C	11.37:g.66083548C>G	ENSP00000308117:p.Gln317His						p.Q317H	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	968	-			317			EGF-like; calcium-binding (Potential).|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.951G>C	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874501	0.51695	.	.	ENSG00000174807	ENST00000311330	D	0.92149	-2.98	4.41	2.39	0.29439	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.516026	0.18778	N	0.131415	D	0.90556	0.7040	N	0.26042	0.785	0.31138	N	0.706944	D	0.61080	0.989	P	0.61533	0.89	D	0.87494	0.2429	10	0.72032	D	0.01	-9.173	7.7546	0.28917	0.0:0.7369:0.1659:0.0971	.	317	Q9HCU0	CD248_HUMAN	H	317	ENSP00000308117:Q317H	ENSP00000308117:Q317H	Q	-	3	2	CD248	65840124	0.979000	0.34478	0.981000	0.43875	0.865000	0.49528	0.589000	0.23939	1.014000	0.39417	0.462000	0.41574	CAG		0.597	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		13	29	0	0	0	0	13	29				
CD248	57124	broad.mit.edu	37	11	66083586	66083586	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083586C>A	ENST00000311330.3	-	1	929	c.913G>T	c.(913-915)Gat>Tat	p.D305Y	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	305					anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						TGCGGATCATCCTCCGCTGGC	0.617																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(913-915)GAT>TAT		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						44.0	39.0	41.0					11																	66083586		2200	4295	6495	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083586C>A	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.913G>T	11.37:g.66083586C>A	ENSP00000308117:p.Asp305Tyr						p.D305Y	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	930	-			305			Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.913G>T	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610765	0.46527	.	.	ENSG00000174807	ENST00000311330	D	0.88277	-2.36	4.41	4.41	0.53225	Epidermal growth factor-like (1);	0.061993	0.64402	D	0.000010	D	0.90765	0.7101	L	0.51422	1.61	0.42859	D	0.994103	D	0.71674	0.998	P	0.57371	0.819	D	0.92046	0.5644	10	0.87932	D	0	-8.6952	14.5201	0.67844	0.0:1.0:0.0:0.0	.	305	Q9HCU0	CD248_HUMAN	Y	305	ENSP00000308117:D305Y	ENSP00000308117:D305Y	D	-	1	0	CD248	65840162	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	4.598000	0.61069	2.279000	0.76181	0.462000	0.41574	GAT		0.617	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		12	25	1	0	1.05e-09	1.22e-09	12	25				
CD248	57124	broad.mit.edu	37	11	66083748	66083748	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083748C>A	ENST00000311330.3	-	1	767	c.751G>T	c.(751-753)Gat>Tat	p.D251Y	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	251					anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						ACGTGACCATCCACCTCCTCC	0.687																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(751-753)GAT>TAT		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						39.0	51.0	47.0					11																	66083748		2200	4294	6494	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083748C>A	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.751G>T	11.37:g.66083748C>A	ENSP00000308117:p.Asp251Tyr						p.D251Y	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	768	-			251			Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.751G>T	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748073	0.49257	.	.	ENSG00000174807	ENST00000311330	D	0.96427	-4.01	4.04	3.12	0.35913	Epidermal growth factor-like (1);	0.799220	0.11387	N	0.569238	D	0.94105	0.8110	N	0.25789	0.76	0.09310	N	1	P	0.50943	0.94	P	0.50231	0.635	D	0.87515	0.2442	10	0.72032	D	0.01	-4.0658	9.2571	0.37590	0.0:0.8909:0.0:0.1091	.	251	Q9HCU0	CD248_HUMAN	Y	251	ENSP00000308117:D251Y	ENSP00000308117:D251Y	D	-	1	0	CD248	65840324	0.009000	0.17119	0.014000	0.15608	0.975000	0.68041	1.420000	0.34804	0.917000	0.36895	0.313000	0.20887	GAT		0.687	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		27	33	1	0	0.000184323	0.000199282	27	33				
CD248	57124	broad.mit.edu	37	11	66083845	66083845	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083845C>T	ENST00000311330.3	-	1	670	c.654G>A	c.(652-654)gaG>gaA	p.E218E	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	218	Sushi.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CCACACCTCCCTCAGGCTGCT	0.662																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(652-654)GAG>GAA		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						29.0	36.0	33.0					11																	66083845		2199	4293	6492	SO:0001819	synonymous_variant	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083845C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.654G>A	11.37:g.66083845C>T							p.E218E	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	671	-			218			Sushi.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Silent	SNP	ENST00000311330.3	37	c.654G>A	CCDS8134.1																																																																																				0.662	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		25	20	0	0	0	0	25	20				
CD248	57124	broad.mit.edu	37	11	66083847	66083847	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083847C>T	ENST00000311330.3	-	1	668	c.652G>A	c.(652-654)Gag>Aag	p.E218K	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	218	Sushi.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						ACACCTCCCTCAGGCTGCTTC	0.667																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(652-654)GAG>AAG		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						28.0	35.0	33.0					11																	66083847		2199	4293	6492	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083847C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.652G>A	11.37:g.66083847C>T	ENSP00000308117:p.Glu218Lys						p.E218K	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	669	-			218			Sushi.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.652G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	9.642	1.139275	0.21205	.	.	ENSG00000174807	ENST00000311330	D	0.86956	-2.19	4.17	1.06	0.20224	.	0.799320	0.10655	N	0.649398	T	0.75250	0.3824	L	0.34521	1.04	0.09310	N	1	B	0.22276	0.067	B	0.17433	0.018	T	0.56312	-0.8000	10	0.14656	T	0.56	0.824	3.4188	0.07385	0.1807:0.5562:0.1629:0.1002	.	218	Q9HCU0	CD248_HUMAN	K	218	ENSP00000308117:E218K	ENSP00000308117:E218K	E	-	1	0	CD248	65840423	0.999000	0.42202	0.000000	0.03702	0.303000	0.27691	2.034000	0.41145	0.035000	0.15519	0.462000	0.41574	GAG		0.667	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		24	20	0	0	0	0	24	20				
CD248	57124	broad.mit.edu	37	11	66083928	66083928	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66083928C>G	ENST00000311330.3	-	1	587	c.571G>C	c.(571-573)Gag>Cag	p.E191Q	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	191	Sushi.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGCAGCCACTCAAACTCTGTG	0.677																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(571-573)GAG>CAG		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						14.0	18.0	17.0					11																	66083928		2176	4280	6456	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66083928C>G	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.571G>C	11.37:g.66083928C>G	ENSP00000308117:p.Glu191Gln						p.E191Q	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	588	-			191			Sushi.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.571G>C	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.564056	0.45694	.	.	ENSG00000174807	ENST00000311330	T	0.41758	0.99	4.06	2.09	0.27110	.	0.405856	0.24960	N	0.034222	T	0.30262	0.0759	L	0.33485	1.01	0.22629	N	0.998919	B	0.09022	0.002	B	0.06405	0.002	T	0.17379	-1.0371	10	0.33141	T	0.24	-8.1919	11.7361	0.51765	0.0:0.6585:0.3415:0.0	.	191	Q9HCU0	CD248_HUMAN	Q	191	ENSP00000308117:E191Q	ENSP00000308117:E191Q	E	-	1	0	CD248	65840504	0.100000	0.21855	0.522000	0.27862	0.922000	0.55478	0.616000	0.24344	0.337000	0.23665	0.462000	0.41574	GAG		0.677	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		12	22	0	0	0	0	12	22				
CD248	57124	broad.mit.edu	37	11	66084045	66084045	+	Missense_Mutation	SNP	C	C	T	rs554499998		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66084045C>T	ENST00000311330.3	-	1	470	c.454G>A	c.(454-456)Gac>Aac	p.D152N	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	152	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						AGGTAGCCGTCGACAGCCAGC	0.716																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(454-456)GAC>AAC		tumor endothelial marker 1 precursor	Cefalotin(DB00456)						14.0	15.0	15.0					11																	66084045		2164	4253	6417	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66084045C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.454G>A	11.37:g.66084045C>T	ENSP00000308117:p.Asp152Asn						p.D152N	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	471	-			152			C-type lectin.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.454G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135803	0.77662	.	.	ENSG00000174807	ENST00000311330	T	0.53423	0.62	4.06	4.06	0.47325	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.062970	0.64402	N	0.000012	T	0.51550	0.1681	N	0.17312	0.475	0.45342	D	0.998333	D	0.89917	1.0	D	0.83275	0.996	T	0.56607	-0.7951	10	0.52906	T	0.07	-15.1391	13.8098	0.63256	0.0:1.0:0.0:0.0	.	152	Q9HCU0	CD248_HUMAN	N	152	ENSP00000308117:D152N	ENSP00000308117:D152N	D	-	1	0	CD248	65840621	1.000000	0.71417	0.919000	0.36401	0.804000	0.45430	6.782000	0.75073	2.118000	0.64928	0.485000	0.47835	GAC		0.716	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		17	15	0	0	0	0	17	15				
CD248	57124	broad.mit.edu	37	11	66084084	66084084	+	Missense_Mutation	SNP	C	C	T	rs371429917		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:66084084C>T	ENST00000311330.3	-	1	431	c.415G>A	c.(415-417)Gag>Aag	p.E139K	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	139	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CAGCGGTGCTCGCCACTTGCC	0.706																																						uc001ohm.1		NA																	0				large_intestine(3)	3						c.(415-417)GAG>AAG		tumor endothelial marker 1 precursor	Cefalotin(DB00456)	C	LYS/GLU	1,4349		0,1,2174	17.0	17.0	17.0		415	2.1	0.0	11		17	0,8504		0,0,4252	no	missense	CD248	NM_020404.2	56	0,1,6426	TT,TC,CC		0.0,0.023,0.0078	possibly-damaging	139/758	66084084	1,12853	2175	4252	6427	SO:0001583	missense	57124					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding	g.chr11:66084084C>T	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.415G>A	11.37:g.66084084C>T	ENSP00000308117:p.Glu139Lys						p.E139K	NM_020404	NP_065137	Q9HCU0	CD248_HUMAN			1	432	-			139			C-type lectin.|Extracellular (Potential).		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	c.415G>A	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	9.696	1.153145	0.21371	2.3E-4	0.0	ENSG00000174807	ENST00000311330	T	0.17854	2.25	4.1	2.14	0.27477	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.553048	0.18281	N	0.146033	T	0.06188	0.0160	N	0.10916	0.065	0.09310	N	1	P	0.38110	0.618	B	0.31946	0.138	T	0.31641	-0.9936	10	0.08599	T	0.76	-0.1248	8.2099	0.31478	0.0:0.7889:0.0:0.2111	.	139	Q9HCU0	CD248_HUMAN	K	139	ENSP00000308117:E139K	ENSP00000308117:E139K	E	-	1	0	CD248	65840660	0.003000	0.15002	0.018000	0.16275	0.291000	0.27294	1.017000	0.29989	0.940000	0.37473	0.491000	0.48974	GAG		0.706	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		21	17	0	0	0	0	21	17				
TPCN2	219931	broad.mit.edu	37	11	68835058	68835058	+	Missense_Mutation	SNP	G	G	A	rs142288453		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:68835058G>A	ENST00000294309.3	+	8	915	c.814G>A	c.(814-816)Gcc>Acc	p.A272T	TPCN2_ENST00000442692.2_3'UTR|TPCN2_ENST00000542467.1_Missense_Mutation_p.A272T	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	272					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCTGACCACGGCCAACAACCC	0.637													g|||	1	0.000199681	0.0	0.0	5008	,	,		14738	0.0		0.001	False		,,,				2504	0.0					uc001oos.2		NA																	0					0						c.(814-816)GCC>ACC		two pore segment channel 2			THR/ALA	1,4399	2.1+/-5.4	0,1,2199	93.0	72.0	79.0		814	4.0	0.8	11	dbSNP_134	79	7,8581	5.0+/-18.6	0,7,4287	yes	missense	TPCN2	NM_139075.3	58	0,8,6486	AA,AG,GG		0.0815,0.0227,0.0616	benign	272/753	68835058	8,12980	2200	4294	6494	SO:0001583	missense	219931				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity	g.chr11:68835058G>A	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.814G>A	11.37:g.68835058G>A	ENSP00000294309:p.Ala272Thr					TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Missense_Mutation_p.A187T|TPCN2_uc010rqg.1_Missense_Mutation_p.A272T	p.A272T	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		8	930	+			272					Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	c.814G>A	CCDS8189.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	18.38	3.612106	0.66672	2.27E-4	8.15E-4	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.97328	-4.34;-4.34	4.92	3.98	0.46160	Ion transport (1);	0.054564	0.64402	D	0.000001	D	0.97864	0.9298	M	0.83384	2.64	0.51233	D	0.999917	D;D;D	0.69078	0.997;0.985;0.994	D;P;P	0.65010	0.931;0.884;0.886	D	0.97064	0.9773	10	0.36615	T	0.2	-28.104	10.5785	0.45242	0.0:0.0:0.7991:0.2009	.	272;272;187	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	T	202;272;187;272	ENSP00000294309:A272T;ENSP00000445551:A272T	ENSP00000294309:A272T	A	+	1	0	TPCN2	68591634	1.000000	0.71417	0.808000	0.32385	0.774000	0.43823	4.503000	0.60407	1.159000	0.42565	0.632000	0.83419	GCC		0.637	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075		12	366	0	0	0	0	12	366				
KRTAP5-8	57830	broad.mit.edu	37	11	71249400	71249400	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:71249400G>T	ENST00000398534.3	+	1	330	c.299G>T	c.(298-300)tGt>tTt	p.C100F		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	100	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						TCCTCAGGCTGTGGGTCATCC	0.612																																						uc001oqr.1		NA																	0					0						c.(298-300)TGT>TTT		keratin associated protein 5-8							88.0	109.0	102.0					11																	71249400		2200	4290	6490	SO:0001583	missense	57830					extracellular region|keratin filament	structural constituent of epidermis	g.chr11:71249400G>T	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.299G>T	11.37:g.71249400G>T	ENSP00000420723:p.Cys100Phe						p.C100F	NM_021046	NP_066384	O75690	KRA58_HUMAN			1	330	+			100			9 X 4 AA repeats of C-C-X-P.		Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	37	c.299G>T	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	-	8.821	0.937518	0.18206	.	.	ENSG00000241233	ENST00000398534	T	0.02067	4.47	1.61	0.681	0.17986	.	.	.	.	.	T	0.08223	0.0205	H	0.96365	3.81	0.24328	N	0.995019	B	0.20988	0.05	B	0.30105	0.111	T	0.14309	-1.0477	9	0.87932	D	0	.	6.358	0.21412	0.1757:0.0:0.8243:0.0	.	100	O75690	KRA58_HUMAN	F	100	ENSP00000420723:C100F	ENSP00000420723:C100F	C	+	2	0	KRTAP5-8	70927048	0.806000	0.28996	0.060000	0.19600	0.043000	0.13939	1.520000	0.35899	0.270000	0.21984	-0.230000	0.12252	TGT		0.612	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046		72	504	1	0	3.79e-24	4.64e-24	72	504				
TMEM135	65084	broad.mit.edu	37	11	87016978	87016978	+	Splice_Site	SNP	A	A	G	rs568746924		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:87016978A>G	ENST00000305494.5	+	9	738	c.699A>G	c.(697-699)atA>atG	p.I233M	TMEM135_ENST00000532959.1_Splice_Site_p.I104M|TMEM135_ENST00000340353.7_Splice_Site_p.I211M|TMEM135_ENST00000535167.1_Splice_Site_p.I94M	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	233					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCAATTTCAGATGCAAACATG	0.284													A|||	1	0.000199681	0.0008	0.0	5008	,	,		10756	0.0		0.0	False		,,,				2504	0.0					uc001pch.2		NA																	0					0						c.(697-699)ATA>ATG		transmembrane protein 135							58.0	60.0	59.0					11																	87016978		2200	4285	6485	SO:0001630	splice_region_variant	65084					integral to membrane		g.chr11:87016978A>G	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.699-1A>G	11.37:g.87016978A>G						TMEM135_uc010rtt.1_Missense_Mutation_p.I94M|TMEM135_uc001pci.2_Missense_Mutation_p.I211M	p.I233M	NM_022918	NP_075069	Q86UB9	TM135_HUMAN			9	722	+		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	233					Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	c.699A>G	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	A	12.72	2.021327	0.35701	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.18	4.06	0.47325	.	0.576718	0.20576	N	0.089622	T	0.28433	0.0703	L	0.46157	1.445	0.38441	D	0.946703	B;B	0.31383	0.004;0.321	B;B	0.37888	0.02;0.26	T	0.09530	-1.0670	9	.	.	.	.	7.8381	0.29382	0.8191:0.0:0.1809:0.0	.	211;233	Q86UB9-2;Q86UB9	.;TM135_HUMAN	M	211;70;104;233;94	ENSP00000345513:I211M;ENSP00000436179:I104M;ENSP00000306344:I233M;ENSP00000439525:I94M	.	I	+	3	3	TMEM135	86694626	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.109000	0.57824	0.934000	0.37316	0.374000	0.22700	ATA		0.284	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	Missense_Mutation	18	25	0	0	0	0	18	25				
HSPA8	3312	broad.mit.edu	37	11	122930647	122930647	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:122930647C>T	ENST00000532636.1	-	5	773	c.654G>A	c.(652-654)gaG>gaA	p.E218E	HSPA8_ENST00000453788.2_Silent_p.E218E|HSPA8_ENST00000533540.1_Intron|SNORD14E_ENST00000364009.1_RNA|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000534319.1_5'UTR|HSPA8_ENST00000526110.1_Silent_p.E199E|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526862.1_Intron|HSPA8_ENST00000227378.3_Silent_p.E218E|HSPA8_ENST00000534624.1_Silent_p.E218E			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	218	Interaction with BAG1.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TAGACTTGACCTCAAAGATTC	0.453																																					Colon(21;486 594 5900 6733 14272)	uc001pyo.2		NA																	0				central_nervous_system(7)|lung(1)	8						c.(652-654)GAG>GAA		heat shock 70kDa protein 8 isoform 1							45.0	46.0	46.0					11																	122930647		2202	4299	6501	SO:0001819	synonymous_variant	3312				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding	g.chr11:122930647C>T	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.654G>A	11.37:g.122930647C>T						HSPA8_uc009zbc.2_5'UTR|HSPA8_uc001pyp.2_Silent_p.E218E|HSPA8_uc010rzu.1_Silent_p.E141E|HSPA8_uc009zbd.1_Silent_p.E218E|HSPA8_uc010rzv.1_3'UTR	p.E218E	NM_006597	NP_006588	P11142	HSP7C_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)	5	732	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	218			Interaction with BAG1.		Q9H3R6	Silent	SNP	ENST00000532636.1	37	c.654G>A	CCDS8440.1																																																																																				0.453	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1			5	32	0	0	0	0	5	32				
PARP11	57097	broad.mit.edu	37	12	3921420	3921420	+	Nonsense_Mutation	SNP	G	G	A	rs375575295		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:3921420G>A	ENST00000228820.4	-	8	1030	c.886C>T	c.(886-888)Cga>Tga	p.R296*	PARP11_ENST00000397096.2_Intron|PARP11_ENST00000476985.1_Intron|PARP11_ENST00000427057.2_Nonsense_Mutation_p.R215*|PARP11_ENST00000447133.3_Nonsense_Mutation_p.R215*	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	289	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R289*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			GAAGGAGGTCGCATGTATTTG	0.413																																						uc001qmk.1		NA																	1	Substitution - Nonsense(1)		endometrium(1)	ovary(1)|central_nervous_system(1)	2						c.(865-867)CGA>TGA		poly (ADP-ribose) polymerase family, member 11		G	stop/ARG	0,4406		0,0,2203	120.0	102.0	108.0		886	3.4	1.0	12		108	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	PARP11	NM_020367.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		296/339	3921420	1,13005	2203	4300	6503	SO:0001587	stop_gained	57097						NAD+ ADP-ribosyltransferase activity	g.chr12:3921420G>A	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.886C>T	12.37:g.3921420G>A	ENSP00000228820:p.Arg296*					PARP11_uc001qml.2_Nonsense_Mutation_p.R296*|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_Nonsense_Mutation_p.R215*|PARP11_uc001qmn.2_Nonsense_Mutation_p.R215*	p.R289*	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)		7	920	-			289			PARP catalytic.		B4DRQ0|Q68DS1|Q8N5Y9	Nonsense_Mutation	SNP	ENST00000228820.4	37	c.865C>T	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	G	35	5.422037	0.96111	0.0	1.16E-4	ENSG00000111224	ENST00000427057;ENST00000228820;ENST00000447133	.	.	.	5.28	3.39	0.38822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	12.053	0.53518	0.0:0.0:0.6761:0.3239	.	.	.	.	X	215;296;215	.	ENSP00000228820:R296X	R	-	1	2	PARP11	3791681	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.237000	0.43061	0.739000	0.32628	0.650000	0.86243	CGA		0.413	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1			39	82	0	0	0	0	39	82				
C12orf4	57102	broad.mit.edu	37	12	4627336	4627336	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:4627336A>T	ENST00000261250.3	-	8	1008	c.921T>A	c.(919-921)agT>agA	p.S307R	C12orf4_ENST00000545746.1_Missense_Mutation_p.S307R	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	307										NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GTTTCACACCACTTCGATGAT	0.413																																						uc001qms.2		NA																	0					0						c.(919-921)AGT>AGA		hypothetical protein LOC57102							153.0	155.0	154.0					12																	4627336		2203	4300	6503	SO:0001583	missense	57102							g.chr12:4627336A>T	AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.921T>A	12.37:g.4627336A>T	ENSP00000261250:p.Ser307Arg					C12orf4_uc001qmt.2_Missense_Mutation_p.S307R	p.S307R	NM_020374	NP_065107	Q9NQ89	CL004_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)	8	1009	-			307					D3DUQ8|Q6MZH5	Missense_Mutation	SNP	ENST00000261250.3	37	c.921T>A	CCDS8528.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159949	0.38119	.	.	ENSG00000047621	ENST00000261250;ENST00000545746;ENST00000541014	.	.	.	5.31	0.47	0.16747	.	0.154733	0.64402	D	0.000001	T	0.38506	0.1043	L	0.34521	1.04	0.58432	D	0.999991	B	0.02656	0.0	B	0.08055	0.003	T	0.07654	-1.0761	9	0.35671	T	0.21	.	5.2145	0.15334	0.5129:0.1498:0.3372:0.0	.	307	Q9NQ89	CL004_HUMAN	R	307;307;134	.	ENSP00000261250:S307R	S	-	3	2	C12orf4	4497597	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	0.924000	0.28777	0.116000	0.18110	0.528000	0.53228	AGT		0.413	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374		55	67	0	0	0	0	55	67				
COPZ1	22818	broad.mit.edu	37	12	54744278	54744278	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:54744278G>A	ENST00000262061.2	+	9	542	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	COPZ1_ENST00000552218.1_Missense_Mutation_p.E190K|COPZ1_ENST00000549043.1_Missense_Mutation_p.E177K|COPZ1_ENST00000548281.1_3'UTR|COPZ1_ENST00000551779.1_3'UTR|COPZ1_ENST00000549116.1_Missense_Mutation_p.E111K|COPZ1_ENST00000548753.1_Missense_Mutation_p.E81K|COPZ1_ENST00000455864.2_Missense_Mutation_p.E146K|COPZ1_ENST00000552362.1_Missense_Mutation_p.E152K|COPZ1_ENST00000416254.2_Missense_Mutation_p.E118K	NM_001271734.1|NM_001271736.1|NM_016057.1	NP_001258663.1|NP_001258665.1|NP_057141.1	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1	169					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)				kidney(1)|lung(4)	5						GTCAGCCAAAGAACAGATCAA	0.493																																						uc001sfs.1		NA																	0					0						c.(505-507)GAA>AAA		coatomer protein complex, subunit zeta 1							258.0	219.0	232.0					12																	54744278		2203	4300	6503	SO:0001583	missense	22818				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol		g.chr12:54744278G>A	AF151878	CCDS8877.1, CCDS61137.1, CCDS61138.1, CCDS61139.1	12q13.2-q13.3	2008-02-05		2003-07-23					2243	protein-coding gene	gene with protein product		615472	"""coatomer protein complex, subunit zeta"""	COPZ			Standard	NM_001271734		Approved	CGI-120	uc009znm.2	P61923		ENST00000262061.2:c.505G>A	12.37:g.54744278G>A	ENSP00000262061:p.Glu169Lys					COPZ1_uc001sft.2_Missense_Mutation_p.E118K|COPZ1_uc009znm.1_Missense_Mutation_p.E177K|COPZ1_uc010sot.1_Missense_Mutation_p.E146K	p.E169K	NM_016057	NP_057141	P61923	COPZ1_HUMAN			9	542	+			169					B4DDX8|B4DHZ0|F8VS17|F8VWL5|Q549N6|Q9Y3C3	Missense_Mutation	SNP	ENST00000262061.2	37	c.505G>A	CCDS8877.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151166	0.78001	.	.	ENSG00000111481	ENST00000262061;ENST00000549043;ENST00000552218;ENST00000552362;ENST00000455864;ENST00000416254;ENST00000549116;ENST00000548753	.	.	.	4.64	4.64	0.57946	.	0.052781	0.64402	D	0.000001	T	0.75049	0.3797	M	0.80332	2.49	0.80722	D	1	P;B;D;P	0.67145	0.924;0.296;0.996;0.788	P;B;P;P	0.55785	0.585;0.292;0.784;0.585	T	0.79487	-0.1783	9	0.66056	D	0.02	-15.1264	15.4226	0.75025	0.0:0.0:1.0:0.0	.	146;177;118;169	B4DDX8;F8VWL5;B4DHZ0;P61923	.;.;.;COPZ1_HUMAN	K	169;177;190;152;146;118;111;81	.	ENSP00000262061:E169K	E	+	1	0	COPZ1	53030545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.987000	0.88182	2.590000	0.87494	0.555000	0.69702	GAA		0.493	COPZ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405753.1	NM_016057		10	148	0	0	0	0	10	148				
TMEM5	10329	broad.mit.edu	37	12	64202512	64202512	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:64202512G>C	ENST00000261234.6	+	6	1130	c.972G>C	c.(970-972)caG>caC	p.Q324H	TMEM5-AS1_ENST00000546214.1_RNA|TMEM5_ENST00000537373.1_Missense_Mutation_p.Q64H	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	324						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		CCTTGCTTCAGAGTGATCTCA	0.428																																						uc001srq.1		NA																	0					0						c.(970-972)CAG>CAC		transmembrane protein 5							120.0	112.0	115.0					12																	64202512		2203	4300	6503	SO:0001583	missense	10329					integral to plasma membrane		g.chr12:64202512G>C	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.972G>C	12.37:g.64202512G>C	ENSP00000261234:p.Gln324His					TMEM5_uc001srr.1_Missense_Mutation_p.Q221H|TMEM5_uc001srs.1_Missense_Mutation_p.Q64H	p.Q324H	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)	6	1076	+		Myeloproliferative disorder(1001;0.0255)	324			Extracellular (Potential).		A8K017|Q6PKD6	Missense_Mutation	SNP	ENST00000261234.6	37	c.972G>C	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	G	7.216	0.596475	0.13875	.	.	ENSG00000118600	ENST00000261234;ENST00000537373	.	.	.	4.65	-5.42	0.02640	.	0.112981	0.64402	N	0.000008	T	0.34919	0.0914	L	0.48362	1.52	0.47009	D	0.999286	B;B	0.10296	0.003;0.003	B;B	0.11329	0.006;0.006	T	0.06698	-1.0812	8	.	.	.	-13.0119	0.6397	0.00808	0.2939:0.2879:0.2182:0.2001	.	64;324	G3V1K2;Q9Y2B1	.;TMEM5_HUMAN	H	324;64	.	.	Q	+	3	2	TMEM5	62488779	1.000000	0.71417	0.327000	0.25402	0.068000	0.16541	0.927000	0.28818	-1.262000	0.02459	0.491000	0.48974	CAG		0.428	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254		27	60	0	0	0	0	27	60				
ZFC3H1	196441	broad.mit.edu	37	12	72057278	72057278	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:72057278C>T	ENST00000378743.3	-	1	471	c.113G>A	c.(112-114)aGt>aAt	p.S38N	THAP2_ENST00000308086.2_5'UTR|ZFC3H1_ENST00000549407.1_5'Flank|ZFC3H1_ENST00000548100.1_Missense_Mutation_p.S38N|ZFC3H1_ENST00000552037.1_Missense_Mutation_p.S38N|THAP2_ENST00000547843.1_5'Flank	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	38	Ser-rich.				RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCTGCTCCGACTCCGTATCTG	0.657											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001swo.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(112-114)AGT>AAT		proline/serine-rich coiled-coil 2							67.0	80.0	76.0					12																	72057278		2084	4220	6304	SO:0001583	missense	196441				RNA processing	intracellular	metal ion binding	g.chr12:72057278C>T	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.113G>A	12.37:g.72057278C>T	ENSP00000368017:p.Ser38Asn		OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1134	ZFC3H1_uc010sts.1_Missense_Mutation_p.S38N|ZFC3H1_uc001swp.2_Missense_Mutation_p.S38N|THAP2_uc001swq.2_5'Flank	p.S38N	NM_144982	NP_659419	O60293	ZC3H1_HUMAN			1	472	-			38			Ser-rich.		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	c.113G>A	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180752	0.38511	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.32023	1.47	4.79	4.79	0.61399	.	0.246842	0.32736	N	0.005710	T	0.31702	0.0805	N	0.08118	0	0.80722	D	1	D;D;D	0.64830	0.994;0.99;0.982	D;P;P	0.63033	0.91;0.719;0.528	T	0.17653	-1.0362	10	0.24483	T	0.36	.	16.1935	0.82006	0.0:1.0:0.0:0.0	.	38;38;38	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	N	38	ENSP00000368017:S38N	ENSP00000368017:S38N	S	-	2	0	ZFC3H1	70343545	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	5.103000	0.64578	2.497000	0.84241	0.557000	0.71058	AGT		0.657	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		60	106	0	0	0	0	60	106				
LHX5	64211	broad.mit.edu	37	12	113906037	113906037	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:113906037C>T	ENST00000261731.3	-	3	1143	c.570G>A	c.(568-570)aaG>aaA	p.K190K		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	190					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						TCTCCAGCTGCTTGGCCTTGA	0.672																																						uc001tvj.1		NA																	0					0						c.(568-570)AAG>AAA		LIM homeobox protein 5							90.0	78.0	82.0					12																	113906037		2203	4300	6503	SO:0001819	synonymous_variant	64211					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:113906037C>T	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.570G>A	12.37:g.113906037C>T							p.K190K	NM_022363	NP_071758	Q9H2C1	LHX5_HUMAN			3	1144	-			190			Homeobox.		Q32MA4	Silent	SNP	ENST00000261731.3	37	c.570G>A	CCDS9171.1																																																																																				0.672	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363		15	24	0	0	0	0	15	24				
FBXO21	23014	broad.mit.edu	37	12	117615346	117615346	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:117615346C>T	ENST00000330622.5	-	4	570	c.571G>A	c.(571-573)Gac>Aac	p.D191N	FBXO21_ENST00000427718.2_Missense_Mutation_p.D191N|FBXO21_ENST00000549689.1_5'UTR			O94952	FBX21_HUMAN	F-box protein 21	191					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		GACTCATAGTCATCTGGCTGC	0.378																																					GBM(168;452 2038 13535 17701 43680)	uc001twk.2		NA																	0				kidney(1)	1						c.(571-573)GAC>AAC		F-box only protein 21 isoform 1							124.0	118.0	120.0					12																	117615346		2203	4300	6503	SO:0001583	missense	23014				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr12:117615346C>T	AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.571G>A	12.37:g.117615346C>T	ENSP00000328187:p.Asp191Asn					FBXO21_uc001twj.2_Missense_Mutation_p.D191N|FBXO21_uc009zwq.2_Missense_Mutation_p.D191N	p.D191N	NM_033624	NP_296373	O94952	FBX21_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0291)	4	610	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		191					B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	ENST00000330622.5	37	c.571G>A	CCDS9184.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851125	0.71719	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622	T;T	0.43688	0.94;0.94	5.54	4.64	0.57946	F-box domain, Skp2-like (1);	0.108818	0.64402	D	0.000007	T	0.33818	0.0876	L	0.40543	1.245	0.48696	D	0.999692	B;B;B	0.22346	0.068;0.002;0.021	B;B;B	0.14023	0.01;0.003;0.005	T	0.14755	-1.0461	10	0.51188	T	0.08	-18.8333	12.092	0.53733	0.0:0.921:0.0:0.079	.	107;191;191	Q8IUQ5;O94952;O94952-1	.;FBX21_HUMAN;.	N	191;107;107;191	ENSP00000414468:D191N;ENSP00000328187:D191N	ENSP00000257563:D107N	D	-	1	0	FBXO21	116099729	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	4.763000	0.62257	2.610000	0.88304	0.563000	0.77884	GAC		0.378	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624		47	50	0	0	0	0	47	50				
KSR2	283455	broad.mit.edu	37	12	117968797	117968797	+	Missense_Mutation	SNP	G	G	A	rs374020752		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:117968797G>A	ENST00000339824.5	-	12	2478	c.1751C>T	c.(1750-1752)aCg>aTg	p.T584M	KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Missense_Mutation_p.T281M|KSR2_ENST00000425217.1_Missense_Mutation_p.T555M			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	584					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCGGGTCGGCGTCTCCGGCAC	0.562																																						uc001two.2		NA																	0				lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15						c.(1663-1665)ACG>ATG		kinase suppressor of ras 2		G	MET/THR	0,3842		0,0,1921	89.0	103.0	98.0		1664	5.1	1.0	12		98	1,8257		0,1,4128	no	missense	KSR2	NM_173598.4	81	0,1,6049	AA,AG,GG		0.0121,0.0,0.0083	benign	555/922	117968797	1,12099	1921	4129	6050	SO:0001583	missense	283455				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr12:117968797G>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1751C>T	12.37:g.117968797G>A	ENSP00000339952:p.Thr584Met						p.T555M	NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN			12	1719	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		584					A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37	c.1664C>T		.	.	.	.	.	.	.	.	.	.	G	12.88	2.070599	0.36566	0.0	1.21E-4	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;D	0.86297	-1.19;-1.19;-2.1	5.13	5.13	0.70059	.	0.662759	0.16095	N	0.229865	T	0.77651	0.4162	L	0.34521	1.04	0.37092	D	0.899471	P	0.43633	0.813	B	0.30572	0.117	T	0.81614	-0.0853	10	0.45353	T	0.12	.	12.3426	0.55103	0.0777:0.0:0.9223:0.0	.	584	Q6VAB6	KSR2_HUMAN	M	555;584;281;256	ENSP00000389715:T555M;ENSP00000339952:T584M;ENSP00000305466:T281M	ENSP00000305466:T281M	T	-	2	0	KSR2	116453180	1.000000	0.71417	0.991000	0.47740	0.671000	0.39405	6.062000	0.71155	2.540000	0.85666	0.650000	0.86243	ACG		0.562	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598		51	94	0	0	0	0	51	94				
HSPH1	10808	broad.mit.edu	37	13	31711647	31711647	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr13:31711647T>C	ENST00000320027.5	-	18	2729	c.2385A>G	c.(2383-2385)acA>acG	p.T795T	HSPH1_ENST00000445273.2_Silent_p.T797T|HSPH1_ENST00000429785.2_Silent_p.T614T|HSPH1_ENST00000380406.5_Silent_p.T754T|HSPH1_ENST00000380405.4_Silent_p.T751T	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	795					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		CGGGTTCACATGTGTTGTTCA	0.358																																						uc001utj.2		NA																	0					0						c.(2383-2385)ACA>ACG		heat shock 105kD							119.0	114.0	116.0					13																	31711647		2202	4300	6502	SO:0001819	synonymous_variant	10808				positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding	g.chr13:31711647T>C	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2385A>G	13.37:g.31711647T>C						HSPH1_uc001utk.2_Silent_p.T751T|HSPH1_uc010aaw.2_Silent_p.T754T|HSPH1_uc001utl.2_Silent_p.T797T|HSPH1_uc010tds.1_Silent_p.T719T	p.T795T	NM_006644	NP_006635	Q92598	HS105_HUMAN		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)	18	2783	-		Lung SC(185;0.0257)	795					B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Silent	SNP	ENST00000320027.5	37	c.2385A>G	CCDS9340.1																																																																																				0.358	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			23	22	0	0	0	0	23	22				
MLNR	2862	broad.mit.edu	37	13	49796405	49796405	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr13:49796405G>A	ENST00000218721.1	+	2	1131	c.1131G>A	c.(1129-1131)ccG>ccA	p.P377P	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	377					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		AGTCCAGGCCGAGAGGCTTCC	0.552																																						uc010tgj.1		NA																	0					0						c.(1129-1131)CCG>CCA		motilin receptor							67.0	67.0	67.0					13																	49796405		2203	4300	6503	SO:0001819	synonymous_variant	2862				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity	g.chr13:49796405G>A	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1131G>A	13.37:g.49796405G>A							p.P377P	NM_001507	NP_001498	O43193	MTLR_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)	2	1131	+		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	377			Cytoplasmic (Potential).			Silent	SNP	ENST00000218721.1	37	c.1131G>A	CCDS9414.1																																																																																				0.552	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507		29	15	0	0	0	0	29	15				
TEP1	7011	broad.mit.edu	37	14	20837659	20837659	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:20837659G>A	ENST00000262715.5	-	53	7540	c.7500C>T	c.(7498-7500)acC>acT	p.T2500T	TEP1_ENST00000556935.1_Silent_p.T2392T	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2500					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGTTACCTGTGGTCCATTCTC	0.488																																						uc001vxe.2		NA																	0				ovary(5)	5						c.(7498-7500)ACC>ACT		telomerase-associated protein 1							204.0	187.0	193.0					14																	20837659		2203	4300	6503	SO:0001819	synonymous_variant	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20837659G>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.7500C>T	14.37:g.20837659G>A						TEP1_uc010ahj.1_RNA|TEP1_uc010ahk.2_Silent_p.T1843T|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Silent_p.T2392T	p.T2500T	NM_007110	NP_009041	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	53	7540	-	all_cancers(95;0.00123)	all_lung(585;0.235)	2500			WD 19.		A0AUV9	Silent	SNP	ENST00000262715.5	37	c.7500C>T	CCDS9548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.49|10.49	1.365137|1.365137	0.24684|0.24684	.|.	.|.	ENSG00000129566|ENSG00000129566	ENST00000553984|ENST00000359243	.|.	.|.	.|.	5.82|5.82	1.91|1.91	0.25777|0.25777	.|.	.|.	.|.	.|.	.|.	T|T	0.25158|0.25158	0.0611|0.0611	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.22382|0.22382	-1.0218|-1.0218	4|5	.|0.28530	.|T	.|0.3	1.4833|1.4833	4.6018|4.6018	0.12357|0.12357	0.2537:0.1618:0.5845:0.0|0.2537:0.1618:0.5845:0.0	.|.	.|.	.|.	.|.	Y|L	157|2493	.|.	.|ENSP00000352180:P2493L	H|P	-|-	1|2	0|0	TEP1|TEP1	19907499|19907499	0.000000|0.000000	0.05858|0.05858	0.009000|0.009000	0.14445|0.14445	0.491000|0.491000	0.33493|0.33493	0.089000|0.089000	0.15002|0.15002	0.358000|0.358000	0.24211|0.24211	-0.469000|-0.469000	0.05056|0.05056	CAC|CCA		0.488	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		5	73	0	0	0	0	5	73				
AJUBA	84962	broad.mit.edu	37	14	23450641	23450641	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:23450641C>A	ENST00000262713.2	-	1	1210	c.835G>T	c.(835-837)Gag>Tag	p.E279*	RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|AJUBA_ENST00000361265.4_Nonsense_Mutation_p.E279*|RP11-298I3.4_ENST00000557615.1_RNA	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	279	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										GCTGTTAGCTCGTCCTGGTAC	0.711																																						uc001whz.2		NA																	0					0						c.(835-837)GAG>TAG		ajuba isoform 1							12.0	14.0	14.0					14																	23450641		2193	4280	6473	SO:0001587	stop_gained	84962				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding	g.chr14:23450641C>A	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.835G>T	14.37:g.23450641C>A	ENSP00000262713:p.Glu279*						p.E279*	NM_032876	NP_116265	Q96IF1	JUB_HUMAN		GBM - Glioblastoma multiforme(265;0.0122)	1	1211	-	all_cancers(95;4.6e-05)		279			PreLIM.		A8MX18|D3DS37	Nonsense_Mutation	SNP	ENST00000262713.2	37	c.835G>T	CCDS9581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.819930|5.819930	0.96989|0.96989	.|.	.|.	ENSG00000129474|ENSG00000129474	ENST00000262713;ENST00000361265|ENST00000553736	.|.	.|.	.|.	4.72|4.72	4.72|4.72	0.59763|0.59763	.|.	0.458973|.	0.20752|.	N|.	0.086335|.	.|T	.|0.62877	.|0.2464	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69684	.|-0.5079	.|3	0.20519|.	T|.	0.43|.	.|.	13.0287|13.0287	0.58829|0.58829	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	279|52	.|.	ENSP00000262713:E279X|.	E|R	-|-	1|2	0|0	JUB|JUB	22520481|22520481	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.804000|0.804000	0.45430|0.45430	4.056000|4.056000	0.57448|0.57448	2.434000|2.434000	0.82447|0.82447	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.711	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2			7	15	1	0	8.13e-05	8.86e-05	7	15				
PSMB5	5693	broad.mit.edu	37	14	23502633	23502633	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:23502633T>C	ENST00000361611.6	-	2	712	c.449A>G	c.(448-450)aAa>aGa	p.K150R	AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000493471.2_Missense_Mutation_p.K150R|PSMB5_ENST00000425762.2_Missense_Mutation_p.K47R|PSMB5_ENST00000460922.2_Intron	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	150					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CCCCATGCCTTTGTACTGATA	0.517																																						uc001wii.2		NA																	0				ovary(1)	1						c.(448-450)AAA>AGA		proteasome beta 5 subunit isoform 1	Bortezomib(DB00188)						140.0	122.0	128.0					14																	23502633		2203	4300	6503	SO:0001583	missense	5693				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus	protein binding|threonine-type endopeptidase activity	g.chr14:23502633T>C	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.449A>G	14.37:g.23502633T>C	ENSP00000355325:p.Lys150Arg					PSMB5_uc001wij.2_Missense_Mutation_p.K150R|PSMB5_uc010tni.1_Missense_Mutation_p.K47R	p.K150R	NM_002797	NP_002788	P28074	PSB5_HUMAN		GBM - Glioblastoma multiforme(265;0.0121)	2	713	-	all_cancers(95;3.3e-05)		150					B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	37	c.449A>G	CCDS9584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.883|8.883	0.952159|0.952159	0.18431|0.18431	.|.	.|.	ENSG00000100804|ENSG00000100804	ENST00000555895|ENST00000361611;ENST00000493471;ENST00000425762	T|T;T;T	0.35789|0.28454	1.29|1.61;1.61;1.61	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.17619|0.17619	0.0423|0.0423	N|N	0.12746|0.12746	0.255|0.255	0.54753|0.54753	D|D	0.999987|0.999987	.|P;B	.|0.47841	.|0.901;0.07	.|B;B	.|0.41813	.|0.367;0.055	T|T	0.04976|0.04976	-1.0914|-1.0914	7|10	.|0.12766	.|T	.|0.61	-4.9549|-4.9549	13.483|13.483	0.61348|0.61348	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|150;150	.|P28074-2;P28074	.|.;PSB5_HUMAN	E|R	99|150;150;47	ENSP00000451816:K99E|ENSP00000355325:K150R;ENSP00000452424:K150R;ENSP00000395206:K47R	.|ENSP00000334973:K150R	K|K	-|-	1|2	0|0	PSMB5|PSMB5	22572473|22572473	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.562000|4.562000	0.60816|0.60816	1.816000|1.816000	0.52996|0.52996	0.459000|0.459000	0.35465|0.35465	AAG|AAA		0.517	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797		33	69	0	0	0	0	33	69				
ACIN1	22985	broad.mit.edu	37	14	23535181	23535181	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:23535181C>T	ENST00000262710.1	-	10	2803	c.2476G>A	c.(2476-2478)Gtt>Att	p.V826I	ACIN1_ENST00000557515.1_Missense_Mutation_p.V68I|ACIN1_ENST00000357481.2_Missense_Mutation_p.V68I|ACIN1_ENST00000555053.1_Missense_Mutation_p.V826I|ACIN1_ENST00000397341.3_Missense_Mutation_p.V68I|ACIN1_ENST00000338631.6_Missense_Mutation_p.V99I|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000605057.1_Missense_Mutation_p.V768I|ACIN1_ENST00000457657.1_Missense_Mutation_p.V786I	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	826					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TTACAGACAACGGAGATCTTC	0.433																																						uc001wit.3		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(2476-2478)GTT>ATT		apoptotic chromatin condensation inducer 1							138.0	128.0	131.0					14																	23535181		2203	4300	6503	SO:0001583	missense	22985				apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding	g.chr14:23535181C>T	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2476G>A	14.37:g.23535181C>T	ENSP00000262710:p.Val826Ile					ACIN1_uc001wio.3_RNA|ACIN1_uc001wip.3_Missense_Mutation_p.V68I|ACIN1_uc001wiq.3_Missense_Mutation_p.V68I|ACIN1_uc001wir.3_Missense_Mutation_p.V99I|ACIN1_uc001wis.3_Missense_Mutation_p.V508I|ACIN1_uc010akg.2_Missense_Mutation_p.V826I	p.V826I	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN		GBM - Glioblastoma multiforme(265;0.00816)	10	2804	-	all_cancers(95;1.36e-05)		826					B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	c.2476G>A	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018065	0.54576	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053;ENST00000555566	T;T;T;T;T;T;T	0.15718	3.39;3.39;3.39;2.4;2.41;3.39;3.39	5.27	5.27	0.74061	.	0.214070	0.23660	N	0.045834	T	0.20007	0.0481	L	0.29908	0.895	0.43545	D	0.99584	P;P;P;P;P	0.45957	0.843;0.869;0.869;0.632;0.632	P;B;B;B;B	0.46885	0.53;0.405;0.405;0.147;0.072	T	0.00704	-1.1602	10	0.38643	T	0.18	-6.681	17.8218	0.88652	0.0:1.0:0.0:0.0	.	826;826;786;99;68	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	I	68;99;68;826;786;68;826;68	ENSP00000451138:V68I;ENSP00000345541:V99I;ENSP00000350073:V68I;ENSP00000262710:V826I;ENSP00000405677:V786I;ENSP00000380502:V68I;ENSP00000451328:V826I	ENSP00000262710:V826I	V	-	1	0	ACIN1	22605021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.194000	0.51005	2.749000	0.94314	0.655000	0.94253	GTT		0.433	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977		15	39	0	0	0	0	15	39				
HECTD1	25831	broad.mit.edu	37	14	31626071	31626071	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:31626071T>G	ENST00000399332.1	-	12	2395	c.1907A>C	c.(1906-1908)aAt>aCt	p.N636T	HECTD1_ENST00000553700.1_Missense_Mutation_p.N636T	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	636					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTCCTCTTCATTCTCATCATC	0.343																																						uc001wrc.1		NA																	0				ovary(3)|large_intestine(1)|lung(1)	5						c.(1906-1908)AAT>ACT		HECT domain containing 1							99.0	87.0	91.0					14																	31626071		1856	4105	5961	SO:0001583	missense	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31626071T>G	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1907A>C	14.37:g.31626071T>G	ENSP00000382269:p.Asn636Thr					HECTD1_uc001wrd.1_Missense_Mutation_p.N151T	p.N636T	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	12	2396	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		636					D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	c.1907A>C	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306168	0.60305	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957;ENST00000556224	T;T;T;T	0.64085	-0.08;-0.08;1.53;-0.08	5.62	5.62	0.85841	Armadillo-type fold (1);	0.040422	0.85682	D	0.000000	T	0.67468	0.2896	L	0.29908	0.895	0.80722	D	1	B;D	0.57899	0.018;0.981	B;D	0.65140	0.013;0.932	T	0.64453	-0.6404	10	0.27785	T	0.31	-24.7824	16.1172	0.81314	0.0:0.0:0.0:1.0	.	636;636	D3DS86;Q9ULT8	.;HECD1_HUMAN	T	636;636;636;110;636	ENSP00000450697:N636T;ENSP00000382269:N636T;ENSP00000451860:N110T;ENSP00000452015:N636T	ENSP00000261312:N636T	N	-	2	0	HECTD1	30695822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.139000	0.71728	2.266000	0.75297	0.533000	0.62120	AAT		0.343	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			25	36	0	0	0	0	25	36				
DNAAF2	55172	broad.mit.edu	37	14	50100984	50100985	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:50100984_50100985GC>TT	ENST00000298292.8	-	1	963_964	c.883_884GC>AA	c.(883-885)GCc>AAc	p.A295N	DNAAF2_ENST00000406043.3_Missense_Mutation_p.A295N	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	295					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CGCCTGCTCGGCCGAGCGCAAC	0.653																																						uc001wws.3		NA																	0					0						c.(883-885)GCC>AAC		kintoun isoform 1																																				SO:0001583	missense	55172	Kartagener_syndrome			axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm		g.chr14:50100984_50100985GC>TT	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.883_884delinsTT	14.37:g.50100984_50100985delinsTT	ENSP00000298292:p.Ala295Asn					SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.A295N	p.A295N	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN			1	964_965	-	all_epithelial(31;0.0021)|Breast(41;0.0124)		295					B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	DNP	ENST00000298292.8	37	c.883_884GC>AA	CCDS9691.2																																																																																				0.653	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1			10	26	0	0	0	0	10	26				
SLC35F4	341880	broad.mit.edu	37	14	58036671	58036671	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:58036671C>A	ENST00000339762.6	-	6	1068	c.1069G>T	c.(1069-1071)Gcc>Tcc	p.A357S	SLC35F4_ENST00000556826.1_Missense_Mutation_p.A321S|SLC35F4_ENST00000554729.1_Missense_Mutation_p.A198S			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	357					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCAAAGTTGGCACTTCCAAGA	0.428																																						uc001xdb.1		NA																	0				ovary(2)	2						c.(1069-1071)GCC>TCC		solute carrier family 35, member F4							51.0	56.0	54.0					14																	58036671		1907	4121	6028	SO:0001583	missense	341880							g.chr14:58036671C>A			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.1069G>T	14.37:g.58036671C>A	ENSP00000342518:p.Ala357Ser					SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_Missense_Mutation_p.A198S	p.A357S	NM_001080455	NP_001073924					6	1069	-								A6NDQ3	Missense_Mutation	SNP	ENST00000339762.6	37	c.1069G>T		.	.	.	.	.	.	.	.	.	.	C	36	5.675061	0.96764	.	.	ENSG00000151812	ENST00000556826;ENST00000339762;ENST00000554729	T;T;T	0.32272	1.46;1.46;1.46	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.53786	0.1818	M	0.67700	2.07	0.80722	D	1	D	0.58620	0.983	D	0.63033	0.91	T	0.31586	-0.9938	10	0.30078	T	0.28	-15.4294	20.5211	0.99222	0.0:1.0:0.0:0.0	.	357	A4IF30	S35F4_HUMAN	S	321;357;198	ENSP00000452086:A321S;ENSP00000342518:A357S;ENSP00000451990:A198S	ENSP00000342518:A357S	A	-	1	0	SLC35F4	57106424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.032000	0.70918	2.861000	0.98227	0.650000	0.86243	GCC		0.428	SLC35F4-201	KNOWN	basic	protein_coding	protein_coding		XM_292260		9	12	1	0	0.00829132	0.00864726	9	12				
SIX4	51804	broad.mit.edu	37	14	61180764	61180764	+	Silent	SNP	C	C	T	rs564205527	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:61180764C>T	ENST00000216513.4	-	3	1766	c.1707G>A	c.(1705-1707)caG>caA	p.Q569Q		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	569					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CCAAGCCTTCCTGTTTCACAG	0.468													C|||	2	0.000399361	0.0	0.0	5008	,	,		20627	0.0		0.0	False		,,,				2504	0.002					uc001xfc.2		NA																	0				breast(3)|ovary(1)	4						c.(1705-1707)CAG>CAA		sine oculis homeobox homolog 4							50.0	49.0	49.0					14																	61180764		2203	4300	6503	SO:0001819	synonymous_variant	51804					nucleus		g.chr14:61180764C>T	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1707G>A	14.37:g.61180764C>T							p.Q569Q	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0275)	3	1707	-			569					Q4QQH5|Q4V764	Silent	SNP	ENST00000216513.4	37	c.1707G>A	CCDS9749.2																																																																																				0.468	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2			13	19	0	0	0	0	13	19				
EXD2	55218	broad.mit.edu	37	14	69704290	69704290	+	Splice_Site	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:69704290A>G	ENST00000409018.3	+	8	1420		c.e8-1		EXD2_ENST00000449989.1_Splice_Site|EXD2_ENST00000409242.1_Splice_Site|EXD2_ENST00000312994.5_Splice_Site|EXD2_ENST00000492815.1_Splice_Site|EXD2_ENST00000409949.1_Splice_Site|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409014.1_Splice_Site|EXD2_ENST00000409675.1_Splice_Site	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2								3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						GGCTTGTTCCAGGAAGAACGT	0.552																																						uc001xkt.2		NA																	0					0						c.e10-2		exonuclease 3'-5' domain containing 2							71.0	68.0	69.0					14																	69704290		2203	4300	6503	SO:0001630	splice_region_variant	55218				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding	g.chr14:69704290A>G	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1293-1A>G	14.37:g.69704290A>G						EXD2_uc001xku.2_Splice_Site_p.R176_splice|EXD2_uc001xkv.2_Splice_Site_p.R431_splice|EXD2_uc001xkw.2_Splice_Site_p.R306_splice|EXD2_uc010aqt.2_Splice_Site_p.R431_splice|EXD2_uc010tte.1_Splice_Site_p.R431_splice|EXD2_uc001xky.2_Splice_Site_p.R306_splice	p.R306_splice	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN			10	1577	+								B4DIH6|G5E947|Q6AWB6|Q8N3D3	Splice_Site	SNP	ENST00000409018.3	37	c.918_splice	CCDS53902.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908644	0.52439	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3161	0.74078	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EXD2	68774043	1.000000	0.71417	0.946000	0.38457	0.405000	0.30901	7.233000	0.78125	2.197000	0.70478	0.455000	0.32223	.		0.552	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1		Intron	14	23	0	0	0	0	14	23				
SEL1L	6400	broad.mit.edu	37	14	81965994	81965995	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr14:81965994_81965995GA>TT	ENST00000336735.4	-	7	905_906	c.789_790TC>AA	c.(787-792)ttTCtg>ttAAtg	p.263_264FL>LM	SEL1L_ENST00000555824.1_Missense_Mutation_p.263_264FL>LM	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	263	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		GAGGCATACAGAAAGCCAAGAG	0.337																																						uc010tvv.1		NA																	0				ovary(1)	1						c.(787-792)TTTCTG>TTAATG		sel-1 suppressor of lin-12-like precursor																																				SO:0001583	missense	6400				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr14:81965994_81965995GA>TT		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.789_790delinsTT	14.37:g.81965994_81965995delinsTT	ENSP00000337053:p.F263_L264delinsLM					SEL1L_uc001xvo.3_Missense_Mutation_p.263_264FL>LM	p.263_264FL>LM	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0299)	7	906_907	-			263_264			Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.|Sel1-like 3.		Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	DNP	ENST00000336735.4	37	c.789_790TC>AA	CCDS9876.1																																																																																				0.337	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065		8	34	0	0	0	0	8	34				
NPAP1	23742	broad.mit.edu	37	15	24921325	24921325	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:24921325A>C	ENST00000329468.2	+	1	785	c.311A>C	c.(310-312)aAc>aCc	p.N104T		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	104					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CCTGCTCGGAACCCCCCGAGG	0.682																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(310-312)AAC>ACC		hypothetical protein LOC23742							40.0	32.0	35.0					15																	24921325		2198	4294	6492	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921325A>C	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.311A>C	15.37:g.24921325A>C	ENSP00000333735:p.Asn104Thr						p.N104T	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	785	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	104						Missense_Mutation	SNP	ENST00000329468.2	37	c.311A>C	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	11.72	1.722156	0.30503	.	.	ENSG00000185823	ENST00000329468	T	0.26518	1.73	2.15	-1.91	0.07641	.	0.440966	0.16851	N	0.196908	T	0.27524	0.0676	L	0.34521	1.04	0.09310	N	1	D	0.62365	0.991	D	0.69479	0.964	T	0.12243	-1.0555	10	0.39692	T	0.17	.	2.8918	0.05678	0.4018:0.2584:0.3399:0.0	.	104	Q9NZP6	CO002_HUMAN	T	104	ENSP00000333735:N104T	ENSP00000333735:N104T	N	+	2	0	C15orf2	22472418	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.245000	0.18142	-0.459000	0.07013	-0.636000	0.03981	AAC		0.682	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		4	49	0	0	0	0	4	49				
HERC2	8924	broad.mit.edu	37	15	28389228	28389228	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:28389228G>A	ENST00000261609.7	-	73	11402	c.11294C>T	c.(11293-11295)gCc>gTc	p.A3765V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTACCTAGGGCACTCAGCTG	0.507																																						uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(11293-11295)GCC>GTC		hect domain and RLD 2							98.0	91.0	94.0					15																	28389228		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28389228G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11294C>T	15.37:g.28389228G>A	ENSP00000261609:p.Ala3765Val						p.A3765V	NM_004667	NP_004658	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	73	11400	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3765						Missense_Mutation	SNP	ENST00000261609.7	37	c.11294C>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163702	0.78226	.	.	ENSG00000128731	ENST00000261609	T	0.38401	1.14	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	N	0.24115	0.695	0.80722	D	1	B	0.22683	0.073	B	0.20767	0.031	T	0.04347	-1.0958	10	0.46703	T	0.11	.	19.961	0.97250	0.0:0.0:1.0:0.0	.	3765	O95714	HERC2_HUMAN	V	3765	ENSP00000261609:A3765V	ENSP00000261609:A3765V	A	-	2	0	HERC2	26062823	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	9.420000	0.97426	2.783000	0.95769	0.655000	0.94253	GCC		0.507	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		30	64	0	0	0	0	30	64				
TTBK2	146057	broad.mit.edu	37	15	43102902	43102902	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:43102902G>A	ENST00000267890.6	-	9	840	c.732C>T	c.(730-732)caC>caT	p.H244H	TTBK2_ENST00000567840.1_Silent_p.H244H|TTBK2_ENST00000567274.1_Silent_p.H209H	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		ACATGAGCCTGTGGTCATATC	0.413																																						uc001zqo.2		NA																	0				ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7						c.(730-732)CAC>CAT		tau tubulin kinase 2							116.0	108.0	111.0					15																	43102902		1855	4101	5956	SO:0001819	synonymous_variant	146057				cell death		ATP binding|protein serine/threonine kinase activity	g.chr15:43102902G>A	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.732C>T	15.37:g.43102902G>A						TTBK2_uc010bcy.2_Silent_p.H175H|TTBK2_uc001zqp.2_Silent_p.H244H|TTBK2_uc010bcz.1_Silent_p.H209H	p.H244H	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN		GBM - Glioblastoma multiforme(94;3.23e-07)	9	1171	-		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)	244			Protein kinase.		O94932|Q6ZN52|Q8IVV1	Silent	SNP	ENST00000267890.6	37	c.732C>T	CCDS42029.1																																																																																				0.413	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500		31	52	0	0	0	0	31	52				
SLC30A4	7782	broad.mit.edu	37	15	45814465	45814465	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:45814465C>G	ENST00000261867.4	-	2	402	c.88G>C	c.(88-90)Gac>Cac	p.D30H	SLC30A4_ENST00000559667.1_5'Flank|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	30	Asp-rich (acidic).			D -> E (in Ref. 1; AAB82561). {ECO:0000305}.	regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		TCCGAGAAGTCAAAGGCGCTG	0.572																																						uc001zvj.2		NA																	0					0						c.(88-90)GAC>CAC		solute carrier family 30 (zinc transporter),							38.0	45.0	43.0					15																	45814465		2198	4298	6496	SO:0001583	missense	7782				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity	g.chr15:45814465C>G		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.88G>C	15.37:g.45814465C>G	ENSP00000261867:p.Asp30His					C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	p.D30H	NM_013309	NP_037441	O14863	ZNT4_HUMAN		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)	2	400	-		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	30	D -> E (in Ref. 1; AAB82561).		Cytoplasmic (Potential).|Asp-rich (acidic).		Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	c.88G>C	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434801	0.83885	.	.	ENSG00000104154	ENST00000261867	T	0.72394	-0.65	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.77212	0.4097	L	0.34521	1.04	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.80643	-0.1291	10	0.87932	D	0	-11.1817	15.6957	0.77494	0.0:1.0:0.0:0.0	.	30	O14863	ZNT4_HUMAN	H	30	ENSP00000261867:D30H	ENSP00000261867:D30H	D	-	1	0	SLC30A4	43601757	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.316000	0.72857	2.021000	0.59480	0.591000	0.81541	GAC		0.572	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1			23	33	0	0	0	0	23	33				
ADPGK	83440	broad.mit.edu	37	15	73044806	73044806	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:73044806C>G	ENST00000311669.8	-	7	1460	c.1367G>C	c.(1366-1368)aGa>aCa	p.R456T	ADPGK_ENST00000456471.2_Missense_Mutation_p.R182T	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	457	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						TATTCCCTCTCTGTGCCATTC	0.493																																						uc002avg.3		NA																	0					0						c.(1369-1371)AGA>ACA		ADP-dependent glucokinase							104.0	104.0	104.0					15																	73044806		1907	4115	6022	SO:0001583	missense	83440				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding	g.chr15:73044806C>G	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1367G>C	15.37:g.73044806C>G	ENSP00000312250:p.Arg456Thr					ADPGK_uc002ave.3_Missense_Mutation_p.R182T|ADPGK_uc010ukw.1_Missense_Mutation_p.R399T|ADPGK_uc002avf.3_Missense_Mutation_p.R456T|ADPGK_uc002avi.3_Missense_Mutation_p.R334T|ADPGK_uc002avh.3_Missense_Mutation_p.R218T	p.R457T	NM_031284	NP_112574	Q9BRR6	ADPGK_HUMAN			7	1464	-			457			ADPK.		Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Missense_Mutation	SNP	ENST00000311669.8	37	c.1370G>C	CCDS42057.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.8|28.8	4.951926|4.951926	0.92660|0.92660	.|.	.|.	ENSG00000159322|ENSG00000159322	ENST00000331065|ENST00000311669;ENST00000443764;ENST00000456471	.|T;T	.|0.44083	.|0.93;0.93	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66015|0.66015	0.2747|0.2747	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.991	.|D;D;D;P	.|0.74023	.|0.971;0.98;0.982;0.846	T|T	0.58267|0.58267	-0.7666|-0.7666	6|10	0.36615|0.27785	T|T	0.2|0.31	-23.7104|-23.7104	20.5407|20.5407	0.99260|0.99260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|399;457;456;182	.|B4DG35;Q9BRR6;Q9BRR6-2;Q9BRR6-4	.|.;ADPGK_HUMAN;.;.	H|T	333|456;376;182	.|ENSP00000312250:R456T;ENSP00000397694:R182T	ENSP00000332964:Q333H|ENSP00000312250:R456T	Q|R	-|-	3|2	2|0	ADPGK|ADPGK	70831859|70831859	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	7.695000|7.695000	0.84257|0.84257	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	CAG|AGA		0.493	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420434.1	NM_031284		41	116	0	0	0	0	41	116				
SNX33	257364	broad.mit.edu	37	15	75942185	75942185	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:75942185A>G	ENST00000308527.5	+	1	1939	c.742A>G	c.(742-744)Agc>Ggc	p.S248G	IMP3_ENST00000565349.1_5'Flank|IMP3_ENST00000314852.2_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	248	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						GGGCATCAAAAGCTACATCTC	0.547																																						uc002bau.2		NA																	0				ovary(1)	1						c.(742-744)AGC>GGC		sorting nexin 33							148.0	128.0	134.0					15																	75942185		2197	4294	6491	SO:0001583	missense	257364				cell communication		phosphatidylinositol binding|protein binding	g.chr15:75942185A>G	AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.742A>G	15.37:g.75942185A>G	ENSP00000311427:p.Ser248Gly					IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_5'UTR	p.S248G	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN			1	838	+			248			PX.		B1NM17	Missense_Mutation	SNP	ENST00000308527.5	37	c.742A>G	CCDS10283.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.087785	0.36855	.	.	ENSG00000173548	ENST00000308527	T	0.31769	1.48	5.42	5.42	0.78866	Phox homologous domain (5);	0.045854	0.85682	D	0.000000	T	0.51686	0.1689	M	0.73598	2.24	0.58432	D	0.999997	P	0.45902	0.868	P	0.56865	0.808	T	0.55909	-0.8066	10	0.87932	D	0	-21.0536	14.288	0.66258	1.0:0.0:0.0:0.0	.	248	Q8WV41	SNX33_HUMAN	G	248	ENSP00000311427:S248G	ENSP00000311427:S248G	S	+	1	0	SNX33	73729240	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	2.056000	0.61249	0.459000	0.35465	AGC		0.547	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286471.1	NM_153271		12	212	0	0	0	0	12	212				
CHRNB4	1143	broad.mit.edu	37	15	78923490	78923490	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:78923490C>T	ENST00000261751.3	-	4	398	c.287G>A	c.(286-288)cGc>cAc	p.R96H	RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000560511.1_5'UTR|CHRNB4_ENST00000412074.2_Missense_Mutation_p.R96H	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	96					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	ACCCTCGTAGCGGGAGCTGTT	0.577																																						uc002bed.1		NA																	0					0						c.(286-288)CGC>CAC		cholinergic receptor, nicotinic, beta 4							126.0	101.0	109.0					15																	78923490		2196	4293	6489	SO:0001583	missense	1143				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr15:78923490C>T	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.287G>A	15.37:g.78923490C>T	ENSP00000261751:p.Arg96His					CHRNB4_uc002bee.1_Missense_Mutation_p.R96H|CHRNB4_uc010blh.1_5'UTR	p.R96H	NM_000750	NP_000741	P30926	ACHB4_HUMAN			4	399	-			96			Extracellular (Potential).		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	37	c.287G>A	CCDS10306.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971500	0.53614	.	.	ENSG00000117971	ENST00000261751;ENST00000412074	T;T	0.79033	-1.23;-1.23	5.12	1.82	0.25136	Neurotransmitter-gated ion-channel ligand-binding (3);	0.588367	0.17709	N	0.164646	T	0.58750	0.2144	N	0.16602	0.42	0.22648	N	0.998899	B;B	0.25312	0.123;0.003	B;B	0.24541	0.054;0.009	T	0.53287	-0.8460	10	0.87932	D	0	.	5.3568	0.16065	0.0:0.3932:0.0:0.6068	.	96;96	E9PHE8;P30926	.;ACHB4_HUMAN	H	96	ENSP00000261751:R96H;ENSP00000416386:R96H	ENSP00000261751:R96H	R	-	2	0	CHRNB4	76710545	0.997000	0.39634	0.998000	0.56505	0.778000	0.44026	1.759000	0.38420	0.589000	0.29677	-0.142000	0.14014	CGC		0.577	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1			27	72	0	0	0	0	27	72				
UNC45A	55898	broad.mit.edu	37	15	91479661	91479661	+	Missense_Mutation	SNP	C	C	T	rs549730654		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:91479661C>T	ENST00000418476.2	+	4	437	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	UNC45A_ENST00000394275.2_Missense_Mutation_p.R118W|UNC45A_ENST00000553671.2_3'UTR|AC068831.3_ENST00000448987.1_RNA|AC068831.3_ENST00000438890.1_RNA	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	133					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R133W(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GGAGGCCTTGCGGAACATCGG	0.582																																						uc002bqg.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(2)	2						c.(397-399)CGG>TGG		smooth muscle cell associated protein-1 isoform							58.0	58.0	58.0					15																	91479661		2198	4298	6496	SO:0001583	missense	55898				cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding	g.chr15:91479661C>T		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.397C>T	15.37:g.91479661C>T	ENSP00000407487:p.Arg133Trp					UNC45A_uc002bqd.2_Missense_Mutation_p.R118W|UNC45A_uc010uqo.1_Missense_Mutation_p.R125W|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.R133W	p.R133W	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	Lung(145;0.189)		4	737	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		133					A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	c.397C>T	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762216	0.69763	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.74106	-0.81;-0.81	5.3	2.27	0.28462	Armadillo-like helical (1);	0.058426	0.64402	N	0.000003	D	0.82277	0.5002	M	0.71581	2.175	0.53688	D	0.999979	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.79997	-0.1567	10	0.72032	D	0.01	-17.738	8.0875	0.30782	0.4417:0.4862:0.0:0.0721	.	133;125;133;118	B4DZL0;B4DLE6;Q9H3U1;A8K6F7	.;.;UN45A_HUMAN;.	W	118;133	ENSP00000377816:R118W;ENSP00000407487:R133W	ENSP00000377816:R118W	R	+	1	2	UNC45A	89280665	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	0.915000	0.28638	0.190000	0.20209	-0.350000	0.07774	CGG		0.582	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671		31	36	0	0	0	0	31	36				
KIAA0556	23247	broad.mit.edu	37	16	27765493	27765493	+	Splice_Site	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr16:27765493G>A	ENST00000261588.4	+	18	3571		c.e18-1			NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556							extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CCCATGTGCAGATCCCGGAGC	0.562																																						uc002dow.2		NA																	0				ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.e18-1		hypothetical protein LOC23247							131.0	116.0	121.0					16																	27765493		2197	4300	6497	SO:0001630	splice_region_variant	23247							g.chr16:27765493G>A	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3553-1G>A	16.37:g.27765493G>A							p.I1185_splice	NM_015202	NP_056017	O60303	K0556_HUMAN			18	3577	+								A7E2C2	Splice_Site	SNP	ENST00000261588.4	37	c.3553_splice	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147917	0.37923	.	.	ENSG00000047578	ENST00000261588	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7803	0.34787	0.1011:0.0:0.8989:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0556	27672994	0.902000	0.30710	0.760000	0.31359	0.049000	0.14656	3.868000	0.56055	2.510000	0.84645	0.650000	0.86243	.		0.562	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	Intron	31	30	0	0	0	0	31	30				
CES2	8824	broad.mit.edu	37	16	66975087	66975087	+	Missense_Mutation	SNP	C	C	T	rs201566497		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr16:66975087C>T	ENST00000317091.4	+	6	2053	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	RP11-361L15.4_ENST00000566869.1_RNA|CES2_ENST00000417689.1_Missense_Mutation_p.R357W	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	293					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	GGGCTGCCTGCGGGGCAAGAG	0.572																																					Ovarian(70;1230 1691 37888 38351)	uc002eqr.2		NA																	0					0						c.(1069-1071)CGG>TGG		carboxylesterase 2 isoform 1							69.0	70.0	70.0					16																	66975087		2200	4300	6500	SO:0001583	missense	8824				catabolic process	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity	g.chr16:66975087C>T	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.1069C>T	16.37:g.66975087C>T	ENSP00000317842:p.Arg357Trp					CES2_uc002eqq.2_Missense_Mutation_p.R357W|CES2_uc002eqs.2_Missense_Mutation_p.R200W	p.R357W	NM_003869	NP_003860	O00748	EST2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	6	2069	+		Ovarian(137;0.0563)	293					A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Missense_Mutation	SNP	ENST00000317091.4	37	c.1069C>T	CCDS10825.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095334	0.36952	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	T;T	0.66815	-0.23;-0.23	5.4	2.11	0.27256	Carboxylesterase, type B (1);	0.255046	0.28135	N	0.016466	D	0.85881	0.5800	H	0.96805	3.885	0.32989	D	0.524632	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.89597	0.3832	10	0.87932	D	0	.	11.0218	0.47722	0.5447:0.4553:0.0:0.0	.	293;357	O00748;A8K367	EST2_HUMAN;.	W	357	ENSP00000394452:R357W;ENSP00000317842:R357W	ENSP00000317842:R357W	R	+	1	2	CES2	65532588	0.002000	0.14202	0.984000	0.44739	0.990000	0.78478	-0.328000	0.07945	0.779000	0.33543	0.655000	0.94253	CGG		0.572	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268838.2	NM_003869		3	43	0	0	0	0	3	43				
E2F4	1874	broad.mit.edu	37	16	67234109	67234109	+	IGR	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr16:67234109G>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000571638.1_3'UTR|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000393997.2_Silent_p.E139E|ELMO3_ENST00000360833.1_Silent_p.E122E|ELMO3_ENST00000477898.1_5'UTR	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TTGAGGCTGAGCAGCTCTTGG	0.642																																						uc002esa.2		NA																	0					0						c.(415-417)GAG>GAA		engulfment and cell motility 3							30.0	33.0	32.0					16																	67234109		2017	4160	6177	SO:0001628	intergenic_variant	79767				apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding	g.chr16:67234109G>A	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67234109G>A						ELMO3_uc002esb.2_Silent_p.E122E|ELMO3_uc002esc.2_5'UTR	p.E139E	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)	5	460	+		Ovarian(137;0.0563)	86					A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	37	c.417G>A	CCDS32464.1																																																																																				0.642	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950		7	7	0	0	0	0	7	7				
MNT	4335	broad.mit.edu	37	17	2290453	2290453	+	Silent	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:2290453G>C	ENST00000174618.4	-	6	1896	c.1491C>G	c.(1489-1491)acC>acG	p.T497T	MNT_ENST00000575374.1_5'Flank|RP1-59D14.1_ENST00000571775.1_RNA	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	497					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		CATGGTTGAGGGTGGCAGGGT	0.682																																						uc002fur.2		NA																	0				skin(1)	1						c.(1489-1491)ACC>ACG		MAX binding protein							31.0	30.0	31.0					17																	2290453		2201	4296	6497	SO:0001819	synonymous_variant	4335				multicellular organismal development|negative regulation of cell proliferation|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr17:2290453G>C	Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.1491C>G	17.37:g.2290453G>C							p.T497T	NM_020310	NP_064706	Q99583	MNT_HUMAN		Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)	6	1743	-			497					A8K6D1|D3DTI7|Q1ED38	Silent	SNP	ENST00000174618.4	37	c.1491C>G	CCDS11018.1																																																																																				0.682	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207158.1	NM_020310		7	5	0	0	0	0	7	5				
ANKFY1	51479	broad.mit.edu	37	17	4098291	4098291	+	Missense_Mutation	SNP	C	C	T	rs147745463		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:4098291C>T	ENST00000341657.4	-	10	1389	c.1354G>A	c.(1354-1356)Gca>Aca	p.A452T	ANKFY1_ENST00000433651.1_Missense_Mutation_p.A452T|ANKFY1_ENST00000574367.1_Missense_Mutation_p.A452T|Y_RNA_ENST00000384660.1_RNA|ANKFY1_ENST00000570535.1_Missense_Mutation_p.A494T	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	452					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTGTCAGGTGCGTCTGTGTGG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		16200	0.0		0.001	False		,,,				2504	0.0					uc002fxq.1		NA																	0				ovary(2)|skin(1)	3						c.(1354-1356)GCA>ACA		ankyrin repeat and FYVE domain containing 1							41.0	44.0	43.0					17																	4098291		2097	4233	6330	SO:0001583	missense	51479					endosome membrane	metal ion binding|protein binding	g.chr17:4098291C>T	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1354G>A	17.37:g.4098291C>T	ENSP00000343362:p.Ala452Thr					ANKFY1_uc002fxn.2_Missense_Mutation_p.A494T|ANKFY1_uc002fxo.2_Missense_Mutation_p.A452T|ANKFY1_uc002fxp.2_Missense_Mutation_p.A451T|ANKFY1_uc010ckp.2_Missense_Mutation_p.A393T|ANKFY1_uc002fxr.2_Missense_Mutation_p.A452T	p.A452T	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN			10	1392	-			452					A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37	c.1354G>A		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	36	5.779205	0.96929	.	.	ENSG00000185722	ENST00000341657;ENST00000535427;ENST00000433651	T;T	0.55760	0.5;0.54	5.46	5.46	0.80206	Ankyrin repeat-containing domain (4);	0.118100	0.56097	D	0.000021	T	0.66277	0.2773	L	0.52573	1.65	0.80722	D	1	D;D;D;P;D	0.89917	1.0;1.0;0.965;0.956;0.99	D;D;P;P;P	0.91635	0.996;0.999;0.495;0.524;0.784	T	0.58267	-0.7666	10	0.14656	T	0.56	-4.5083	18.2892	0.90123	0.0:1.0:0.0:0.0	.	393;452;452;452;494	F5H754;Q9P2R3-3;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;.;ANFY1_HUMAN;.;.	T	452;393;452	ENSP00000343362:A452T;ENSP00000416005:A452T	ENSP00000343362:A452T	A	-	1	0	ANKFY1	4045040	1.000000	0.71417	0.435000	0.26784	0.279000	0.26890	7.724000	0.84798	2.582000	0.87167	0.655000	0.94253	GCA		0.572	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376		14	31	0	0	0	0	14	31				
TP53	7157	broad.mit.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.R249_T256delRPILTIIT(1)|p.R249_P250>SS(1)|p.P250fs*14(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(745-747)AGG>AGT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577534C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	17.37:g.7577534C>A	ENSP00000269305:p.Arg249Ser	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R249S|TP53_uc002gih.2_Missense_Mutation_p.R249S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117S|TP53_uc010cng.1_Missense_Mutation_p.R117S|TP53_uc002gii.1_Missense_Mutation_p.R117S|TP53_uc010cnh.1_Missense_Mutation_p.R249S|TP53_uc010cni.1_Missense_Mutation_p.R249S|TP53_uc002gij.2_Missense_Mutation_p.R249S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156S|TP53_uc002gio.2_Missense_Mutation_p.R117S	p.R249S	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	941	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	249		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.747G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		38	19	1	0	7.63e-17	9.22e-17	38	19				
MYH10	4628	broad.mit.edu	37	17	8383589	8383589	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:8383589C>A	ENST00000269243.4	-	38	5481	c.5343G>T	c.(5341-5343)caG>caT	p.Q1781H	NDEL1_ENST00000299734.7_Intron|MYH10_ENST00000379980.4_Missense_Mutation_p.Q1797H|MYH10_ENST00000360416.3_Missense_Mutation_p.Q1812H|MYH10_ENST00000396239.1_Missense_Mutation_p.Q1802H	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1781					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TGTCACTCTTCTGGGCGGCGC	0.592																																						uc002gll.2		NA																	0				ovary(2)	2						c.(5341-5343)CAG>CAT		myosin, heavy polypeptide 10, non-muscle							102.0	85.0	91.0					17																	8383589		2203	4300	6503	SO:0001583	missense	4628				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:8383589C>A	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5343G>T	17.37:g.8383589C>A	ENSP00000269243:p.Gln1781His					MYH10_uc002glm.2_Missense_Mutation_p.Q1812H|MYH10_uc010cnx.2_Missense_Mutation_p.Q1790H	p.Q1781H	NM_005964	NP_005955	P35580	MYH10_HUMAN			38	5439	-			1781			Potential.		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	c.5343G>T	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.938836	0.92526	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.79454	-1.26;-1.27;-1.27;-1.27	5.1	5.1	0.69264	Myosin tail (1);	0.252666	0.41500	D	0.000868	D	0.88317	0.6404	M	0.80616	2.505	0.80722	D	1	P;P;P	0.52577	0.954;0.944;0.954	D;P;D	0.63793	0.918;0.866;0.918	D	0.89290	0.3618	10	0.87932	D	0	.	19.0596	0.93081	0.0:1.0:0.0:0.0	.	1790;1812;1781	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	H	1781;1812;1802;1797	ENSP00000269243:Q1781H;ENSP00000353590:Q1812H;ENSP00000379539:Q1802H;ENSP00000369315:Q1797H	ENSP00000269243:Q1781H	Q	-	3	2	MYH10	8324314	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.541000	0.45735	2.818000	0.97014	0.655000	0.94253	CAG		0.592	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2			33	71	1	0	1.57e-24	1.93e-24	33	71				
FLCN	201163	broad.mit.edu	37	17	17120410	17120410	+	Silent	SNP	G	G	A	rs150752548	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:17120410G>A	ENST00000285071.4	-	10	1603	c.1149C>T	c.(1147-1149)ctC>ctT	p.L383L	RP11-45M22.4_ENST00000427497.3_Missense_Mutation_p.R91C	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	383					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTGACTGGACGAGGTCCACGT	0.567									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																													uc002gra.3		NA																	0				thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						c.(1147-1149)CTC>CTT		folliculin isoform 1		G		0,4406		0,0,2203	116.0	93.0	101.0		1149	-10.9	0.4	17	dbSNP_134	101	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	FLCN	NM_144997.5		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		383/580	17120410	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	201163	Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding	g.chr17:17120410G>A	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.1149C>T	17.37:g.17120410G>A						PLD6_uc010cpn.2_RNA	p.L383L	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN			10	1653	-			383					A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Silent	SNP	ENST00000285071.4	37	c.1149C>T	CCDS32579.1																																																																																				0.567	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606		12	29	0	0	0	0	12	29				
PIGS	94005	broad.mit.edu	37	17	26882020	26882020	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:26882020G>C	ENST00000308360.7	-	11	1616	c.1241C>G	c.(1240-1242)aCg>aGg	p.T414R	PIGS_ENST00000395346.2_Missense_Mutation_p.T406R|UNC119_ENST00000301032.4_5'Flank|UNC119_ENST00000335765.4_5'Flank|PIGS_ENST00000543734.1_Missense_Mutation_p.T353R	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	414					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CCCTTCACTCGTAGGCCCTGA	0.592																																						uc002hbo.2		NA																	0				breast(2)|urinary_tract(1)|kidney(1)	4						c.(1240-1242)ACG>AGG		phosphatidylinositol glycan anchor biosynthesis,							70.0	59.0	63.0					17																	26882020		2203	4300	6503	SO:0001583	missense	94005				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr17:26882020G>C		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1241C>G	17.37:g.26882020G>C	ENSP00000309430:p.Thr414Arg					UNC119_uc002hbk.2_5'Flank|UNC119_uc002hbm.2_5'Flank|PIGS_uc002hbn.2_Missense_Mutation_p.T406R|PIGS_uc010wap.1_Missense_Mutation_p.T353R	p.T414R	NM_033198	NP_149975	Q96S52	PIGS_HUMAN			11	1614	-	Lung NSC(42;0.00431)		414			Lumenal (Potential).		Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	37	c.1241C>G	CCDS11235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.14|10.14	1.267545|1.267545	0.23136|0.23136	.|.	.|.	ENSG00000087111|ENSG00000087111	ENST00000268758|ENST00000395346;ENST00000308360;ENST00000543734	.|T;T;T	.|0.41400	.|1.0;1.0;1.0	5.42|5.42	-0.944|-0.944	0.10392|0.10392	.|.	.|0.495768	.|0.24618	.|N	.|0.036996	T|T	0.16769|0.16769	0.0403|0.0403	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999997|0.999997	.|B;B	.|0.17667	.|0.023;0.018	.|B;B	.|0.20955	.|0.028;0.032	T|T	0.20538|0.20538	-1.0272|-1.0272	6|10	0.87932|0.16896	D|T	0|0.51	-9.8901|-9.8901	5.7645|5.7645	0.18219|0.18219	0.0:0.403:0.3599:0.2371|0.0:0.403:0.3599:0.2371	.|.	.|414;406	.|Q96S52;Q96S52-2	.|PIGS_HUMAN;.	G|R	156|406;414;353	.|ENSP00000378755:T406R;ENSP00000309430:T414R;ENSP00000438447:T353R	ENSP00000268758:R156G|ENSP00000309430:T414R	R|T	-|-	1|2	2|0	PIGS|PIGS	23906147|23906147	0.931000|0.931000	0.31567|0.31567	0.657000|0.657000	0.29651|0.29651	0.933000|0.933000	0.57130|0.57130	1.259000|1.259000	0.32956|0.32956	0.066000|0.066000	0.16515|0.16515	-0.532000|-0.532000	0.04303|0.04303	CGA|ACG		0.592	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198		18	25	0	0	0	0	18	25				
SLC6A4	6532	broad.mit.edu	37	17	28537590	28537590	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:28537590C>T	ENST00000401766.2	-	10	1904	c.1392G>A	c.(1390-1392)cgG>cgA	p.R464R	SLC6A4_ENST00000261707.3_Silent_p.R464R			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	464					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CGAGCACGAACCGCTCCCGGC	0.597																																						uc002hey.3		NA																	0				skin(3)|ovary(1)	4						c.(1390-1392)CGG>CGA		solute carrier family 6 member 4	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)						115.0	102.0	106.0					17																	28537590		2203	4300	6503	SO:0001819	synonymous_variant	6532				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity	g.chr17:28537590C>T	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1392G>A	17.37:g.28537590C>T						SLC6A4_uc010csg.2_RNA	p.R464R	NM_001045	NP_001036	P31645	SC6A4_HUMAN			11	1936	-			464			Helical; Name=9; (Potential).		Q5EE02	Silent	SNP	ENST00000401766.2	37	c.1392G>A	CCDS11256.1																																																																																				0.597	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045		12	48	0	0	0	0	12	48				
CACNB1	782	broad.mit.edu	37	17	37347836	37347836	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:37347836T>C	ENST00000394303.3	-	3	389	c.182A>G	c.(181-183)gAg>gGg	p.E61G	CACNB1_ENST00000582877.1_5'UTR|CACNB1_ENST00000394310.3_Missense_Mutation_p.E61G|CACNB1_ENST00000344140.5_Missense_Mutation_p.E61G	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	61					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTGTAGGACTCCGCTGAGCC	0.597																																					Esophageal Squamous(5;100 366 38393 41452 45827)	uc002hrm.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(181-183)GAG>GGG		calcium channel, voltage-dependent, beta 1	Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)						64.0	54.0	57.0					17																	37347836		2203	4300	6503	SO:0001583	missense	782				axon guidance	voltage-gated calcium channel complex		g.chr17:37347836T>C		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.182A>G	17.37:g.37347836T>C	ENSP00000377840:p.Glu61Gly					CACNB1_uc002hrl.1_5'UTR|CACNB1_uc002hrn.2_Missense_Mutation_p.E61G|CACNB1_uc002hro.2_Missense_Mutation_p.E61G|CACNB1_uc002hrp.1_Missense_Mutation_p.E61G|CACNB1_uc010web.1_Missense_Mutation_p.E14G	p.E61G	NM_000723	NP_000714	Q02641	CACB1_HUMAN			3	335	-			61					A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	ENST00000394303.3	37	c.182A>G	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.914990	0.92178	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	T;T;T	0.78707	-1.19;-1.2;-1.19	5.08	5.08	0.68730	.	0.051951	0.85682	D	0.000000	T	0.70422	0.3222	N	0.19112	0.55	0.58432	D	0.999999	B;P;P;B;P	0.47484	0.447;0.822;0.504;0.447;0.896	B;B;B;B;P	0.46510	0.168;0.423;0.273;0.118;0.519	T	0.75991	-0.3122	10	0.87932	D	0	-20.7547	14.115	0.65146	0.0:0.0:0.0:1.0	.	14;61;61;61;61	F5H6X1;Q6TME4;Q02641-2;Q02641-3;Q02641	.;.;.;.;CACB1_HUMAN	G	11;61;61;61;14	ENSP00000377840:E61G;ENSP00000345461:E61G;ENSP00000377847:E61G	ENSP00000345461:E61G	E	-	2	0	CACNB1	34601362	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	7.824000	0.86668	2.025000	0.59659	0.477000	0.44152	GAG		0.597	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3			11	23	0	0	0	0	11	23				
GRB7	2886	broad.mit.edu	37	17	37899470	37899470	+	Silent	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:37899470G>T	ENST00000309156.4	+	5	758	c.501G>T	c.(499-501)gtG>gtT	p.V167V	GRB7_ENST00000394211.3_Silent_p.V167V|GRB7_ENST00000309185.3_Silent_p.V167V|GRB7_ENST00000394209.2_Silent_p.V167V|GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394204.1_Silent_p.V167V|GRB7_ENST00000445327.2_Silent_p.V190V	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	167	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGGTGGAAGTGCAGGCTGCCT	0.582																																						uc002hsr.2		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(499-501)GTG>GTT		growth factor receptor-bound protein 7							67.0	68.0	68.0					17																	37899470		2203	4300	6503	SO:0001819	synonymous_variant	2886				blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity	g.chr17:37899470G>T	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.501G>T	17.37:g.37899470G>T						GRB7_uc002hss.2_Silent_p.V167V|GRB7_uc010cwc.2_Silent_p.V167V|GRB7_uc002hst.2_Silent_p.V167V	p.V167V	NM_005310	NP_005301	Q14451	GRB7_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)		5	751	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		167			Ras-associating.		B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Silent	SNP	ENST00000309156.4	37	c.501G>T	CCDS11345.1																																																																																				0.582	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310		8	82	1	0	2.18e-05	2.41e-05	8	82				
KRTAP4-9	100132386	broad.mit.edu	37	17	39261731	39261731	+	Missense_Mutation	SNP	G	G	C	rs369890328	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:39261731G>C	ENST00000391415.1	+	1	148	c.91G>C	c.(91-93)Gag>Cag	p.E31Q		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	31	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.E31Q(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						CAGCTGCTGTGAGACCACCTG	0.637													G|||	8	0.00159744	0.0015	0.0	5008	,	,		17461	0.0		0.001	False		,,,				2504	0.0051					uc010wfp.1		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(91-93)GAG>CAG		keratin associated protein 4-9							16.0	22.0	20.0					17																	39261731		692	1590	2282	SO:0001583	missense	100132386					keratin filament		g.chr17:39261731G>C	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.91G>C	17.37:g.39261731G>C	ENSP00000375234:p.Glu31Gln						p.E31Q	NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN			1	91	+			31			2.|29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].			Missense_Mutation	SNP	ENST00000391415.1	37	c.91G>C	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.121653	0.00346	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.26518	1.73	3.31	-2.91	0.05631	.	.	.	.	.	T	0.02727	0.0082	N	0.00020	-2.78	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45425	-0.9262	9	0.02654	T	1	.	7.3216	0.26531	0.2761:0.3069:0.4171:0.0	.	31	Q9BYQ8	KRA49_HUMAN	Q	31	ENSP00000375234:E31Q	ENSP00000334461:E31Q	E	+	1	0	KRTAP4-9	36515257	0.000000	0.05858	0.038000	0.18304	0.335000	0.28730	-1.734000	0.01848	-0.249000	0.09569	-1.188000	0.01700	GAG		0.637	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041		4	37	0	0	0	0	4	37				
KLHL10	317719	broad.mit.edu	37	17	39994252	39994252	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:39994252C>T	ENST00000293303.4	+	1	221	c.68C>T	c.(67-69)gCg>gTg	p.A23V	NT5C3B_ENST00000435506.2_5'Flank|NT5C3B_ENST00000521789.1_5'Flank|RN7SL871P_ENST00000583512.1_RNA|KLHL10_ENST00000485613.1_3'UTR|NT5C3B_ENST00000269534.8_5'Flank	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	23					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.A23V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				AAGATGAGTGCGATGGCCTGT	0.562																																						uc010cxr.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(67-69)GCG>GTG		kelch-like 10							140.0	139.0	140.0					17																	39994252		2083	4210	6293	SO:0001583	missense	317719					cytoplasm		g.chr17:39994252C>T	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.68C>T	17.37:g.39994252C>T	ENSP00000293303:p.Ala23Val					NT5C3L_uc010wfu.1_5'Flank|NT5C3L_uc002hyb.3_5'Flank|NT5C3L_uc002hyc.3_5'Flank|NT5C3L_uc002hyd.3_5'Flank|NT5C3L_uc002hxy.3_5'Flank|NT5C3L_uc002hxz.3_5'Flank|NT5C3L_uc002hya.3_5'Flank|KLHL10_uc010wfv.1_Missense_Mutation_p.A23V|KLHL10_uc010wfw.1_5'UTR	p.A23V	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN			1	210	+		Breast(137;0.000162)	23					Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	c.68C>T	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842145	0.51057	.	.	ENSG00000161594	ENST00000448203;ENST00000293303;ENST00000438813	D;T;D	0.83914	-1.78;-0.43;-1.65	4.98	4.98	0.66077	BTB/POZ fold (1);	0.225852	0.38058	N	0.001821	T	0.78110	0.4232	L	0.31926	0.97	0.44523	D	0.997478	D;P	0.55605	0.972;0.942	P;B	0.46049	0.502;0.446	T	0.76963	-0.2764	10	0.31617	T	0.26	.	15.1739	0.72896	0.0:1.0:0.0:0.0	.	23;23	B4DXV2;Q6JEL2	.;KLH10_HUMAN	V	23	ENSP00000391983:A23V;ENSP00000293303:A23V;ENSP00000416221:A23V	ENSP00000293303:A23V	A	+	2	0	KLHL10	37247778	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.245000	0.65405	2.622000	0.88805	0.650000	0.86243	GCG		0.562	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467		38	73	0	0	0	0	38	73				
HELZ	9931	broad.mit.edu	37	17	65186378	65186378	+	Silent	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:65186378T>G	ENST00000358691.5	-	10	817	c.651A>C	c.(649-651)tcA>tcC	p.S217S	HELZ_ENST00000580662.1_5'UTR|HELZ_ENST00000580168.1_Silent_p.S217S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	217						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TTATCAGCCGTGAAGCATATC	0.393																																						uc010wqk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(649-651)TCA>TCC		helicase with zinc finger domain							151.0	135.0	140.0					17																	65186378		1868	4106	5974	SO:0001819	synonymous_variant	9931							g.chr17:65186378T>G	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.651A>C	17.37:g.65186378T>G						HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Silent_p.S217S	p.S217S	NM_014877	NP_055692					10	838	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Silent	SNP	ENST00000358691.5	37	c.651A>C	CCDS42374.1																																																																																				0.393	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		12	50	0	0	0	0	12	50				
OTOP2	92736	broad.mit.edu	37	17	72929559	72929559	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:72929559C>T	ENST00000580223.1	+	6	1638	c.1608C>T	c.(1606-1608)atC>atT	p.I536I	OTOP3_ENST00000328801.4_5'Flank|OTOP2_ENST00000331427.4_Silent_p.I536I			Q7RTS6	OTOP2_HUMAN	otopetrin 2	536						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					GGGCGGTCATCGTCAACATCT	0.592																																						uc010wrp.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(1606-1608)ATC>ATT		otopetrin 2							140.0	105.0	117.0					17																	72929559		2203	4300	6503	SO:0001819	synonymous_variant	92736					integral to membrane		g.chr17:72929559C>T	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1608C>T	17.37:g.72929559C>T						OTOP3_uc010wrq.1_5'Flank|OTOP3_uc010wrr.1_5'Flank	p.I536I	NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN			8	1697	+	all_lung(278;0.172)|Lung NSC(278;0.207)		536			Helical; (Potential).			Silent	SNP	ENST00000580223.1	37	c.1608C>T	CCDS11708.1																																																																																				0.592	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160		15	77	0	0	0	0	15	77				
ZNF750	79755	broad.mit.edu	37	17	80790003	80790003	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:80790003C>G	ENST00000269394.3	-	2	1161	c.328G>C	c.(328-330)Gac>Cac	p.D110H	ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000355528.4_Intron|TBCD_ENST00000539345.2_Intron|TBCD_ENST00000397466.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	110					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TCCTTGATGTCTTCCCTGGCA	0.612																																						uc002kga.2		NA																	0				central_nervous_system(1)	1						c.(328-330)GAC>CAC		zinc finger protein 750							67.0	63.0	64.0					17																	80790003		2203	4300	6503	SO:0001583	missense	79755					intracellular	zinc ion binding	g.chr17:80790003C>G	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.328G>C	17.37:g.80790003C>G	ENSP00000269394:p.Asp110His					TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	p.D110H	NM_024702	NP_078978	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)		2	639	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	110					Q9H899	Missense_Mutation	SNP	ENST00000269394.3	37	c.328G>C	CCDS11819.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674560	0.47781	.	.	ENSG00000141579	ENST00000269394	T	0.29655	1.56	5.86	5.86	0.93980	.	0.235410	0.36002	N	0.002850	T	0.55016	0.1894	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.47824	-0.9087	9	.	.	.	-29.6428	19.1589	0.93524	0.0:1.0:0.0:0.0	.	110	Q32MQ0	ZN750_HUMAN	H	110	ENSP00000269394:D110H	.	D	-	1	0	ZNF750	78383292	0.033000	0.19621	0.015000	0.15790	0.145000	0.21501	2.506000	0.45433	2.773000	0.95371	0.655000	0.94253	GAC		0.612	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702		9	55	0	0	0	0	9	55				
ZNF521	25925	broad.mit.edu	37	18	22806653	22806653	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr18:22806653C>A	ENST00000361524.3	-	4	1377	c.1229G>T	c.(1228-1230)tGc>tTc	p.C410F	ZNF521_ENST00000538137.2_Missense_Mutation_p.C410F|ZNF521_ENST00000584787.1_Missense_Mutation_p.C190F|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	410					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTGTTTGTTGCAGTAAATACA	0.438			T	PAX5	ALL																																	uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(1228-1230)TGC>TTC		zinc finger protein 521							93.0	91.0	92.0					18																	22806653		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806653C>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1229G>T	18.37:g.22806653C>A	ENSP00000354794:p.Cys410Phe					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.C410F|ZNF521_uc002kvl.2_Missense_Mutation_p.C190F	p.C410F	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	1476	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		410			C2H2-type 9; degenerate.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.1229G>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401567	0.25291	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.21543	2.13;2.0	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.40498	0.1119	L	0.32530	0.975	0.54753	D	0.999983	D	0.89917	1.0	D	0.87578	0.998	T	0.07731	-1.0757	10	0.87932	D	0	-23.0925	20.8598	0.99761	0.0:1.0:0.0:0.0	.	410	Q96K83	ZN521_HUMAN	F	410;444;410	ENSP00000354794:C410F;ENSP00000382352:C410F	ENSP00000354794:C410F	C	-	2	0	ZNF521	21060651	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	TGC		0.438	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		27	44	1	0	6.33e-13	7.49e-13	27	44				
CDH2	1000	broad.mit.edu	37	18	25589801	25589801	+	Silent	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr18:25589801C>A	ENST00000269141.3	-	5	1005	c.582G>T	c.(580-582)cgG>cgT	p.R194R	CDH2_ENST00000399380.3_Silent_p.R163R	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	194	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTACACTGTACCGCAGTGAAA	0.483																																						uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(580-582)CGG>CGT		cadherin 2, type 1 preproprotein							95.0	86.0	89.0					18																	25589801		2203	4300	6503	SO:0001819	synonymous_variant	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25589801C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.582G>T	18.37:g.25589801C>A						CDH2_uc010xbn.1_Silent_p.R163R	p.R194R	NM_001792	NP_001783	P19022	CADH2_HUMAN			5	1041	-			194			Cadherin 1.|Extracellular (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	ENST00000269141.3	37	c.582G>T	CCDS11891.1																																																																																				0.483	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		28	44	1	0	1.77e-15	2.12e-15	28	44				
KLHL14	57565	broad.mit.edu	37	18	30350122	30350122	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr18:30350122C>T	ENST00000359358.4	-	2	871	c.433G>A	c.(433-435)Gcc>Acc	p.A145T	AC012123.1_ENST00000426194.1_Intron|KLHL14_ENST00000358095.4_Missense_Mutation_p.A145T	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	145	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTCACGTTGGCCGTGTAGAGG	0.637																																						uc002kxm.1		NA																	0				ovary(1)	1						c.(433-435)GCC>ACC		kelch-like 14							99.0	97.0	97.0					18																	30350122		2203	4300	6503	SO:0001583	missense	57565					cytosol|endoplasmic reticulum membrane		g.chr18:30350122C>T	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.433G>A	18.37:g.30350122C>T	ENSP00000352314:p.Ala145Thr						p.A145T	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN			2	821	-			145			BTB.		A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	c.433G>A	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.682411	0.29872	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.22743	1.94;1.94	4.34	4.34	0.51931	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.055344	0.64402	D	0.000001	T	0.19248	0.0462	L	0.33339	1.005	0.54753	D	0.999984	B	0.30542	0.284	B	0.35312	0.2	T	0.06972	-1.0797	10	0.87932	D	0	.	11.864	0.52482	0.0:0.9101:0.0:0.0899	.	145	Q9P2G3	KLH14_HUMAN	T	145	ENSP00000352314:A145T;ENSP00000350808:A145T	ENSP00000350808:A145T	A	-	1	0	KLHL14	28604120	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.766000	0.62279	2.141000	0.66446	0.460000	0.39030	GCC		0.637	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1			38	130	0	0	0	0	38	130				
CHAF1A	10036	broad.mit.edu	37	19	4432045	4432045	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:4432045C>T	ENST00000301280.5	+	12	2145	c.2044C>T	c.(2044-2046)Caa>Taa	p.Q682*	CHAF1A_ENST00000587368.1_3'UTR|CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	682	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGCGTCCTGCAACCTGTGAA	0.602								Chromatin Structure																														uc002mal.2		NA																	0				ovary(1)|skin(1)	2						c.(2044-2046)CAA>TAA	Chromatin_Structure	chromatin assembly factor 1, subunit A (p150)							96.0	86.0	89.0					19																	4432045		2203	4300	6503	SO:0001587	stop_gained	10036				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding	g.chr19:4432045C>T	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2044C>T	19.37:g.4432045C>T	ENSP00000301280:p.Gln682*						p.Q682*	NM_005483	NP_005474	Q13111	CAF1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)	12	2144	+		Hepatocellular(1079;0.137)	682			Binds to p60.		Q6NXG5|Q7Z7K3|Q9UJY8	Nonsense_Mutation	SNP	ENST00000301280.5	37	c.2044C>T	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	C	36	5.608135	0.96626	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-50.2735	17.1654	0.86814	0.0:1.0:0.0:0.0	.	.	.	.	X	682	.	ENSP00000301280:Q682X	Q	+	1	0	CHAF1A	4383045	1.000000	0.71417	0.972000	0.41901	0.063000	0.16089	6.084000	0.71335	2.592000	0.87571	0.561000	0.74099	CAA		0.602	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483		25	56	0	0	0	0	25	56				
OR7E24	26648	broad.mit.edu	37	19	9361989	9361989	+	Silent	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:9361989T>G	ENST00000456448.1	+	1	384	c.270T>G	c.(268-270)ggT>ggG	p.G90G		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						CTGACATCGGTTTCACCTCCA	0.532																																						uc002mlb.1		NA																	0				skin(1)	1						c.(268-270)GGT>GGG		olfactory receptor, family 7, subfamily E,							57.0	55.0	56.0					19																	9361989		2203	4297	6500	SO:0001819	synonymous_variant	26648				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9361989T>G	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.270T>G	19.37:g.9361989T>G							p.G90G	NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN			1	270	+			90			Helical; Name=2; (Potential).		B9EJD9|Q9UPJ1	Silent	SNP	ENST00000456448.1	37	c.270T>G	CCDS45955.1																																																																																				0.532	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1			23	27	0	0	0	0	23	27				
ICAM3	3385	broad.mit.edu	37	19	10446518	10446518	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:10446518C>T	ENST00000160262.5	-	3	686	c.478G>A	c.(478-480)Gag>Aag	p.E160K	RAVER1_ENST00000293677.6_5'Flank|ICAM3_ENST00000589261.1_Missense_Mutation_p.E83K	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	160	Ig-like C2-type 2.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			CGGCTCAGCTCCTCCTCCCAG	0.677																																						uc002mob.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(478-480)GAG>AAG		intercellular adhesion molecule 3 precursor							25.0	24.0	24.0					19																	10446518		2202	4300	6502	SO:0001583	missense	3385				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding	g.chr19:10446518C>T		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.478G>A	19.37:g.10446518C>T	ENSP00000160262:p.Glu160Lys					RAVER1_uc002moa.2_5'Flank|ICAM3_uc010dxd.1_Missense_Mutation_p.E83K|ICAM3_uc010xlf.1_Missense_Mutation_p.E83K	p.E160K	NM_002162	NP_002153	P32942	ICAM3_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)		3	533	-			160			Extracellular (Potential).|Ig-like C2-type 2.		Q6PD68	Missense_Mutation	SNP	ENST00000160262.5	37	c.478G>A	CCDS12235.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411919	0.83340	.	.	ENSG00000076662	ENST00000160262	T	0.05580	3.42	4.98	4.98	0.66077	Intercellular adhesion molecule/vascular cell adhesion molecule, N-terminal (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.067732	0.56097	D	0.000036	T	0.24928	0.0605	M	0.85542	2.76	0.31328	N	0.685176	B;P	0.41450	0.422;0.75	B;P	0.56088	0.377;0.791	T	0.06552	-1.0820	10	0.66056	D	0.02	-39.316	14.1117	0.65126	0.0:1.0:0.0:0.0	.	83;160	B7Z6W6;P32942	.;ICAM3_HUMAN	K	160	ENSP00000160262:E160K	ENSP00000160262:E160K	E	-	1	0	ICAM3	10307518	0.752000	0.28338	0.994000	0.49952	0.492000	0.33523	2.283000	0.43470	2.479000	0.83701	0.555000	0.69702	GAG		0.677	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1			3	10	0	0	0	0	3	10				
PGLYRP2	114770	broad.mit.edu	37	19	15587132	15587132	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:15587132A>T	ENST00000340880.4	-	2	829	c.349T>A	c.(349-351)Tcg>Acg	p.S117T	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.S117T	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	117					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GCCACGGTCGAGCCATCAGGT	0.627																																						uc002nbf.3		NA																	0				ovary(3)	3						c.(349-351)TCG>ACG		peptidoglycan recognition protein 2 precursor							147.0	113.0	124.0					19																	15587132		2203	4300	6503	SO:0001583	missense	114770				defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding	g.chr19:15587132A>T	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.349T>A	19.37:g.15587132A>T	ENSP00000345968:p.Ser117Thr					PGLYRP2_uc002nbg.3_Missense_Mutation_p.S117T	p.S117T	NM_052890	NP_443122	Q96PD5	PGRP2_HUMAN			2	482	-			117					A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	37	c.349T>A	CCDS12330.2	.	.	.	.	.	.	.	.	.	.	A	15.16	2.749583	0.49257	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.05996	3.44;3.36	5.17	5.17	0.71159	.	0.085211	0.48286	D	0.000200	T	0.10465	0.0256	L	0.48260	1.515	0.29706	N	0.839779	P;P	0.52692	0.955;0.925	P;P	0.49752	0.58;0.621	T	0.05402	-1.0887	10	0.31617	T	0.26	-10.1063	11.4109	0.49925	1.0:0.0:0.0:0.0	.	117;117	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	T	117	ENSP00000345968:S117T;ENSP00000292609:S117T	ENSP00000292609:S117T	S	-	1	0	PGLYRP2	15448132	1.000000	0.71417	0.991000	0.47740	0.141000	0.21300	2.828000	0.48120	1.967000	0.57214	0.460000	0.39030	TCG		0.627	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890		43	68	0	0	0	0	43	68				
DDX49	54555	broad.mit.edu	37	19	19035702	19035702	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:19035702T>A	ENST00000247003.4	+	9	1008	c.941T>A	c.(940-942)aTc>aAc	p.I314N	DDX49_ENST00000438170.2_Missense_Mutation_p.S217T|DDX49_ENST00000599156.1_3'UTR|AC002985.3_ENST00000596918.1_Intron	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	314	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			GGCCTGGACATCCCTACGGTA	0.637																																						uc002nkq.1		NA																	0				ovary(1)	1						c.(940-942)ATC>AAC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 49							64.0	59.0	61.0					19																	19035702		2203	4300	6503	SO:0001583	missense	54555						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr19:19035702T>A		CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.941T>A	19.37:g.19035702T>A	ENSP00000247003:p.Ile314Asn					HOMER3_uc002nko.1_Intron|HOMER3_uc002nkp.1_Intron|DDX49_uc002nkr.1_RNA|DDX49_uc002nks.1_Missense_Mutation_p.I207N|DDX49_uc002nkt.1_3'UTR	p.I314N	NM_019070	NP_061943	Q9Y6V7	DDX49_HUMAN	Epithelial(12;0.0289)		9	998	+			314			Helicase C-terminal.		E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	ENST00000247003.4	37	c.941T>A	CCDS12390.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.78|17.78	3.474248|3.474248	0.63737|0.63737	.|.	.|.	ENSG00000105671|ENSG00000105671	ENST00000247003|ENST00000438170	T|T	0.79033|0.08370	-1.23|3.1	4.94|4.94	4.94|4.94	0.65067|0.65067	Helicase, C-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.31167|0.31167	0.0788|0.0788	H|H	0.97103|0.97103	3.94|3.94	0.28933|0.28933	N|N	0.891434|0.891434	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.53092|0.53092	-0.8487|-0.8487	10|7	0.87932|0.07813	D|T	0|0.8	-16.7789|-16.7789	13.7883|13.7883	0.63123|0.63123	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	314|.	Q9Y6V7|.	DDX49_HUMAN|.	N|T	314|217	ENSP00000247003:I314N|ENSP00000395377:S217T	ENSP00000247003:I314N|ENSP00000395377:S217T	I|S	+|+	2|1	0|0	DDX49|DDX49	18896702|18896702	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.358000|0.358000	0.29455|0.29455	5.966000|5.966000	0.70395|0.70395	1.860000|1.860000	0.53959|0.53959	0.418000|0.418000	0.28097|0.28097	ATC|TCC		0.637	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464593.1	NM_019070		23	27	0	0	0	0	23	27				
HAPLN4	404037	broad.mit.edu	37	19	19369367	19369367	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:19369367C>T	ENST00000291481.7	-	4	845	c.782G>A	c.(781-783)cGc>cAc	p.R261H	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	261	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GGCGTCGTAGCGTTCCTCGGC	0.687																																						uc002nmb.2		NA																	0				pancreas(1)	1						c.(781-783)CGC>CAC		hyaluronan and proteoglycan link protein 4							74.0	60.0	65.0					19																	19369367		2203	4300	6503	SO:0001583	missense	404037				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding	g.chr19:19369367C>T	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.782G>A	19.37:g.19369367C>T	ENSP00000291481:p.Arg261His					HAPLN4_uc002nmc.2_Missense_Mutation_p.R261H	p.R261H	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	Epithelial(12;0.00575)		4	837	-			261			Link 1.		A5PKW5|Q96PW2	Missense_Mutation	SNP	ENST00000291481.7	37	c.782G>A	CCDS12398.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.752907	0.49362	.	.	ENSG00000187664	ENST00000291481	T	0.12465	2.68	3.97	2.92	0.33932	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.15089	0.0364	M	0.71581	2.175	0.39267	D	0.964326	P	0.38048	0.616	B	0.36719	0.231	T	0.03852	-1.0998	10	0.49607	T	0.09	-25.9286	7.303	0.26432	0.0:0.7269:0.1747:0.0984	.	261	Q86UW8	HPLN4_HUMAN	H	261	ENSP00000291481:R261H	ENSP00000291481:R261H	R	-	2	0	HAPLN4	19230367	1.000000	0.71417	0.818000	0.32626	0.875000	0.50365	0.989000	0.29629	0.875000	0.35847	0.313000	0.20887	CGC		0.687	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002		20	24	0	0	0	0	20	24				
ZNF737	100129842	broad.mit.edu	37	19	20728176	20728176	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:20728176A>T	ENST00000427401.4	-	4	927	c.833T>A	c.(832-834)aTt>aAt	p.I278N		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TCCAGTATGAATTATCTTATG	0.408																																						uc002npa.2		NA																	0				ovary(1)	1						c.(832-834)ATT>AAT		zinc finger protein 737							35.0	35.0	35.0					19																	20728176		692	1591	2283	SO:0001583	missense	100129842				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:20728176A>T	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.833T>A	19.37:g.20728176A>T	ENSP00000395733:p.Ile278Asn						p.I278N	NM_001159293	NP_001152765	C9JHM3	C9JHM3_HUMAN			4	1013	-			278					C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	37	c.833T>A	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	-	11.22	1.574858	0.28092	.	.	ENSG00000237440	ENST00000427401	T	0.07567	3.18	0.801	-1.6	0.08426	.	.	.	.	.	T	0.07999	0.0200	L	0.28014	0.82	0.23132	N	0.998244	P	0.49185	0.92	P	0.51742	0.678	T	0.27536	-1.0071	9	0.87932	D	0	.	1.4485	0.02369	0.3546:0.3218:0.0:0.3236	.	278	C9JHM3	.	N	278	ENSP00000395733:I278N	ENSP00000395733:I278N	I	-	2	0	ZNF737	20520016	0.000000	0.05858	0.098000	0.21074	0.098000	0.18820	-0.349000	0.07731	0.147000	0.19030	0.145000	0.16022	ATT		0.408	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289		14	18	0	0	0	0	14	18				
ZNF573	126231	broad.mit.edu	37	19	38262306	38262306	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:38262306C>T	ENST00000590414.2	-	2	121	c.100G>A	c.(100-102)Gcc>Acc	p.A34T	ZNF573_ENST00000392138.1_5'UTR|ZNF573_ENST00000357309.3_Intron|ZNF573_ENST00000585724.1_Intron|ZNF573_ENST00000536220.1_5'UTR|ZNF573_ENST00000339503.4_5'UTR			Q86YE8	ZN573_HUMAN	zinc finger protein 573	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			AAGTCTATGGCCACATCCCTG	0.408																																						uc002ohe.2		NA																	0				ovary(1)	1						c.(100-102)GCC>ACC		zinc finger protein 573																																				SO:0001583	missense	126231				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38262306C>T	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.100G>A	19.37:g.38262306C>T	ENSP00000465020:p.Ala34Thr					ZNF573_uc010efs.2_5'UTR|ZNF573_uc002ohd.2_Missense_Mutation_p.A32T|ZNF573_uc002ohf.2_5'UTR|ZNF573_uc002ohg.2_5'UTR	p.A34T	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)		2	122	-			14			KRAB.		B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	ENST00000590414.2	37	c.100G>A	CCDS59381.1																																																																																				0.408	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360		6	22	0	0	0	0	6	22				
FUT2	2524	broad.mit.edu	37	19	49206855	49206855	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:49206855G>C	ENST00000425340.2	+	2	759	c.642G>C	c.(640-642)aaG>aaC	p.K214N	FUT2_ENST00000391876.4_Missense_Mutation_p.K214N	NM_000511.5|NM_001097638.2	NP_000502.4|NP_001091107.1	Q10981	FUT2_HUMAN	fucosyltransferase 2 (secretor status included)	214					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)	7		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)		AAGTGTGGAAGGGGGTGGTGG	0.627																																						uc002pke.3		NA																	0				central_nervous_system(1)	1						c.(640-642)AAG>AAC		fucosyltransferase 2							67.0	70.0	69.0					19																	49206855		2203	4300	6503	SO:0001583	missense	2524				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	galactoside 2-alpha-L-fucosyltransferase activity	g.chr19:49206855G>C		CCDS33069.1	19q13.33	2014-07-19			ENSG00000176920	ENSG00000176920		"""Fucosyltransferases"""	4013	protein-coding gene	gene with protein product	"""alpha (1,2) fucosyltransferase"", ""galactoside 2-alpha-L-fucosyltransferase 2"", ""GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2"", ""alpha(1,2)FT2"", ""secretor factor"", ""secretor blood group alpha-2-fucosyltransferase"""	182100		SE		1763885	Standard	NM_000511		Approved	sej, Se2, SEC2	uc010emc.3	Q10981	OTTHUMG00000164427	ENST00000425340.2:c.642G>C	19.37:g.49206855G>C	ENSP00000387498:p.Lys214Asn					FUT2_uc010emc.2_Missense_Mutation_p.K214N	p.K214N	NM_001097638	NP_001091107	Q10981	FUT2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)	2	753	+		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	214			Lumenal (Potential).		Q0VAG5|Q14338|Q5D0G2	Missense_Mutation	SNP	ENST00000425340.2	37	c.642G>C	CCDS33069.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321251	0.41096	.	.	ENSG00000176920	ENST00000522966;ENST00000425340;ENST00000391876	D;D;D	0.96940	-4.18;-4.18;-4.18	5.16	2.99	0.34606	.	.	.	.	.	D	0.97826	0.9286	M	0.90145	3.09	0.39377	D	0.966196	D	0.76494	0.999	D	0.71870	0.975	D	0.97850	1.0274	9	0.87932	D	0	.	7.6923	0.28575	0.268:0.0:0.732:0.0	.	214	Q10981	FUT2_HUMAN	N	214	ENSP00000430227:K214N;ENSP00000387498:K214N;ENSP00000375748:K214N	ENSP00000375748:K214N	K	+	3	2	FUT2	53898667	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	0.659000	0.24994	1.307000	0.44944	0.549000	0.68633	AAG		0.627	FUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378731.2	NM_000511		34	54	0	0	0	0	34	54				
BRSK1	84446	broad.mit.edu	37	19	55805723	55805723	+	Silent	SNP	A	A	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:55805723A>C	ENST00000309383.1	+	7	913	c.636A>C	c.(634-636)gcA>gcC	p.A212A	BRSK1_ENST00000590333.1_Silent_p.A228A|BRSK1_ENST00000585418.1_Silent_p.A212A	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	212	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GCCGCCGGGCAGACATGTGGA	0.587																																						uc002qkg.2		NA																	0				ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(634-636)GCA>GCC		BR serine/threonine kinase 1							90.0	87.0	88.0					19																	55805723		2203	4300	6503	SO:0001819	synonymous_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55805723A>C	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.636A>C	19.37:g.55805723A>C						BRSK1_uc002qkf.2_Silent_p.A228A	p.A212A	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	7	913	+		Renal(1328;0.245)	212			Protein kinase.		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	c.636A>C	CCDS12921.1																																																																																				0.587	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		10	24	0	0	0	0	10	24				
ZRANB3	84083	broad.mit.edu	37	2	135988170	135988170	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:135988170C>G	ENST00000264159.6	-	13	1983	c.1867G>C	c.(1867-1869)Gag>Cag	p.E623Q	ZRANB3_ENST00000536680.1_Missense_Mutation_p.E623Q|ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Missense_Mutation_p.E623Q	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	623					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		TGCCAGCCCTCTACAGGAAAG	0.488																																						uc002tum.2		NA																	0				lung(2)	2						c.(1867-1869)GAG>CAG		zinc finger, RAN-binding domain containing 3							118.0	113.0	115.0					2																	135988170		1920	4132	6052	SO:0001583	missense	84083					intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding	g.chr2:135988170C>G	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1867G>C	2.37:g.135988170C>G	ENSP00000264159:p.Glu623Gln					ZRANB3_uc002tuk.2_Missense_Mutation_p.E166Q|ZRANB3_uc002tul.2_Missense_Mutation_p.E623Q	p.E623Q	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.135)	13	1984	-			623			RanBP2-type.		B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	c.1867G>C	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	9.929	1.214407	0.22289	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	T;T;T	0.42131	0.98;0.98;0.98	5.47	-3.35	0.04928	Zinc finger, RanBP2-type (2);	0.799425	0.11975	N	0.511315	T	0.22820	0.0551	N	0.21142	0.635	0.09310	N	1	B;B	0.17038	0.02;0.016	B;B	0.23574	0.047;0.028	T	0.34900	-0.9810	10	0.12103	T	0.63	-16.312	8.4511	0.32871	0.0:0.5328:0.2724:0.1948	.	623;623	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	Q	88;88;623;623;623	ENSP00000383979:E623Q;ENSP00000264159:E623Q;ENSP00000441320:E623Q	ENSP00000264159:E623Q	E	-	1	0	ZRANB3	135704640	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-1.274000	0.02820	-0.476000	0.06842	0.563000	0.77884	GAG		0.488	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143		21	35	0	0	0	0	21	35				
THSD7B	80731	broad.mit.edu	37	2	137814502	137814502	+	Missense_Mutation	SNP	C	C	A	rs267598893		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:137814502C>A	ENST00000409968.1	+	3	830	c.652C>A	c.(652-654)Cca>Aca	p.P218T	THSD7B_ENST00000543459.1_Missense_Mutation_p.P77T|THSD7B_ENST00000413152.2_Missense_Mutation_p.P187T|THSD7B_ENST00000272643.3_Missense_Mutation_p.P218T			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	218	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TTTGCAATGTCCAAATCTGAC	0.478																																						uc002tva.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(559-561)CCA>ACA		thrombospondin, type I, domain containing 7B							183.0	179.0	180.0					2																	137814502		1927	4159	6086	SO:0001583	missense	80731							g.chr2:137814502C>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.652C>A	2.37:g.137814502C>A	ENSP00000387145:p.Pro218Thr					THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.P77T	p.P187T	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	2	559	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.559C>A		.	.	.	.	.	.	.	.	.	.	C	17.73	3.461362	0.63513	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69161	-0.5218	10	0.44086	T	0.13	.	19.9508	0.97198	0.0:1.0:0.0:0.0	.	218;187	Q9C0I4;C9JKN6	THS7B_HUMAN;.	T	218;218;187;77	ENSP00000387145:P218T;ENSP00000272643:P218T;ENSP00000413841:P187T;ENSP00000443370:P77T	ENSP00000272643:P218T	P	+	1	0	THSD7B	137530972	1.000000	0.71417	0.903000	0.35520	0.183000	0.23260	7.776000	0.85560	2.890000	0.99128	0.585000	0.79938	CCA		0.478	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		58	136	1	0	1.22e-34	1.5e-34	58	136				
KIF5C	3800	broad.mit.edu	37	2	149847689	149847689	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:149847689G>T	ENST00000435030.1	+	16	2250	c.1882G>T	c.(1882-1884)Gcc>Tcc	p.A628S	KIF5C_ENST00000414838.2_Missense_Mutation_p.A533S|KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000397413.1_Missense_Mutation_p.A396S			O60282	KIF5C_HUMAN	kinesin family member 5C	628					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		GGAGCTGGCAGCCTGCCAGCT	0.587																																						uc010zbu.1		NA																	0				skin(1)	1						c.(1882-1884)GCC>TCC		kinesin family member 5C							26.0	34.0	32.0					2																	149847689		1958	4138	6096	SO:0001583	missense	3800				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:149847689G>T	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1882G>T	2.37:g.149847689G>T	ENSP00000393379:p.Ala628Ser					KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Missense_Mutation_p.A180S	p.A628S	NM_004522	NP_004513	O60282	KIF5C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.108)	16	2250	+			628					O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	37	c.1882G>T		.	.	.	.	.	.	.	.	.	.	G	5.540	0.284512	0.10513	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	D;D;D	0.88124	-2.34;-2.34;-2.34	4.9	4.9	0.64082	.	0.146062	0.47455	D	0.000229	T	0.81612	0.4859	.	.	.	0.20563	N	0.999889	B;B	0.14438	0.001;0.01	B;B	0.21917	0.003;0.037	T	0.64905	-0.6297	8	.	.	.	.	18.2728	0.90073	0.0:0.0:1.0:0.0	.	628;194	O60282;Q3LIE3	KIF5C_HUMAN;.	S	628;533;531;396	ENSP00000393379:A628S;ENSP00000410115:A533S;ENSP00000380560:A396S	.	A	+	1	0	KIF5C	149555935	0.998000	0.40836	0.990000	0.47175	0.981000	0.71138	2.946000	0.49050	2.529000	0.85273	0.655000	0.94253	GCC		0.587	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522		6	16	1	0	3.6e-05	3.97e-05	6	16				
KCNH7	90134	broad.mit.edu	37	2	163374317	163374317	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:163374317C>A	ENST00000332142.5	-	4	914	c.815G>T	c.(814-816)aGa>aTa	p.R272I	KCNH7_ENST00000477019.1_5'UTR|KCNH7_ENST00000328032.4_Missense_Mutation_p.R272I	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	272					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CGAAGATGCTCTCCGTATACT	0.458																																					GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	0				ovary(3)|skin(2)	5						c.(814-816)AGA>ATA		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						118.0	106.0	110.0					2																	163374317		2203	4300	6503	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163374317C>A	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.815G>T	2.37:g.163374317C>A	ENSP00000331727:p.Arg272Ile					KCNH7_uc002uci.2_Missense_Mutation_p.R272I	p.R272I	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			4	1027	-			272			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.815G>T	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	32	5.188576	0.94923	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99136	-5.47;-5.47	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.99007	0.9661	L	0.49126	1.545	0.80722	D	1	D;D	0.67145	0.994;0.996	D;D	0.70487	0.909;0.969	D	0.99915	1.1221	10	0.87932	D	0	.	20.2556	0.98417	0.0:1.0:0.0:0.0	.	272;272	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	I	272	ENSP00000331727:R272I;ENSP00000333781:R272I	ENSP00000333781:R272I	R	-	2	0	KCNH7	163082563	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.273000	0.78527	2.791000	0.96007	0.655000	0.94253	AGA		0.458	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		5	53	1	0	5.94e-07	6.68e-07	5	53				
LRP2	4036	broad.mit.edu	37	2	169989168	169989168	+	Silent	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:169989168A>G	ENST00000263816.3	-	77	13929	c.13644T>C	c.(13642-13644)gaT>gaC	p.D4548D		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4548					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATTCTTATTATCCACATTTT	0.383																																						uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(13642-13644)GAT>GAC		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						127.0	124.0	125.0					2																	169989168		2203	4300	6503	SO:0001819	synonymous_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:169989168A>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13644T>C	2.37:g.169989168A>G							p.D4548D	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	77	13857	-			4548			Cytoplasmic (Potential).		O00711|Q16215	Silent	SNP	ENST00000263816.3	37	c.13644T>C	CCDS2232.1																																																																																				0.383	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		25	52	0	0	0	0	25	52				
ZNF804A	91752	broad.mit.edu	37	2	185731223	185731223	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:185731223A>G	ENST00000302277.6	+	2	833	c.239A>G	c.(238-240)gAc>gGc	p.D80G		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	80							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AATTCATATGACCATGCTCAC	0.358																																						uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(238-240)GAC>GGC		zinc finger protein 804A							70.0	70.0	70.0					2																	185731223		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185731223A>G	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.239A>G	2.37:g.185731223A>G	ENSP00000303252:p.Asp80Gly						p.D80G	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			2	833	+			80			C2H2-type.		A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.239A>G	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850517	0.71719	.	.	ENSG00000170396	ENST00000302277	T	0.16597	2.33	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, C2H2 (1);	0.186508	0.32258	N	0.006349	T	0.47266	0.1436	M	0.85462	2.755	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.53507	-0.8429	10	0.72032	D	0.01	-5.8269	15.1974	0.73104	1.0:0.0:0.0:0.0	.	80	Q7Z570	Z804A_HUMAN	G	80	ENSP00000303252:D80G	ENSP00000303252:D80G	D	+	2	0	ZNF804A	185439468	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.228000	0.95250	2.233000	0.73108	0.482000	0.46254	GAC		0.358	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		15	74	0	0	0	0	15	74				
SLC40A1	30061	broad.mit.edu	37	2	190428622	190428622	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:190428622G>A	ENST00000261024.2	-	7	1516	c.1090C>T	c.(1090-1092)Cgt>Tgt	p.R364C		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	364					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CATTTTCGACGTAGCCAAGTA	0.468																																						uc002uqp.3		NA																	0				ovary(1)	1						c.(1090-1092)CGT>TGT		solute carrier family 40 (iron-regulated							97.0	86.0	90.0					2																	190428622		2203	4300	6503	SO:0001583	missense	30061				anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding	g.chr2:190428622G>A	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1090C>T	2.37:g.190428622G>A	ENSP00000261024:p.Arg364Cys						p.R364C	NM_014585	NP_055400	Q9NP59	S40A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)		7	1441	-			364					Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	c.1090C>T	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380479	0.82792	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	T	0.80738	-1.41	6.16	5.28	0.74379	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.87489	0.6190	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.86147	0.1585	10	0.44086	T	0.13	-21.5749	10.7041	0.45946	0.0664:0.0:0.8041:0.1295	.	364	Q9NP59	S40A1_HUMAN	C	364;99	ENSP00000261024:R364C	ENSP00000261024:R364C	R	-	1	0	SLC40A1	190136867	1.000000	0.71417	0.325000	0.25375	0.988000	0.76386	4.691000	0.61738	2.937000	0.99478	0.650000	0.86243	CGT		0.468	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2			18	111	0	0	0	0	18	111				
CUL3	8452	broad.mit.edu	37	2	225368470	225368470	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:225368470C>G	ENST00000264414.4	-	9	1614	c.1276G>C	c.(1276-1278)Gat>Cat	p.D426H	CUL3_ENST00000409777.1_Missense_Mutation_p.D402H|CUL3_ENST00000344951.4_Missense_Mutation_p.D360H|CUL3_ENST00000409096.1_Missense_Mutation_p.D402H	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	426					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCAAATACATCTTTTTCTTGC	0.294																																						uc002vny.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4						c.(1276-1278)GAT>CAT		cullin 3							128.0	116.0	120.0					2																	225368470		2202	4295	6497	SO:0001583	missense	8452				cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding	g.chr2:225368470C>G	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1276G>C	2.37:g.225368470C>G	ENSP00000264414:p.Asp426His					CUL3_uc010zls.1_Missense_Mutation_p.D360H|CUL3_uc010fwy.1_Missense_Mutation_p.D432H	p.D426H	NM_003590	NP_003581	Q13618	CUL3_HUMAN		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)	9	1660	-		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)	426					A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	c.1276G>C	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940224	0.92526	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.67	5.67	0.87782	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.95076	0.8405	H	0.98178	4.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96538	0.9398	10	0.87932	D	0	.	19.7689	0.96353	0.0:1.0:0.0:0.0	.	360;404;426	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	H	426;360;402;402	ENSP00000264414:D426H;ENSP00000343601:D360H;ENSP00000387200:D402H;ENSP00000386525:D402H	ENSP00000264414:D426H	D	-	1	0	CUL3	225076714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.656000	0.90262	0.650000	0.86243	GAT		0.294	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2			7	4	0	0	0	0	7	4				
JAG1	182	broad.mit.edu	37	20	10620273	10620273	+	Missense_Mutation	SNP	G	G	A	rs533237399		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr20:10620273G>A	ENST00000254958.5	-	26	4045	c.3530C>T	c.(3529-3531)aCg>aTg	p.T1177M	JAG1_ENST00000423891.2_Missense_Mutation_p.T1018M	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1177					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GTCTACCAGCGTGTACGCCGG	0.507									Alagille Syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		17392	0.0		0.0	False		,,,				2504	0.001					uc002wnw.2		NA																	0				lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(3529-3531)ACG>ATG		jagged 1 precursor							192.0	185.0	187.0					20																	10620273		2203	4300	6503	SO:0001583	missense	182	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity	g.chr20:10620273G>A	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3530C>T	20.37:g.10620273G>A	ENSP00000254958:p.Thr1177Met						p.T1177M	NM_000214	NP_000205	P78504	JAG1_HUMAN			26	4046	-			1177			Cytoplasmic (Potential).		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	c.3530C>T	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.961802	0.34659	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.86297	-2.08;-2.1	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.78984	0.4370	N	0.17082	0.46	0.80722	D	1	B	0.29936	0.262	B	0.15870	0.014	T	0.75975	-0.3128	10	0.45353	T	0.12	.	19.8041	0.96521	0.0:0.0:1.0:0.0	.	1177	P78504	JAG1_HUMAN	M	1177;1018	ENSP00000254958:T1177M;ENSP00000389519:T1018M	ENSP00000254958:T1177M	T	-	2	0	JAG1	10568273	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.420000	0.97426	2.756000	0.94617	0.563000	0.77884	ACG		0.507	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214		82	41	0	0	0	0	82	41				
BTBD3	22903	broad.mit.edu	37	20	11903683	11903683	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr20:11903683T>A	ENST00000405977.1	+	5	1563	c.938T>A	c.(937-939)cTa>cAa	p.L313Q	BTBD3_ENST00000378226.2_Missense_Mutation_p.L313Q|BTBD3_ENST00000399006.2_Missense_Mutation_p.L252Q|BTBD3_ENST00000254977.3_Missense_Mutation_p.L252Q	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	313					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						CGCAAGGTTCTAGGAAAGGCA	0.463																																						uc002wnz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(937-939)CTA>CAA		BTB/POZ domain containing protein 3 isoform a							120.0	119.0	120.0					20																	11903683		2203	4300	6503	SO:0001583	missense	22903							g.chr20:11903683T>A	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.938T>A	20.37:g.11903683T>A	ENSP00000384545:p.Leu313Gln					BTBD3_uc002wny.2_Missense_Mutation_p.L252Q|BTBD3_uc002woa.2_Missense_Mutation_p.L252Q|BTBD3_uc010zrf.1_Missense_Mutation_p.L162Q|BTBD3_uc010zrg.1_Missense_Mutation_p.L162Q|BTBD3_uc010zrh.1_Missense_Mutation_p.L162Q	p.L313Q	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN			4	1297	+			313					D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	37	c.938T>A	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106630	0.77096	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226	D;D;D;D	0.83914	-1.76;-1.76;-1.78;-1.78	6.16	6.16	0.99307	BTB/Kelch-associated (1);	0.000000	0.85682	D	0.000000	D	0.93671	0.7978	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95107	0.8235	10	0.87932	D	0	.	15.9872	0.80168	0.0:0.0:0.0:1.0	.	313	Q9Y2F9	BTBD3_HUMAN	Q	252;252;313;313	ENSP00000254977:L252Q;ENSP00000381971:L252Q;ENSP00000384545:L313Q;ENSP00000367471:L313Q	ENSP00000254977:L252Q	L	+	2	0	BTBD3	11851683	1.000000	0.71417	0.952000	0.39060	0.901000	0.52897	8.040000	0.89188	2.367000	0.80283	0.528000	0.53228	CTA		0.463	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			37	37	0	0	0	0	37	37				
CST9L	128821	broad.mit.edu	37	20	23545618	23545618	+	Silent	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr20:23545618G>C	ENST00000376979.3	-	3	709	c.411C>G	c.(409-411)ctC>ctG	p.L137L		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	137						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TCTTGTTCAGGAGGCTGAACT	0.552																																						uc002wtk.3		NA																	0					0						c.(409-411)CTC>CTG		cystatin 9-like precursor							157.0	135.0	142.0					20																	23545618		2203	4300	6503	SO:0001819	synonymous_variant	128821					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23545618G>C		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.411C>G	20.37:g.23545618G>C							p.L137L	NM_080610	NP_542177	Q9H4G1	CST9L_HUMAN			3	710	-	Colorectal(13;0.0431)|Lung NSC(19;0.235)		137					B2R5A1	Silent	SNP	ENST00000376979.3	37	c.411C>G	CCDS13157.1																																																																																				0.552	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610		21	19	0	0	0	0	21	19				
CEP250	11190	broad.mit.edu	37	20	34090746	34090746	+	Silent	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr20:34090746C>A	ENST00000397527.1	+	30	5269	c.4549C>A	c.(4549-4551)Cgg>Agg	p.R1517R	CEP250_ENST00000342580.4_Silent_p.R1461R	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1517	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CGAGAAGGATCGGGAGACTCA	0.512																																						uc002xcm.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(4549-4551)CGG>AGG		centrosomal protein 2							60.0	64.0	63.0					20																	34090746		2203	4300	6503	SO:0001819	synonymous_variant	11190				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding	g.chr20:34090746C>A	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.4549C>A	20.37:g.34090746C>A						CEP250_uc010zve.1_Silent_p.R885R	p.R1517R	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0106)		31	5220	+	Lung NSC(9;0.00156)|all_lung(11;0.00243)		1517			Gln/Glu-rich.|Potential.		E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	ENST00000397527.1	37	c.4549C>A	CCDS13255.1																																																																																				0.512	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186		14	16	1	0	0.000151284	0.000164422	14	16				
SYNJ1	8867	broad.mit.edu	37	21	34099218	34099218	+	5'Flank	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr21:34099218C>T	ENST00000322229.7	-	0	0				SYNJ1_ENST00000382491.3_5'UTR|SYNJ1_ENST00000382499.2_Missense_Mutation_p.E36K|PAXBP1-AS1_ENST00000440052.1_RNA|SYNJ1_ENST00000433931.2_Missense_Mutation_p.E36K|PAXBP1-AS1_ENST00000458479.1_RNA|SYNJ1_ENST00000357345.3_5'UTR			O43426	SYNJ1_HUMAN	synaptojanin 1						cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						CTCCTTTCTTCGGAGGCAGCC	0.488																																						uc002yqh.2		NA																	0				ovary(4)|skin(1)	5						c.(106-108)GAA>AAA		synaptojanin 1 isoform a							99.0	91.0	94.0					21																	34099218		2203	4300	6503	SO:0001631	upstream_gene_variant	8867						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr21:34099218C>T	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926		21.37:g.34099218C>T	Exception_encountered					SYNJ1_uc011ads.1_5'UTR|SYNJ1_uc002yqf.2_5'UTR|SYNJ1_uc002yqg.2_5'UTR|SYNJ1_uc002yqi.2_Missense_Mutation_p.E36K|uc002yqj.1_5'Flank|uc002yqk.2_5'Flank	p.E36K	NM_003895	NP_003886	O43426	SYNJ1_HUMAN			2	106	-			Error:Variant_position_missing_in_O43426_after_alignment					O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	c.106G>A	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893112	0.72524	.	.	ENSG00000159082	ENST00000382499;ENST00000433931	D;D	0.94000	-3.33;-2.5	4.54	3.58	0.41010	.	.	.	.	.	D	0.84302	0.5442	N	0.08118	0	0.80722	D	1	B	0.24368	0.102	B	0.10450	0.005	T	0.81538	-0.0887	9	0.40728	T	0.16	.	12.369	0.55244	0.0:0.8306:0.1694:0.0	.	36	C9JFZ1	.	K	36	ENSP00000371939:E36K;ENSP00000409667:E36K	ENSP00000371939:E36K	E	-	1	0	SYNJ1	33021089	0.986000	0.35501	0.996000	0.52242	0.964000	0.63967	2.738000	0.47401	2.092000	0.63282	0.456000	0.33151	GAA		0.488	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				24	46	0	0	0	0	24	46				
RIPK4	54101	broad.mit.edu	37	21	43166824	43166824	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr21:43166824G>A	ENST00000352483.2	-	5	845	c.781C>T	c.(781-783)Ctc>Ttc	p.L261F	RIPK4_ENST00000542057.1_Missense_Mutation_p.L198F|RIPK4_ENST00000332512.3_Missense_Mutation_p.L261F|RIPK4_ENST00000544709.1_Missense_Mutation_p.L198F			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CGCTGCATGAGGCGTATCAGG	0.672																																						uc002yzn.1		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(781-783)CTC>TTC		ankyrin repeat domain 3							43.0	45.0	44.0					21																	43166824		2202	4300	6502	SO:0001583	missense	54101					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr21:43166824G>A	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.781C>T	21.37:g.43166824G>A	ENSP00000330161:p.Leu261Phe						p.L261F	NM_020639	NP_065690	P57078	RIPK4_HUMAN			5	829	-			261					Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37	c.781C>T		.	.	.	.	.	.	.	.	.	.	G	29.6	5.017848	0.93404	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.28	5.28	0.74379	.	0.000000	0.53938	D	0.000049	D	0.82838	0.5124	M	0.64080	1.96	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84565	0.0652	10	0.87932	D	0	-37.95	17.9152	0.88947	0.0:0.0:1.0:0.0	.	261	P57078-2	.	F	261;261;198;198	ENSP00000332454:L261F;ENSP00000330161:L261F;ENSP00000441754:L198F;ENSP00000442901:L198F	ENSP00000332454:L261F	L	-	1	0	RIPK4	42039893	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	9.443000	0.97568	2.471000	0.83476	0.561000	0.74099	CTC		0.672	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639		22	42	0	0	0	0	22	42				
PCNT	5116	broad.mit.edu	37	21	47841931	47841931	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr21:47841931C>G	ENST00000359568.5	+	32	7179	c.7072C>G	c.(7072-7074)Cct>Gct	p.P2358A	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2358					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTCAGGAGGCCCTGAGGCTCA	0.612																																						uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(7072-7074)CCT>GCT		pericentrin							75.0	80.0	78.0					21																	47841931		2203	4300	6503	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47841931C>G	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7072C>G	21.37:g.47841931C>G	ENSP00000352572:p.Pro2358Ala					PCNT_uc002zjj.2_Missense_Mutation_p.P2240A	p.P2358A	NM_006031	NP_006022	O95613	PCNT_HUMAN			32	7179	+	Breast(49;0.112)		2358					O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.7072C>G	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.381343	0.01204	.	.	ENSG00000160299	ENST00000359568	T	0.01484	4.84	4.19	-2.56	0.06268	.	.	.	.	.	T	0.00936	0.0031	N	0.22421	0.69	0.09310	N	1	B;B	0.12013	0.005;0.004	B;B	0.09377	0.004;0.002	T	0.48937	-0.8990	9	0.02654	T	1	.	0.2075	0.00152	0.3047:0.2287:0.1401:0.3265	.	2240;2358	O95613-2;O95613	.;PCNT_HUMAN	A	2358	ENSP00000352572:P2358A	ENSP00000352572:P2358A	P	+	1	0	PCNT	46666359	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.192000	0.17096	-0.462000	0.06984	0.655000	0.94253	CCT		0.612	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		22	49	0	0	0	0	22	49				
MYH9	4627	broad.mit.edu	37	22	36701124	36701124	+	Silent	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr22:36701124G>T	ENST00000216181.5	-	18	2414	c.2184C>A	c.(2182-2184)tcC>tcA	p.S728S		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	728	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCTTGGGAATGGAGTTTGGAG	0.537			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(2182-2184)TCC>TCA		myosin, heavy polypeptide 9, non-muscle							134.0	125.0	128.0					22																	36701124		2203	4300	6503	SO:0001819	synonymous_variant	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36701124G>T		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2184C>A	22.37:g.36701124G>T						MYH9_uc003aph.1_Silent_p.S592S	p.S728S	NM_002473	NP_002464	P35579	MYH9_HUMAN			18	2415	-			728			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	c.2184C>A	CCDS13927.1																																																																																				0.537	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		20	45	1	0	2.38e-13	2.82e-13	20	45				
NDUFA6	4700	broad.mit.edu	37	22	42482286	42482286	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr22:42482286T>C	ENST00000498737.2	-	3	498	c.366A>G	c.(364-366)gtA>gtG	p.V122V	NDUFA6_ENST00000470753.1_Silent_p.V39V|NDUFA6_ENST00000602404.1_Silent_p.V96V	NM_002490.3	NP_002481.2	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa	122					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|lung(3)|upper_aerodigestive_tract(1)	5						GCTGCTTCCATACTTTAATTG	0.453																																						uc003bcb.2		NA																	0					0						c.(364-366)GTA>GTG		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						201.0	176.0	185.0					22																	42482286		2203	4300	6503	SO:0001819	synonymous_variant	4700				mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr22:42482286T>C	AF047182	CCDS33656.1	22q13.2	2010-05-07	2002-08-29		ENSG00000184983	ENSG00000184983		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7690	protein-coding gene	gene with protein product	"""complex I B14 subunit"""	602138	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (14kD, B14)"""			9763676, 9425316	Standard	NM_002490		Approved	B14, LYRM6, CI-B14, NADHB14	uc003bcb.3	P56556	OTTHUMG00000151287	ENST00000498737.2:c.366A>G	22.37:g.42482286T>C							p.V122V	NM_002490	NP_002481	P56556	NDUA6_HUMAN			3	428	-			122					B2RE54|O43675|Q6FGW0|Q6IBT8|Q6IC39	Silent	SNP	ENST00000498737.2	37	c.366A>G	CCDS33656.1																																																																																				0.453	NDUFA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322089.4	NM_002490		28	59	0	0	0	0	28	59				
CYP8B1	1582	broad.mit.edu	37	3	42917176	42917176	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:42917176G>T	ENST00000316161.4	-	1	457	c.133C>A	c.(133-135)Cat>Aat	p.H45N	KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.H45N|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	45					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		GCCATGGCATGGCCAAGCCAG	0.577																																						uc003cmh.2		NA																	0				ovary(2)	2						c.(133-135)CAT>AAT		cytochrome P450, family 8, subfamily B,							56.0	53.0	54.0					3																	42917176		2203	4300	6503	SO:0001583	missense	1582				bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity	g.chr3:42917176G>T	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.133C>A	3.37:g.42917176G>T	ENSP00000318867:p.His45Asn					CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.H45N	p.H45N	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)	1	458	-			45					B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	c.133C>A	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533292	0.45073	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.64085	-0.08;-0.08	5.04	3.2	0.36748	.	0.116572	0.64402	D	0.000017	T	0.66761	0.2822	M	0.64404	1.975	0.37955	D	0.932796	P;P	0.49253	0.921;0.779	P;P	0.53102	0.718;0.483	T	0.69154	-0.5220	10	0.49607	T	0.09	-16.7523	9.3366	0.38054	0.2998:0.0:0.7002:0.0	.	45;45	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	N	45	ENSP00000404499:H45N;ENSP00000318867:H45N	ENSP00000318867:H45N	H	-	1	0	CYP8B1	42892180	0.998000	0.40836	0.971000	0.41717	0.727000	0.41649	2.605000	0.46283	0.730000	0.32425	-1.134000	0.01955	CAT		0.577	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391		28	25	1	0	7.26e-15	8.67e-15	28	25				
CELSR3	1951	broad.mit.edu	37	3	48694603	48694603	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:48694603G>A	ENST00000164024.4	-	2	4207	c.3927C>T	c.(3925-3927)gaC>gaT	p.D1309D	CELSR3_ENST00000544264.1_Silent_p.D1309D	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1309					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGATGAAGACGTCCTCAGCGG	0.657																																						uc003cul.2		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(3925-3927)GAC>GAT		cadherin EGF LAG seven-pass G-type receptor 3							72.0	64.0	67.0					3																	48694603		2202	4300	6502	SO:0001819	synonymous_variant	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48694603G>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3927C>T	3.37:g.48694603G>A						CELSR3_uc003cuf.1_Silent_p.D1379D	p.D1309D	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	2	4208	-			1309			Extracellular (Potential).		O75092	Silent	SNP	ENST00000164024.4	37	c.3927C>T	CCDS2775.1																																																																																				0.657	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		9	14	0	0	0	0	9	14				
FILIP1L	11259	broad.mit.edu	37	3	99569270	99569270	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:99569270A>C	ENST00000354552.3	-	5	1720	c.1250T>G	c.(1249-1251)gTt>gGt	p.V417G	FILIP1L_ENST00000487087.1_5'UTR|CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000471562.1_Missense_Mutation_p.V177G|FILIP1L_ENST00000383694.2_Missense_Mutation_p.V177G|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000331335.5_Missense_Mutation_p.V417G	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	417						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						GAGTTTTTCAACCTCTAGTTT	0.368																																						uc003dtm.2		NA																	0				ovary(1)	1						c.(1249-1251)GTT>GGT		filamin A interacting protein 1-like isoform 1							111.0	104.0	106.0					3																	99569270		1806	4076	5882	SO:0001583	missense	11259					cytoplasm|membrane|myosin complex|nucleus		g.chr3:99569270A>C		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1250T>G	3.37:g.99569270A>C	ENSP00000346560:p.Val417Gly					C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Missense_Mutation_p.V417G|FILIP1L_uc010hpf.2_5'UTR|FILIP1L_uc010hpg.2_Missense_Mutation_p.V177G|FILIP1L_uc003dtn.2_Missense_Mutation_p.V177G|FILIP1L_uc003dtp.1_Missense_Mutation_p.V177G	p.V417G	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN			5	1713	-			417			Potential.		B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	SNP	ENST00000354552.3	37	c.1250T>G	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.271491	0.59649	.	.	ENSG00000168386	ENST00000354552;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	T;T;T;T;T	0.44881	0.91;1.32;0.91;1.33;1.36	5.55	4.39	0.52855	.	0.139707	0.32301	N	0.006290	T	0.60856	0.2301	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.66351	0.943;0.878	T	0.63717	-0.6574	10	0.72032	D	0.01	-5.0123	11.376	0.49728	0.9287:0.0:0.0713:0.0	.	417;417	Q4L180-2;Q4L180	.;FIL1L_HUMAN	G	417;177;417;177;163;177	ENSP00000346560:V417G;ENSP00000419642:V177G;ENSP00000327880:V417G;ENSP00000373192:V177G;ENSP00000419874:V177G	ENSP00000327880:V417G	V	-	2	0	FILIP1L	101051960	1.000000	0.71417	0.984000	0.44739	0.983000	0.72400	9.331000	0.96430	0.932000	0.37266	-0.256000	0.11100	GTT		0.368	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890		45	46	0	0	0	0	45	46				
TRMT10C	54931	broad.mit.edu	37	3	101283915	101283915	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:101283915T>G	ENST00000309922.6	+	2	444	c.290T>G	c.(289-291)tTc>tGc	p.F97C		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	97					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										ACCAGAGAGTTCATTGAGATG	0.403																																						uc003duz.2		NA																	0				ovary(1)	1						c.(289-291)TTC>TGC		RNA (guanine-9-) methyltransferase domain							102.0	94.0	96.0					3																	101283915		1903	4138	6041	SO:0001583	missense	54931				tRNA processing	mitochondrion	methyltransferase activity|protein binding	g.chr3:101283915T>G	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.290T>G	3.37:g.101283915T>G	ENSP00000312356:p.Phe97Cys						p.F97C	NM_017819	NP_060289	Q7L0Y3	MRRP1_HUMAN			2	438	+			97					Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	c.290T>G	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521184	0.44866	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.43688	0.94;0.94	5.87	4.65	0.58169	.	0.487974	0.20921	N	0.083262	T	0.27349	0.0671	L	0.29908	0.895	0.24503	N	0.99425	P	0.45078	0.85	B	0.37780	0.258	T	0.16305	-1.0407	10	0.39692	T	0.17	-24.0484	8.5011	0.33159	0.0:0.075:0.1331:0.7919	.	97	Q7L0Y3	MRRP1_HUMAN	C	97	ENSP00000312356:F97C;ENSP00000419389:F97C	ENSP00000312356:F97C	F	+	2	0	RG9MTD1	102766605	0.996000	0.38824	0.978000	0.43139	0.996000	0.88848	2.463000	0.45058	2.371000	0.80710	0.533000	0.62120	TTC		0.403	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819		14	60	0	0	0	0	14	60				
SNX4	8723	broad.mit.edu	37	3	125172710	125172710	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:125172710T>C	ENST00000251775.4	-	12	1158	c.1134A>G	c.(1132-1134)ctA>ctG	p.L378L	SNX4_ENST00000536067.1_Silent_p.L233L	NM_003794.2	NP_003785.1	O95219	SNX4_HUMAN	sorting nexin 4	378					endocytic recycling (GO:0032456)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|early endosome membrane (GO:0031901)|membrane (GO:0016020)|protein complex (GO:0043234)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(2)|central_nervous_system(1)|lung(6)|ovary(1)|skin(1)	11						TTTGTTCTTCTAGCACCTTTA	0.393																																						uc003eib.2		NA																	0				breast(2)|ovary(1)|central_nervous_system(1)	4						c.(1132-1134)CTA>CTG		sorting nexin 4							148.0	144.0	146.0					3																	125172710		2203	4300	6503	SO:0001819	synonymous_variant	8723				cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding	g.chr3:125172710T>C	AF065485	CCDS3032.1	3q21.2	2014-02-12			ENSG00000114520	ENSG00000114520		"""Sorting nexins"""	11175	protein-coding gene	gene with protein product		605931				9819414	Standard	NM_003794		Approved	ATG24B	uc003eib.4	O95219	OTTHUMG00000159575	ENST00000251775.4:c.1134A>G	3.37:g.125172710T>C						SNX4_uc011bkf.1_Silent_p.L233L	p.L378L	NM_003794	NP_003785	O95219	SNX4_HUMAN			12	1176	-			378					B3KMH0|B4DQV4|D3DNA3	Silent	SNP	ENST00000251775.4	37	c.1134A>G	CCDS3032.1																																																																																				0.393	SNX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356299.1	NM_003794		20	46	0	0	0	0	20	46				
COL6A6	131873	broad.mit.edu	37	3	130283910	130283910	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:130283910T>C	ENST00000358511.6	+	3	765	c.734T>C	c.(733-735)tTt>tCt	p.F245S	COL6A6_ENST00000453409.2_Missense_Mutation_p.F245S	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	245	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GAGGAGAACTTTGACTATCTT	0.418																																						uc010htl.2		NA																	0				ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(733-735)TTT>TCT		collagen type VI alpha 6 precursor							139.0	134.0	136.0					3																	130283910		1891	4123	6014	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130283910T>C	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.734T>C	3.37:g.130283910T>C	ENSP00000351310:p.Phe245Ser						p.F245S	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN			3	765	+			245			Nonhelical region.|VWFA 2.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.734T>C	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.783477	0.49891	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.88354	-2.37;-2.37	5.09	5.09	0.68999	von Willebrand factor, type A (3);	0.463917	0.20225	N	0.096607	D	0.95017	0.8387	M	0.90870	3.155	0.38817	D	0.955556	D	0.58620	0.983	P	0.62298	0.9	D	0.96627	0.9464	10	0.87932	D	0	.	14.8295	0.70137	0.0:0.0:0.0:1.0	.	245	A6NMZ7	CO6A6_HUMAN	S	245	ENSP00000351310:F245S;ENSP00000399236:F245S	ENSP00000351310:F245S	F	+	2	0	COL6A6	131766600	1.000000	0.71417	0.385000	0.26158	0.066000	0.16364	4.481000	0.60250	2.053000	0.61076	0.459000	0.35465	TTT		0.418	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		43	83	0	0	0	0	43	83				
IL20RB	53833	broad.mit.edu	37	3	136708366	136708366	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:136708366G>C	ENST00000329582.4	+	4	739	c.490G>C	c.(490-492)Gag>Cag	p.E164Q	IL20RB_ENST00000309741.5_Missense_Mutation_p.E117Q	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	164	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						GCCCCAGTTTGAGTTCCTTGT	0.567																																						uc003eri.1		NA																	0				ovary(1)	1						c.(490-492)GAG>CAG		interleukin 20 receptor beta precursor							66.0	65.0	66.0					3																	136708366		2203	4300	6503	SO:0001583	missense	53833					integral to membrane	receptor activity	g.chr3:136708366G>C	BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.490G>C	3.37:g.136708366G>C	ENSP00000328133:p.Glu164Gln					IL20RB_uc003erj.1_RNA|IL20RB_uc010hud.1_Missense_Mutation_p.E22Q	p.E164Q	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN			4	739	+			164			Extracellular (Potential).|Fibronectin type-III 2.		B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Missense_Mutation	SNP	ENST00000329582.4	37	c.490G>C	CCDS3093.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.746622	0.49257	.	.	ENSG00000174564	ENST00000329582;ENST00000309741	T	0.29142	1.58	5.43	4.54	0.55810	Fibronectin, type III (1);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.174540	0.40222	N	0.001154	T	0.18964	0.0455	N	0.16656	0.425	0.31260	N	0.69303	B	0.21071	0.051	B	0.22152	0.038	T	0.14008	-1.0488	9	.	.	.	-0.12	12.0087	0.53274	0.0:0.1745:0.8255:0.0	.	164	Q6UXL0	I20RB_HUMAN	Q	164;117	ENSP00000328133:E164Q	.	E	+	1	0	IL20RB	138191056	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.465000	0.45075	1.263000	0.44181	0.655000	0.94253	GAG		0.567	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357277.2	NM_144717		12	39	0	0	0	0	12	39				
COPB2	9276	broad.mit.edu	37	3	139092255	139092255	+	Splice_Site	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:139092255C>A	ENST00000333188.5	-	9	1076		c.e9-1		COPB2_ENST00000507777.1_Splice_Site	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)						COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						CCCGACCAAGCTGAAAGAAAG	0.408																																						uc003etf.3		NA																	0				ovary(2)	2						c.e9-1		coatomer protein complex, subunit beta 2 (beta							57.0	55.0	56.0					3																	139092255		2203	4300	6503	SO:0001630	splice_region_variant	9276				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity	g.chr3:139092255C>A	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.895-1G>T	3.37:g.139092255C>A						COPB2_uc011bmv.1_Splice_Site_p.L270_splice|COPB2_uc010hui.2_Splice_Site_p.L270_splice	p.L299_splice	NM_004766	NP_004757	P35606	COPB2_HUMAN			9	1025	-								B4DZI8	Splice_Site	SNP	ENST00000333188.5	37	c.895_splice	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365936	0.82463	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.439	0.94809	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COPB2	140574945	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.776000	0.85560	2.668000	0.90789	0.591000	0.81541	.		0.408	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	Intron	9	29	1	0	3.1e-07	3.51e-07	9	29				
ARHGEF26	26084	broad.mit.edu	37	3	153840472	153840472	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:153840472C>G	ENST00000356448.4	+	2	975	c.691C>G	c.(691-693)Cct>Gct	p.P231A	ARHGEF26_ENST00000465093.1_Missense_Mutation_p.P231A|ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26-AS1_ENST00000479270.1_RNA|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.P231A|ARHGEF26-AS1_ENST00000480639.1_RNA|ARHGEF26-AS1_ENST00000491862.1_RNA	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	231					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						CCTCGAGAATCCTTCCGTGGT	0.542																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	uc011bog.1		NA																	0				large_intestine(1)	1						c.(691-693)CCT>GCT		Src homology 3 domain-containing guanine							16.0	19.0	18.0					3																	153840472		1855	4089	5944	SO:0001583	missense	26084				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity	g.chr3:153840472C>G	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.691C>G	3.37:g.153840472C>G	ENSP00000348828:p.Pro231Ala					uc003ezu.1_5'Flank|SGEF_uc011boh.1_Missense_Mutation_p.P231A	p.P231A	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		2	902	+			231					B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	37	c.691C>G	CCDS46938.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648677	0.47258	.	.	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.56444	0.46;0.46;2.22	5.04	3.24	0.37175	.	0.287569	0.34750	N	0.003710	T	0.31796	0.0808	L	0.27053	0.805	0.09310	N	0.999998	P;B	0.35745	0.518;0.19	B;B	0.27380	0.079;0.033	T	0.11817	-1.0572	10	0.15066	T	0.55	-5.2306	10.8246	0.46625	0.0:0.8444:0.0:0.1556	.	231;231	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	A	231	ENSP00000348828:P231A;ENSP00000423418:P231A;ENSP00000423295:P231A	ENSP00000348828:P231A	P	+	1	0	ARHGEF26	155323162	0.109000	0.22037	0.003000	0.11579	0.244000	0.25665	2.049000	0.41288	0.517000	0.28361	0.655000	0.94253	CCT		0.542	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595		12	16	0	0	0	0	12	16				
SLC33A1	9197	broad.mit.edu	37	3	155551699	155551699	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:155551699T>C	ENST00000392845.3	-	3	1475	c.1095A>G	c.(1093-1095)aaA>aaG	p.K365K	SLC33A1_ENST00000359479.3_Silent_p.K365K			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	365					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTGCAGTGTATTTGCTGATAA	0.388																																						uc003fan.3		NA																	0				ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1093-1095)AAA>AAG		acetyl-coenzyme A transporter							98.0	97.0	97.0					3																	155551699		2203	4300	6503	SO:0001819	synonymous_variant	9197				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity	g.chr3:155551699T>C	D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.1095A>G	3.37:g.155551699T>C						SLC33A1_uc003fao.1_Silent_p.K365K	p.K365K	NM_004733	NP_004724	O00400	ACATN_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		3	1476	-			365			Cytoplasmic (Potential).		B2R5Q2|D3DNK4	Silent	SNP	ENST00000392845.3	37	c.1095A>G	CCDS3173.1	.	.	.	.	.	.	.	.	.	.	T	13.00	2.106536	0.37145	.	.	ENSG00000169359	ENST00000475842	.	.	.	6.04	-5.62	0.02481	.	.	.	.	.	T	0.65842	0.2730	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68827	-0.5306	4	.	.	.	-5.1952	17.1508	0.86777	0.0:0.6163:0.0:0.3837	.	.	.	.	V	85	.	.	I	-	1	0	SLC33A1	157034393	0.930000	0.31532	0.783000	0.31826	0.998000	0.95712	0.006000	0.13152	-0.731000	0.04862	0.529000	0.55759	ATA		0.388	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351130.3	NM_004733		16	38	0	0	0	0	16	38				
GOLIM4	27333	broad.mit.edu	37	3	167747722	167747722	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:167747722G>C	ENST00000470487.1	-	10	1968	c.1279C>G	c.(1279-1281)Ctg>Gtg	p.L427V	GOLIM4_ENST00000309027.4_Missense_Mutation_p.L399V	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	427	Gln-rich.|Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						tgttcccgcagctgctgGGCC	0.577																																						uc003ffe.2		NA																	0				breast(4)|skin(1)	5						c.(1279-1281)CTG>GTG		golgi integral membrane protein 4							81.0	73.0	76.0					3																	167747722		2203	4300	6503	SO:0001583	missense	27333				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus		g.chr3:167747722G>C	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1279C>G	3.37:g.167747722G>C	ENSP00000417354:p.Leu427Val					GOLIM4_uc011bpe.1_Missense_Mutation_p.L427V|GOLIM4_uc011bpf.1_Missense_Mutation_p.L399V|GOLIM4_uc011bpg.1_Missense_Mutation_p.L399V	p.L427V	NM_014498	NP_055313	O00461	GOLI4_HUMAN			10	1623	-			427			Glu-rich.|Gln-rich.|Lumenal (Potential).			Missense_Mutation	SNP	ENST00000470487.1	37	c.1279C>G	CCDS3204.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.531048	0.45073	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.65	4.77	0.60923	.	0.128851	0.53938	D	0.000055	T	0.57636	0.2067	M	0.72894	2.215	0.22601	N	0.998941	P;P	0.40180	0.705;0.705	P;P	0.49276	0.605;0.605	T	0.51903	-0.8646	9	0.26408	T	0.33	-2.2345	14.6524	0.68808	0.0711:0.0:0.9289:0.0	.	399;427	F8W785;O00461	.;GOLI4_HUMAN	V	427;399	.	ENSP00000309893:L399V	L	-	1	2	GOLIM4	169230416	0.450000	0.25697	0.235000	0.24058	0.334000	0.28698	2.657000	0.46724	1.400000	0.46741	0.555000	0.69702	CTG		0.577	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2			30	112	0	0	0	0	30	112				
KLHL24	54800	broad.mit.edu	37	3	183369021	183369021	+	Missense_Mutation	SNP	A	A	G	rs529830658		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr3:183369021A>G	ENST00000454652.2	+	4	1263	c.877A>G	c.(877-879)Ata>Gta	p.I293V	KLHL24_ENST00000242810.6_Missense_Mutation_p.I293V|KLHL24_ENST00000476808.1_Missense_Mutation_p.I293V	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	293						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			ACGGTACCACATACTTGGGAA	0.388																																						uc003flv.2		NA																	0				ovary(1)	1						c.(877-879)ATA>GTA		DRE1 protein							61.0	60.0	60.0					3																	183369021		2203	4300	6503	SO:0001583	missense	54800					axon|cytoplasm|perikaryon		g.chr3:183369021A>G		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.877A>G	3.37:g.183369021A>G	ENSP00000395012:p.Ile293Val					KLHL24_uc003flw.2_Missense_Mutation_p.I293V|KLHL24_uc003flx.2_Missense_Mutation_p.I293V	p.I293V	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)		3	1172	+	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		293					A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	c.877A>G	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	A	10.23	1.291652	0.23564	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.67865	-0.29;-0.29;-0.23	5.09	5.09	0.68999	Galactose oxidase, beta-propeller (1);	0.098186	0.64402	D	0.000002	T	0.52338	0.1728	N	0.25647	0.755	0.41204	D	0.986395	B;B	0.06786	0.001;0.0	B;B	0.08055	0.002;0.003	T	0.52465	-0.8572	10	0.56958	D	0.05	.	10.1563	0.42825	0.9213:0.0:0.0787:0.0	.	293;293	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	V	293	ENSP00000242810:I293V;ENSP00000395012:I293V;ENSP00000419010:I293V	ENSP00000242810:I293V	I	+	1	0	KLHL24	184851715	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.005000	0.63972	1.905000	0.55150	0.377000	0.23210	ATA		0.388	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		13	48	0	0	0	0	13	48				
TBCK	93627	broad.mit.edu	37	4	107165855	107165855	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr4:107165855C>G	ENST00000273980.5	-	12	1445	c.998G>C	c.(997-999)gGa>gCa	p.G333A	TBCK_ENST00000394706.3_Missense_Mutation_p.G294A|TBCK_ENST00000394708.2_Missense_Mutation_p.G333A|TBCK_ENST00000432496.2_Missense_Mutation_p.G333A|TBCK_ENST00000361687.4_Missense_Mutation_p.G270A					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						CAAGTCACCTCCAGCCAAACA	0.363																																						uc010ilv.2		NA																	0				large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						c.(997-999)GGA>GCA		TBC domain-containing protein kinase-like							115.0	110.0	112.0					4																	107165855		2203	4300	6503	SO:0001583	missense	93627					intracellular	Rab GTPase activator activity	g.chr4:107165855C>G		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.998G>C	4.37:g.107165855C>G	ENSP00000273980:p.Gly333Ala					TBCK_uc003hyb.2_Missense_Mutation_p.G76A|TBCK_uc003hye.2_Missense_Mutation_p.G294A|TBCK_uc003hyc.2_Missense_Mutation_p.G270A|TBCK_uc003hyd.2_Missense_Mutation_p.G161A|TBCK_uc003hyf.2_Missense_Mutation_p.G333A	p.G333A	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN			11	1363	-			333						Missense_Mutation	SNP	ENST00000273980.5	37	c.998G>C	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416104	0.83449	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.38401	0.1039	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.998	D;D;D	0.97110	0.948;1.0;0.965	T	0.19976	-1.0289	10	0.87932	D	0	.	18.566	0.91116	0.0:1.0:0.0:0.0	.	333;294;270	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	A	333;333;270;294;333	ENSP00000273980:G333A;ENSP00000405847:G333A;ENSP00000355338:G270A;ENSP00000378196:G294A;ENSP00000378198:G333A	ENSP00000273980:G333A	G	-	2	0	TBCK	107385304	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.610000	0.82949	2.370000	0.80446	0.644000	0.83932	GGA		0.363	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		18	12	0	0	0	0	18	12				
PRSS48	345062	broad.mit.edu	37	4	152201007	152201007	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr4:152201007C>T	ENST00000455694.2	+	2	114	c.112C>T	c.(112-114)Cgc>Tgc	p.R38C	SH3D19_ENST00000604030.1_Intron|PRSS48_ENST00000441586.2_Intron	NM_183375.2	NP_899231.2	Q7RTY5	PRS48_HUMAN	protease, serine, 48	38	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8						TGCTGCAGGGCGCTGGCCTTG	0.527																																						uc011cif.1		NA																	0				large_intestine(1)	1						c.(112-114)CGC>TGC		epidermis-specific serine protease-like protein							111.0	108.0	109.0					4																	152201007		2018	4176	6194	SO:0001583	missense	345062				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr4:152201007C>T	BN000134	CCDS47145.1	4q31.3	2010-05-07			ENSG00000189099	ENSG00000189099		"""Serine peptidases / Serine peptidases"""	24635	protein-coding gene	gene with protein product						12838346	Standard	NM_183375		Approved	ESSPL	uc011cif.2	Q7RTY5	OTTHUMG00000161673	ENST00000455694.2:c.112C>T	4.37:g.152201007C>T	ENSP00000401328:p.Arg38Cys					PRSS48_uc011cig.1_Intron	p.R38C	NM_183375	NP_899231	Q7RTY5	PRS48_HUMAN			2	112	+			38			Peptidase S1.		Q08E82|Q0VAD4	Missense_Mutation	SNP	ENST00000455694.2	37	c.112C>T	CCDS47145.1	.	.	.	.	.	.	.	.	.	.	c	10.61	1.397613	0.25205	.	.	ENSG00000189099	ENST00000455694	T	0.31247	1.5	4.92	-0.511	0.11970	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.199900	0.06467	N	0.730511	T	0.40670	0.1126	M	0.72576	2.205	0.09310	N	1	D	0.76494	0.999	P	0.54174	0.744	T	0.28776	-1.0033	10	0.54805	T	0.06	.	2.7885	0.05380	0.3972:0.2847:0.2324:0.0857	.	38	Q7RTY5	PRS48_HUMAN	C	38	ENSP00000401328:R38C	ENSP00000401328:R38C	R	+	1	0	PRSS48	152420457	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-1.184000	0.03076	0.034000	0.15491	-0.196000	0.12772	CGC		0.527	PRSS48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365685.3	NM_183375		28	30	0	0	0	0	28	30				
FGA	2243	broad.mit.edu	37	4	155510666	155510666	+	Missense_Mutation	SNP	G	G	A	rs121909606		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr4:155510666G>A	ENST00000302053.3	-	2	181	c.103C>T	c.(103-105)Cgt>Tgt	p.R35C	FGA_ENST00000403106.3_Missense_Mutation_p.R35C	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	35		Cleavage; by thrombin; to release fibrinopeptide A.	R -> C.|R -> H. {ECO:0000269|PubMed:8461606}.		blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.R35C(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CTTGGGCCACGCACGCCTCCT	0.493																																					NSCLC(143;340 1922 20892 22370 48145)	uc003iod.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|breast(1)	3	GRCh37	CM930249	FGA	M	rs121909606	c.(103-105)CGT>TGT		fibrinogen, alpha polypeptide isoform alpha-E	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)						155.0	145.0	148.0					4																	155510666		2203	4300	6503	SO:0001583	missense	2243				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155510666G>A		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.103C>T	4.37:g.155510666G>A	ENSP00000306361:p.Arg35Cys					FGA_uc003ioe.1_Missense_Mutation_p.R35C|FGA_uc003iof.1_Missense_Mutation_p.R35C	p.R35C	NM_000508	NP_000499	P02671	FIBA_HUMAN			2	161	-	all_hematologic(180;0.215)	Renal(120;0.0458)	35		R -> C.|R -> H.		Cleavage; by thrombin; to release fibrinopeptide A.	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	c.103C>T	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713301	0.68730	.	.	ENSG00000171560	ENST00000302053;ENST00000403106;ENST00000457487	T;T	0.76186	-1.0;1.58	5.58	5.58	0.84498	.	0.293343	0.38436	N	0.001687	D	0.86818	0.6024	M	0.76002	2.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.87693	0.2555	10	0.87932	D	0	.	19.5768	0.95447	0.0:0.0:1.0:0.0	.	35;35;35	A8K3E4;P02671-2;P02671	.;.;FIBA_HUMAN	C	35	ENSP00000306361:R35C;ENSP00000385981:R35C	ENSP00000306361:R35C	R	-	1	0	FGA	155730116	1.000000	0.71417	0.955000	0.39395	0.266000	0.26442	6.473000	0.73572	2.622000	0.88805	0.650000	0.86243	CGT		0.493	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508		42	19	0	0	0	0	42	19				
ICE1	23379	broad.mit.edu	37	5	5461761	5461761	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:5461761A>G	ENST00000296564.7	+	13	2536	c.2314A>G	c.(2314-2316)Ata>Gta	p.I772V		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		772					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CACATCATTAATAGGTTCTCA	0.388																																						uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2314-2316)ATA>GTA		hypothetical protein LOC23379							83.0	73.0	76.0					5																	5461761		1905	4127	6032	SO:0001583	missense	23379							g.chr5:5461761A>G																												ENST00000296564.7:c.2314A>G	5.37:g.5461761A>G	ENSP00000296564:p.Ile772Val						p.I772V	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			13	2536	+			772					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.2314A>G	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	1.303	-0.604419	0.03717	.	.	ENSG00000164151	ENST00000296564	T	0.09538	2.97	5.16	-5.39	0.02664	.	3.252940	0.00851	N	0.001836	T	0.04452	0.0122	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36335	-0.9752	10	0.06365	T	0.9	0.021	6.628	0.22841	0.4664:0.3619:0.1717:0.0	.	772	Q9Y2F5	K0947_HUMAN	V	772	ENSP00000296564:I772V	ENSP00000296564:I772V	I	+	1	0	KIAA0947	5514761	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-0.851000	0.04313	-1.361000	0.02169	-0.467000	0.05162	ATA		0.388	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			9	22	0	0	0	0	9	22				
SLC27A6	28965	broad.mit.edu	37	5	128324299	128324299	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:128324299C>T	ENST00000262462.4	+	3	1702	c.692C>T	c.(691-693)cCa>cTa	p.P231L	SLC27A6_ENST00000506176.1_Missense_Mutation_p.P231L|SLC27A6_ENST00000395266.1_Missense_Mutation_p.P231L			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	231				P -> S (in Ref. 3; CAG33410). {ECO:0000305}.	long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CCAGGTCTACCAAAAGCAGCT	0.368																																						uc003kuy.2		NA																	0					0						c.(691-693)CCA>CTA		solute carrier family 27 (fatty acid							143.0	147.0	145.0					5																	128324299		2203	4300	6503	SO:0001583	missense	28965				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	g.chr5:128324299C>T	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.692C>T	5.37:g.128324299C>T	ENSP00000262462:p.Pro231Leu					SLC27A6_uc003kuz.2_Missense_Mutation_p.P231L	p.P231L	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	4	1088	+		all_cancers(142;0.0483)|Prostate(80;0.055)	231	P -> S (in Ref. 3; CAG33410).		AMP (Potential).		Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	c.692C>T	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540551	0.85917	.	.	ENSG00000113396	ENST00000508645;ENST00000262462;ENST00000395266;ENST00000506176	T;D;D;D	0.84944	0.16;-1.92;-1.92;-1.92	4.18	4.18	0.49190	AMP-dependent synthetase/ligase (1);AMP-binding, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95611	0.8573	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97370	0.9975	9	.	.	.	-3.7502	17.8288	0.88674	0.0:1.0:0.0:0.0	.	231	Q9Y2P4	S27A6_HUMAN	L	50;231;231;231	ENSP00000421759:P50L;ENSP00000262462:P231L;ENSP00000378684:P231L;ENSP00000421024:P231L	.	P	+	2	0	SLC27A6	128352198	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.948000	0.75965	2.640000	0.89533	0.655000	0.94253	CCA		0.368	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031		30	32	0	0	0	0	30	32				
WNT8A	7478	broad.mit.edu	37	5	137426396	137426396	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:137426396C>T	ENST00000398754.1	+	6	695	c.690C>T	c.(688-690)agC>agT	p.S230S	WNT8A_ENST00000506684.1_Silent_p.S248S	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	230					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTGGGAACAGCGCCGAGGGCC	0.542																																						uc003lcd.1		NA																	0				ovary(1)|lung(1)|breast(1)|skin(1)	4						c.(688-690)AGC>AGT		wingless-type MMTV integration site family,							44.0	49.0	47.0					5																	137426396		1951	4150	6101	SO:0001819	synonymous_variant	7478				brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity	g.chr5:137426396C>T	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.690C>T	5.37:g.137426396C>T						BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Silent_p.S248S|WNT8A_uc011cyk.1_Silent_p.S248S	p.S230S	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		6	695	+			230					Q96S51	Silent	SNP	ENST00000398754.1	37	c.690C>T	CCDS43368.1																																																																																				0.542	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244		19	28	0	0	0	0	19	28				
PCDHA2	56146	broad.mit.edu	37	5	140175998	140175998	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:140175998C>A	ENST00000526136.1	+	1	1449	c.1449C>A	c.(1447-1449)gaC>gaA	p.D483E	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.D483E|PCDHA2_ENST00000378132.1_Missense_Mutation_p.D483E	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	483	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGATGCGGACGCGCAGGAGA	0.657																																						uc003lhd.2		NA																	0				ovary(4)	4						c.(1447-1449)GAC>GAA		protocadherin alpha 2 isoform 1 precursor							71.0	74.0	73.0					5																	140175998		2203	4300	6503	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140175998C>A	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1449C>A	5.37:g.140175998C>A	ENSP00000431748:p.Asp483Glu					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.D483E|PCDHA2_uc011czy.1_Missense_Mutation_p.D483E	p.D483E	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1555	+			483			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1449C>A	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	11.98	1.800657	0.31869	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.73789	-0.78;-0.78;-0.78	3.94	-0.157	0.13387	Cadherin (4);Cadherin-like (1);	0.000000	0.41194	U	0.000923	D	0.87993	0.6318	H	0.96430	3.82	0.24291	N	0.995166	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79240	-0.1885	10	0.87932	D	0	.	9.0795	0.36542	0.0:0.5966:0.0:0.4033	.	483;483;483	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	E	483	ENSP00000430584:D483E;ENSP00000367372:D483E;ENSP00000431748:D483E	ENSP00000367372:D483E	D	+	3	2	PCDHA2	140156182	0.000000	0.05858	0.964000	0.40570	0.130000	0.20726	-0.319000	0.08039	-0.027000	0.13873	-0.779000	0.03376	GAC		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		38	82	1	0	7.05e-23	8.59e-23	38	82				
PCDHA3	56145	broad.mit.edu	37	5	140182672	140182672	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:140182672G>T	ENST00000522353.2	+	1	1890	c.1890G>T	c.(1888-1890)gaG>gaT	p.E630D	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.E630D|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	630	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACACGGGAGAGATCAGCACGA	0.657																																						uc003lhf.2		NA																	0				ovary(6)|skin(2)	8						c.(1888-1890)GAG>GAT		protocadherin alpha 3 isoform 1 precursor							79.0	78.0	78.0					5																	140182672		2203	4299	6502	SO:0001583	missense	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140182672G>T	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1890G>T	5.37:g.140182672G>T	ENSP00000429808:p.Glu630Asp					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.E630D	p.E630D	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1890	+			630			Cadherin 6.|Extracellular (Potential).		O75286	Missense_Mutation	SNP	ENST00000522353.2	37	c.1890G>T	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	g	16.08	3.020312	0.54576	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.50813	0.73;0.73	4.32	3.44	0.39384	Cadherin (4);Cadherin-like (1);	0.000000	0.35585	U	0.003108	T	0.65821	0.2728	M	0.86097	2.795	0.30494	N	0.771062	D;D	0.63880	0.993;0.993	P;D	0.63381	0.767;0.914	T	0.68401	-0.5418	10	0.87932	D	0	.	8.9293	0.35661	0.1738:0.0:0.8262:0.0	.	630;630	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	D	630	ENSP00000429808:E630D;ENSP00000434086:E630D	ENSP00000429808:E630D	E	+	3	2	PCDHA3	140162856	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	1.962000	0.40442	0.935000	0.37341	0.467000	0.42956	GAG		0.657	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		22	56	1	0	2.89e-11	3.4e-11	22	56				
PCDHGB3	56102	broad.mit.edu	37	5	140750142	140750142	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:140750142T>G	ENST00000576222.1	+	1	312	c.181T>G	c.(181-183)Tta>Gta	p.L61V	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGGGGATTTACCTACTAG	0.557																																						uc003ljw.1		NA																	0					0						c.(181-183)TTA>GTA		protocadherin gamma subfamily B, 3 isoform 1							100.0	108.0	106.0					5																	140750142		1847	4095	5942	SO:0001583	missense	56102				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140750142T>G	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.181T>G	5.37:g.140750142T>G	ENSP00000461862:p.Leu61Val					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Missense_Mutation_p.L61V	p.L61V	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	181	+			61			Extracellular (Potential).|Cadherin 1.		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.181T>G	CCDS58980.1																																																																																				0.557	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		6	142	0	0	0	0	6	142				
PCDHGB3	56102	broad.mit.edu	37	5	140779261	140779261	+	Intron	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:140779261A>T	ENST00000576222.1	+	1	2546				PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTGCGCACCTTCGAACT	0.647																																						uc003lkf.1		NA																	0					0						c.(1567-1569)ACC>TCC		protocadherin gamma subfamily B, 5 isoform 1							28.0	33.0	31.0					5																	140779261		2033	4181	6214	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140779261A>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26885A>T	5.37:g.140779261A>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.T523S	p.T523S	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1567	+			523			Extracellular (Potential).|Cadherin 5.		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.1567A>T	CCDS58980.1																																																																																				0.647	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		10	24	0	0	0	0	10	24				
GLRA1	2741	broad.mit.edu	37	5	151202317	151202317	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:151202317A>C	ENST00000455880.2	-	9	1577	c.1291T>G	c.(1291-1293)Ttc>Gtc	p.F431V	GLRA1_ENST00000545569.1_Missense_Mutation_p.F340V|GLRA1_ENST00000274576.4_Missense_Mutation_p.F423V			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	431					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCCATGGGGAAGCCAATGCGG	0.507																																						uc003lut.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1291-1293)TTC>GTC		glycine receptor, alpha 1 isoform 1 precursor	Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						135.0	143.0	140.0					5																	151202317		2203	4300	6503	SO:0001583	missense	2741				muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity	g.chr5:151202317A>C		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.1291T>G	5.37:g.151202317A>C	ENSP00000411593:p.Phe431Val					GLRA1_uc003lur.2_Missense_Mutation_p.F423V|GLRA1_uc003lus.2_Missense_Mutation_p.F340V	p.F431V	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		9	1578	-		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	431			Helical; (Probable).		B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	c.1291T>G	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337995	0.81911	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.90900	-2.75;-2.75;-2.75	5.03	5.03	0.67393	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95519	0.8544	M	0.85373	2.75	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.999	D	0.96213	0.9154	10	0.87932	D	0	.	14.7566	0.69569	1.0:0.0:0.0:0.0	.	431;340;423	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	V	423;431;340	ENSP00000274576:F423V;ENSP00000411593:F431V;ENSP00000445913:F340V	ENSP00000274576:F423V	F	-	1	0	GLRA1	151182510	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.241000	0.78201	1.871000	0.54225	0.460000	0.39030	TTC		0.507	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1			26	42	0	0	0	0	26	42				
MICB	4277	broad.mit.edu	37	6	31473459	31473459	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:31473459C>A	ENST00000252229.6	+	2	215	c.136C>A	c.(136-138)Ctc>Atc	p.L46I	MICB_ENST00000538442.1_Missense_Mutation_p.L14I|MICB_ENST00000399150.3_Missense_Mutation_p.L46I	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						GTCAGGGTTTCTCGCTGAGGG	0.562																																						uc003ntn.3		NA																	0					0						c.(136-138)CTC>ATC		MHC class I polypeptide-related sequence B							98.0	101.0	100.0					6																	31473459		1285	2566	3851	SO:0001583	missense	4277				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding	g.chr6:31473459C>A		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.136C>A	6.37:g.31473459C>A	ENSP00000252229:p.Leu46Ile					MICB_uc011dnm.1_Missense_Mutation_p.L14I|MICB_uc003nto.3_Missense_Mutation_p.L46I	p.L46I	NM_005931	NP_005922	Q29980	MICB_HUMAN			2	252	+			46			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000252229.6	37	c.136C>A	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	N	11.39	1.624228	0.28889	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.00655	5.95;5.95;5.95	2.68	-1.27	0.09347	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.142430	0.06881	U	0.802425	T	0.00496	0.0016	L	0.31371	0.925	0.09310	N	1	P;D;D	0.76494	0.913;0.999;0.994	D;D;D	0.91635	0.986;0.999;0.999	T	0.46992	-0.9151	10	0.11485	T	0.65	.	2.9044	0.05716	0.0:0.3683:0.2387:0.393	.	14;46;46	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	I	14;46;46	ENSP00000442345:L14I;ENSP00000382103:L46I;ENSP00000252229:L46I	ENSP00000252229:L46I	L	+	1	0	MICB	31581438	0.000000	0.05858	0.001000	0.08648	0.058000	0.15608	-1.124000	0.03260	-0.116000	0.11893	0.305000	0.20034	CTC		0.562	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076102.3	NM_005931		27	19	1	0	2.44e-19	2.96e-19	27	19				
CYP21A1P	1590	broad.mit.edu	37	6	31974427	31974427	+	Intron	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:31974427G>A	ENST00000594256.1	-	1	38				CYP21A1P_ENST00000342991.6_RNA																							CACCCCTGTGGCCATTGAGGA	0.627																																						uc010jtp.2		NA																	0					0						c.(478-480)GCC>ACC		SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;																																				SO:0001627	intron_variant	1589				glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding	g.chr6:31974427G>A																												ENST00000594256.1:c.38+416C>T	6.37:g.31974427G>A						CYP21A2_uc011dpb.1_Missense_Mutation_p.A130T	p.A160T			P08686	CP21A_HUMAN			5	596	+			159						Missense_Mutation	SNP	ENST00000594256.1	37	c.478G>A																																																																																					0.627	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding				11	11	0	0	0	0	11	11				
UBR2	23304	broad.mit.edu	37	6	42603184	42603184	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:42603184G>A	ENST00000372899.1	+	14	1832	c.1574G>A	c.(1573-1575)gGa>gAa	p.G525E	UBR2_ENST00000372883.3_Missense_Mutation_p.G29E|UBR2_ENST00000372901.1_Missense_Mutation_p.G525E	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	525					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CGTCAAGTAGGACAACATATT	0.348																																						uc011dur.1		NA																	0				ovary(3)|pancreas(1)	4						c.(1573-1575)GGA>GAA		ubiquitin protein ligase E3 component n-recognin							102.0	96.0	98.0					6																	42603184		2203	4300	6503	SO:0001583	missense	23304				cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding	g.chr6:42603184G>A	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1574G>A	6.37:g.42603184G>A	ENSP00000361990:p.Gly525Glu					UBR2_uc011dus.1_Missense_Mutation_p.G170E|UBR2_uc010jxv.1_Missense_Mutation_p.G29E|UBR2_uc003osh.2_RNA	p.G525E	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		14	1574	+	Colorectal(47;0.196)		525					O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	c.1574G>A	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072455	0.93950	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.60299	0.2;0.2;0.2	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.79011	2.435	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.935;1.0	T	0.73736	-0.3889	10	0.46703	T	0.11	-9.0228	18.9982	0.92821	0.0:0.0:1.0:0.0	.	525;525;29	Q8IWV8-4;Q8IWV8;Q8IWV8-3	.;UBR2_HUMAN;.	E	525;525;29	ENSP00000361990:G525E;ENSP00000361992:G525E;ENSP00000361974:G29E	ENSP00000361974:G29E	G	+	2	0	UBR2	42711162	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.440000	0.97547	2.470000	0.83445	0.650000	0.86243	GGA		0.348	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255		16	10	0	0	0	0	16	10				
GPR115	221393	broad.mit.edu	37	6	47682615	47682615	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:47682615G>C	ENST00000283303.2	+	6	1892	c.1634G>C	c.(1633-1635)aGa>aCa	p.R545T	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Missense_Mutation_p.R602T|GPR115_ENST00000327753.3_Missense_Mutation_p.R545T	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	545					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						GGCTACATGAGACCTGAGGCC	0.483																																					GBM(22;431 510 9010 26644 32828)	uc003oza.1		NA																	0				ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(1633-1635)AGA>ACA		G-protein coupled receptor 115 precursor							148.0	141.0	143.0					6																	47682615		2203	4300	6503	SO:0001583	missense	221393				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47682615G>C	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1634G>C	6.37:g.47682615G>C	ENSP00000283303:p.Arg545Thr					GPR115_uc003oyz.1_Missense_Mutation_p.R602T|GPR115_uc003ozb.1_Missense_Mutation_p.R543T	p.R545T	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN			6	1892	+			545			Extracellular (Potential).		B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	c.1634G>C	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557953	0.27827	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.36340	1.26;1.26;1.26	5.24	5.24	0.73138	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	L	0.42581	1.335	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.23084	-1.0198	10	0.33940	T	0.23	-23.1887	18.158	0.89700	0.0:0.0:1.0:0.0	.	545	Q8IZF3	GP115_HUMAN	T	602;545;545	ENSP00000360264:R602T;ENSP00000328319:R545T;ENSP00000283303:R545T	ENSP00000283303:R545T	R	+	2	0	GPR115	47790574	0.788000	0.28762	0.395000	0.26283	0.043000	0.13939	3.170000	0.50816	2.593000	0.87608	0.655000	0.94253	AGA		0.483	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		40	166	0	0	0	0	40	166				
DST	667	broad.mit.edu	37	6	56716396	56716396	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:56716396C>A	ENST00000370754.5	-	4	423	c.424G>T	c.(424-426)Ggg>Tgg	p.G142W	RP11-472M19.2_ENST00000426453.1_RNA			Q03001	DYST_HUMAN	dystonin	0	Actin-binding.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GACGCGTTCCCGGAACTCTAC	0.502											OREG0017515	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(424-426)GGG>TGG		dystonin isoform 2							44.0	42.0	42.0					6																	56716396		1568	3582	5150	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56716396C>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370754.5:c.424G>T	6.37:g.56716396C>A	ENSP00000359790:p.Gly142Trp		OREG0017515	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1017	DST_uc011dxj.1_5'UTR|DST_uc011dxk.1_Missense_Mutation_p.G4W|DST_uc011dxl.1_5'UTR	p.G142W	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		4	452	-	Lung NSC(77;0.103)		Error:Variant_position_missing_in_Q03001_after_alignment					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370754.5	37	c.424G>T		.	.	.	.	.	.	.	.	.	.	C	17.51	3.407160	0.62399	.	.	ENSG00000151914	ENST00000370754;ENST00000520645;ENST00000449297	D;D;D	0.97378	-1.91;-2.48;-4.36	5.76	5.76	0.90799	.	.	.	.	.	D	0.98632	0.9542	.	.	.	0.25554	N	0.987055	D	0.89917	1.0	D	0.97110	1.0	D	0.99383	1.0923	7	0.87932	D	0	.	19.9705	0.97284	0.0:1.0:0.0:0.0	.	142	E9PEB9	.	W	142;4;142	ENSP00000359790:G142W;ENSP00000431030:G4W;ENSP00000393082:G142W	ENSP00000359790:G142W	G	-	1	0	DST	56824355	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.352000	0.79404	2.728000	0.93425	0.655000	0.94253	GGG		0.502	DST-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001723		10	14	1	0	3.86e-05	4.25e-05	10	14				
COL12A1	1303	broad.mit.edu	37	6	75851809	75851809	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:75851809G>A	ENST00000322507.8	-	27	5205	c.4896C>T	c.(4894-4896)gtC>gtT	p.V1632V	COL12A1_ENST00000345356.6_Silent_p.V468V|COL12A1_ENST00000483888.2_Silent_p.V1632V|COL12A1_ENST00000416123.2_Silent_p.V1632V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1632	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAGAAACGCTGACTGTGTACA	0.493																																						uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(4894-4896)GTC>GTT		collagen, type XII, alpha 1 long isoform							181.0	177.0	178.0					6																	75851809		2150	4258	6408	SO:0001819	synonymous_variant	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75851809G>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4896C>T	6.37:g.75851809G>A						COL12A1_uc003pht.2_Silent_p.V468V	p.V1632V	NM_004370	NP_004361	Q99715	COCA1_HUMAN			27	5062	-			1632			Fibronectin type-III 11.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	c.4896C>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	0.978	-0.698117	0.03279	.	.	ENSG00000111799	ENST00000419671	.	.	.	6.16	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0413	0.06139	0.1275:0.2983:0.3595:0.2147	.	.	.	.	X	374	.	.	Q	-	1	0	COL12A1	75908529	0.517000	0.26226	0.856000	0.33681	0.096000	0.18686	0.073000	0.14640	0.430000	0.26230	0.650000	0.86243	CAG		0.493	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		47	61	0	0	0	0	47	61				
LAMA4	3910	broad.mit.edu	37	6	112493962	112493962	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:112493962G>C	ENST00000230538.7	-	12	1799	c.1402C>G	c.(1402-1404)Cgc>Ggc	p.R468G	LAMA4_ENST00000522006.1_Missense_Mutation_p.R461G|LAMA4_ENST00000424408.2_Missense_Mutation_p.R461G|LAMA4_ENST00000389463.4_Missense_Mutation_p.R461G	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	468	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AACAGAGTGCGGGTCTCATTG	0.527																																						uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(1402-1404)CGC>GGC		laminin, alpha 4 isoform 1 precursor							71.0	61.0	64.0					6																	112493962		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112493962G>C		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1402C>G	6.37:g.112493962G>C	ENSP00000230538:p.Arg468Gly					LAMA4_uc003pvv.2_Missense_Mutation_p.R461G|LAMA4_uc003pvt.2_Missense_Mutation_p.R461G	p.R468G	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	12	1711	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	468			Domain II and I.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.1402C>G	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186551	0.78789	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.74	4.76	0.60689	Laminin I (1);	0.334623	0.33980	N	0.004363	T	0.17831	0.0428	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.981;0.998	T	0.00050	-1.2198	10	0.52906	T	0.07	.	11.2099	0.48793	0.0:0.0:0.7176:0.2824	.	468;461	Q16363;Q16363-2	LAMA4_HUMAN;.	G	468;461;461;461	ENSP00000230538:R468G;ENSP00000429488:R461G;ENSP00000374114:R461G;ENSP00000416470:R461G	ENSP00000230538:R468G	R	-	1	0	LAMA4	112600655	1.000000	0.71417	0.988000	0.46212	0.862000	0.49288	2.757000	0.47557	2.873000	0.98535	0.563000	0.77884	CGC		0.527	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		4	29	0	0	0	0	4	29				
GJA1	2697	broad.mit.edu	37	6	121768632	121768632	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr6:121768632G>T	ENST00000282561.3	+	2	796	c.639G>T	c.(637-639)atG>atT	p.M213I		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	213					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	TCATCTTCATGCTGGTGGTGT	0.488																																						uc003pyr.2		NA																	0				ovary(2)	2						c.(637-639)ATG>ATT		connexin 43	Carvedilol(DB01136)						153.0	151.0	152.0					6																	121768632		2203	4300	6503	SO:0001583	missense	2697				cell-cell signaling|cellular membrane organization|gap junction assembly|heart development|muscle contraction|positive regulation of I-kappaB kinase/NF-kappaB cascade	connexon complex|Golgi-associated vesicle membrane|integral to plasma membrane|membrane raft	ion transmembrane transporter activity|signal transducer activity	g.chr6:121768632G>T	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.639G>T	6.37:g.121768632G>T	ENSP00000282561:p.Met213Ile					GJA1_uc011ebo.1_Missense_Mutation_p.M114I|GJA1_uc011ebp.1_Missense_Mutation_p.M1I	p.M213I	NM_000165	NP_000156	P17302	CXA1_HUMAN		GBM - Glioblastoma multiforme(226;0.00252)	2	889	+			213			Helical; (Potential).		B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	c.639G>T	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585583	0.86748	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.96774	-4.12	5.81	5.81	0.92471	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.98015	0.9346	M	0.92219	3.285	0.80722	D	1	P	0.49635	0.926	P	0.52646	0.705	D	0.98621	1.0667	10	0.87932	D	0	.	20.0796	0.97766	0.0:0.0:1.0:0.0	.	213	P17302	CXA1_HUMAN	I	197;213	ENSP00000282561:M213I	ENSP00000282561:M213I	M	+	3	0	GJA1	121810331	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.813000	0.99286	2.758000	0.94735	0.460000	0.39030	ATG		0.488	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165		47	78	1	0	2.28e-18	2.76e-18	47	78				
ZMIZ2	83637	broad.mit.edu	37	7	44801094	44801094	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:44801094T>C	ENST00000309315.4	+	10	1410	c.1287T>C	c.(1285-1287)gaT>gaC	p.D429D	ZMIZ2_ENST00000441627.1_Silent_p.D429D|ZMIZ2_ENST00000433667.1_Silent_p.D397D|ZMIZ2_ENST00000265346.7_Silent_p.D403D|ZMIZ2_ENST00000413916.1_Silent_p.D371D	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	429					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTGTGCGCGATGGGGTGGTCC	0.612																																					NSCLC(20;604 852 1948 16908 50522)	uc003tlr.2		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(1285-1287)GAT>GAC		zinc finger, MIZ-type containing 2 isoform 1							60.0	71.0	67.0					7																	44801094		2202	4300	6502	SO:0001819	synonymous_variant	83637				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding	g.chr7:44801094T>C	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1287T>C	7.37:g.44801094T>C						ZMIZ2_uc003tlq.2_Silent_p.D371D|ZMIZ2_uc003tls.2_Silent_p.D403D|ZMIZ2_uc003tlt.2_Silent_p.D52D|ZMIZ2_uc010kyj.2_5'UTR	p.D429D	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN			10	1410	+			429					A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	ENST00000309315.4	37	c.1287T>C	CCDS43576.1																																																																																				0.612	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		5	80	0	0	0	0	5	80				
ADCY1	107	broad.mit.edu	37	7	45697403	45697403	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:45697403T>A	ENST00000297323.7	+	6	1248	c.1226T>A	c.(1225-1227)cTg>cAg	p.L409Q	ADCY1_ENST00000432715.1_Missense_Mutation_p.L184Q	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	409					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGTGGTGTCCTGGGCTTGCGC	0.602																																						uc003tne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(1225-1227)CTG>CAG		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						125.0	92.0	103.0					7																	45697403		2203	4300	6503	SO:0001583	missense	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45697403T>A	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1226T>A	7.37:g.45697403T>A	ENSP00000297323:p.Leu409Gln					ADCY1_uc003tnd.2_Missense_Mutation_p.L184Q	p.L409Q	NM_021116	NP_066939	Q08828	ADCY1_HUMAN			6	1244	+			409			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	c.1226T>A	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.400359	0.83120	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.85702	-2.02;-2.02	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000002	D	0.94059	0.8096	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95157	0.8278	10	0.87932	D	0	.	11.9572	0.52988	0.0:0.0:0.0:1.0	.	409;184	Q08828;C9J1J0	ADCY1_HUMAN;.	Q	184;409;409	ENSP00000392721:L184Q;ENSP00000297323:L409Q	ENSP00000297323:L409Q	L	+	2	0	ADCY1	45663928	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.292000	0.78731	1.980000	0.57719	0.533000	0.62120	CTG		0.602	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		10	18	0	0	0	0	10	18				
Unknown	0	broad.mit.edu	37	7	63679786	63679786	+	IGR	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:63679786A>G								GUSBP6 (68687 upstream) : ZNF679 (9065 downstream)																							GAAAATGTGGACATGAGAATT	0.348																																						uc011kdn.1		NA																	0					0						c.(355-357)GGA>GGG		zinc finger protein 735							43.0	33.0	36.0					7																	63679786		692	1589	2281	SO:0001628	intergenic_variant	730291				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63679786A>G																													7.37:g.63679786A>G							p.G119G	NM_001159524	NP_001152996	P0CB33	ZN735_HUMAN			4	357	+			119						Silent	SNP		37	c.357A>G																																																																																				0	0.348									22	30	0	0	0	0	22	30				
ACN9	57001	broad.mit.edu	37	7	96747113	96747113	+	Silent	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:96747113C>T	ENST00000360382.4	+	1	79	c.78C>T	c.(76-78)gaC>gaT	p.D26D	ACN9_ENST00000432641.2_Silent_p.D26D					ACN9 homolog (S. cerevisiae)											large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(3)	10	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					TGCCCCCGGACCTCAAATCCC	0.597																																						uc003uoo.3		NA																	0					0						c.(76-78)GAC>GAT		ACN9 homolog precursor							100.0	90.0	93.0					7																	96747113		2203	4300	6503	SO:0001819	synonymous_variant	57001				regulation of gluconeogenesis	mitochondrial intermembrane space		g.chr7:96747113C>T	BC028409	CCDS5648.1	7q22.1	2006-02-09			ENSG00000196636	ENSG00000196636			21752	protein-coding gene	gene with protein product		615773					Standard	NM_020186		Approved	DC11	uc003uoo.4	Q9NRP4	OTTHUMG00000154064	ENST00000360382.4:c.78C>T	7.37:g.96747113C>T							p.D26D	NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN			1	1209	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)		26						Silent	SNP	ENST00000360382.4	37	c.78C>T																																																																																					0.597	ACN9-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333686.3	NM_020186		16	58	0	0	0	0	16	58				
ZNF394	84124	broad.mit.edu	37	7	99091989	99091989	+	Silent	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:99091989A>G	ENST00000337673.6	-	3	1052	c.849T>C	c.(847-849)aaT>aaC	p.N283N	ZNF394_ENST00000394177.3_5'Flank|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR|ZNF789_ENST00000494186.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	283					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCAATTCATTATTTTTAGAGT	0.458																																					Ovarian(24;589 697 9939 12704 40742)	uc003uqs.2		NA																	0					0						c.(847-849)AAT>AAC		zinc finger protein 394							142.0	129.0	134.0					7																	99091989		2203	4300	6503	SO:0001819	synonymous_variant	84124				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99091989A>G	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.849T>C	7.37:g.99091989A>G						ZNF394_uc003uqt.2_Silent_p.N76N	p.N283N	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN			3	1010	-	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		283					A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Silent	SNP	ENST00000337673.6	37	c.849T>C	CCDS5666.1																																																																																				0.458	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164		9	103	0	0	0	0	9	103				
PRKAR2B	5577	broad.mit.edu	37	7	106781395	106781395	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:106781395A>T	ENST00000265717.4	+	5	843	c.584A>T	c.(583-585)gAt>gTt	p.D195V	PRKAR2B_ENST00000393613.2_3'UTR	NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	195					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TATGTAATTGATAGGTAAGTT	0.348																																						uc003vdx.2		NA																	0				ovary(1)	1						c.(583-585)GAT>GTT		cAMP-dependent protein kinase, regulatory							141.0	136.0	137.0					7																	106781395		2203	4299	6502	SO:0001583	missense	5577				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity	g.chr7:106781395A>T		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.584A>T	7.37:g.106781395A>T	ENSP00000265717:p.Asp195Val						p.D195V	NM_002736	NP_002727	P31323	KAP3_HUMAN			5	759	+			195			cAMP 1.		A4D0R9	Missense_Mutation	SNP	ENST00000265717.4	37	c.584A>T	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.729366	0.89390	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	D	0.91740	-2.9	5.25	5.25	0.73442	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.043573	0.85682	D	0.000000	D	0.91952	0.7451	N	0.13327	0.33	0.80722	D	1	D	0.65815	0.995	D	0.72338	0.977	D	0.93780	0.7083	10	0.87932	D	0	-0.8069	15.4527	0.75285	1.0:0.0:0.0:0.0	.	195	P31323	KAP3_HUMAN	V	195;195;182	ENSP00000265717:D195V	ENSP00000265717:D195V	D	+	2	0	PRKAR2B	106568631	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	9.259000	0.95561	2.121000	0.65114	0.460000	0.39030	GAT		0.348	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1			15	28	0	0	0	0	15	28				
AHCYL2	23382	broad.mit.edu	37	7	129043233	129043233	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:129043233G>C	ENST00000325006.3	+	7	986	c.932G>C	c.(931-933)gGa>gCa	p.G311A	AHCYL2_ENST00000490911.1_Missense_Mutation_p.G208A|AHCYL2_ENST00000474594.1_Missense_Mutation_p.G208A|AHCYL2_ENST00000531335.2_Missense_Mutation_p.G230A|RNU7-16P_ENST00000516471.1_RNA|AHCYL2_ENST00000446212.1_Missense_Mutation_p.G209A|AHCYL2_ENST00000446544.2_Missense_Mutation_p.G310A	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	311					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						TTGGATGATGGAGGGGATCTT	0.403																																					Pancreas(160;1736 1964 29875 40941 45605)	uc011kov.1		NA																	0				ovary(2)	2						c.(931-933)GGA>GCA		S-adenosylhomocysteine hydrolase-like 2 isoform							132.0	131.0	131.0					7																	129043233		2203	4300	6503	SO:0001583	missense	23382				one-carbon metabolic process		adenosylhomocysteinase activity	g.chr7:129043233G>C	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.932G>C	7.37:g.129043233G>C	ENSP00000315931:p.Gly311Ala					AHCYL2_uc003vot.2_Missense_Mutation_p.G310A|AHCYL2_uc003vov.2_Missense_Mutation_p.G208A|AHCYL2_uc011kow.1_Missense_Mutation_p.G209A|AHCYL2_uc011kox.1_Missense_Mutation_p.G208A	p.G311A	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN			7	986	+			311					B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	c.932G>C	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.771695|4.771695	0.90108|0.90108	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000466924|ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	.|D;D;D;D;D;D	.|0.92249	.|-3.0;-3.0;-3.0;-3.0;-3.0;-3.0	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97589|0.97589	0.9210|0.9210	H|H	0.97682|0.97682	4.055|4.055	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0	D|D	0.98908|0.98908	1.0779|1.0779	5|10	.|0.87932	.|D	.|0	-9.0486|-9.0486	16.3801|16.3801	0.83458|0.83458	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|208;209;311;208;310	.|B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.|.;.;SAHH3_HUMAN;.;.	Q|A	218|311;310;230;208;209;208	.|ENSP00000315931:G311A;ENSP00000413639:G310A;ENSP00000431787:G230A;ENSP00000420459:G208A;ENSP00000405267:G209A;ENSP00000420801:G208A	.|ENSP00000315931:G311A	E|G	+|+	1|2	0|0	AHCYL2|AHCYL2	128830469|128830469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.380000|9.380000	0.97202|0.97202	2.519000|2.519000	0.84933|0.84933	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.403	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1			30	54	0	0	0	0	30	54				
PARP12	64761	broad.mit.edu	37	7	139727186	139727186	+	Silent	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr7:139727186G>T	ENST00000263549.3	-	10	2391	c.1518C>A	c.(1516-1518)tcC>tcA	p.S506S		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	506	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					ACTCTTCCGAGGAAGAACTAA	0.448																																						uc003vvl.1		NA																	0				ovary(3)	3						c.(1516-1518)TCC>TCA		poly ADP-ribose polymerase 12							108.0	106.0	106.0					7																	139727186		2203	4300	6503	SO:0001819	synonymous_variant	64761					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding	g.chr7:139727186G>T	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1518C>A	7.37:g.139727186G>T						PARP12_uc003vvk.1_Silent_p.S292S|PARP12_uc010lnf.1_RNA	p.S506S	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN			10	2392	-	Melanoma(164;0.0142)		506			PARP catalytic.		Q9H610|Q9NP36|Q9NTI3	Silent	SNP	ENST00000263549.3	37	c.1518C>A	CCDS5857.1																																																																																				0.448	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750		19	55	1	0	2.94e-08	3.38e-08	19	55				
ESCO2	157570	broad.mit.edu	37	8	27657230	27657230	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:27657230T>G	ENST00000305188.8	+	10	1908	c.1670T>G	c.(1669-1671)cTc>cGc	p.L557R	ESCO2_ENST00000397418.2_Missense_Mutation_p.L205R	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	557					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		GTTGATACCCTCAGGTAAGAA	0.428									SC Phocomelia syndrome																													uc003xgg.2		NA																	0				central_nervous_system(1)	1						c.(1669-1671)CTC>CGC		establishment of cohesion 1 homolog 2							113.0	111.0	111.0					8																	27657230		2203	4300	6503	SO:0001583	missense	157570	SC_Phocomelia_syndrome	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding	g.chr8:27657230T>G	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.1670T>G	8.37:g.27657230T>G	ENSP00000306999:p.Leu557Arg					ESCO2_uc010luy.1_RNA	p.L557R	NM_001017420	NP_001017420	Q56NI9	ESCO2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)	10	1753	+		Ovarian(32;0.000953)	557					B3KW59|Q49AP4	Missense_Mutation	SNP	ENST00000305188.8	37	c.1670T>G	CCDS34872.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.636368	0.87760	.	.	ENSG00000171320	ENST00000305188;ENST00000397418	D;D	0.83755	-1.76;-1.76	6.17	6.17	0.99709	.	0.390821	0.27841	N	0.017628	D	0.89104	0.6620	M	0.75777	2.31	0.36929	D	0.891806	D	0.58970	0.984	P	0.57846	0.828	D	0.92139	0.5719	10	0.87932	D	0	-0.586	14.7743	0.69713	0.0:0.0:0.0:1.0	.	557	Q56NI9	ESCO2_HUMAN	R	557;205	ENSP00000306999:L557R;ENSP00000380563:L205R	ENSP00000306999:L557R	L	+	2	0	ESCO2	27713149	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.553000	0.67287	2.371000	0.80710	0.533000	0.62120	CTC		0.428	ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376276.1	NM_001017420		26	53	0	0	0	0	26	53				
ADAM32	203102	broad.mit.edu	37	8	39022614	39022614	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:39022614G>T	ENST00000379907.4	+	9	859	c.732G>T	c.(730-732)aaG>aaT	p.K244N	ADAM32_ENST00000519315.1_Missense_Mutation_p.K244N|ADAM32_ENST00000437682.2_Missense_Mutation_p.K251N	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	244	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ATGAAAATAAGATTTCTACAG	0.303																																						uc003xmt.3		NA																	0				ovary(1)|lung(1)|kidney(1)	3						c.(730-732)AAG>AAT		a disintegrin and metalloprotease domain 32							132.0	121.0	124.0					8																	39022614		1801	4076	5877	SO:0001583	missense	203102				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:39022614G>T	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.732G>T	8.37:g.39022614G>T	ENSP00000369238:p.Lys244Asn					ADAM32_uc011lch.1_Missense_Mutation_p.K251N|ADAM32_uc003xmu.3_Missense_Mutation_p.K244N	p.K244N	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)		9	977	+		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	244			Peptidase M12B.|Extracellular (Potential).		Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	c.732G>T	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.407929	0.62399	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907;ENST00000399826	T;T;T	0.67345	-0.26;-0.26;-0.26	5.09	2.27	0.28462	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.34986	N	0.003529	T	0.79902	0.4526	M	0.89095	3.005	0.29475	N	0.856773	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.81914	0.986;0.995;0.995	T	0.71974	-0.4430	10	0.38643	T	0.18	.	6.4521	0.21910	0.3018:0.0:0.6982:0.0	.	251;244;244	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	N	251;244;244;245	ENSP00000405978:K251N;ENSP00000429422:K244N;ENSP00000369238:K244N	ENSP00000369238:K244N	K	+	3	2	ADAM32	39141771	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	0.569000	0.23638	0.648000	0.30732	0.561000	0.74099	AAG		0.303	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004		22	32	1	0	7.88e-14	9.37e-14	22	32				
ZMAT4	79698	broad.mit.edu	37	8	40554847	40554847	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:40554847A>G	ENST00000297737.6	-	4	412	c.266T>C	c.(265-267)gTg>gCg	p.V89A	ZMAT4_ENST00000315769.7_Missense_Mutation_p.V89A	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	89						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			GGAATCGGCCACCACCGCTGA	0.502																																						uc003xnr.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(265-267)GTG>GCG		zinc finger, matrin type 4 isoform a							150.0	134.0	139.0					8																	40554847		2203	4300	6503	SO:0001583	missense	79698					nucleus	DNA binding|zinc ion binding	g.chr8:40554847A>G	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.266T>C	8.37:g.40554847A>G	ENSP00000297737:p.Val89Ala					ZMAT4_uc003xns.2_Missense_Mutation_p.V89A	p.V89A	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.00722)		4	412	-	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	89			Matrin-type 2.		Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	37	c.266T>C	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.013127	0.93346	.	.	ENSG00000165061	ENST00000315769;ENST00000297737;ENST00000519406	T;T;T	0.20738	2.05;2.05;2.05	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	L	0.58428	1.81	0.53688	D	0.999977	D;D	0.89917	0.99;1.0	D;D	0.87578	0.941;0.998	T	0.16158	-1.0412	10	0.08599	T	0.76	-25.0427	16.0034	0.80327	1.0:0.0:0.0:0.0	.	89;89	Q9H898-2;Q9H898	.;ZMAT4_HUMAN	A	89	ENSP00000319785:V89A;ENSP00000297737:V89A;ENSP00000428423:V89A	ENSP00000297737:V89A	V	-	2	0	ZMAT4	40674004	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.757000	0.91657	2.371000	0.80710	0.533000	0.62120	GTG		0.502	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645		23	62	0	0	0	0	23	62				
SULF1	23213	broad.mit.edu	37	8	70517085	70517085	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:70517085C>G	ENST00000260128.4	+	13	2012	c.1295C>G	c.(1294-1296)tCa>tGa	p.S432*	SULF1_ENST00000402687.4_Nonsense_Mutation_p.S432*|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Nonsense_Mutation_p.S432*|SULF1_ENST00000458141.2_Nonsense_Mutation_p.S432*	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	432					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ATCCAACAGTCAAATCACTTG	0.463																																						uc010lza.1		NA																	0				central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(1294-1296)TCA>TGA		sulfatase 1 precursor							102.0	98.0	99.0					8																	70517085		2203	4300	6503	SO:0001587	stop_gained	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70517085C>G	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1295C>G	8.37:g.70517085C>G	ENSP00000260128:p.Ser432*					SULF1_uc003xyd.2_Nonsense_Mutation_p.S432*|SULF1_uc003xye.2_Nonsense_Mutation_p.S432*|SULF1_uc003xyf.2_Nonsense_Mutation_p.S432*|SULF1_uc003xyg.2_Nonsense_Mutation_p.S432*|SULF1_uc003xyh.1_RNA	p.S432*	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		13	2012	+	Breast(64;0.0654)		432					Q86YV8|Q8NCA2|Q9UPS5	Nonsense_Mutation	SNP	ENST00000260128.4	37	c.1295C>G	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	46	12.646530	0.99685	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	.	.	.	6.04	6.04	0.98038	.	0.053609	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	.	.	.	X	432	.	ENSP00000260128:S432X	S	+	2	0	SULF1	70679639	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	6.084000	0.71335	2.873000	0.98535	0.561000	0.74099	TCA		0.463	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		29	49	0	0	0	0	29	49				
VPS13B	157680	broad.mit.edu	37	8	100880545	100880545	+	Silent	SNP	G	G	A	rs375229257	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:100880545G>A	ENST00000358544.2	+	59	11430	c.11319G>A	c.(11317-11319)ccG>ccA	p.P3773P	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.P3748P	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3773					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTGATCAGCCGATGCAGAACT	0.493													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20540	0.0		0.0	False		,,,				2504	0.0				Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(11317-11319)CCG>CCA		vacuolar protein sorting 13B isoform 5		G	,	1,4405	2.1+/-5.4	0,1,2202	85.0	81.0	83.0		11319,11244	-7.2	0.7	8		83	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	VPS13B	NM_017890.3,NM_152564.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	3773/4023,3748/3998	100880545	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100880545G>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11319G>A	8.37:g.100880545G>A						VPS13B_uc003yiw.2_Silent_p.P3748P	p.P3773P	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		59	11430	+	Breast(36;3.73e-07)		3773					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.11319G>A	CCDS6280.1																																																																																				0.493	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		17	50	0	0	0	0	17	50				
DPYS	1807	broad.mit.edu	37	8	105459661	105459661	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:105459661T>C	ENST00000351513.2	-	3	626	c.494A>G	c.(493-495)aAa>aGa	p.K165R		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	165					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GTACAGATCTTTATAGGCCAT	0.413																																						uc003yly.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(493-495)AAA>AGA		dihydropyrimidinase							132.0	121.0	124.0					8																	105459661		2203	4300	6503	SO:0001583	missense	1807				protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding	g.chr8:105459661T>C	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.494A>G	8.37:g.105459661T>C	ENSP00000276651:p.Lys165Arg						p.K165R	NM_001385	NP_001376	Q14117	DPYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		3	623	-			165						Missense_Mutation	SNP	ENST00000351513.2	37	c.494A>G	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.079536	0.55753	.	.	ENSG00000147647	ENST00000351513;ENST00000521573	D;D	0.90504	-2.68;-2.68	6.02	2.37	0.29283	Amidohydrolase 1 (1);	0.091643	0.85682	N	0.000000	D	0.88518	0.6458	M	0.71036	2.16	0.53688	D	0.999974	B	0.12013	0.005	B	0.17722	0.019	T	0.82835	-0.0261	10	0.72032	D	0.01	-13.7044	10.0335	0.42114	0.0:0.1816:0.0:0.8184	.	165	Q14117	DPYS_HUMAN	R	165;112	ENSP00000276651:K165R;ENSP00000430246:K112R	ENSP00000276651:K165R	K	-	2	0	DPYS	105528837	1.000000	0.71417	0.021000	0.16686	0.984000	0.73092	4.012000	0.57131	0.171000	0.19730	0.528000	0.53228	AAA		0.413	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385		22	70	0	0	0	0	22	70				
PKHD1L1	93035	broad.mit.edu	37	8	110487466	110487466	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:110487466A>G	ENST00000378402.5	+	51	8829	c.8725A>G	c.(8725-8727)Att>Gtt	p.I2909V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2909					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CATAACCAACATTTCATATAC	0.338										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(8725-8727)ATT>GTT		fibrocystin L precursor							96.0	89.0	91.0					8																	110487466		1859	4111	5970	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110487466A>G	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8725A>G	8.37:g.110487466A>G	ENSP00000367655:p.Ile2909Val	HNSCC(38;0.096)					p.I2909V	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		51	8829	+			2909			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.8725A>G	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.207088	0.79127	.	.	ENSG00000205038	ENST00000378402	D	0.87491	-2.26	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.88066	0.6337	M	0.64404	1.975	0.33974	D	0.647196	P	0.46859	0.885	P	0.47673	0.554	D	0.92293	0.5843	10	0.51188	T	0.08	.	13.8935	0.63755	1.0:0.0:0.0:0.0	.	2909	Q86WI1	PKHL1_HUMAN	V	2909	ENSP00000367655:I2909V	ENSP00000367655:I2909V	I	+	1	0	PKHD1L1	110556642	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.326000	0.79133	2.157000	0.67596	0.533000	0.62120	ATT		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		6	29	0	0	0	0	6	29				
CSMD3	114788	broad.mit.edu	37	8	113585824	113585824	+	Silent	SNP	G	G	A	rs202084967		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:113585824G>A	ENST00000297405.5	-	24	4192	c.3948C>T	c.(3946-3948)cgC>cgT	p.R1316R	CSMD3_ENST00000455883.2_Silent_p.R1212R|CSMD3_ENST00000343508.3_Silent_p.R1276R|CSMD3_ENST00000352409.3_Silent_p.R1316R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1316	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTGTCAGTCCGCGCATAGATG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			G|||	1	0.000199681	0.0	0.0	5008	,	,		15087	0.001		0.0	False		,,,				2504	0.0					uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(3946-3948)CGC>CGT		CUB and Sushi multiple domains 3 isoform 1		G	,,	0,4406		0,0,2203	125.0	125.0	125.0		3636,3948,3828	-0.9	1.0	8		125	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CSMD3	NM_052900.2,NM_198123.1,NM_198124.1	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	1212/3539,1316/3708,1276/3668	113585824	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113585824G>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3948C>T	8.37:g.113585824G>A		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Silent_p.R588R|CSMD3_uc003ynt.2_Silent_p.R1276R|CSMD3_uc011lhx.1_Silent_p.R1212R	p.R1316R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			24	4107	-			1316			Extracellular (Potential).|CUB 7.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.3948C>T	CCDS6315.1																																																																																				0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		27	88	0	0	0	0	27	88				
CSMD3	114788	broad.mit.edu	37	8	113988125	113988125	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:113988125C>G	ENST00000297405.5	-	7	1527	c.1283G>C	c.(1282-1284)aGa>aCa	p.R428T	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.R388T|CSMD3_ENST00000352409.3_Missense_Mutation_p.R428T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	428						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGTCTTGGTCTTCTCCTGGT	0.453										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(1282-1284)AGA>ACA		CUB and Sushi multiple domains 3 isoform 1							213.0	190.0	198.0					8																	113988125		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113988125C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1283G>C	8.37:g.113988125C>G	ENSP00000297405:p.Arg428Thr	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003ynt.2_Missense_Mutation_p.R388T|CSMD3_uc011lhx.1_Intron	p.R428T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			7	1442	-			428			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.1283G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037880	0.54896	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.19105	2.17;2.17;2.19	6.17	6.17	0.99709	.	0.000000	0.53938	D	0.000042	T	0.33904	0.0879	N	0.22421	0.69	0.33360	D	0.572171	D;D	0.57899	0.967;0.981	D;D	0.69142	0.916;0.962	T	0.09422	-1.0675	10	0.22706	T	0.39	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	428;388	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	T	388;428;428	ENSP00000345799:R388T;ENSP00000297405:R428T;ENSP00000343124:R428T	ENSP00000297405:R428T	R	-	2	0	CSMD3	114057301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.335000	0.65929	2.941000	0.99782	0.655000	0.94253	AGA		0.453	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		36	92	0	0	0	0	36	92				
KIAA0196	9897	broad.mit.edu	37	8	126061386	126061386	+	Silent	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:126061386G>A	ENST00000318410.7	-	19	2590	c.2241C>T	c.(2239-2241)acC>acT	p.T747T	KIAA0196_ENST00000517845.1_Silent_p.T599T	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	747					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATCCATCCATGGTCGCTCCCA	0.403																																						uc003yrt.2		NA																	0				ovary(2)	2						c.(2239-2241)ACC>ACT		strumpellin							100.0	88.0	92.0					8																	126061386		2203	4300	6503	SO:0001819	synonymous_variant	9897				cell death	WASH complex		g.chr8:126061386G>A		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2241C>T	8.37:g.126061386G>A						KIAA0196_uc011lir.1_Silent_p.T599T|KIAA0196_uc003yru.1_Silent_p.T321T	p.T747T	NM_014846	NP_055661	Q12768	STRUM_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		19	2570	-	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		747					A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	c.2241C>T	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	G	8.899	0.955777	0.18507	.	.	ENSG00000164961	ENST00000523273	.	.	.	5.88	3.08	0.35506	.	.	.	.	.	T	0.55226	0.1907	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45804	-0.9236	4	.	.	.	-11.1942	6.92	0.24383	0.136:0.0:0.601:0.263	.	.	.	.	L	364	.	.	P	-	2	0	KIAA0196	126130568	1.000000	0.71417	0.984000	0.44739	0.905000	0.53344	1.318000	0.33643	0.367000	0.24454	-0.218000	0.12543	CCA		0.403	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		16	39	0	0	0	0	16	39				
KCNQ3	3786	broad.mit.edu	37	8	133141630	133141630	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:133141630A>T	ENST00000388996.4	-	15	2918	c.2498T>A	c.(2497-2499)cTc>cAc	p.L833H	KCNQ3_ENST00000521134.1_Missense_Mutation_p.L713H|KCNQ3_ENST00000519445.1_Missense_Mutation_p.L821H	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	833					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACCCTCGGCGAGGTACCGCTT	0.597																																						uc003ytj.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(2497-2499)CTC>CAC		potassium voltage-gated channel KQT-like protein							78.0	67.0	70.0					8																	133141630		2203	4300	6503	SO:0001583	missense	3786				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr8:133141630A>T	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2498T>A	8.37:g.133141630A>T	ENSP00000373648:p.Leu833His					KCNQ3_uc010mdt.2_Missense_Mutation_p.L821H|uc003yti.2_5'Flank	p.L833H	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)		15	2723	-	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		833					A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	c.2498T>A	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.344070	0.82022	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	T;T;T	0.55413	0.52;0.52;0.52	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.66809	0.2827	L	0.47716	1.5	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69614	-0.5098	10	0.87932	D	0	-23.6141	15.0309	0.71705	1.0:0.0:0.0:0.0	.	821;833	E7ET42;O43525	.;KCNQ3_HUMAN	H	833;713;821;810;712	ENSP00000373648:L833H;ENSP00000429799:L713H;ENSP00000428790:L821H	ENSP00000373648:L833H	L	-	2	0	KCNQ3	133210812	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	8.495000	0.90481	2.157000	0.67596	0.533000	0.62120	CTC		0.597	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519		8	34	0	0	0	0	8	34				
CYC1	1537	broad.mit.edu	37	8	145151332	145151332	+	Silent	SNP	T	T	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr8:145151332T>C	ENST00000318911.4	+	4	619	c.546T>C	c.(544-546)agT>agC	p.S182S		NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	182	Cytochrome c.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACCCCAACAGTGAGGCTGCTC	0.587											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003zaz.3		NA																	0					0						c.(544-546)AGT>AGC		cytochrome c-1							126.0	122.0	123.0					8																	145151332		2203	4300	6503	SO:0001819	synonymous_variant	1537				respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding	g.chr8:145151332T>C	BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.546T>C	8.37:g.145151332T>C			OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1692	CYC1_uc003zay.2_Silent_p.S123S	p.S182S	NM_001916	NP_001907	P08574	CY1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		4	589	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		182			Cytochrome c.		Q5U062|Q6FHS7	Silent	SNP	ENST00000318911.4	37	c.546T>C	CCDS6415.1																																																																																				0.587	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916		27	56	0	0	0	0	27	56				
PTPLAD2	401494	broad.mit.edu	37	9	21029378	21029378	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr9:21029378G>A	ENST00000495827.2	-	2	103	c.58C>T	c.(58-60)Ctt>Ttt	p.L20F	PTPLAD2_ENST00000513293.2_Missense_Mutation_p.L20F|PTPLAD2_ENST00000488436.1_5'Flank	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	20					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		TAGATGAAAAGATACGCATTC	0.328																																						uc010miq.1		NA																	0				skin(1)	1						c.(58-60)CTT>TTT		protein tyrosine phosphatase-like A domain							88.0	89.0	88.0					9																	21029378		1857	4080	5937	SO:0001583	missense	401494				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity	g.chr9:21029378G>A		CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.58C>T	9.37:g.21029378G>A	ENSP00000419503:p.Leu20Phe					PTPLAD2_uc003zoj.1_5'UTR|PTPLAD2_uc010mir.1_Missense_Mutation_p.L20F	p.L20F	NM_001010915	NP_001010915	Q5VWC8	HACD4_HUMAN		Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)	2	104	-			20			Helical; (Potential).		Q7Z385	Missense_Mutation	SNP	ENST00000495827.2	37	c.58C>T	CCDS43791.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604835	0.66445	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	T;T	0.54479	0.57;0.57	5.3	5.3	0.74995	.	0.072133	0.56097	D	0.000027	T	0.67776	0.2929	M	0.75615	2.305	0.44309	D	0.997184	D	0.69078	0.997	P	0.59115	0.852	T	0.71748	-0.4499	10	0.87932	D	0	-2.1969	13.6897	0.62537	0.0:0.0:0.8449:0.1551	.	20	Q5VWC8	HACD4_HUMAN	F	20	ENSP00000426475:L20F;ENSP00000419503:L20F	ENSP00000419503:L20F	L	-	1	0	PTPLAD2	21019378	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	5.491000	0.66887	2.644000	0.89710	0.655000	0.94253	CTT		0.328	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915		23	73	0	0	0	0	23	73				
FAM214B	80256	broad.mit.edu	37	9	35107864	35107864	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr9:35107864C>T	ENST00000378561.1	-	2	3463	c.408G>A	c.(406-408)tgG>tgA	p.W136*	FAM214B_ENST00000603301.1_Nonsense_Mutation_p.W136*|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000605244.1_Nonsense_Mutation_p.W136*|FAM214B_ENST00000378566.1_Intron|FAM214B_ENST00000488109.2_Nonsense_Mutation_p.W136*|FAM214B_ENST00000378557.1_Nonsense_Mutation_p.W136*|FAM214B_ENST00000322813.5_Nonsense_Mutation_p.W136*|FAM214B_ENST00000378554.2_Nonsense_Mutation_p.W136*			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	136						nucleus (GO:0005634)											CCCCCGAAGTCCAAGATGAGG	0.617																																						uc003zwl.2		NA																	0				ovary(2)	2						c.(406-408)TGG>TGA		hypothetical protein LOC80256							40.0	46.0	44.0					9																	35107864		2203	4300	6503	SO:0001587	stop_gained	80256					nucleus		g.chr9:35107864C>T	AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.408G>A	9.37:g.35107864C>T	ENSP00000367823:p.Trp136*					KIAA1539_uc003zwm.2_Nonsense_Mutation_p.W136*|KIAA1539_uc003zwn.2_Intron|KIAA1539_uc003zwo.2_Nonsense_Mutation_p.W136*|KIAA1539_uc003zwp.1_Nonsense_Mutation_p.W136*|KIAA1539_uc010mkk.1_Intron	p.W136*	NM_025182	NP_079458	Q7L5A3	K1539_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		3	733	-	all_epithelial(49;0.217)		136					B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Nonsense_Mutation	SNP	ENST00000378561.1	37	c.408G>A	CCDS6578.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755713	0.69648	.	.	ENSG00000005238	ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	4.67	2.78	0.32641	.	0.622916	0.14594	N	0.310058	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-5.1119	6.0697	0.19883	0.1493:0.6912:0.0:0.1595	.	.	.	.	X	136	.	ENSP00000319897:W136X	W	-	3	0	KIAA1539	35097864	0.999000	0.42202	1.000000	0.80357	0.822000	0.46500	2.494000	0.45329	1.192000	0.43071	0.555000	0.69702	TGG		0.617	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182		16	41	0	0	0	0	16	41				
PIP5K1B	8395	broad.mit.edu	37	9	71532554	71532554	+	Missense_Mutation	SNP	C	C	T	rs146846422		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr9:71532554C>T	ENST00000265382.3	+	9	1167	c.862C>T	c.(862-864)Cca>Tca	p.P288S	PIP5K1B_ENST00000541509.1_Missense_Mutation_p.P288S	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	288	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		GGAGGAGACCCCACAAAATGT	0.473																																						uc004agu.2		NA																	0				stomach(1)	1						c.(862-864)CCA>TCA		phosphatidylinositol-4-phosphate 5-kinase, type							188.0	194.0	192.0					9																	71532554		2203	4300	6503	SO:0001583	missense	8395					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding	g.chr9:71532554C>T	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.862C>T	9.37:g.71532554C>T	ENSP00000265382:p.Pro288Ser					PIP5K1B_uc011lrq.1_Missense_Mutation_p.P288S|PIP5K1B_uc004agv.2_RNA	p.P288S	NM_003558	NP_003549	O14986	PI51B_HUMAN		Lung(182;0.133)	9	1167	+			288			PIPK.		A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	ENST00000265382.3	37	c.862C>T	CCDS6624.1	.	.	.	.	.	.	.	.	.	.	T	0.501	-0.871076	0.02570	.	.	ENSG00000107242	ENST00000541509;ENST00000377290;ENST00000265382;ENST00000419747	T;T	0.27557	1.66;1.66	5.75	0.571	0.17352	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.495280	0.21607	N	0.071844	T	0.05823	0.0152	N	0.00408	-1.53	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37957	-0.9683	10	0.05436	T	0.98	-5.3095	6.1022	0.20053	0.0:0.197:0.3597:0.4433	.	288	O14986	PI51B_HUMAN	S	288;288;288;235	ENSP00000438082:P288S;ENSP00000265382:P288S	ENSP00000265382:P288S	P	+	1	0	PIP5K1B	70722374	0.188000	0.23250	0.000000	0.03702	0.981000	0.71138	0.406000	0.21032	-0.417000	0.07461	-0.308000	0.09152	CCA		0.473	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558		163	56	0	0	0	0	163	56				
NUTM2G	441457	broad.mit.edu	37	9	99694538	99694538	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr9:99694538G>C	ENST00000372322.3	+	2	572	c.551G>C	c.(550-552)gGa>gCa	p.G184A	NUTM2G_ENST00000354649.3_Missense_Mutation_p.G184A|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	184																	GGGGCTCATGGAGAGGGCAGC	0.647																																						uc004awq.1		NA																	0				skin(1)	1						c.(550-552)GGA>GCA		hypothetical protein LOC441457							61.0	64.0	63.0					9																	99694538		1925	4107	6032	SO:0001583	missense	441457							g.chr9:99694538G>C		CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.551G>C	9.37:g.99694538G>C	ENSP00000361397:p.Gly184Ala						p.G184A	NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN			2	1266	+		Acute lymphoblastic leukemia(62;0.0527)	184					A6NNI5|Q5VZR3	Missense_Mutation	SNP	ENST00000372322.3	37	c.551G>C	CCDS55329.1	.	.	.	.	.	.	.	.	.	.	.	9.868	1.198068	0.22037	.	.	ENSG00000188152	ENST00000354649;ENST00000372322;ENST00000417159;ENST00000375230	T;T	0.25749	1.78;1.78	1.03	1.03	0.20045	.	1.210120	0.05728	N	0.598982	T	0.34279	0.0892	M	0.64404	1.975	0.09310	N	1	D	0.55385	0.971	P	0.50934	0.654	T	0.24584	-1.0156	10	0.45353	T	0.12	.	5.4622	0.16624	0.0:0.0:1.0:0.0	.	184	Q5VZR2-2	.	A	184;184;184;65	ENSP00000346670:G184A;ENSP00000361397:G184A	ENSP00000346670:G184A	G	+	2	0	FAM22G	98734359	0.332000	0.24722	0.022000	0.16811	0.017000	0.09413	1.230000	0.32612	0.892000	0.36259	0.479000	0.44913	GGA		0.647	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053291.2	NM_001170741		19	110	0	0	0	0	19	110				
C5	727	broad.mit.edu	37	9	123797114	123797114	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr9:123797114G>C	ENST00000223642.1	-	5	580	c.551C>G	c.(550-552)tCt>tGt	p.S184C		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	184					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	GTCAGGAAAAGAGATAATTCC	0.353																																						uc004bkv.2		NA																	0				ovary(2)	2						c.(550-552)TCT>TGT		complement component 5 preproprotein	Eculizumab(DB01257)						65.0	62.0	63.0					9																	123797114		2203	4300	6503	SO:0001583	missense	727				activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity	g.chr9:123797114G>C	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.551C>G	9.37:g.123797114G>C	ENSP00000223642:p.Ser184Cys					C5_uc010mvm.1_Missense_Mutation_p.S184C|C5_uc010mvn.1_Missense_Mutation_p.S184C	p.S184C	NM_001735	NP_001726	P01031	CO5_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	5	581	-			184					Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	c.551C>G	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815240	0.70912	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.75589	-0.95	5.87	4.97	0.65823	Alpha-2-macroglobulin, N-terminal (1);	0.285709	0.40469	N	0.001082	D	0.88872	0.6555	M	0.91612	3.225	0.48975	D	0.999731	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.90999	0.4841	10	0.54805	T	0.06	.	16.1296	0.81418	0.0:0.134:0.866:0.0	.	255;184	Q59GS8;P01031	.;CO5_HUMAN	C	184;255	ENSP00000223642:S184C	ENSP00000223642:S184C	S	-	2	0	C5	122836935	1.000000	0.71417	0.995000	0.50966	0.964000	0.63967	3.420000	0.52735	1.615000	0.50252	0.655000	0.94253	TCT		0.353	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735		12	22	0	0	0	0	12	22				
OTUD5	55593	broad.mit.edu	37	X	48780923	48780923	+	Silent	SNP	G	G	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chrX:48780923G>T	ENST00000156084.4	-	8	1641	c.1581C>A	c.(1579-1581)tcC>tcA	p.S527S	OTUD5_ENST00000376488.3_Silent_p.S522S|OTUD5_ENST00000428668.2_Silent_p.S305S|OTUD5_ENST00000396743.3_Silent_p.S522S|OTUD5_ENST00000484499.1_5'Flank	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	527					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						AGGCAGAGGGGGACATCTGCT	0.607																																						uc004dlu.2		NA																	0				pancreas(1)	1						c.(1579-1581)TCC>TCA		OTU domain containing 5 isoform a							25.0	25.0	25.0					X																	48780923		2199	4299	6498	SO:0001819	synonymous_variant	55593				negative regulation of type I interferon production		cysteine-type peptidase activity	g.chrX:48780923G>T		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.1581C>A	X.37:g.48780923G>T						OTUD5_uc004dlt.3_Silent_p.S522S|OTUD5_uc004dlv.2_Silent_p.S522S|OTUD5_uc011mmp.1_Silent_p.S305S	p.S527S	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN			8	1642	-			527					B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Silent	SNP	ENST00000156084.4	37	c.1581C>A	CCDS14313.1																																																																																				0.607	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602		8	3	1	0	0.000157383	0.000170602	8	3				
ERCC6L	54821	broad.mit.edu	37	X	71426165	71426165	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chrX:71426165A>C	ENST00000334463.3	-	2	2587	c.2452T>G	c.(2452-2454)Ttt>Gtt	p.F818V	ERCC6L_ENST00000373657.1_Missense_Mutation_p.F695V|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	818					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					ACACTTCCAAACCCCTTTGGT	0.383																																						uc004eaq.1		NA																	0				ovary(3)	3						c.(2452-2454)TTT>GTT		excision repair protein ERCC6-like							96.0	88.0	91.0					X																	71426165		2203	4300	6503	SO:0001583	missense	54821				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	g.chrX:71426165A>C	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2452T>G	X.37:g.71426165A>C	ENSP00000334675:p.Phe818Val					PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.F695V	p.F818V	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN			2	2549	-	Renal(35;0.156)		818					Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	c.2452T>G	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	A	6.380	0.438175	0.12104	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.90261	-2.61;-2.64	4.69	-1.8	0.07907	.	.	.	.	.	T	0.76608	0.4011	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.60414	-0.7268	9	0.12766	T	0.61	1.3995	9.2985	0.37831	0.2733:0.6383:0.0884:0.0	.	818	Q2NKX8	ERC6L_HUMAN	V	695;818	ENSP00000362761:F695V;ENSP00000334675:F818V	ENSP00000334675:F818V	F	-	1	0	ERCC6L	71342890	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-0.386000	0.07370	-0.499000	0.06623	-0.387000	0.06579	TTT		0.383	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		23	10	0	0	0	0	23	10				
LPAR4	2846	broad.mit.edu	37	X	78011180	78011180	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chrX:78011180T>G	ENST00000435339.3	+	2	1200	c.814T>G	c.(814-816)Tat>Gat	p.Y272D		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	272					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						CCTCTTCTTGTATGCCCTGGT	0.408																																						uc010nme.2		NA																	0				ovary(3)	3						c.(814-816)TAT>GAT		lysophosphatidic acid receptor 4							158.0	121.0	134.0					X																	78011180		2203	4300	6503	SO:0001583	missense	2846					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78011180T>G	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.814T>G	X.37:g.78011180T>G	ENSP00000408205:p.Tyr272Asp						p.Y272D	NM_005296	NP_005287	Q99677	LPAR4_HUMAN			2	1219	+			272			Helical; Name=6; (Potential).		B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	c.814T>G	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.349615	0.41599	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.70631	-0.5;-0.5	4.13	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.76463	0.3991	L	0.42686	1.345	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.74697	-0.3578	10	0.36615	T	0.2	.	11.2486	0.49013	0.0:0.0:0.0:1.0	.	272	Q99677	LPAR4_HUMAN	D	272	ENSP00000408205:Y272D;ENSP00000362398:Y272D	ENSP00000362398:Y272D	Y	+	1	0	LPAR4	77897836	1.000000	0.71417	0.860000	0.33809	0.574000	0.36063	7.438000	0.80431	1.527000	0.49086	0.345000	0.21793	TAT		0.408	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		21	9	0	0	0	0	21	9				
ATP1A4	480	broad.mit.edu	37	1	160156092	160156095	+	Frame_Shift_Del	DEL	CCTA	CCTA	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:160156092_160156095delCCTA	ENST00000368081.4	+	21	3467_3470	c.2996_2999delCCTA	c.(2995-3000)ccctacfs	p.PY999fs	ATP1A4_ENST00000470705.1_Frame_Shift_Del_p.PY135fs	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	999				ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228). {ECO:0000305}.	ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGTGCCATTCCCTACAGTATTCTC	0.549																																						uc001fve.3		NA																	0				ovary(2)|skin(2)	4						c.(2995-3000)CCCTACfs		Na+/K+ -ATPase alpha 4 subunit isoform 1																																				SO:0001589	frameshift_variant	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160156092_160156095delCCTA	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2996_2999delCCTA	1.37:g.160156092_160156095delCCTA	ENSP00000357060:p.Pro999fs					ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Frame_Shift_Del_p.P502fs|ATP1A4_uc001fvh.2_Frame_Shift_Del_p.P135fs	p.P999fs	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		21	3475_3478	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		999_1000	ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228).		Helical; (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Frame_Shift_Del	DEL	ENST00000368081.4	37	c.2996_2999delCCTA	CCDS1197.1																																																																																				0.549	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		16	615	NA	NA	NA	NA	16	615	---	---	---	---
GPR161	23432	broad.mit.edu	37	1	168074064	168074068	+	Frame_Shift_Del	DEL	AGCTG	AGCTG	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr1:168074064_168074068delAGCTG	ENST00000367838.1	-	4	334_338	c.21_25delCAGCT	c.(19-27)ctcagctgcfs	p.SC8fs	GPR161_ENST00000367835.1_Frame_Shift_Del_p.SC8fs|GPR161_ENST00000361697.2_Frame_Shift_Del_p.SC8fs|GPR161_ENST00000546300.1_Intron|GPR161_ENST00000537209.1_Frame_Shift_Del_p.SC28fs|GPR161_ENST00000271357.5_Frame_Shift_Del_p.SC8fs|GPR161_ENST00000367836.1_Intron|GPR161_ENST00000539777.1_Intron	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	8					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					TCCTTCCTGCAGCTGAGGGAGGAGT	0.566																																						uc001gfc.2		NA																	0					0						c.(19-27)CTCAGCTGCfs		G protein-coupled receptor 161 isoform 2																																				SO:0001589	frameshift_variant	23432				multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:168074064_168074068delAGCTG	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.21_25delCAGCT	1.37:g.168074064_168074068delAGCTG	ENSP00000356812:p.Ser8fs					GPR161_uc001gfb.2_Intron|GPR161_uc010pll.1_Intron|GPR161_uc010plm.1_Intron|GPR161_uc009wvo.2_Frame_Shift_Del_p.L24fs|GPR161_uc001gfd.2_Frame_Shift_Del_p.L7fs|GPR161_uc010pln.1_Frame_Shift_Del_p.L27fs|GPR161_uc001gfe.1_Frame_Shift_Del_p.L7fs	p.L7fs	NM_153832	NP_722561	Q8N6U8	GP161_HUMAN			4	335_339	-	all_hematologic(923;0.215)		7_9			Extracellular (Potential).		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Frame_Shift_Del	DEL	ENST00000367838.1	37	c.21_25delCAGCT	CCDS1268.1																																																																																				0.566	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369		22	892	NA	NA	NA	NA	22	892	---	---	---	---
MUC6	4588	broad.mit.edu	37	11	1016769	1016771	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr11:1016769_1016771delGGT	ENST00000421673.2	-	31	6080_6082	c.6030_6032delACC	c.(6028-6033)ccacct>cct	p.2010_2011PP>P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2010	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.P2011S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGAGAAAGGTGGAACGTGAG	0.537																																						uc001lsw.2		NA																	1	Substitution - Missense(1)		skin(1)	ovary(1)	1						c.(6028-6033)CCACCT>CCT		mucin 6, gastric																																				SO:0001651	inframe_deletion	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1016769_1016771delGGT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6030_6032delACC	11.37:g.1016769_1016771delGGT	ENSP00000406861:p.Pro2011del						p.2010_2011PP>P	NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	31	6081_6083	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	2010_2011			Thr-rich.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	In_Frame_Del	DEL	ENST00000421673.2	37	c.6030_6032delACC	CCDS44513.1																																																																																				0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		9	1388	NA	NA	NA	NA	9	1388	---	---	---	---
PRB2	653247	broad.mit.edu	37	12	11546856	11546858	+	In_Frame_Del	DEL	AGA	AGA	-	rs200312236|rs202119309		TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr12:11546856_11546858delAGA	ENST00000389362.4	-	3	189_191	c.154_156delTCT	c.(154-156)tctdel	p.S52del	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	52						extracellular region (GO:0005576)		p.?(2)|p.A39_G59delAPPQGGNKPQGPPSPPGKPQG(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TTCCTGGAGGAGATGGGGGACCT	0.557																																						uc010shk.1		NA																	3	Unknown(2)|Deletion - In frame(1)		stomach(3)		0						c.(154-156)TCTdel		proline-rich protein BstNI subfamily 2				14,4130		3,8,2061						1.0	0.0			144	22,8112		1,20,4046	no	coding	PRB2	NM_006248.3		4,28,6107	A1A1,A1R,RR		0.2705,0.3378,0.2932				36,12242				SO:0001651	inframe_deletion	653247							g.chr12:11546856_11546858delAGA	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.154_156delTCT	12.37:g.11546856_11546858delAGA	ENSP00000374013:p.Ser52del						p.S52del	NM_006248	NP_006239			OV - Ovarian serous cystadenocarcinoma(49;0.185)		3	189_191	-		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)						O00599|P02811|P04281	In_Frame_Del	DEL	ENST00000389362.4	37	c.154_156delTCT	CCDS41757.2																																																																																				0.557	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248		9	397	NA	NA	NA	NA	9	397	---	---	---	---
TGM7	116179	broad.mit.edu	37	15	43579612	43579612	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:43579612delC	ENST00000452443.2	-	6	735	c.731delG	c.(730-732)ggcfs	p.G244fs		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	244					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	GTAGTCCTCGCCCCAGTTCCC	0.607																																						uc001zrf.1		NA																	0				ovary(2)	2						c.(730-732)GGCfs		transglutaminase 7	L-Glutamine(DB00130)						83.0	71.0	75.0					15																	43579612		2202	4299	6501	SO:0001589	frameshift_variant	116179				peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr15:43579612delC	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.731delG	15.37:g.43579612delC	ENSP00000389466:p.Gly244fs						p.G244fs	NM_052955	NP_443187	Q96PF1	TGM7_HUMAN		GBM - Glioblastoma multiforme(94;9.14e-07)	6	736	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	244						Frame_Shift_Del	DEL	ENST00000452443.2	37	c.731delG	CCDS32213.1																																																																																				0.607	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955		17	34	NA	NA	NA	NA	17	34	---	---	---	---
HAPLN3	145864	broad.mit.edu	37	15	89424690	89424691	+	Frame_Shift_Del	DEL	GC	GC	-	rs78894646	byFrequency	TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr15:89424690_89424691delGC	ENST00000359595.3	-	3	604_605	c.390_391delGC	c.(388-393)tcgctgfs	p.L131fs	HAPLN3_ENST00000562889.1_Frame_Shift_Del_p.L193fs	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	131	Ig-like V-type. {ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	TGGATCTCCAGCGAGACGTCAT	0.629																																						uc002bnc.2		NA																	0					0						c.(388-393)TCGCTGfs		hyaluronan and proteoglycan link protein 3																																				SO:0001589	frameshift_variant	145864				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding	g.chr15:89424690_89424691delGC	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.390_391delGC	15.37:g.89424690_89424691delGC	ENSP00000352606:p.Leu131fs					HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Frame_Shift_Del_p.S192fs	p.S130fs	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN			3	518_519	-	Lung NSC(78;0.0392)|all_lung(78;0.077)		130_131			Ig-like V-type.		A8K7P0	Frame_Shift_Del	DEL	ENST00000359595.3	37	c.390_391delGC	CCDS10346.1																																																																																				0.629	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232		32	142	NA	NA	NA	NA	32	142	---	---	---	---
SYNRG	11276	broad.mit.edu	37	17	35896099	35896100	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr17:35896099_35896100insA	ENST00000339208.6	-	19	3787_3788	c.3647_3648insT	c.(3646-3648)atgfs	p.M1216fs	SYNRG_ENST00000394378.2_Frame_Shift_Ins_p.M1138fs|SYNRG_ENST00000502449.2_Frame_Shift_Ins_p.M1093fs|SYNRG_ENST00000585472.1_Frame_Shift_Ins_p.M1137fs|SYNRG_ENST00000591288.1_Frame_Shift_Ins_p.M1010fs|SYNRG_ENST00000346661.4_Frame_Shift_Ins_p.M1216fs|SYNRG_ENST00000345615.4_Frame_Shift_Ins_p.M1138fs	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1216					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TGGCGAGTGACATGAAGCCGAT	0.46																																						uc002hoa.2		NA																	0				ovary(2)	2						c.(3646-3648)ATGfs		synergin, gamma isoform 1																																				SO:0001589	frameshift_variant	11276				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding	g.chr17:35896099_35896100insA	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3648dupT	17.37:g.35896100_35896100dupA	ENSP00000343610:p.Met1216fs					SYNRG_uc010wde.1_Frame_Shift_Ins_p.M1138fs|SYNRG_uc010wdf.1_Frame_Shift_Ins_p.M1138fs|SYNRG_uc002hoc.2_Frame_Shift_Ins_p.M1137fs|SYNRG_uc002hoe.2_Frame_Shift_Ins_p.M1138fs|SYNRG_uc002hod.2_Frame_Shift_Ins_p.M1093fs|SYNRG_uc010wdg.1_Frame_Shift_Ins_p.M1010fs|SYNRG_uc002hob.2_Frame_Shift_Ins_p.M1216fs	p.M1216fs	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN			19	3730_3731	-			1216					A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Frame_Shift_Ins	INS	ENST00000339208.6	37	c.3647_3648insT	CCDS11321.1																																																																																				0.460	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247		9	63	NA	NA	NA	NA	9	63	---	---	---	---
FTL	2512	broad.mit.edu	37	19	49469858	49469861	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr19:49469858_49469861delACTC	ENST00000331825.6	+	4	601_604	c.394_397delACTC	c.(394-399)actcacfs	p.TH132fs	CTD-2639E6.9_ENST00000599784.1_lincRNA	NM_000146.3	NP_000137.2	P02792	FRIL_HUMAN	ferritin, light polypeptide	132	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|membrane (GO:0016020)	ferric iron binding (GO:0008199)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)			cervix(1)|kidney(3)|lung(5)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	CTTCCTGGAGACTCACTTCCTAGA	0.525																																						uc002plo.2		NA																	0					0						c.(394-399)ACTCACfs		ferritin, light polypeptide	Iron Dextran(DB00893)																																			SO:0001589	frameshift_variant	2512				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity	g.chr19:49469858_49469861delACTC	AY207005	CCDS33070.1	19q13.33	2014-05-19			ENSG00000087086	ENSG00000087086			3999	protein-coding gene	gene with protein product	"""ferritin light polypeptide-like 3"", ""L apoferritin"", ""ferritin L subunit"", ""ferritin light chain"", ""ferritin L-chain"", ""neurodegeneration with brain iron accumulation 3"""	134790				3000916, 9526618	Standard	NM_000146		Approved	MGC71996, NBIA3	uc002plo.3	P02792		ENST00000331825.6:c.394_397delACTC	19.37:g.49469858_49469861delACTC	ENSP00000366525:p.Thr132fs					FTL_uc002pln.1_3'UTR	p.T132fs	NM_000146	NP_000137	P02792	FRIL_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	4	593_596	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	132_133			Ferritin-like diiron.		B2R4B9|Q6IBT7|Q7Z2W1|Q86WI9|Q8WU07|Q96AU9|Q96CU0|Q9BTZ8	Frame_Shift_Del	DEL	ENST00000331825.6	37	c.394_397delACTC	CCDS33070.1																																																																																				0.525	FTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466233.1	NM_000146		60	157	NA	NA	NA	NA	60	157	---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	63086416	63086417	+	Frame_Shift_Ins	INS	-	-	GACTCAGA			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr2:63086416_63086417insGACTCAGA	ENST00000263991.5	+	9	1334_1335	c.852_853insGACTCAGA	c.(853-855)gacfs	p.-287fs	AC007098.1_ENST00000452397.1_RNA|EHBP1_ENST00000405015.3_Frame_Shift_Ins_p.-252fs|EHBP1_ENST00000431489.1_Frame_Shift_Ins_p.-252fs|EHBP1_ENST00000405289.1_Frame_Shift_Ins_p.-252fs|EHBP1_ENST00000354487.3_Frame_Shift_Ins_p.-252fs	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1							cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTGGAGATCCTGACTCAGAAGG	0.361																																						uc002sby.2		NA																	0				ovary(1)|breast(1)	2						c.(850-855)CCTGACfs		EH domain binding protein 1 isoform 1																																				SO:0001589	frameshift_variant	23301	Hereditary_Prostate_Cancer				cytoplasm|membrane		g.chr2:63086416_63086417insGACTCAGA	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.853_860dupGACTCAGA	2.37:g.63086417_63086424dupGACTCAGA	ENSP00000263991:p.Glu287fs					EHBP1_uc010fcp.2_Frame_Shift_Ins_p.P249fs|EHBP1_uc002sbx.2_Frame_Shift_Ins_p.P249fs|EHBP1_uc002sbz.2_Frame_Shift_Ins_p.P249fs|EHBP1_uc002scb.2_Frame_Shift_Ins_p.P249fs	p.P284fs	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)		9	1334_1335	+	Lung NSC(7;0.0951)|all_lung(7;0.169)		284_285					O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Frame_Shift_Ins	INS	ENST00000263991.5	37	c.852_853insGACTCAGA	CCDS1872.1																																																																																				0.361	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252		11	54	NA	NA	NA	NA	11	54	---	---	---	---
GAB1	2549	broad.mit.edu	37	4	144361302	144361303	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr4:144361302_144361303insT	ENST00000262994.4	+	6	1654_1655	c.1352_1353insT	c.(1351-1356)aatcccfs	p.P452fs	GAB1_ENST00000505913.1_Frame_Shift_Ins_p.P349fs|GAB1_ENST00000262995.4_Frame_Shift_Ins_p.P452fs	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	452	Pro-rich.				activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					GTCCCAATGAATCCCAATTCAC	0.351																																						uc003ije.2		NA																	0				breast(2)|lung(1)|skin(1)	4						c.(1351-1353)AATfs		GRB2-associated binding protein 1 isoform b																																				SO:0001589	frameshift_variant	2549				cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity	g.chr4:144361302_144361303insT	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1353dupT	4.37:g.144361303_144361303dupT	ENSP00000262994:p.Pro452fs					GAB1_uc003ijd.2_Frame_Shift_Ins_p.N451fs|GAB1_uc011chq.1_Frame_Shift_Ins_p.N348fs	p.N451fs	NM_002039	NP_002030	Q13480	GAB1_HUMAN			6	1711_1712	+	all_hematologic(180;0.158)		451			Pro-rich.		A8K152|Q4W5G2|Q6P1W2	Frame_Shift_Ins	INS	ENST00000262994.4	37	c.1352_1353insT	CCDS3759.1																																																																																				0.351	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039		35	31	NA	NA	NA	NA	35	31	---	---	---	---
APC	324	broad.mit.edu	37	5	112173680	112173680	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chr5:112173680delG	ENST00000457016.1	+	16	2769	c.2389delG	c.(2389-2391)ggtfs	p.G797fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.G797fs|APC_ENST00000508376.2_Frame_Shift_Del_p.G797fs			P25054	APC_HUMAN	adenomatous polyposis coli	797	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTCTCTATGGTGATTATGT	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	uc010jby.2		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	D|Mis|N|F|S	adenomatous polyposis of the colon gene			"""E, M, O"""		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS		1	Unknown(1)	p.?(1)	skin(1)	large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515						c.(2389-2391)GGTfs		adenomatous polyposis coli							83.0	84.0	83.0					5																	112173680		2202	4300	6502	SO:0001589	frameshift_variant	324	Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	g.chr5:112173680delG	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2389delG	5.37:g.112173680delG	ENSP00000413133:p.Gly797fs	TSP Lung(16;0.13)				APC_uc011cvt.1_Frame_Shift_Del_p.G779fs|APC_uc003kpz.3_Frame_Shift_Del_p.G797fs|APC_uc003kpy.3_Frame_Shift_Del_p.G797fs|APC_uc010jbz.2_Frame_Shift_Del_p.G514fs|APC_uc010jca.2_Frame_Shift_Del_p.G97fs	p.G797fs	NM_001127511	NP_001120983	P25054	APC_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	16	2769	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	797			Ser-rich.		D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	c.2389delG	CCDS4107.1																																																																																				0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		12	59	NA	NA	NA	NA	12	59	---	---	---	---
CAPN6	827	broad.mit.edu	37	X	110490693	110490698	+	In_Frame_Del	DEL	TCCTCC	TCCTCC	-			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chrX:110490693_110490698delTCCTCC	ENST00000324068.1	-	12	1808_1813	c.1641_1646delGGAGGA	c.(1639-1647)aaggaggaa>aaa	p.EE548del	CAPN6_ENST00000541758.1_In_Frame_Del_p.EE293del	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	548	C2.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						AGAACGGACTTCCTCCTTTCCACATT	0.393																																						uc004epc.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(1639-1647)AAGGAGGAA>AAA		calpain 6																																				SO:0001651	inframe_deletion	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110490693_110490698delTCCTCC	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1641_1646delGGAGGA	X.37:g.110490693_110490698delTCCTCC	ENSP00000317214:p.Glu548_Glu549del					CAPN6_uc011msu.1_In_Frame_Del_p.EE293del	p.EE548del	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN			12	1809_1814	-			548_549			C2.		D3DUY7|Q9UEQ1|Q9UJA8	In_Frame_Del	DEL	ENST00000324068.1	37	c.1641_1646delGGAGGA	CCDS14555.1																																																																																				0.393	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			21	26	NA	NA	NA	NA	21	26	---	---	---	---
TBL1Y	90665	broad.mit.edu	37	Y	6948772	6948773	+	Splice_Site	INS	-	-	C			TCGA-CV-7418-01A-11D-2078-08	TCGA-CV-7418-10A-01D-2078-08	 	 	 	 	 	 	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	25a70d04-f533-4e60-b9fc-e74d600db296	7dbbc6b9-3e72-4914-b072-4d1a5af90c1f	g.chrY:6948772_6948773insC	ENST00000383032.1	+	14	1602_1603		c.e14-1		TBL1Y_ENST00000346432.3_Splice_Site|TBL1Y_ENST00000355162.2_Splice_Site	NM_033284.1	NP_150600.1	Q9BQ87	TBL1Y_HUMAN	transducin (beta)-like 1, Y-linked						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)|skin(1)	8						CCCTGCTGCAGCCCCCGCCCTT	0.51																																						uc004frb.2		NA																	0					0						c.e14-1		transducin beta-like 1Y																																				SO:0001630	splice_region_variant	90665				transcription, DNA-dependent			g.chrY:6948772_6948773insC	AF332220	CCDS14779.1	Yp11.2	2013-01-10	2009-12-17		ENSG00000092377	ENSG00000092377		"""WD repeat domain containing"""	18502	protein-coding gene	gene with protein product		400033					Standard	NM_033284		Approved	TBL1	uc004frd.3	Q9BQ87	OTTHUMG00000035299	ENST00000383032.1:c.956-1->C	Y.37:g.6948777_6948777dupC						TBL1Y_uc004frc.2_Splice_Site_p.A319_splice|TBL1Y_uc004frd.2_Splice_Site_p.A319_splice|TBL1Y_uc011nap.1_Splice_Site_p.A161_splice	p.A319_splice	NM_033284	NP_150600	Q9BQ87	TBL1Y_HUMAN			14	1603	+								A1L4B3	Splice_Site	INS	ENST00000383032.1	37	c.956_splice	CCDS14779.1																																																																																				0.510	TBL1Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085360.1	NM_033284	Intron	34	15	NA	NA	NA	NA	34	15	---	---	---	---
