#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACLY	47	broad.mit.edu;hgsc.bcm.edu	37	17	40049295	40049295	+	Missense_Mutation	SNP	T	T	G	rs144101604		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr17:40049295T>G	ENST00000352035.2	-	15	1722	c.1592A>C	c.(1591-1593)tAc>tCc	p.Y531S	ACLY_ENST00000590151.1_Missense_Mutation_p.Y531S|ACLY_ENST00000353196.1_Missense_Mutation_p.Y521S|ACLY_ENST00000537919.1_Missense_Mutation_p.Y260S|ACLY_ENST00000393896.2_Missense_Mutation_p.Y521S	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	531					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.Y531S(1)	NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CGTGAAAGGGTAGACCATGGC	0.577																																					Colon(64;807 1396 15971 30971)												1	Substitution - Missense(1)	kidney(1)											63.0	62.0	62.0					17																	40049295		2203	4300	6503	SO:0001583	missense	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.1592A>C	17.37:g.40049295T>G	ENSP00000253792:p.Tyr531Ser		B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.037747	0.93630	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	6.08	6.08	0.98989	CoA-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93200	0.7834	M	0.93062	3.375	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.996;0.998;0.986;0.999;0.96	D	0.94013	0.7286	10	0.52906	T	0.07	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	260;575;585;521;531	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	S	531;585;521;260;521	ENSP00000253792:Y531S;ENSP00000345398:Y521S;ENSP00000445349:Y260S;ENSP00000377474:Y521S	ENSP00000253792:Y531S	Y	-	2	0	ACLY	37302821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.333000	0.79357	0.533000	0.62120	TAC		0.577	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1		NM_001096	
ACSF3	197322	broad.mit.edu;hgsc.bcm.edu	37	16	89167563	89167563	+	Silent	SNP	G	G	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:89167563G>A	ENST00000317447.4	+	3	851	c.474G>A	c.(472-474)ccG>ccA	p.P158P	ACSF3_ENST00000406948.3_Silent_p.P158P|ACSF3_ENST00000378345.4_Intron	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	158					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)	p.P158P(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TCCTGAGCCCGGTGGTCAGGA	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											30.0	28.0	29.0					16																	89167563		2197	4300	6497	SO:0001819	synonymous_variant	197322			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.474G>A	16.37:g.89167563G>A			A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Silent	SNP	ENST00000317447.4	37	CCDS10974.1																																																																																				0.637	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1		NM_174917	
ANKS1A	23294	hgsc.bcm.edu	37	6	34985551	34985553	+	In_Frame_Del	DEL	CAA	CAA	-	rs149130122|rs202233464	byFrequency	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr6:34985551_34985553delCAA	ENST00000360359.3	+	11	1863_1865	c.1725_1727delCAA	c.(1723-1728)accaac>acc	p.N576del	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	576					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TGCCCACCACCAACAGCCGCTCG	0.655																																																	0																																										SO:0001651	inframe_deletion	23294			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1725_1727delCAA	6.37:g.34985551_34985553delCAA	ENSP00000353518:p.Asn576del		A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	In_Frame_Del	DEL	ENST00000360359.3	37	CCDS4798.1																																																																																				0.655	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1		XM_166478	
B3GAT2	135152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	71665632	71665632	+	Silent	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr6:71665632C>T	ENST00000230053.6	-	1	1109	c.501G>A	c.(499-501)ctG>ctA	p.L167L		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	167					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)	p.L167L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCTCTGGCGCAGCCAGGCGA	0.701																																																	1	Substitution - coding silent(1)	kidney(1)											5.0	7.0	6.0					6																	71665632		1854	3672	5526	SO:0001819	synonymous_variant	135152			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.501G>A	6.37:g.71665632C>T			Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1																																																																																				0.701	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2		NM_080742	
BMPER	168667	hgsc.bcm.edu	37	7	34118719	34118730	+	In_Frame_Del	DEL	GCGCATCGCGCT	GCGCATCGCGCT	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	GCGCATCGCGCT	GCGCATCGCGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr7:34118719_34118730delGCGCATCGCGCT	ENST00000297161.2	+	13	1703_1714	c.1329_1340delGCGCATCGCGCT	c.(1327-1341)tcgcgcatcgcgctc>tcc	p.RIAL444del	BMPER_ENST00000426693.1_In_Frame_Del_p.RIAL444del	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	444	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.A446A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GGAACGGCTCGCGCATCGCGCTCCCCTGCCGC	0.656																																																	1	Substitution - coding silent(1)	lung(1)																																								SO:0001651	inframe_deletion	168667				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1329_1340delGCGCATCGCGCT	7.37:g.34118719_34118730delGCGCATCGCGCT	ENSP00000297161:p.Arg444_Leu447del		A8K1P8|Q8TF36	In_Frame_Del	DEL	ENST00000297161.2	37	CCDS5442.1																																																																																				0.656	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2		NM_133468	
C2CD3	26005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	73850649	73850649	+	Splice_Site	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr11:73850649C>T	ENST00000334126.7	-	4	934		c.e4+1		C2CD3_ENST00000539061.1_Splice_Site|C2CD3_ENST00000313663.7_Splice_Site			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3						brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.?(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					ATGGTAATTACCTCGGAGTGG	0.408																																																	2	Unknown(2)	kidney(2)											292.0	289.0	290.0					11																	73850649		2200	4293	6493	SO:0001630	splice_region_variant	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.707+1G>A	11.37:g.73850649C>T			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Splice_Site	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	14.69	2.611338	0.46631	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000289350;ENST00000539061	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7792	0.63073	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C2CD3	73528297	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	4.890000	0.63178	2.631000	0.89168	0.644000	0.83932	.		0.408	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015531	Intron
KANSL1L	151050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	211018808	211018808	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr2:211018808G>T	ENST00000281772.9	-	2	762	c.499C>A	c.(499-501)Caa>Aaa	p.Q167K	KANSL1L_ENST00000452086.1_Missense_Mutation_p.Q167K|KANSL1L_ENST00000457374.1_Missense_Mutation_p.Q167K|KANSL1L_ENST00000429908.2_5'Flank|KANSL1L_ENST00000418791.1_Missense_Mutation_p.Q167K	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	167						histone acetyltransferase complex (GO:0000123)		p.Q167K(1)									TTTTGTAGTTGTACTTTATCT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											115.0	108.0	110.0					2																	211018808		2203	4300	6503	SO:0001583	missense	0			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.499C>A	2.37:g.211018808G>T	ENSP00000281772:p.Gln167Lys		B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	G	0.974	-0.699296	0.03279	.	.	ENSG00000144445	ENST00000281772;ENST00000418791;ENST00000457374;ENST00000452086	.	.	.	5.81	4.89	0.63831	.	0.381555	0.26567	N	0.023660	T	0.25457	0.0619	N	0.24115	0.695	0.18873	N	0.999983	B;B;B;B	0.30236	0.169;0.274;0.264;0.137	B;B;B;B	0.30401	0.079;0.115;0.085;0.085	T	0.15694	-1.0428	9	0.06236	T	0.91	.	11.9776	0.53100	0.0711:0.1339:0.795:0.0	.	167;167;167;167	A0AUZ9-4;A0AUZ9-3;A0AUZ9-2;A0AUZ9	.;.;.;CB067_HUMAN	K	167	.	ENSP00000281772:Q167K	Q	-	1	0	C2orf67	210727053	1.000000	0.71417	0.971000	0.41717	0.993000	0.82548	1.840000	0.39230	2.765000	0.95021	0.558000	0.71614	CAA		0.333	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3		NM_152519	
CLSTN3	9746	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7288076	7288077	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr12:7288076_7288077GA>TG	ENST00000266546.6	+	4	987_988	c.537_538GA>TG	c.(535-540)caGAtc>caTGtc	p.179_180QI>HV	CLSTN3_ENST00000537408.1_Missense_Mutation_p.191_192QI>HV	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.Q179>?(1)|p.Q179H(1)|p.I180V(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						AGTACAGCCAGATCTGCTACTA	0.579																																																	3	Substitution - Missense(2)|Complex(1)	kidney(3)																																								SO:0001583	missense	9746			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	Exception_encountered	12.37:g.7288076_7288077delinsTG	ENSP00000266546:p.Q179_I180delinsHV		D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																				0.579	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2		NM_014718	
CTSB	1508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	11703250	11703250	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr8:11703250C>T	ENST00000353047.6	-	9	1095	c.842G>A	c.(841-843)cGc>cAc	p.R281H	CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000533455.1_Missense_Mutation_p.R281H|CTSB_ENST00000434271.1_Missense_Mutation_p.R281H|CTSB_ENST00000530640.2_Missense_Mutation_p.R281H|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000453527.2_Missense_Mutation_p.R281H|CTSB_ENST00000345125.3_Missense_Mutation_p.R281H|CTSB_ENST00000531089.1_Missense_Mutation_p.R281H|CTSB_ENST00000534510.1_Missense_Mutation_p.R281H	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	281					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)	p.R281H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		GCCCAGGATGCGGATGGCATG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											130.0	85.0	100.0					8																	11703250		2203	4300	6503	SO:0001583	missense	1508			M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.842G>A	8.37:g.11703250C>T	ENSP00000345672:p.Arg281His		B3KQR5|B3KRR5|Q503A6|Q96D87	Missense_Mutation	SNP	ENST00000353047.6	37	CCDS5986.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826409	0.90955	.	.	ENSG00000164733	ENST00000434271;ENST00000540571;ENST00000353047;ENST00000530640;ENST00000531089;ENST00000453527;ENST00000345125;ENST00000533455;ENST00000534510;ENST00000541328	D;D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.43	5.43	0.79202	Peptidase C1A, papain C-terminal (3);	0.055373	0.85682	D	0.000000	D	0.94739	0.8302	H	0.97540	4.025	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.995;0.999	D	0.95433	0.8518	10	0.87932	D	0	.	11.7662	0.51933	0.0:0.9208:0.0:0.0792	.	218;281;281;218	B3KUJ8;A8K2H4;P07858;F5H2P9	.;.;CATB_HUMAN;.	H	281;218;281;281;281;281;281;281;281;187	ENSP00000415889:R281H;ENSP00000345672:R281H;ENSP00000435105:R281H;ENSP00000433215:R281H;ENSP00000409917:R281H;ENSP00000342070:R281H;ENSP00000432244:R281H;ENSP00000434217:R281H	ENSP00000342070:R281H	R	-	2	0	CTSB	11740659	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.474000	0.60203	2.825000	0.97269	0.655000	0.94253	CGC		0.612	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3		NM_147780	
DENND1A	57706	hgsc.bcm.edu	37	9	126146189	126146197	+	Splice_Site	DEL	CGGCCTGTC	CGGCCTGTC	-	rs75693594|rs111273094|rs2808411	byFrequency	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	CGGCCTGTC	CGGCCTGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr9:126146189_126146197delCGGCCTGTC	ENST00000373624.2	-	21	1779_1782	c.1578_1581delGACAGGCCG	c.(1576-1581)cagaca>ca	p.QT526del	DENND1A_ENST00000542603.1_Splice_Site_p.WT311del|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Splice_Site_p.WT537del	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	526					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P527P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GATACGGCTGCGGCCTGTCGGGGACAGAG	0.66																																																	1	Substitution - coding silent(1)	lung(1)																																								SO:0001630	splice_region_variant	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1578-1GACAGGCCG>-	9.37:g.126146189_126146197delCGGCCTGTC			A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Frame_Shift_Del	DEL	ENST00000373624.2	37	CCDS35133.1																																																																																				0.660	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1		NM_024820	In_Frame_Del
DQX1	165545	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	74745642	74745642	+	Missense_Mutation	SNP	C	C	T	rs554672292		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr2:74745642C>T	ENST00000404568.3	-	12	2304	c.2085G>A	c.(2083-2085)atG>atA	p.M695I	DQX1_ENST00000393951.2_Missense_Mutation_p.M695I	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	695						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.M577I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TAGAATCTGCCATTCCTTCCC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		21939	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											154.0	136.0	142.0					2																	74745642		2203	4300	6503	SO:0001583	missense	165545			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.2085G>A	2.37:g.74745642C>T	ENSP00000384621:p.Met695Ile		Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	12.35	1.912987	0.33815	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.02631	4.22;4.22	5.0	4.11	0.48088	.	0.386721	0.23414	N	0.048438	T	0.03220	0.0094	L	0.40543	1.245	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.36212	-0.9757	10	0.51188	T	0.08	.	8.5073	0.33195	0.0:0.8892:0.0:0.1108	.	695	Q8TE96	DQX1_HUMAN	I	695	ENSP00000377523:M695I;ENSP00000384621:M695I	ENSP00000377523:M695I	M	-	3	0	DQX1	74599150	0.012000	0.17670	0.819000	0.32651	0.801000	0.45260	1.097000	0.30988	1.059000	0.40554	0.563000	0.77884	ATG		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3		NM_133637	
GRIN2B	2904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	13769424	13769424	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr12:13769424C>A	ENST00000609686.1	-	5	1502	c.1293G>T	c.(1291-1293)agG>agT	p.R431S		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	431					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R431S(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGACTGTGTTCCTCATGCAGG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											182.0	148.0	160.0					12																	13769424		2203	4300	6503	SO:0001583	missense	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1293G>T	12.37:g.13769424C>A	ENSP00000477455:p.Arg431Ser		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887419	0.72410	.	.	ENSG00000150086	ENST00000279593	T	0.12672	2.66	5.53	4.62	0.57501	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.27765	0.0683	L	0.55743	1.74	0.80722	D	1	D	0.64830	0.994	D	0.63381	0.914	T	0.01007	-1.1483	10	0.54805	T	0.06	.	10.5697	0.45194	0.0:0.7936:0.1346:0.0718	.	431	Q13224	NMDE2_HUMAN	S	431	ENSP00000279593:R431S	ENSP00000279593:R431S	R	-	3	2	GRIN2B	13660691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.982000	0.56909	1.279000	0.44446	0.563000	0.77884	AGG		0.517	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			
IDH1	3417	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	209104723	209104723	+	Nonsense_Mutation	SNP	A	A	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr2:209104723A>C	ENST00000415913.1	-	8	1236	c.855T>G	c.(853-855)taT>taG	p.Y285*	IDH1_ENST00000345146.2_Nonsense_Mutation_p.Y285*|IDH1_ENST00000446179.1_Nonsense_Mutation_p.Y285*	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	285					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.Y285*(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		CGAGAGAGCCATACCCTGTAA	0.517			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)			Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	1	Substitution - Nonsense(1)	kidney(1)											106.0	81.0	89.0					2																	209104723		2203	4300	6503	SO:0001587	stop_gained	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.855T>G	2.37:g.209104723A>C	ENSP00000390265:p.Tyr285*		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Nonsense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	A	38	7.080045	0.98048	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	.	.	.	6.08	-1.57	0.08506	.	0.051185	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-17.5657	11.0089	0.47651	0.6204:0.0:0.3796:0.0	.	.	.	.	X	285	.	ENSP00000260985:Y285X	Y	-	3	2	IDH1	208812968	1.000000	0.71417	0.982000	0.44146	0.460000	0.32559	1.566000	0.36396	-0.254000	0.09500	-0.353000	0.07706	TAT		0.517	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			
KCNK18	338567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	118969176	118969176	+	Missense_Mutation	SNP	G	G	A	rs139101102		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr10:118969176G>A	ENST00000334549.1	+	3	521	c.521G>A	c.(520-522)cGc>cAc	p.R174H		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	174					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.R174H(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		TTCTTTACCCGCCCCCTCCTC	0.507																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)						G	HIS/ARG	0,4406		0,0,2203	85.0	89.0	88.0		521	-3.3	0.0	10	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNK18	NM_181840.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	174/385	118969176	1,13005	2203	4300	6503	SO:0001583	missense	338567			AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.521G>A	10.37:g.118969176G>A	ENSP00000334650:p.Arg174His		Q5SQQ8	Missense_Mutation	SNP	ENST00000334549.1	37	CCDS7598.1	.	.	.	.	.	.	.	.	.	.	G	9.837	1.189940	0.21954	0.0	1.16E-4	ENSG00000186795	ENST00000334549	T	0.26223	1.75	4.41	-3.26	0.05064	.	1.118960	0.06526	N	0.740624	T	0.08935	0.0221	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22941	-1.0202	10	0.40728	T	0.16	.	1.0346	0.01545	0.2564:0.3024:0.2513:0.1898	.	174	Q7Z418	KCNKI_HUMAN	H	174	ENSP00000334650:R174H	ENSP00000334650:R174H	R	+	2	0	KCNK18	118959166	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.919000	0.04017	-0.759000	0.04684	-0.345000	0.07892	CGC		0.507	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2		NM_181840	
KCNRG	283518	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	50594550	50594550	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr13:50594550A>G	ENST00000312942.1	+	2	1019	c.779A>G	c.(778-780)gAg>gGg	p.E260G	KCNRG_ENST00000360473.4_3'UTR|TRIM13_ENST00000478111.1_3'UTR	NM_173605.1	NP_775876.1	Q8N5I3	KCNRG_HUMAN	potassium channel regulator	260					protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)	identical protein binding (GO:0042802)	p.E260G(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CCAAAACCAGAGACTATCATC	0.353																																																	1	Substitution - Missense(1)	kidney(1)											73.0	68.0	70.0					13																	50594550		2203	4300	6503	SO:0001583	missense	283518				CCDS9424.1, CCDS41889.1	13q14.11	2008-05-02			ENSG00000198553	ENSG00000198553			18893	protein-coding gene	gene with protein product							Standard	NM_173605		Approved		uc001vdu.3	Q8N5I3	OTTHUMG00000140140	ENST00000312942.1:c.779A>G	13.37:g.50594550A>G	ENSP00000324191:p.Glu260Gly		A2A2X9|Q0P6D0|Q8IU75|Q8N3Q9	Missense_Mutation	SNP	ENST00000312942.1	37	CCDS9424.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.566533	0.28003	.	.	ENSG00000198553	ENST00000312942	T	0.58797	0.31	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000002	T	0.41096	0.1144	N	0.20986	0.625	0.32113	N	0.589065	B	0.21753	0.06	B	0.20577	0.03	T	0.49031	-0.8981	10	0.45353	T	0.12	.	8.0242	0.30427	0.8776:0.0:0.1224:0.0	.	260	Q8N5I3	KCNRG_HUMAN	G	260	ENSP00000324191:E260G	ENSP00000324191:E260G	E	+	2	0	KCNRG	49492551	0.999000	0.42202	0.997000	0.53966	0.386000	0.30323	1.497000	0.35649	2.018000	0.59344	0.455000	0.32223	GAG		0.353	KCNRG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276308.1			
ICE1	23379	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	5462929	5462929	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr5:5462929T>G	ENST00000296564.7	+	13	3704	c.3482T>G	c.(3481-3483)aTa>aGa	p.I1161R		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1161					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.I1161R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GATTTTAACATAAGTACTTTT	0.428																																																	1	Substitution - Missense(1)	kidney(1)											82.0	76.0	78.0					5																	5462929		1868	4119	5987	SO:0001583	missense	23379																														ENST00000296564.7:c.3482T>G	5.37:g.5462929T>G	ENSP00000296564:p.Ile1161Arg		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.815305	0.90790	.	.	ENSG00000164151	ENST00000296564	T	0.12984	2.63	5.14	5.14	0.70334	.	.	.	.	.	T	0.21509	0.0518	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	D	0.64237	0.923	T	0.08576	-1.0715	9	0.66056	D	0.02	-3.0355	11.3412	0.49533	0.0:0.0:0.0:1.0	.	1161	Q9Y2F5	K0947_HUMAN	R	1161	ENSP00000296564:I1161R	ENSP00000296564:I1161R	I	+	2	0	KIAA0947	5515929	0.013000	0.17824	0.003000	0.11579	0.973000	0.67179	1.597000	0.36729	1.935000	0.56089	0.254000	0.18369	ATA		0.428	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			
KIF3C	3797	hgsc.bcm.edu	37	2	26203995	26203996	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr2:26203995_26203996insG	ENST00000264712.3	-	1	1370_1371	c.791_792insC	c.(790-792)gcafs	p.A264fs	KIF3C_ENST00000405914.1_Frame_Shift_Ins_p.A264fs	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	264	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGGTGTGGCTGCCCCTCCCGC	0.624																																																	0																																										SO:0001589	frameshift_variant	3797				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.792dupC	2.37:g.26203996_26203996dupG	ENSP00000264712:p.Ala264fs		O43544|Q4ZG18|Q53SX5|Q562F7	Frame_Shift_Ins	INS	ENST00000264712.3	37	CCDS1719.1																																																																																				0.624	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			
LILRB3	11025	hgsc.bcm.edu	37	19	54721256	54721256	+	Missense_Mutation	SNP	A	A	G	rs117030367	byFrequency	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr19:54721256A>G	ENST00000391750.1	-	13	1817	c.1681T>C	c.(1681-1683)Tca>Cca	p.S561P	LILRA6_ENST00000270464.5_Missense_Mutation_p.S562P|LILRA6_ENST00000391735.3_3'UTR|LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000440558.2_Missense_Mutation_p.S561P|LILRB3_ENST00000407860.2_Missense_Mutation_p.S578P|LILRB3_ENST00000245620.9_Missense_Mutation_p.S562P|LILRB3_ENST00000346401.6_Missense_Mutation_p.S573P|LILRB3_ENST00000424807.1_Missense_Mutation_p.S561P|LILRA6_ENST00000419410.2_Missense_Mutation_p.S562P			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	561				S -> P (in Ref. 2; AAB87667). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGACAGTGAGGAGGGAGGA	0.587													.|||	688	0.13738	0.3154	0.1225	5008	,	,		18342	0.006		0.1093	False		,,,				2504	0.0716																0													104.0	107.0	106.0					19																	54721256		2200	4300	6500	SO:0001583	missense	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1681T>C	19.37:g.54721256A>G	ENSP00000375630:p.Ser561Pro		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	37	CCDS33105.1	162	0.07417582417582418	87	0.17682926829268292	24	0.06629834254143646	1	0.0017482517482517483	50	0.06596306068601583	a	1.378	-0.584193	0.03827	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482;ENSG00000244482;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000440558;ENST00000270464;ENST00000419410	T;T;T;T;T;T;T;T	0.00509	6.94;6.94;6.91;6.94;6.93;6.94;6.94;6.96	2.38	-4.75	0.03239	.	.	.	.	.	T	0.00012	0.0000	N	0.00325	-1.645	0.80722	P	0.0	B;B;B;B;B;B;B	0.14805	0.0;0.002;0.0;0.0;0.011;0.0;0.0	B;B;B;B;B;B;B	0.15052	0.0;0.004;0.0;0.001;0.012;0.001;0.001	T	0.30297	-0.9983	8	0.25751	T	0.34	.	2.1603	0.03823	0.5095:0.1978:0.1738:0.1189	.	578;561;562;573;578;561;562	B5MCX0;F8WCY4;D3YTC4;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;.;.;LIRB3_HUMAN;.	P	561;561;573;562;578;561;562;562	ENSP00000375630:S561P;ENSP00000412771:S561P;ENSP00000345184:S573P;ENSP00000245620:S562P;ENSP00000384274:S578P;ENSP00000390120:S561P;ENSP00000270464:S562P;ENSP00000411227:S562P	ENSP00000270464:S562P	S	-	1	0	LILRB3;LILRA6	59413068	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-3.289000	0.00525	-2.791000	0.00356	-1.123000	0.02005	TCA		0.587	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5		NM_006864	
LPCAT3	10162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7087581	7087581	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr12:7087581A>G	ENST00000261407.4	-	9	1047	c.962T>C	c.(961-963)gTg>gCg	p.V321A	LPCAT3_ENST00000535021.1_Splice_Site|U47924.30_ENST00000606112.1_lincRNA	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	321					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)	p.V321A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AAAGAGCCACACCTTCATGTT	0.547																																																	1	Substitution - Missense(1)	kidney(1)											109.0	102.0	104.0					12																	7087581		2203	4300	6503	SO:0001583	missense	10162			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.962T>C	12.37:g.7087581A>G	ENSP00000261407:p.Val321Ala		B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	ENST00000261407.4	37	CCDS8572.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524892	0.85600	.	.	ENSG00000111684	ENST00000261407	T	0.73152	-0.72	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.83202	0.5203	M	0.80746	2.51	0.80722	D	1	D	0.71674	0.998	P	0.61592	0.891	D	0.84770	0.0767	10	0.52906	T	0.07	-8.4189	16.255	0.82510	1.0:0.0:0.0:0.0	.	321	Q6P1A2	MBOA5_HUMAN	A	321	ENSP00000261407:V321A	ENSP00000261407:V321A	V	-	2	0	LPCAT3	6957842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.348000	0.90064	2.240000	0.73641	0.533000	0.62120	GTG		0.547	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1		NM_005768	
OR10AD1	121275	hgsc.bcm.edu	37	12	48596138	48596139	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr12:48596138_48596139insG	ENST00000310248.2	-	1	1031_1032	c.937_938insC	c.(937-939)cagfs	p.Q313fs		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						AGACTGTGGCTGGGCCAGCCTG	0.54																																																	0																																										SO:0001589	frameshift_variant	121275				CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.938dupC	12.37:g.48596141_48596141dupG	ENSP00000308689:p.Gln313fs		B9EGT9|Q6IFA8	Frame_Shift_Ins	INS	ENST00000310248.2	37	CCDS31787.1																																																																																				0.540	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397577.1			
OR10G2	26534	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	22102295	22102295	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr14:22102295G>C	ENST00000542433.1	-	1	801	c.704C>G	c.(703-705)aCc>aGc	p.T235S		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T235S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		CCCATCAGCGGTGCGTATCTT	0.542																																																	1	Substitution - Missense(1)	kidney(1)											42.0	43.0	43.0					14																	22102295		2176	4242	6418	SO:0001583	missense	26534				CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.704C>G	14.37:g.22102295G>C	ENSP00000445383:p.Thr235Ser		B2RPD0	Missense_Mutation	SNP	ENST00000542433.1	37	CCDS32047.1	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.366620	0.01225	.	.	ENSG00000255582	ENST00000542433	T	0.00010	9.4	3.92	3.92	0.45320	GPCR, rhodopsin-like superfamily (1);	0.137065	0.33005	N	0.005387	T	0.00073	0.0002	N	0.00566	-1.37	0.09310	N	1	D	0.59357	0.985	P	0.62740	0.906	T	0.66878	-0.5812	10	0.02654	T	1	-8.0537	13.4661	0.61254	0.0:0.0:1.0:0.0	.	235	Q8NGC3	O10G2_HUMAN	S	235	ENSP00000445383:T235S	ENSP00000445383:T235S	T	-	2	0	OR10G2	21172135	0.026000	0.19158	0.971000	0.41717	0.028000	0.11728	1.990000	0.40717	2.027000	0.59764	0.557000	0.71058	ACC		0.542	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1			
OR4C13	283092	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	49974717	49974717	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr11:49974717C>T	ENST00000555099.1	+	1	775	c.743C>T	c.(742-744)tCc>tTc	p.S248F		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S248F(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						GTCATCTTATCCTTTATACCC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											181.0	162.0	169.0					11																	49974717		2201	4296	6497	SO:0001583	missense	283092			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.743C>T	11.37:g.49974717C>T	ENSP00000452277:p.Ser248Phe		A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.707587	0.00005	.	.	ENSG00000258817	ENST00000555099	T	0.00013	9.27	2.91	1.75	0.24633	GPCR, rhodopsin-like superfamily (1);	0.280860	0.25668	N	0.029100	T	0.00012	0.0000	N	0.00026	-2.66	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31024	-0.9958	9	.	.	.	.	6.498	0.22153	0.0:0.1284:0.0:0.8716	.	248	Q8NGP0	OR4CD_HUMAN	F	248	ENSP00000452277:S248F	.	S	+	2	0	OR4C13	49931293	0.003000	0.15002	0.011000	0.14972	0.006000	0.05464	0.439000	0.21575	0.333000	0.23563	-1.497000	0.00963	TCC		0.433	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1		NM_001001955	
PCLO	27445	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	82583288	82583288	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr7:82583288C>A	ENST00000333891.9	-	5	7318	c.6981G>T	c.(6979-6981)gaG>gaT	p.E2327D	PCLO_ENST00000423517.2_Missense_Mutation_p.E2327D	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E2327D(2)|p.E2258D(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTCGTTCGGCCTCCAACTCCT	0.413																																																	3	Substitution - Missense(3)	kidney(3)											125.0	128.0	127.0					7																	82583288		1852	4093	5945	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6981G>T	7.37:g.82583288C>A	ENSP00000334319:p.Glu2327Asp			Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	1.795	-0.478503	0.04414	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16597	2.33;2.33	4.9	1.36	0.22044	.	.	.	.	.	T	0.12008	0.0292	L	0.36672	1.1	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.31696	-0.9934	9	0.87932	D	0	.	3.1514	0.06489	0.4217:0.2428:0.0:0.3356	.	2327;2327	Q9Y6V0-5;Q9Y6V0-6	.;.	D	2258;2327;2327	ENSP00000334319:E2327D;ENSP00000388393:E2327D	ENSP00000334319:E2327D	E	-	3	2	PCLO	82421224	0.000000	0.05858	0.003000	0.11579	0.030000	0.12068	0.064000	0.14437	0.052000	0.16007	0.505000	0.49811	GAG		0.413	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5		NM_014510	
PLAG1	5324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	57080032	57080032	+	Silent	SNP	G	G	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr8:57080032G>T	ENST00000316981.3	-	5	752	c.273C>A	c.(271-273)acC>acA	p.T91T	PLAG1_ENST00000423799.2_Silent_p.T9T|PLAG1_ENST00000429357.2_Silent_p.T91T	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	91	Decreased nuclear import with localization in the nucleus but also in the cytoplasm.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T91T(2)	CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TACACTTGTGGGTTTTCTCAG	0.363			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																			Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	2	Substitution - coding silent(2)	kidney(2)											54.0	48.0	50.0					8																	57080032		2203	4300	6503	SO:0001819	synonymous_variant	5324			U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.273C>A	8.37:g.57080032G>T			B4DLC2|Q59GH8|Q9Y4L2	Silent	SNP	ENST00000316981.3	37	CCDS6165.1																																																																																				0.363	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1		NM_002655	
PRCC	5546	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156767110	156767110	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr1:156767110C>A	ENST00000271526.4	+	6	1638	c.1366C>A	c.(1366-1368)Cag>Aag	p.Q456K	PRCC_ENST00000353233.3_Missense_Mutation_p.Q424K	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	456					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.Q456K(1)	PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCGGAAACACCAGATCACATA	0.463			T	TFE3	papillary renal						OREG0013886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	1	Substitution - Missense(1)	kidney(1)											84.0	91.0	88.0					1																	156767110		2203	4300	6503	SO:0001583	missense	5546			X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.1366C>A	1.37:g.156767110C>A	ENSP00000271526:p.Gln456Lys	1781	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	37	CCDS1157.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.868738	0.91587	.	.	ENSG00000143294	ENST00000271526;ENST00000353233;ENST00000368201;ENST00000526188	T;T	0.68903	-0.36;-0.23	5.43	5.43	0.79202	Mitotic checkpoint protein PRCC, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.77313	2.365	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.995	T	0.81640	-0.0841	10	0.87932	D	0	-18.1796	17.9695	0.89108	0.0:1.0:0.0:0.0	.	424;456	A6NG79;Q92733	.;PRCC_HUMAN	K	456;424;432;163	ENSP00000271526:Q456K;ENSP00000339300:Q424K	ENSP00000271526:Q456K	Q	+	1	0	PRCC	155033734	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.957000	0.76019	2.824000	0.97209	0.655000	0.94253	CAG		0.463	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2		NM_005973	
PRICKLE3	4007	hgsc.bcm.edu	37	X	49032303	49032304	+	In_Frame_Ins	INS	-	-	GTGATG			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chrX:49032303_49032304insGTGATG	ENST00000376317.3	-	9	1660_1661	c.1566_1567insCATCAC	c.(1564-1569)cacaac>cacCATCACaac	p.521_522insHH	PRICKLE3_ENST00000538114.1_In_Frame_Ins_p.345_346insHH|PRICKLE3_ENST00000536904.1_In_Frame_Ins_p.440_441insHH|PRICKLE3_ENST00000540849.1_In_Frame_Ins_p.453_454insHH	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	521	Poly-His.						zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						GGGTGGCGGTTgtgatggtgat	0.644														2	0.000529801	0.0015	0.0	3775	,	,		9120	0.0		0.0	False		,,,				2504	0.0																0										21,3700		0,17,4,1575,533						-0.1	0.0			80	2,6482		0,1,1,2356,1769	no	coding	PRICKLE3	NM_006150.3		0,18,5,3931,2302	A1A1,A1R,A1,RR,R		0.0308,0.5644,0.2254				23,10182				SO:0001652	inframe_insertion	4007			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1561_1566dupCATCAC	X.37:g.49032304_49032309dupGTGATG	ENSP00000365494:p.His520_His521dup		B7Z8F2|O76007|Q53XR5	In_Frame_Ins	INS	ENST00000376317.3	37	CCDS14320.1																																																																																				0.644	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1		NM_006150	
PROKR1	10887	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	68882419	68882419	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr2:68882419C>T	ENST00000303786.3	+	3	1313	c.893C>T	c.(892-894)gCg>gTg	p.A298V	PROKR1_ENST00000394342.2_Missense_Mutation_p.A298V			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	298					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.A298V(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTATGCTGGGCGCCCTTCTAC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											126.0	97.0	107.0					2																	68882419		2203	4300	6503	SO:0001583	missense	10887			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.893C>T	2.37:g.68882419C>T	ENSP00000303775:p.Ala298Val		A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570788	0.86542	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.71698	-0.59;-0.59	4.68	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.088873	0.85682	N	0.000000	T	0.77184	0.4093	M	0.64997	1.995	0.54753	D	0.999989	D	0.62365	0.991	P	0.58780	0.845	T	0.79288	-0.1865	10	0.66056	D	0.02	.	11.1188	0.48277	0.0:0.9098:0.0:0.0902	.	298	Q8TCW9	PKR1_HUMAN	V	298	ENSP00000303775:A298V;ENSP00000377874:A298V	ENSP00000303775:A298V	A	+	2	0	PROKR1	68735923	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	4.588000	0.60999	1.584000	0.49913	0.655000	0.94253	GCG		0.597	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2			
PTPN12	5782	hgsc.bcm.edu;ucsc.edu	37	7	77256343	77256343	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr7:77256343delT	ENST00000248594.6	+	13	1619	c.1347delT	c.(1345-1347)agtfs	p.S449fs	PTPN12_ENST00000415482.2_Frame_Shift_Del_p.S330fs|PTPN12_ENST00000435495.2_Frame_Shift_Del_p.S319fs	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	449					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GACCAAAAAGTTTTGATGGGA	0.338																																																	0													49.0	53.0	52.0					7																	77256343		2202	4299	6501	SO:0001589	frameshift_variant	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1347delT	7.37:g.77256343delT	ENSP00000248594:p.Ser449fs		A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Frame_Shift_Del	DEL	ENST00000248594.6	37	CCDS5592.1																																																																																				0.338	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			
RND1	27289	hgsc.bcm.edu	37	12	49259528	49259529	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr12:49259528_49259529insG	ENST00000309739.5	-	1	152_153	c.22_23insC	c.(22-24)cagfs	p.Q8fs		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	8					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						CACGACTGGCTGGGGGGCCCGT	0.589																																																	0																																										SO:0001589	frameshift_variant	27289			Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.23dupC	12.37:g.49259534_49259534dupG	ENSP00000308461:p.Gln8fs		A8K9P7	Frame_Shift_Ins	INS	ENST00000309739.5	37	CCDS8771.1																																																																																				0.589	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408915.1		NM_014470	
SBF1	6305	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	50893343	50893343	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr22:50893343C>T	ENST00000390679.3	-	34	4818	c.4634G>A	c.(4633-4635)aGg>aAg	p.R1545K	SBF1_ENST00000380817.3_Missense_Mutation_p.R1571K|SBF1_ENST00000476293.1_5'Flank|SBF1_ENST00000348911.6_Missense_Mutation_p.R1546K			O95248	MTMR5_HUMAN	SET binding factor 1	1545	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R1571K(1)|p.R1545K(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CACCTGGCCCCTGCGTTCCCC	0.637																																																	2	Substitution - Missense(2)	kidney(2)											45.0	52.0	50.0					22																	50893343		2135	4229	6364	SO:0001583	missense	6305			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.4634G>A	22.37:g.50893343C>T	ENSP00000375097:p.Arg1545Lys		A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	C	11.99	1.803498	0.31869	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	D;D;D	0.85773	-2.03;-2.03;-2.02	3.74	-0.733	0.11144	Myotubularin phosphatase domain (1);	1.122620	0.06887	N	0.803508	T	0.66992	0.2846	N	0.04297	-0.235	0.34552	D	0.711381	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.56848	-0.7911	10	0.24483	T	0.36	.	7.8097	0.29223	0.0:0.4797:0.0:0.5203	.	1545;1571;104	O95248;O95248-4;A6PVG7	MTMR5_HUMAN;.;.	K	1571;1546;1581;1545	ENSP00000370196:R1571K;ENSP00000252027:R1546K;ENSP00000375097:R1545K	ENSP00000336522:R1581K	R	-	2	0	SBF1	49240209	0.000000	0.05858	0.995000	0.50966	0.963000	0.63663	0.110000	0.15437	0.063000	0.16370	0.462000	0.41574	AGG		0.637	SBF1-201	KNOWN	basic	protein_coding	protein_coding				
SLX4	84464	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	3641179	3641179	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:3641179C>A	ENST00000294008.3	-	12	3100	c.2460G>T	c.(2458-2460)agG>agT	p.R820S		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	820	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.R820S(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CCCACATTGACCTCAAGAGTT	0.478								Direct reversal of damage																																									1	Substitution - Missense(1)	kidney(1)											162.0	173.0	170.0					16																	3641179		2197	4300	6497	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2460G>T	16.37:g.3641179C>A	ENSP00000294008:p.Arg820Ser		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469857	0.84533	.	.	ENSG00000188827	ENST00000294008	T	0.01287	5.05	5.57	4.61	0.57282	.	0.254634	0.34879	N	0.003611	T	0.04724	0.0128	L	0.59436	1.845	0.26483	N	0.975078	D	0.59767	0.986	P	0.53954	0.738	T	0.06881	-1.0802	10	0.72032	D	0.01	.	15.5716	0.76341	0.0:0.8618:0.1382:0.0	.	820	Q8IY92	SLX4_HUMAN	S	820	ENSP00000294008:R820S	ENSP00000294008:R820S	R	-	3	2	SLX4	3581180	1.000000	0.71417	0.854000	0.33618	0.992000	0.81027	4.169000	0.58223	1.336000	0.45506	0.561000	0.74099	AGG		0.478	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3		NM_032444	
SPAG9	9043	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	49098649	49098649	+	Silent	SNP	T	T	C	rs373565315		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr17:49098649T>C	ENST00000262013.7	-	7	1069	c.861A>G	c.(859-861)acA>acG	p.T287T	SPAG9_ENST00000510283.1_Silent_p.T130T|SPAG9_ENST00000357122.4_Silent_p.T273T|SPAG9_ENST00000505279.1_Silent_p.T273T	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	287					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.T273T(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CAGTAGGAATTGTTGCCACAT	0.378																																																	1	Substitution - coding silent(1)	kidney(1)						T	,	0,4406		0,0,2203	186.0	175.0	178.0		861,819	0.9	0.0	17		178	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SPAG9	NM_001130528.2,NM_003971.5	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	287/1322,273/1308	49098649	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9043			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.861A>G	17.37:g.49098649T>C			A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	ENST00000262013.7	37	CCDS45740.1																																																																																				0.378	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2		NM_003971	
TOB2	10766	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	41832382	41832382	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr22:41832382A>G	ENST00000327492.3	-	2	1674	c.968T>C	c.(967-969)cTc>cCc	p.L323P		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	323					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L323P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						GTTGTAGCTGAGGCCTTCCAC	0.602																																																	1	Substitution - Missense(1)	kidney(1)											103.0	97.0	99.0					22																	41832382		2203	4300	6503	SO:0001583	missense	10766			D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.968T>C	22.37:g.41832382A>G	ENSP00000331305:p.Leu323Pro		Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Missense_Mutation	SNP	ENST00000327492.3	37	CCDS14015.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965364	0.74131	.	.	ENSG00000183864	ENST00000327492	T	0.71341	-0.56	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000002	D	0.83069	0.5174	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84499	0.0615	10	0.66056	D	0.02	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	323	Q14106	TOB2_HUMAN	P	323	ENSP00000331305:L323P	ENSP00000331305:L323P	L	-	2	0	TOB2	40162328	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.904000	0.92590	2.254000	0.74563	0.533000	0.62120	CTC		0.602	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320699.1		NM_016272	
VHL	7428	hgsc.bcm.edu	37	3	10183851	10183851	+	Missense_Mutation	SNP	G	G	C	rs193922609		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr3:10183851G>C	ENST00000256474.2	+	1	1160	c.320G>C	c.(319-321)cGc>cCc	p.R107P	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.R107P	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	107	Involved in binding to CCT complex.		R -> G (in pheochromocytoma). {ECO:0000269|PubMed:12000816}.|R -> P (in VHLD; type I). {ECO:0000269|PubMed:9829911}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.R107fs*52(3)|p.G104fs*23(2)|p.R107P(2)|p.G106fs*51(1)|p.G104fs*22(1)|p.R107fs*51(1)|p.G104fs*52(1)|p.G106fs*49(1)|p.R108fs*52(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGCACGGGCCGCCGCATCCAC	0.682		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	13	Deletion - Frameshift(10)|Substitution - Missense(2)|Insertion - Frameshift(1)	kidney(13)	GRCh37	CM023996|CM982004	VHL	M							11.0	12.0	12.0					3																	10183851		1662	3577	5239	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.320G>C	3.37:g.10183851G>C	ENSP00000256474:p.Arg107Pro		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682396	0.88542	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99833	-7.03;-7.03	5.17	4.29	0.51040	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.118683	0.64402	D	0.000014	D	0.99667	0.9876	M	0.61703	1.905	0.33657	D	0.60926	D;D	0.89917	0.999;1.0	D;D	0.80764	0.979;0.994	D	0.98514	1.0620	10	0.36615	T	0.2	-15.5698	13.5883	0.61944	0.0:0.1569:0.8431:0.0	.	107;107	P40337-2;P40337	.;VHL_HUMAN	P	107	ENSP00000256474:R107P;ENSP00000344757:R107P	ENSP00000256474:R107P	R	+	2	0	VHL	10158851	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.365000	0.59486	1.175000	0.42826	0.479000	0.44913	CGC		0.682	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WIZ	58525	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	15537959	15537959	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr19:15537959C>A	ENST00000389282.4	-	6	3699	c.3486G>T	c.(3484-3486)aaG>aaT	p.K1162N	WIZ_ENST00000599686.3_Missense_Mutation_p.K346N|WIZ_ENST00000263381.7_Missense_Mutation_p.K305N|WIZ_ENST00000599910.2_Missense_Mutation_p.K479N|WIZ_ENST00000545156.1_Missense_Mutation_p.K476N			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1162	Pro-rich.				positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.K476N(1)|p.K305N(1)|p.K1162N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CTGGGAACATCTTTCGGGCCG	0.622																																																	3	Substitution - Missense(3)	kidney(3)											43.0	48.0	46.0					19																	15537959		1992	4159	6151	SO:0001583	missense	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3486G>T	19.37:g.15537959C>A	ENSP00000373933:p.Lys1162Asn		B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	ENST00000389282.4	37		.	.	.	.	.	.	.	.	.	.	C	18.77	3.694185	0.68386	.	.	ENSG00000011451	ENST00000389282;ENST00000263381;ENST00000416927;ENST00000545156	T;T;T	0.32272	1.46;1.46;1.46	5.51	4.46	0.54185	.	0.231795	0.40064	N	0.001191	T	0.36386	0.0965	N	0.24115	0.695	0.32919	D	0.515583	D;D;D	0.89917	1.0;0.999;0.964	D;D;P	0.76575	0.96;0.988;0.554	T	0.48927	-0.8991	10	0.54805	T	0.06	-34.5618	7.2325	0.26051	0.0:0.7301:0.0:0.2699	.	1162;305;346	O95785;O95785-2;B3KVH1	WIZ_HUMAN;.;.	N	1162;305;346;476	ENSP00000373933:K1162N;ENSP00000263381:K305N;ENSP00000445824:K476N	ENSP00000263381:K305N	K	-	3	2	WIZ	15398959	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.748000	0.38308	1.261000	0.44149	0.561000	0.74099	AAG		0.622	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_021241	
ZBTB49	166793	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	4322531	4322531	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr4:4322531C>A	ENST00000337872.4	+	8	1907	c.1786C>A	c.(1786-1788)Ctg>Atg	p.L596M	ZBTB49_ENST00000355834.3_Missense_Mutation_p.L474M|RP11-265O12.1_ENST00000509015.1_lincRNA|ZBTB49_ENST00000538529.1_Missense_Mutation_p.L79M	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	596					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L596M(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CCCAGATGTGCTGGAGGAGCT	0.557																																																	1	Substitution - Missense(1)	kidney(1)											62.0	57.0	58.0					4																	4322531		2203	4300	6503	SO:0001583	missense	166793			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.1786C>A	4.37:g.4322531C>A	ENSP00000338807:p.Leu596Met		Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608249	0.46527	.	.	ENSG00000168826	ENST00000355834;ENST00000337872;ENST00000538529	T;T;T	0.15017	2.46;2.8;3.11	4.57	3.71	0.42584	.	0.768893	0.10553	N	0.661237	T	0.37652	0.1011	M	0.65975	2.015	0.09310	N	1	D;P	0.58620	0.983;0.833	P;B	0.58873	0.847;0.336	T	0.21655	-1.0239	10	0.52906	T	0.07	.	14.7835	0.69784	0.0:0.8546:0.1454:0.0	.	474;596	Q6ZSB9-2;Q6ZSB9	.;ZBT49_HUMAN	M	474;596;79	ENSP00000348091:L474M;ENSP00000338807:L596M;ENSP00000445653:L79M	ENSP00000338807:L596M	L	+	1	2	ZBTB49	4373432	0.003000	0.15002	0.005000	0.12908	0.143000	0.21401	1.148000	0.31614	1.031000	0.39867	0.455000	0.32223	CTG		0.557	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3		NM_145291	
ZNF836	162962	broad.mit.edu;hgsc.bcm.edu	37	19	52658790	52658790	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr19:52658790G>C	ENST00000322146.8	-	5	2667	c.2146C>G	c.(2146-2148)Cct>Gct	p.P716A	ZNF836_ENST00000597252.1_Missense_Mutation_p.P716A|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P716A(2)|p.P716S(1)		endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TCCCCAGTAGGATTTCTGTGA	0.398																																																	3	Substitution - Missense(3)	kidney(2)|upper_aerodigestive_tract(1)											67.0	67.0	67.0					19																	52658790		1976	4175	6151	SO:0001583	missense	162962			BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2146C>G	19.37:g.52658790G>C	ENSP00000325038:p.Pro716Ala			Missense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	g	14.22	2.470694	0.43942	.	.	ENSG00000196267	ENST00000322146	T	0.14640	2.49	2.18	1.09	0.20402	Zinc finger, C2H2 (1);	.	.	.	.	T	0.08492	0.0211	N	0.24115	0.695	0.22280	N	0.999239	P	0.38280	0.625	B	0.33799	0.17	T	0.24404	-1.0161	9	0.87932	D	0	.	7.7484	0.28883	0.1405:0.0:0.8595:0.0	.	716	Q6ZNA1	ZN836_HUMAN	A	716	ENSP00000325038:P716A	ENSP00000325038:P716A	P	-	1	0	ZNF836	57350602	0.981000	0.34729	0.000000	0.03702	0.006000	0.05464	4.244000	0.58728	0.243000	0.21327	-0.266000	0.10368	CCT		0.398	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1		NM_001102657	
ABCD1	215	broad.mit.edu	37	X	153008982	153008982	+	Silent	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chrX:153008982C>T	ENST00000218104.3	+	10	2430	c.2031C>T	c.(2029-2031)ggC>ggT	p.G677G	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	677	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		G -> D (in ALD). {ECO:0000269|PubMed:21700483}.		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.G677G(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGGGGAGGGCGGCTGGAAGT	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											16.0	16.0	16.0					X																	153008982		2198	4296	6494	SO:0001819	synonymous_variant	215			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.2031C>T	X.37:g.153008982C>T			Q6GTZ2	Silent	SNP	ENST00000218104.3	37	CCDS14728.1																																																																																				0.647	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1		NM_000033	
CNDP1	84735	broad.mit.edu	37	18	72201786	72201786	+	5'UTR	SNP	G	G	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr18:72201786G>A	ENST00000358821.3	+	0	112				CNDP1_ENST00000585136.1_3'UTR|CNDP1_ENST00000582365.1_5'Flank	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)							extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GGGGGACAACGTGGGTCAGGG	0.512																																					Melanoma(32;1029 1042 25286 38395 44237)												0																																										SO:0001623	5_prime_UTR_variant	84735				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.-117G>A	18.37:g.72201786G>A			Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Translation_Start_Site	SNP	ENST00000358821.3	37	CCDS12007.1																																																																																				0.512	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1		NM_032649	
CYB5RL	606495	broad.mit.edu	37	1	54661136	54661136	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr1:54661136G>T	ENST00000534324.1	-	1	153	c.154C>A	c.(154-156)Caa>Aaa	p.Q52K	CYB5RL_ENST00000287899.8_Missense_Mutation_p.Q52K|CYB5RL_ENST00000497820.1_Missense_Mutation_p.Q52K|CYB5RL_ENST00000537208.1_Missense_Mutation_p.Q52K|CYB5RL_ENST00000401046.3_5'UTR|CYB5RL_ENST00000419823.2_Missense_Mutation_p.Q52K|MRPL37_ENST00000487096.1_Intron|CYB5RL_ENST00000542737.1_Missense_Mutation_p.Q52K|RP11-446E24.4_ENST00000311841.7_Missense_Mutation_p.Q52K			Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	52	Oxidoreductase-like.						cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.Q52K(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|urinary_tract(1)	8						TTGCTGGCTTGGGCTGCCTCC	0.602																																																	1	Substitution - Missense(1)	kidney(1)											38.0	40.0	39.0					1																	54661136		2045	4188	6233	SO:0001583	missense	606495				CCDS44151.1	1p32.3	2011-04-08			ENSG00000215883	ENSG00000215883			32220	protein-coding gene	gene with protein product						12477932	Standard	NM_001031672		Approved	LOC606495	uc009vzo.3	Q6IPT4	OTTHUMG00000008082	ENST00000534324.1:c.154C>A	1.37:g.54661136G>T	ENSP00000434343:p.Gln52Lys		B7ZBS4|Q8NF25	Missense_Mutation	SNP	ENST00000534324.1	37	CCDS44151.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231338	0.39399	.	.	ENSG00000215883	ENST00000419823;ENST00000534324;ENST00000287899;ENST00000542737;ENST00000537208;ENST00000497820	T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06	5.17	3.25	0.37280	Oxidoreductase-like, N-terminal (1);	.	.	.	.	T	0.25644	0.0624	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04320	-1.0960	9	0.16896	T	0.51	-18.5146	11.1158	0.48259	0.0:0.0:0.5102:0.4898	.	52	Q6IPT4	NB5R5_HUMAN	K	52	ENSP00000409075:Q52K;ENSP00000434343:Q52K;ENSP00000287899:Q52K;ENSP00000438151:Q52K;ENSP00000443797:Q52K;ENSP00000431157:Q52K	ENSP00000287899:Q52K	Q	-	1	0	CYB5RL	54433724	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.446000	0.35090	0.722000	0.32252	0.561000	0.74099	CAA		0.602	CYB5RL-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388318.1		NM_001031672	
FGD1	2245	broad.mit.edu	37	X	54491893	54491893	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chrX:54491893C>T	ENST00000375135.3	-	8	2360	c.1627G>A	c.(1627-1629)Gat>Aat	p.D543N		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	543	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D543N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CTTTGGGCATCCTTGCTGTCC	0.562																																																	1	Substitution - Missense(1)	kidney(1)											45.0	41.0	43.0					X																	54491893		2203	4300	6503	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1627G>A	X.37:g.54491893C>T	ENSP00000364277:p.Asp543Asn		Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	C	33	5.281350	0.95489	.	.	ENSG00000102302	ENST00000375135	T	0.62941	-0.01	5.43	5.43	0.79202	Dbl homology (DH) domain (5);	0.000000	0.53938	D	0.000045	T	0.78175	0.4242	M	0.71206	2.165	0.58432	D	0.999998	P;B	0.45569	0.861;0.152	P;B	0.62649	0.905;0.194	T	0.80315	-0.1434	10	0.87932	D	0	-3.6319	17.0001	0.86378	0.0:1.0:0.0:0.0	.	301;543	B4DS99;P98174	.;FGD1_HUMAN	N	543	ENSP00000364277:D543N	ENSP00000364277:D543N	D	-	1	0	FGD1	54508618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.691000	0.84191	2.277000	0.76020	0.523000	0.50628	GAT		0.562	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1		NM_004463	
ISOC1	51015	broad.mit.edu	37	5	128430566	128430566	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr5:128430566C>A	ENST00000173527.5	+	1	123	c.107C>A	c.(106-108)gCg>gAg	p.A36E	MIR4633_ENST00000584064.1_RNA	NM_016048.2	NP_057132.2	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	36						extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	catalytic activity (GO:0003824)	p.A36E(1)		kidney(2)|lung(7)	9		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		TCAGTCTTCGCGCGACCCTCG	0.687																																																	1	Substitution - Missense(1)	kidney(1)											22.0	27.0	25.0					5																	128430566		1902	4120	6022	SO:0001583	missense	51015			AF151869	CCDS43357.1	5q22.1-q33.3	2010-03-19			ENSG00000066583	ENSG00000066583			24254	protein-coding gene	gene with protein product						10810093, 18566572	Standard	NM_016048		Approved	CGI-111	uc003kva.3	Q96CN7	OTTHUMG00000163144	ENST00000173527.5:c.107C>A	5.37:g.128430566C>A	ENSP00000173527:p.Ala36Glu		Q7Z770	Missense_Mutation	SNP	ENST00000173527.5	37	CCDS43357.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368734	0.42003	.	.	ENSG00000066583	ENST00000506986;ENST00000514194;ENST00000173527;ENST00000513879	.	.	.	4.05	3.17	0.36434	.	0.272242	0.29286	N	0.012589	T	0.35566	0.0936	N	0.24115	0.695	0.34722	D	0.728812	B	0.26775	0.159	B	0.23419	0.046	T	0.41233	-0.9520	8	.	.	.	-8.8979	12.2156	0.54404	0.0:0.9145:0.0:0.0855	.	36	Q96CN7	ISOC1_HUMAN	E	15;36;36;27	.	.	A	+	2	0	ISOC1	128458465	1.000000	0.71417	0.999000	0.59377	0.169000	0.22640	5.359000	0.66074	1.034000	0.39945	0.205000	0.17691	GCG		0.687	ISOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371826.1		NM_016048	
LOC441666	441666	broad.mit.edu	37	10	42832015	42832015	+	RNA	SNP	A	A	C	rs376496590		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr10:42832015A>C	ENST00000609841.1	-	0	1888					NR_024380.1																						TATGTACATTAAGGTCTAAAG	0.343																																																	0																																												441666																															10.37:g.42832015A>C				RNA	SNP	ENST00000609841.1	37																																																																																					0.343	RP11-313J2.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472483.1			
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	C	T	rs200758966		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr10:42832122C>T	ENST00000609841.1	-	0	1781					NR_024380.1																						CAGTAAAAGGCTTTGCCACAT	0.348																																																	0																																												441666																															10.37:g.42832122C>T				RNA	SNP	ENST00000609841.1	37																																																																																					0.348	RP11-313J2.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472483.1			
MUC5B	727897	broad.mit.edu	37	11	1275577	1275577	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr11:1275577G>T	ENST00000529681.1	+	34	15531	c.15473G>T	c.(15472-15474)gGc>gTc	p.G5158V	MUC5B_ENST00000447027.1_Missense_Mutation_p.G5161V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5158	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.G5113V(1)|p.G5158V(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AAGGAGGAGGGCCTGGTGAGT	0.682																																																	2	Substitution - Missense(2)	kidney(2)											25.0	29.0	28.0					11																	1275577		2131	4227	6358	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15473G>T	11.37:g.1275577G>T	ENSP00000436812:p.Gly5158Val		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	0.491	-0.875302	0.02550	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.57436	0.4;0.4	4.4	1.34	0.21922	.	.	.	.	.	T	0.27489	0.0675	N	0.11560	0.145	0.25807	N	0.984446	B;P	0.39282	0.411;0.666	B;B	0.32624	0.091;0.149	T	0.12656	-1.0539	9	0.87932	D	0	.	5.9972	0.19501	0.1953:0.1578:0.6469:0.0	.	5495;5161	A7Y9J9;E9PBJ0	.;.	V	5158;5161;5102;57;4870	ENSP00000436812:G5158V;ENSP00000415793:G5161V	ENSP00000343037:G5102V	G	+	2	0	MUC5B	1232153	0.023000	0.18921	0.535000	0.28026	0.026000	0.11368	0.310000	0.19356	0.339000	0.23719	-1.131000	0.01979	GGC		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
PCDHGA3	56112	broad.mit.edu	37	5	140725628	140725628	+	Silent	SNP	C	C	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr5:140725628C>G	ENST00000253812.6	+	1	2028	c.2028C>G	c.(2026-2028)ggC>ggG	p.G676G	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	676	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G676G(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGACCTGGGCAGCCTCGAGC	0.687																																																	1	Substitution - coding silent(1)	kidney(1)											21.0	26.0	24.0					5																	140725628		2196	4255	6451	SO:0001819	synonymous_variant	56112			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2028C>G	5.37:g.140725628C>G			Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																				0.687	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1		NM_018916	
RNF151	146310	broad.mit.edu	37	16	2018623	2018623	+	Silent	SNP	C	C	A	rs554796786		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:2018623C>A	ENST00000569714.1	+	4	443	c.435C>A	c.(433-435)ggC>ggA	p.G145G	RNF151_ENST00000321392.3_Silent_p.G144G|RNF151_ENST00000569210.2_3'UTR	NM_174903.4	NP_777563.2	Q2KHN1	RN151_HUMAN	ring finger protein 151	145					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G144G(1)		kidney(1)|lung(1)	2						GCCCCCTGGGCTGCGGGGCCA	0.741																																																	1	Substitution - coding silent(1)	kidney(1)											5.0	6.0	5.0					16																	2018623		1935	4023	5958	SO:0001819	synonymous_variant	146310			BC029501	CCDS58405.1	16p13.3	2013-01-09			ENSG00000179580	ENSG00000179580		"""RING-type (C3HC4) zinc fingers"""	23235	protein-coding gene	gene with protein product						12477932	Standard	NM_174903		Approved		uc002cnt.1	Q2KHN1	OTTHUMG00000176852	ENST00000569714.1:c.435C>A	16.37:g.2018623C>A			Q8NHS5	Silent	SNP	ENST00000569714.1	37	CCDS58405.1																																																																																				0.741	RNF151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434030.1		NM_174903	
PKD1	5310	broad.mit.edu	37	16	2168149	2168149	+	Missense_Mutation	SNP	C	C	G	rs527753637		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:2168149C>G	ENST00000262304.4	-	5	1052	c.844G>C	c.(844-846)Gga>Cga	p.G282R	RP11-304L19.2_ENST00000562027.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.G282R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	282	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.G282R(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCAGAGGTCCGTGGGGCCCC	0.726																																																	1	Substitution - Missense(1)	kidney(1)											6.0	9.0	8.0					16																	2168149		1969	4115	6084	SO:0001583	missense	5310			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.844G>C	16.37:g.2168149C>G	ENSP00000262304:p.Gly282Arg		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	c	2.300	-0.360329	0.05103	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.67171	-0.25;-0.25	4.62	2.62	0.31277	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (2);	0.639678	0.15084	N	0.281515	T	0.72036	0.3411	M	0.68317	2.08	0.19775	N	0.999956	D;D	0.69078	0.997;0.992	D;D	0.64877	0.93;0.91	T	0.58967	-0.7542	10	0.16420	T	0.52	.	5.3645	0.16105	0.1632:0.6495:0.0:0.1873	.	282;282	P98161-3;P98161	.;PKD1_HUMAN	R	282;282;215	ENSP00000262304:G282R;ENSP00000399501:G282R	ENSP00000262304:G282R	G	-	1	0	PKD1	2108150	0.966000	0.33281	0.723000	0.30687	0.312000	0.27988	3.199000	0.51043	0.394000	0.25230	-0.413000	0.06143	GGA		0.726	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			
SLC7A5P1	81893	broad.mit.edu	37	16	21531133	21531133	+	IGR	SNP	C	C	G	rs518428		TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:21531133C>G								MIR3680-1 (13677 upstream) : SCARNA6 (67814 downstream)																							ACCCCCGGCCCGCGCCCCGTA	0.657																																																	0																																										SO:0001628	intergenic_variant	387254																															16.37:g.21531133C>G				Missense_Mutation	SNP		37																																																																																				0	0.657									
LOC646938	646938	broad.mit.edu	37	15	79045468	79045468	+	RNA	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr15:79045468A>G	ENST00000434914.1	+	0	145					NR_036495.1																						GCTGATCAGTATCTCCTTTGG	0.612																																																	0																																												0																															15.37:g.79045468A>G				RNA	SNP	ENST00000434914.1	37		.	.	.	.	.	.	.	.	.	.	a	7.826	0.718890	0.15372	.	.	ENSG00000238166	ENST00000434914	.	.	.	3.25	3.25	0.37280	.	.	.	.	.	T	0.59459	0.2195	.	.	.	.	.	.	.	.	.	.	.	.	T	0.71758	-0.4496	4	0.72032	D	0.01	.	9.9385	0.41565	1.0:0.0:0.0:0.0	.	.	.	.	V	49	.	ENSP00000403147:I49V	I	+	1	0	AC022748.1	76832523	1.000000	0.71417	0.989000	0.46669	0.270000	0.26580	4.673000	0.61604	1.509000	0.48786	0.076000	0.15429	ATC		0.612	RP11-160C18.4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000421329.1			
BCRP7	100133163	broad.mit.edu	37	22	18846098	18846098	+	3'UTR	SNP	G	G	A	rs9306211	byFrequency	TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr22:18846098G>A	ENST00000412938.1	+	0	3456																											ATGCCTCGGCGCTCGATCTCC	0.622																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*3453G>A	22.37:g.18846098G>A				RNA	SNP	ENST00000412938.1	37																																																																																					0.622	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000471615.1			
ZNF48	197407	broad.mit.edu	37	16	30409890	30409890	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chr16:30409890A>G	ENST00000320159.2	+	2	1695	c.1319A>G	c.(1318-1320)gAg>gGg	p.E440G	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	440	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E440G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CAGGCTGGGGAGCCACCCCCA	0.672																																																	1	Substitution - Missense(1)	kidney(1)											19.0	24.0	22.0					16																	30409890		2166	4251	6417	SO:0001583	missense	197407			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1319A>G	16.37:g.30409890A>G	ENSP00000324056:p.Glu440Gly		Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	CCDS10679.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.322202	0.60634	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.07216	3.21	4.42	4.42	0.53409	.	0.175486	0.27469	N	0.019237	T	0.06600	0.0169	N	0.19112	0.55	0.33515	D	0.591697	P	0.51791	0.948	B	0.43783	0.431	T	0.35301	-0.9794	10	0.23891	T	0.37	-17.9872	11.9326	0.52855	1.0:0.0:0.0:0.0	.	440	Q96MX3	ZNF48_HUMAN	G	565;440	ENSP00000324056:E440G	ENSP00000324056:E440G	E	+	2	0	ZNF48	30317391	0.068000	0.21057	1.000000	0.80357	0.980000	0.70556	-0.460000	0.06720	1.977000	0.57605	0.455000	0.32223	GAG		0.672	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2		NM_152652	
ZXDB	158586	broad.mit.edu	37	X	57619421	57619421	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3380-01A-01D-0966-08	TCGA-A3-3380-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	269d4e2a-a425-4fde-bb51-5880f7f8b2b9	2664fe7c-61ae-40cc-9411-7b4cd795169a	g.chrX:57619421A>G	ENST00000374888.1	+	1	1153	c.940A>G	c.(940-942)Acc>Gcc	p.T314A		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	314	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T314A(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTGCGGCTGGACCTTCACCAC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											16.0	16.0	16.0					X																	57619421		2203	4296	6499	SO:0001583	missense	158586			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.940A>G	X.37:g.57619421A>G	ENSP00000364023:p.Thr314Ala		A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	0.578	-0.838200	0.02692	.	.	ENSG00000198455	ENST00000374888	T	0.52295	0.67	3.35	2.04	0.26737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.124679	0.53938	D	0.000043	T	0.14356	0.0347	N	0.01482	-0.84	0.36520	D	0.870123	B	0.24882	0.113	B	0.27262	0.078	T	0.31110	-0.9955	10	0.02654	T	1	.	5.1225	0.14867	0.5825:0.0:0.0:0.4174	.	314	P98169	ZXDB_HUMAN	A	314	ENSP00000364023:T314A	ENSP00000364023:T314A	T	+	1	0	ZXDB	57636146	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.085000	0.30840	1.357000	0.45904	0.393000	0.25936	ACC		0.627	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1		NM_007157	
