#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF10L	55160	hgsc.bcm.edu	37	1	18023490	18023490	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:18023490C>G	ENST00000361221.3	+	29	3614	c.3455C>G	c.(3454-3456)gCa>gGa	p.A1152G	ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.A1113G|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.A925G|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.A1113G|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.A855G	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	1152						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GACGGGCAGGCACACGAGCCC	0.687											OREG0013156	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1152G		.											.	ARHGEF10L-292	0			c.C3455G						.						22.0	22.0	22.0					1																	18023490		2199	4295	6494	SO:0001583	missense	55160	exon29			GGCAGGCACACGA	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.3455C>G	1.37:g.18023490C>G	ENSP00000355060:p.Ala1152Gly	32	0	722	30	2	NM_018125	0	0	21	21	0	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	C	0.151	-1.091069	0.01858	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T	0.59906	0.5;0.5;0.5;0.23;2.49	5.11	2.11	0.27256	.	0.854734	0.10305	N	0.690747	T	0.38825	0.1055	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B;B;B	0.27823	0.081;0.19;0.003;0.016;0.0;0.0;0.0	B;B;B;B;B;B;B	0.24006	0.044;0.05;0.005;0.01;0.0;0.0;0.0	T	0.21827	-1.0234	10	0.24483	T	0.36	-2.8352	5.2153	0.15338	0.1484:0.6263:0.1435:0.0819	.	925;925;855;913;1108;1113;1152	Q5VXI4;B4DTL3;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	G	1152;1113;1113;925;925;855	ENSP00000355060:A1152G;ENSP00000399401:A1113G;ENSP00000364564:A1113G;ENSP00000364557:A925G;ENSP00000167825:A855G	ENSP00000167825:A855G	A	+	2	0	ARHGEF10L	17896077	0.000000	0.05858	0.012000	0.15200	0.001000	0.01503	0.830000	0.27462	0.149000	0.19098	-0.905000	0.02835	GCA	.		0.687	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
IL22RA1	58985	bcgsc.ca	37	1	24447843	24447843	+	Missense_Mutation	SNP	G	G	T	rs75716137		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:24447843G>T	ENST00000270800.1	-	7	1215	c.1177C>A	c.(1177-1179)Caa>Aaa	p.Q393K		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	393					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		GGAGTGGCTTGAGGGGCATAG	0.582																																					p.Q393K													.	IL22RA1-91	0			c.C1177A						.						59.0	62.0	61.0					1																	24447843		2203	4300	6503	SO:0001583	missense	58985	exon7			TGGCTTGAGGGGC	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.1177C>A	1.37:g.24447843G>T	ENSP00000270800:p.Gln393Lys	173	0		109	34	NM_021258	0	0	2	2	0	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	CCDS247.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726456	0.48833	.	.	ENSG00000142677	ENST00000270800	T	0.14144	2.53	4.9	4.9	0.64082	.	0.870285	0.09673	N	0.770867	T	0.09992	0.0245	L	0.27053	0.805	0.09310	N	0.999995	P;P	0.42908	0.793;0.793	B;B	0.35114	0.196;0.126	T	0.13176	-1.0519	10	0.17369	T	0.5	-27.4158	13.499	0.61442	0.0:0.0:1.0:0.0	.	325;393	B4E2V9;Q8N6P7	.;I22R1_HUMAN	K	393	ENSP00000270800:Q393K	ENSP00000270800:Q393K	Q	-	1	0	IL22RA1	24320430	0.673000	0.27539	0.083000	0.20561	0.136000	0.21042	4.235000	0.58666	2.562000	0.86427	0.558000	0.71614	CAA	.		0.582	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1		
PPCS	79717	bcgsc.ca	37	1	42922310	42922310	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:42922310G>C	ENST00000372561.3	+	1	81	c.74G>C	c.(73-75)cGc>cCc	p.R25P	PPCS_ENST00000455780.1_Intron|PPCS_ENST00000372562.1_Intron|ZMYND12_ENST00000372565.3_5'Flank|PPCS_ENST00000372556.3_Intron|PPCS_ENST00000372560.3_Missense_Mutation_p.R25P|ZMYND12_ENST00000433602.2_5'Flank|PPCS_ENST00000472013.1_3'UTR	NM_024664.2	NP_078940.2	Q9HAB8	PPCS_HUMAN	phosphopantothenoylcysteine synthetase	25					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	phosphopantothenate--cysteine ligase activity (GO:0004632)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|skin(3)	12	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTTATGGCTCGCTTCGCGGCC	0.721																																					p.R25P													.	PPCS-90	0			c.G74C						.						10.0	13.0	12.0					1																	42922310		1817	3983	5800	SO:0001583	missense	79717	exon1			TGGCTCGCTTCGC	AK021900	CCDS41311.1, CCDS41312.1	1p34.2	2008-02-05			ENSG00000127125	ENSG00000127125	6.3.2.5		25686	protein-coding gene	gene with protein product		609853				11923312	Standard	NM_024664		Approved	FLJ11838	uc001chl.3	Q9HAB8	OTTHUMG00000007332	ENST00000372561.3:c.74G>C	1.37:g.42922310G>C	ENSP00000361642:p.Arg25Pro	71	0		24	16	NM_024664	0	0	4	4	0	Q3KQT2|Q5VVM0	Missense_Mutation	SNP	ENST00000372561.3	37	CCDS41311.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619808	0.46736	.	.	ENSG00000127125	ENST00000372560;ENST00000372561	.	.	.	5.22	4.28	0.50868	DNA/pantothenate metabolism flavoprotein, C-terminal (2);	0.273869	0.41001	D	0.000961	T	0.39733	0.1089	N	0.24115	0.695	0.80722	D	1	B	0.24675	0.109	B	0.20384	0.029	T	0.32613	-0.9900	9	0.48119	T	0.1	-1.0833	8.2516	0.31730	0.1746:0.0:0.8254:0.0	.	25	Q9HAB8	PPCS_HUMAN	P	25	.	ENSP00000361641:R25P	R	+	2	0	PPCS	42694897	0.903000	0.30736	1.000000	0.80357	0.985000	0.73830	1.162000	0.31786	2.712000	0.92718	0.563000	0.77884	CGC	.		0.721	PPCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019166.1	NM_024664	
PTPRF	5792	bcgsc.ca	37	1	44070598	44070598	+	Missense_Mutation	SNP	C	C	T	rs147874335		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:44070598C>T	ENST00000359947.4	+	17	3402	c.3062C>T	c.(3061-3063)gCg>gTg	p.A1021V	PTPRF_ENST00000422171.2_Missense_Mutation_p.A369V|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Missense_Mutation_p.A1012V|PTPRF_ENST00000372414.3_Missense_Mutation_p.A1021V|PTPRF_ENST00000438120.1_Missense_Mutation_p.A1012V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1021	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTCCGGGTGGCGGCTGCAATG	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21066	0.0		0.0	False		,,,				2504	0.0				p.A1021V													.	PTPRF-232	0			c.C3062T						.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	117.0	120.0	119.0		3062,3035	1.3	0.9	1	dbSNP_134	119	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	PTPRF	NM_002840.3,NM_130440.2	64,64	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	benign,benign	1021/1908,1012/1899	44070598	5,13001	2203	4300	6503	SO:0001583	missense	5792	exon17			GGGTGGCGGCTGC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.3062C>T	1.37:g.44070598C>T	ENSP00000353030:p.Ala1021Val	149	0		124	6	NM_002840	0	0	56	56	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.87|14.87	2.665441|2.665441	0.47677|0.47677	0.0|0.0	5.81E-4|5.81E-4	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000429895	T;T;T;T;T;T|.	0.51574|.	0.7;0.7;0.7;0.7;0.7;0.71|.	4.91|4.91	1.28|1.28	0.21552|0.21552	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	0.259629|.	0.20302|.	N|.	0.095002|.	T|T	0.26085|0.26085	0.0636|0.0636	N|N	0.14661|0.14661	0.345|0.345	0.29885|0.29885	N|N	0.825714|0.825714	B;B;B;D;P|.	0.69078|.	0.007;0.0;0.01;0.997;0.531|.	B;B;B;P;B|.	0.55345|.	0.003;0.001;0.006;0.774;0.109|.	T|T	0.29150|0.29150	-1.0021|-1.0021	10|5	0.27785|.	T|.	0.31|.	.|.	9.2697|9.2697	0.37664|0.37664	0.6451:0.2479:0.107:0.0|0.6451:0.2479:0.107:0.0	.|.	666;369;587;1012;1021|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	V|W	1021;1012;1021;1012;369;82|667	ENSP00000353030:A1021V;ENSP00000398822:A1012V;ENSP00000361491:A1021V;ENSP00000361490:A1012V;ENSP00000387885:A369V;ENSP00000361484:A82V|.	ENSP00000353030:A1021V|.	A|R	+|+	2|1	0|2	PTPRF|PTPRF	43843185|43843185	0.540000|0.540000	0.26410|0.26410	0.896000|0.896000	0.35187|0.35187	0.967000|0.967000	0.64934|0.64934	1.325000|1.325000	0.33724|0.33724	0.546000|0.546000	0.28920|0.28920	0.491000|0.491000	0.48974|0.48974	GCG|CGG	C|1.000;T|0.000		0.562	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
KIAA1324	57535	bcgsc.ca	37	1	109735398	109735398	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:109735398A>C	ENST00000369939.3	+	14	2032	c.1849A>C	c.(1849-1851)Acc>Ccc	p.T617P	KIAA1324_ENST00000529753.1_Missense_Mutation_p.T530P|KIAA1324_ENST00000369938.1_3'UTR	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	617					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		AGATTCAGGAACCTGCCACTC	0.562																																					p.T617P													.	KIAA1324-157	0			c.A1849C						.						154.0	148.0	150.0					1																	109735398		2203	4300	6503	SO:0001583	missense	57535	exon14			TCAGGAACCTGCC	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.1849A>C	1.37:g.109735398A>C	ENSP00000358955:p.Thr617Pro	286	32		227	80	NM_020775	0	0	0	0	0	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	ENST00000369939.3	37	CCDS794.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.130791	0.37630	.	.	ENSG00000116299	ENST00000369939;ENST00000457623;ENST00000529753	T;T;T	0.64618	-0.11;-0.11;-0.11	4.81	3.54	0.40534	Growth factor, receptor (1);	0.505379	0.23247	N	0.050290	T	0.24160	0.0585	N	0.14661	0.345	0.32545	N	0.533146	B;P;B;B	0.42692	0.21;0.787;0.21;0.21	B;B;B;B	0.41619	0.192;0.361;0.124;0.124	T	0.06734	-1.0810	10	0.35671	T	0.21	-15.6136	5.7003	0.17879	0.7307:0.0:0.2692:0.0	.	617;530;617;617	Q6UXG2-4;Q6UXG2-3;C9J810;Q6UXG2	.;.;.;K1324_HUMAN	P	617;567;530	ENSP00000358955:T617P;ENSP00000393964:T567P;ENSP00000434595:T530P	ENSP00000358955:T617P	T	+	1	0	KIAA1324	109536921	0.000000	0.05858	1.000000	0.80357	0.816000	0.46133	0.706000	0.25690	0.999000	0.39023	0.528000	0.53228	ACC	.		0.562	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
KCNC4	3749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110774916	110774916	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:110774916G>A	ENST00000369787.3	+	4	1920	c.1893G>A	c.(1891-1893)ctG>ctA	p.L631L	KCNC4_ENST00000413138.3_Intron|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	631					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGGGACTCTGTTCCTGCCAC	0.562																																					p.L631L		.											.	KCNC4-154	0			c.G1893A						.						74.0	54.0	61.0					1																	110774916		2203	4300	6503	SO:0001819	synonymous_variant	3749	exon4			GACTCTGTTCCTG	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1893G>A	1.37:g.110774916G>A		25	0		32	10	NM_004978	0	0	0	0	0	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	37	CCDS821.1																																																																																			.		0.562	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
DENND2D	79961	hgsc.bcm.edu	37	1	111739853	111739853	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:111739853A>G	ENST00000357640.4	-	5	678	c.449T>C	c.(448-450)cTt>cCt	p.L150P	DENND2D_ENST00000369752.5_Missense_Mutation_p.L147P|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	150	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CACTTTGGGAAGGCGAGGGCC	0.597																																					p.L150P		.											.	DENND2D-227	0			c.T449C						.						46.0	41.0	43.0					1																	111739853		2203	4300	6503	SO:0001583	missense	79961	exon5			TTGGGAAGGCGAG		CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.449T>C	1.37:g.111739853A>G	ENSP00000350266:p.Leu150Pro	25	0		30	2	NM_024901	0	0	21	21	0	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	37	CCDS831.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323695	0.81580	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.12774	2.65;2.65	5.59	5.59	0.84812	DENN (3);	0.236682	0.39544	N	0.001326	T	0.10766	0.0263	M	0.66378	2.025	0.80722	D	1	B;P	0.35411	0.445;0.5	B;B	0.35770	0.134;0.21	T	0.01432	-1.1356	10	0.87932	D	0	-19.5041	13.9922	0.64374	1.0:0.0:0.0:0.0	.	147;150	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	P	150;147	ENSP00000350266:L150P;ENSP00000358767:L147P	ENSP00000350266:L150P	L	-	2	0	DENND2D	111541376	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	3.995000	0.57001	2.250000	0.74265	0.533000	0.62120	CTT	.		0.597	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1	NM_024901	
VANGL1	81839	bcgsc.ca	37	1	116226631	116226631	+	Nonsense_Mutation	SNP	C	C	A	rs74117015		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:116226631C>A	ENST00000355485.2	+	6	1284	c.1013C>A	c.(1012-1014)tCa>tAa	p.S338*	VANGL1_ENST00000369509.1_Nonsense_Mutation_p.S338*|VANGL1_ENST00000310260.3_Nonsense_Mutation_p.S338*|VANGL1_ENST00000474344.1_3'UTR|VANGL1_ENST00000369510.4_Nonsense_Mutation_p.S336*	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	338					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CGCAGGGACTCAAGCCACAAC	0.527																																					p.S338X													.	VANGL1-226	0			c.C1013A						.						75.0	68.0	70.0					1																	116226631		2203	4300	6503	SO:0001587	stop_gained	81839	exon6			GGGACTCAAGCCA	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.1013C>A	1.37:g.116226631C>A	ENSP00000347672:p.Ser338*	81	2		66	29	NM_001172412	0	0	3	3	0	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Nonsense_Mutation	SNP	ENST00000355485.2	37	CCDS883.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254362	0.95336	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	.	.	.	4.58	4.58	0.56647	.	0.244948	0.41938	D	0.000799	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	4.8415	12.6952	0.56999	0.1648:0.8352:0.0:0.0	.	.	.	.	X	338;336;338;338	.	ENSP00000310800:S338X	S	+	2	0	VANGL1	116028154	1.000000	0.71417	0.934000	0.37439	0.464000	0.32679	2.734000	0.47368	2.366000	0.80165	0.551000	0.68910	TCA	C|0.500;A|0.500		0.527	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
NBPF14	25832	hgsc.bcm.edu	37	1	148015634	148015634	+	Missense_Mutation	SNP	T	T	C	rs200156420	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:148015634T>C	ENST00000369219.1	-	8	1013	c.997A>G	c.(997-999)Aac>Gac	p.N333D				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	333	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.			N -> D (in Ref. 3; AAO15399). {ECO:0000305}.		cytoplasm (GO:0005737)		p.N333D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					CCATCCATGTTAACAGCCAAG	0.463													-|||	445	0.0888578	0.146	0.0778	5008	,	,		13640	0.0675		0.0408	False		,,,				2504	0.091				p.N333D		.											.	NBPF14-91	1	Substitution - Missense(1)	skin(1)	c.A997G						.						4.0	3.0	4.0					1																	148015634		718	1612	2330	SO:0001583	missense	25832	exon8			CCATGTTAACAGC	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.997A>G	1.37:g.148015634T>C	ENSP00000358221:p.Asn333Asp	46	1		58	3	NM_015383	0	0	0	0	0	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	-	0	-2.747081	0.00086	.	.	ENSG00000122497	ENST00000369219	T	0.04234	3.67	.	.	.	DUF1220 (2);	.	.	.	.	T	0.00210	0.0006	N	0.00028	-2.63	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43686	-0.9376	7	0.02654	T	1	.	.	.	.	.	333	Q5TI25	NBPFE_HUMAN	D	333	ENSP00000358221:N333D	ENSP00000358221:N333D	N	-	1	0	NBPF14	146482258	0.402000	0.25311	0.002000	0.10522	0.000000	0.00434	-1.348000	0.02629	0.357000	0.24183	0.000000	0.15137	AAC	.		0.463	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
PI4KB	5298	bcgsc.ca	37	1	151263397	151263397	+	IGR	SNP	G	G	T	rs77014701		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:151263397G>T	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_3'UTR			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACTGTGGCTTGTGCTTTGCCT	0.632																																					p.L1142F	Colon(154;765 1838 9854 28443 37492)												.	ZNF687-92	0			c.G3426T						.						92.0	78.0	82.0					1																	151263397		2203	4300	6503	SO:0001628	intergenic_variant	57592	exon9			TGGCTTGTGCTTT	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151263397G>T		85	0		82	24	NM_020832	0	0	10	11	1	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		.	.	.	.	.	.	.	.	.	.	G	18.69	3.677234	0.68042	.	.	ENSG00000143373	ENST00000336715;ENST00000324048	T;T	0.29142	1.58;1.58	5.27	2.28	0.28536	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.25885	N	0.027675	T	0.30103	0.0754	M	0.66939	2.045	0.80722	D	1	D	0.64830	0.994	P	0.60886	0.88	T	0.08411	-1.0723	10	0.48119	T	0.1	-4.0316	5.4057	0.16320	0.1897:0.2541:0.5562:0.0	.	1142	Q8N1G0	ZN687_HUMAN	F	1142	ENSP00000336620:L1142F;ENSP00000319829:L1142F	ENSP00000319829:L1142F	L	+	3	2	ZNF687	149530021	0.694000	0.27738	1.000000	0.80357	0.996000	0.88848	0.651000	0.24873	0.810000	0.34279	0.563000	0.77884	TTG	C|1.000		0.632	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
LINGO4	339398	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	151774638	151774638	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:151774638C>G	ENST00000368820.3	-	2	1480	c.543G>C	c.(541-543)aaG>aaC	p.K181N		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	181						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGGTGCTCAACTTGGCTAGCC	0.612																																					p.K181N		.											.	LINGO4-90	0			c.G543C						.						37.0	43.0	41.0					1																	151774638		2203	4299	6502	SO:0001583	missense	339398	exon2			GCTCAACTTGGCT		CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.543G>C	1.37:g.151774638C>G	ENSP00000357810:p.Lys181Asn	115	0		101	6	NM_001004432	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368820.3	37	CCDS30855.1	.	.	.	.	.	.	.	.	.	.	C	3.774	-0.047078	0.07407	.	.	ENSG00000213171	ENST00000368820	T	0.54071	0.59	5.13	2.23	0.28157	.	0.401034	0.21238	N	0.077871	T	0.09024	0.0223	N	0.05351	-0.065	0.20926	N	0.999823	B	0.06786	0.001	B	0.06405	0.002	T	0.39375	-0.9617	10	0.07482	T	0.82	.	8.7903	0.34845	0.0:0.748:0.0:0.252	.	181	Q6UY18	LIGO4_HUMAN	N	181	ENSP00000357810:K181N	ENSP00000357810:K181N	K	-	3	2	LINGO4	150041262	0.037000	0.19845	0.017000	0.16124	0.866000	0.49608	-0.213000	0.09305	0.328000	0.23435	0.462000	0.41574	AAG	.		0.612	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036639.1	XM_291387	
CACNA1S	779	bcgsc.ca	37	1	201017805	201017805	+	Missense_Mutation	SNP	A	A	C	rs79011683		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:201017805A>C	ENST00000362061.3	-	36	4572	c.4346T>G	c.(4345-4347)gTg>gGg	p.V1449G	CACNA1S_ENST00000367338.3_Missense_Mutation_p.V1430G	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1449					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTTCATGCCCACCAGCCGCTG	0.627																																					p.V1449G													.	CACNA1S-94	0			c.T4346G						.						68.0	55.0	59.0					1																	201017805		2203	4300	6503	SO:0001583	missense	779	exon36			ATGCCCACCAGCC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.4346T>G	1.37:g.201017805A>C	ENSP00000355192:p.Val1449Gly	66	6		65	36	NM_000069	0	0	0	0	0	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	27.4	4.824332	0.90955	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.10288	2.89;2.89	5.15	5.15	0.70609	.	0.116960	0.64402	D	0.000018	T	0.36054	0.0953	M	0.89904	3.07	0.80722	D	1	D	0.56746	0.977	P	0.57960	0.83	T	0.46190	-0.9209	10	0.87932	D	0	.	15.2557	0.73582	1.0:0.0:0.0:0.0	.	1449	Q13698	CAC1S_HUMAN	G	1449;1430	ENSP00000355192:V1449G;ENSP00000356307:V1430G	ENSP00000355192:V1449G	V	-	2	0	CACNA1S	199284428	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.242000	0.95408	2.060000	0.61445	0.455000	0.32223	GTG	.		0.627	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
OBSCN	84033	bcgsc.ca	37	1	228430947	228430947	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:228430947C>G	ENST00000422127.1	+	10	3037	c.2993C>G	c.(2992-2994)gCc>gGc	p.A998G	OBSCN_ENST00000284548.11_Missense_Mutation_p.A998G|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1090G|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	998	Ig-like 10.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGGCAGGGGCCAGTGCCACG	0.592																																					p.A1090G													.	OBSCN-403	0			c.C3269G						.						24.0	25.0	25.0					1																	228430947		1997	4166	6163	SO:0001583	missense	84033	exon11			CAGGGGCCAGTGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2993C>G	1.37:g.228430947C>G	ENSP00000409493:p.Ala998Gly	37	0		29	20	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	2.996	-0.207096	0.06180	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04275	3.66;3.66	4.99	-1.36	0.09085	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	2.441030	0.02358	N	0.076594	T	0.02494	0.0076	N	0.04297	-0.235	0.21675	N	0.999593	B;B	0.15473	0.013;0.008	B;B	0.22386	0.039;0.015	T	0.41342	-0.9514	10	0.23302	T	0.38	.	2.6595	0.05023	0.3558:0.2476:0.3066:0.09	.	998;998	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	998	ENSP00000284548:A998G;ENSP00000409493:A998G	ENSP00000284548:A998G	A	+	2	0	OBSCN	226497570	0.709000	0.27886	0.093000	0.20910	0.160000	0.22226	-0.229000	0.09098	0.123000	0.18342	0.460000	0.39030	GCC	.		0.592	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	bcgsc.ca	37	1	228434292	228434292	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:228434292C>G	ENST00000422127.1	+	13	3865	c.3821C>G	c.(3820-3822)gCc>gGc	p.A1274G	OBSCN_ENST00000284548.11_Missense_Mutation_p.A1274G|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1366G|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1274	Ig-like 13.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGGCAGGGGCCAGTGCCACA	0.592																																					p.A1366G													.	OBSCN-403	0			c.C4097G						.						71.0	71.0	71.0					1																	228434292		2010	4164	6174	SO:0001583	missense	84033	exon14			CAGGGGCCAGTGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3821C>G	1.37:g.228434292C>G	ENSP00000409493:p.Ala1274Gly	148	0		95	41	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	1.723	-0.496196	0.04291	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04275	3.66;3.66	4.66	1.5	0.22942	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.534254	0.18563	N	0.137542	T	0.02119	0.0066	N	0.04335	-0.225	0.20196	N	0.99992	B;B	0.13594	0.002;0.008	B;B	0.18871	0.01;0.023	T	0.47761	-0.9092	10	0.22706	T	0.39	.	6.3266	0.21246	0.3995:0.3372:0.2632:0.0	.	1274;1274	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	1274	ENSP00000284548:A1274G;ENSP00000409493:A1274G	ENSP00000284548:A1274G	A	+	2	0	OBSCN	226500915	0.391000	0.25221	0.138000	0.22173	0.004000	0.04260	1.310000	0.33551	0.898000	0.36418	0.563000	0.77884	GCC	.		0.592	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	bcgsc.ca	37	1	228487735	228487735	+	Intron	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:228487735C>G	ENST00000422127.1	+	43	11703				OBSCN_ENST00000570156.2_Missense_Mutation_p.Q4543E|OBSCN_ENST00000602685.1_3'UTR|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000366707.4_Missense_Mutation_p.Q1233E|OBSCN_ENST00000284548.11_Intron|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000359599.6_3'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGCCTGAAGCAGGATGGGAC	0.567																																					p.Q4543E													.	OBSCN-403	0			c.C13627G						.						130.0	108.0	115.0					1																	228487735		876	1991	2867	SO:0001627	intron_variant	84033	exon51			CTGAAGCAGGATG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+4991C>G	1.37:g.228487735C>G		119	0		91	4	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444568	0.63178	.	.	ENSG00000154358	ENST00000366707	T	0.65916	-0.18	4.37	4.37	0.52481	.	.	.	.	.	T	0.49270	0.1547	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43988	-0.9357	6	0.02654	T	1	.	17.1074	0.86667	0.0:1.0:0.0:0.0	.	.	.	.	E	1233	ENSP00000355668:Q1233E	ENSP00000355668:Q1233E	Q	+	1	0	OBSCN	226554358	1.000000	0.71417	0.999000	0.59377	0.618000	0.37518	4.053000	0.57427	2.229000	0.72834	0.561000	0.74099	CAG	.		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ABCB10	23456	hgsc.bcm.edu	37	1	229685147	229685147	+	Missense_Mutation	SNP	G	G	C	rs138482043	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:229685147G>C	ENST00000344517.4	-	2	594	c.552C>G	c.(550-552)atC>atG	p.I184M	RNA5SP78_ENST00000364622.1_RNA	NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	184	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CAGACATGGAGATAACACTGG	0.527																																					p.I184M		.											.	ABCB10-153	0			c.C552G						.						85.0	79.0	81.0					1																	229685147		2203	4300	6503	SO:0001583	missense	23456	exon2			CATGGAGATAACA	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.552C>G	1.37:g.229685147G>C	ENSP00000355637:p.Ile184Met	53	0		38	2	NM_012089	0	0	2	2	0	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	37	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.746671	0.49257	.	.	ENSG00000135776	ENST00000344517	D	0.89681	-2.55	5.53	3.33	0.38152	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.250753	0.42294	D	0.000732	D	0.85548	0.5722	L	0.39633	1.23	0.50813	D	0.99989	B	0.25850	0.136	B	0.35727	0.209	D	0.83456	0.0051	10	0.49607	T	0.09	-15.9883	11.715	0.51647	0.2162:0.0:0.7838:0.0	.	184	Q9NRK6	ABCBA_HUMAN	M	184	ENSP00000355637:I184M	ENSP00000355637:I184M	I	-	3	3	ABCB10	227751770	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	1.474000	0.35398	1.351000	0.45789	0.591000	0.81541	ATC	G|0.993;A|0.007		0.527	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
EXO1	9156	bcgsc.ca	37	1	242020734	242020734	+	Missense_Mutation	SNP	C	C	A	rs78172944|rs369069198		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:242020734C>A	ENST00000366548.3	+	7	1086	c.493C>A	c.(493-495)Caa>Aaa	p.Q165K	EXO1_ENST00000518483.1_Missense_Mutation_p.Q165K|EXO1_ENST00000493702.1_3'UTR|EXO1_ENST00000348581.5_Missense_Mutation_p.Q165K	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	165	I-domain.|Interaction with MSH3.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GGGAATTGTGCAAGCCATAAT	0.458								Editing and processing nucleases																													p.Q165K													.	EXO1-661	0			c.C493A						.						96.0	99.0	98.0					1																	242020734		2203	4300	6503	SO:0001583	missense	9156	exon7			ATTGTGCAAGCCA	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.493C>A	1.37:g.242020734C>A	ENSP00000355506:p.Gln165Lys	118	3		110	62	NM_130398	0	0	0	0	0	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057200	0.55325	.	.	ENSG00000174371	ENST00000366548;ENST00000423131;ENST00000348581;ENST00000366547;ENST00000518483;ENST00000437497	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.93	4.99	0.66335	XPG/RAD2 endonuclease (2);	0.215165	0.49305	D	0.000141	T	0.75649	0.3878	M	0.84683	2.71	0.80722	D	1	D;P;D	0.56521	0.959;0.949;0.976	P;B;P	0.49276	0.55;0.333;0.605	T	0.78999	-0.1982	10	0.48119	T	0.1	0.0222	15.2098	0.73214	0.0:0.7373:0.2627:0.0	.	165;165;165	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	K	165;125;165;125;165;122	ENSP00000355506:Q165K;ENSP00000415531:Q125K;ENSP00000311873:Q165K;ENSP00000430251:Q165K;ENSP00000412041:Q122K	ENSP00000311873:Q165K	Q	+	1	0	EXO1	240087357	0.999000	0.42202	0.998000	0.56505	0.517000	0.34286	3.939000	0.56591	2.813000	0.96785	0.650000	0.86243	CAA	.		0.458	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
PDE6C	5146	hgsc.bcm.edu	37	10	95396764	95396764	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr10:95396764A>G	ENST00000371447.3	+	11	1564	c.1426A>G	c.(1426-1428)Aag>Gag	p.K476E		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	476					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	ATTTCAAGAGAAGTTAAATGT	0.308																																					p.K476E		.											.	PDE6C-94	0			c.A1426G						.						76.0	78.0	77.0					10																	95396764		2201	4299	6500	SO:0001583	missense	5146	exon11			CAAGAGAAGTTAA	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1426A>G	10.37:g.95396764A>G	ENSP00000360502:p.Lys476Glu	25	0		24	2	NM_006204	0	0	0	0	0	A6NCR6|Q5VY29	Missense_Mutation	SNP	ENST00000371447.3	37	CCDS7429.1	.	.	.	.	.	.	.	.	.	.	A	16.60	3.167376	0.57476	.	.	ENSG00000095464	ENST00000371447	T	0.64260	-0.09	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.67757	0.2927	M	0.83852	2.665	0.58432	D	0.999993	D	0.58268	0.982	P	0.44732	0.459	T	0.72272	-0.4342	10	0.36615	T	0.2	.	15.1703	0.72869	1.0:0.0:0.0:0.0	.	476	P51160	PDE6C_HUMAN	E	476	ENSP00000360502:K476E	ENSP00000360502:K476E	K	+	1	0	PDE6C	95386754	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.900000	0.75687	2.231000	0.72958	0.459000	0.35465	AAG	.		0.308	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204	
DNMBP	23268	bcgsc.ca	37	10	101646368	101646368	+	Missense_Mutation	SNP	C	C	A	rs201493282		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr10:101646368C>A	ENST00000324109.4	-	13	3398	c.3307G>T	c.(3307-3309)Gtc>Ttc	p.V1103F	DNMBP_ENST00000540316.1_Missense_Mutation_p.V39F|DNMBP_ENST00000543621.1_Missense_Mutation_p.V349F|DNMBP_ENST00000472036.1_5'UTR|DNMBP_ENST00000342239.3_Missense_Mutation_p.V1127F	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1103	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GGGGAGATGACAAGCCGCTCT	0.478																																					p.V1103F													.	DNMBP-233	0			c.G3307T						.						83.0	80.0	81.0					10																	101646368		2203	4300	6503	SO:0001583	missense	23268	exon13			AGATGACAAGCCG	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3307G>T	10.37:g.101646368C>A	ENSP00000315659:p.Val1103Phe	162	0		122	33	NM_015221	0	0	1	2	1	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	C	34	5.379696	0.95945	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.82	5.82	0.92795	BAR (3);	0.000000	0.43747	D	0.000531	D	0.84266	0.5434	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85588	0.1244	10	0.87932	D	0	-24.1351	19.7034	0.96065	0.0:1.0:0.0:0.0	.	1103;349;1127	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	F	1127;1103;349;349;39	ENSP00000344914:V1127F;ENSP00000315659:V1103F;ENSP00000443657:V349F;ENSP00000443573:V39F	ENSP00000315659:V1103F	V	-	1	0	DNMBP	101636358	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.815000	0.86186	2.756000	0.94617	0.561000	0.74099	GTC	.		0.478	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
MUC5B	727897	hgsc.bcm.edu	37	11	1258389	1258389	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:1258389T>G	ENST00000529681.1	+	25	3350	c.3292T>G	c.(3292-3294)Tcc>Gcc	p.S1098A	MUC5B_ENST00000447027.1_Missense_Mutation_p.S1101A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1098	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCTGCCGCTCCCAGGTGGG	0.682																																					p.S1098A		.											.	.	0			c.T3292G						.						10.0	15.0	13.0					11																	1258389		1897	4084	5981	SO:0001583	missense	727897	exon25			TGCCGCTCCCAGG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3292T>G	11.37:g.1258389T>G	ENSP00000436812:p.Ser1098Ala	43	0		24	2	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	5.715	0.316511	0.10845	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76839	-1.05;-1.05	4.38	-4.2	0.03823	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.59473	0.2196	N	0.10645	0.015	0.27479	N	0.952642	B;P;P	0.48089	0.026;0.905;0.905	B;P;P	0.47376	0.027;0.545;0.545	T	0.57613	-0.7781	9	0.87932	D	0	.	6.1245	0.20172	0.0:0.2029:0.3546:0.4425	.	1098;1791;1101	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	A	1098;1101;1099;1168	ENSP00000436812:S1098A;ENSP00000415793:S1101A	ENSP00000343037:S1099A	S	+	1	0	MUC5B	1214965	0.000000	0.05858	0.074000	0.20217	0.008000	0.06430	-0.169000	0.09911	-0.576000	0.05974	-0.648000	0.03929	TCC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	10626061	10626061	+	Missense_Mutation	SNP	C	C	G	rs374023004		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:10626061C>G	ENST00000436272.1	-	12	1631	c.1553G>C	c.(1552-1554)aGa>aCa	p.R518T	MRVI1_ENST00000423302.2_Missense_Mutation_p.R545T|MRVI1_ENST00000527509.2_Missense_Mutation_p.R454T|MRVI1_ENST00000531107.1_Missense_Mutation_p.R537T|MRVI1_ENST00000534266.2_Missense_Mutation_p.R230T|MRVI1_ENST00000541483.1_Missense_Mutation_p.R339T|MRVI1_ENST00000424001.1_Missense_Mutation_p.R230T|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000421747.1_Missense_Mutation_p.R536T|MRVI1_ENST00000545852.1_Missense_Mutation_p.R230T|MRVI1_ENST00000552103.1_Missense_Mutation_p.R454T|MRVI1_ENST00000547195.1_Missense_Mutation_p.R454T|MRVI1_ENST00000558540.1_Missense_Mutation_p.R230T			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	518	Interaction with ITPR1. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GCTGTCATTTCTAAAGGCCAA	0.488																																					p.R545T		.											.	MRVI1-25	0			c.G1634C						.						173.0	166.0	168.0					11																	10626061		1964	4161	6125	SO:0001583	missense	10335	exon13			TCATTTCTAAAGG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1553G>C	11.37:g.10626061C>G	ENSP00000412229:p.Arg518Thr	130	0		82	18	NM_130385	0	0	1	1	0	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		.	.	.	.	.	.	.	.	.	.	C	27.5	4.839467	0.91117	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.998;0.998;0.997	T	0.13980	-1.0489	10	0.56958	D	0.05	-13.6185	19.0062	0.92852	0.0:1.0:0.0:0.0	.	339;518;537;536	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	T	536;519;518;454;454;230;230;545;339;537;454	ENSP00000414598:R536T;ENSP00000412229:R518T;ENSP00000448278:R454T;ENSP00000446764:R454T;ENSP00000441971:R230T;ENSP00000401205:R230T;ENSP00000412130:R545T;ENSP00000437784:R339T;ENSP00000432436:R537T;ENSP00000432067:R454T	ENSP00000307885:R519T	R	-	2	0	MRVI1	10582637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.538000	0.67193	2.553000	0.86117	0.563000	0.77884	AGA	.		0.488	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
USH1C	10083	bcgsc.ca	37	11	17542427	17542427	+	Silent	SNP	G	G	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:17542427G>T	ENST00000318024.4	-	14	1308	c.1200C>A	c.(1198-1200)cgC>cgA	p.R400R	USH1C_ENST00000527020.1_Silent_p.R381R|USH1C_ENST00000005226.7_Silent_p.R400R|USH1C_ENST00000527720.1_Silent_p.R369R	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	400					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						ACTTTGGCTTGCGAAGGGGTA	0.512																																					p.R400R													.	USH1C-91	0			c.C1200A						.						251.0	239.0	243.0					11																	17542427		2200	4293	6493	SO:0001819	synonymous_variant	10083	exon14			TGGCTTGCGAAGG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1200C>A	11.37:g.17542427G>T		427	0		313	51	NM_005709	0	0	0	0	0	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	ENST00000318024.4	37	CCDS31438.1																																																																																			.		0.512	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
USH1C	10083	bcgsc.ca	37	11	17542436	17542436	+	Silent	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:17542436T>G	ENST00000318024.4	-	14	1299	c.1191A>C	c.(1189-1191)gtA>gtC	p.V397V	USH1C_ENST00000527020.1_Silent_p.V378V|USH1C_ENST00000005226.7_Silent_p.V397V|USH1C_ENST00000527720.1_Silent_p.V366V	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	397					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						TGCGAAGGGGTACTGGGTGTA	0.517																																					p.V397V													.	USH1C-91	0			c.A1191C						.						282.0	265.0	271.0					11																	17542436		2200	4293	6493	SO:0001819	synonymous_variant	10083	exon14			AAGGGGTACTGGG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1191A>C	11.37:g.17542436T>G		481	2		344	83	NM_005709	0	0	23	25	2	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	ENST00000318024.4	37	CCDS31438.1																																																																																			.		0.517	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
MRPL21	219927	bcgsc.ca	37	11	68660885	68660885	+	Silent	SNP	G	G	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:68660885G>T	ENST00000362034.2	-	5	444	c.435C>A	c.(433-435)ggC>ggA	p.G145G	MRPL21_ENST00000450904.2_Silent_p.G60G|MRPL21_ENST00000567045.1_Silent_p.G60G	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	145					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGAGTGGCTTGCCAAGCAGCG	0.532																																					p.G145G													.	MRPL21-90	0			c.C435A						.						68.0	65.0	66.0					11																	68660885		2200	4294	6494	SO:0001819	synonymous_variant	219927	exon5			TGGCTTGCCAAGC	AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.435C>A	11.37:g.68660885G>T		78	1		59	29	NM_181514	0	0	0	0	0	A6NKU0|C9JPR2	Silent	SNP	ENST00000362034.2	37	CCDS8186.1																																																																																			.		0.532	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512	
MAML2	84441	hgsc.bcm.edu	37	11	95825431	95825431	+	Silent	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:95825431T>C	ENST00000524717.1	-	2	3048	c.1764A>G	c.(1762-1764)caA>caG	p.Q588Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	588					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgTTGGGTGTAGT	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q588Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.A1764G						.																																			SO:0001819	synonymous_variant	84441	exon2			TTGCTGTTGGGTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1764A>G	11.37:g.95825431T>C		12	2		6	2	NM_032427	0	0	7	7	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
PPHLN1	51535	hgsc.bcm.edu	37	12	42840394	42840394	+	Splice_Site	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:42840394G>C	ENST00000395568.2	+	13	1435	c.1351G>C	c.(1351-1353)Gat>Cat	p.D451H	PPHLN1_ENST00000256678.8_Splice_Site_p.D356H|PPHLN1_ENST00000317560.9_Intron|PPHLN1_ENST00000432191.2_Splice_Site_p.D427H	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	451					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		ctaattctaggatgtaaagcc	0.393																																					p.D451H		.											.	PPHLN1-154	0			c.G1351C						.						54.0	55.0	54.0					12																	42840394		2203	4300	6503	SO:0001630	splice_region_variant	51535	exon13			TTCTAGGATGTAA	AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.1351-1G>C	12.37:g.42840394G>C		29	0		33	2	NM_016488	0	0	0	0	0	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Missense_Mutation	SNP	ENST00000395568.2	37	CCDS31777.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320402	0.23994	.	.	ENSG00000134283	ENST00000395568;ENST00000256678;ENST00000432191	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.61098	0.2320	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.58970	0.984;0.972;0.984;0.972	D;P;D;P	0.65323	0.934;0.861;0.934;0.861	T	0.61173	-0.7116	7	0.87932	D	0	.	.	.	.	.	356;402;427;451	F8W6A0;B7Z695;Q8NEY8-3;Q8NEY8	.;.;.;PPHLN_HUMAN	H	451;356;427	.	ENSP00000256678:D356H	D	+	1	0	PPHLN1	41126661	0.332000	0.24722	0.224000	0.23877	0.223000	0.24884	0.251000	0.18257	0.202000	0.20498	0.205000	0.17691	GAT	.		0.393	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515	Missense_Mutation
KRT1	3848	bcgsc.ca	37	12	53069392	53069392	+	Missense_Mutation	SNP	G	G	T	rs75007002		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:53069392G>T	ENST00000252244.3	-	9	1578	c.1520C>A	c.(1519-1521)aCa>aAa	p.T507K		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	507	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						GGTGTGGCTTGTGCTCACAGC	0.562																																					p.T507K													.	KRT1-92	0			c.C1520A						.						61.0	58.0	59.0					12																	53069392		2203	4300	6503	SO:0001583	missense	3848	exon9			TGGCTTGTGCTCA	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1520C>A	12.37:g.53069392G>T	ENSP00000252244:p.Thr507Lys	107	0		125	52	NM_006121	0	0	0	0	0	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827529	0.32329	.	.	ENSG00000167768	ENST00000252244	D	0.90620	-2.7	4.61	2.57	0.30868	.	.	.	.	.	T	0.81446	0.4824	N	0.14661	0.345	0.31022	N	0.718014	P	0.39480	0.675	B	0.33960	0.173	T	0.80188	-0.1486	9	0.59425	D	0.04	.	13.6984	0.62593	0.0:0.5685:0.4315:0.0	.	507	P04264	K2C1_HUMAN	K	507	ENSP00000252244:T507K	ENSP00000252244:T507K	T	-	2	0	KRT1	51355659	0.004000	0.15560	1.000000	0.80357	0.904000	0.53231	0.012000	0.13287	1.036000	0.39998	0.462000	0.41574	ACA	.		0.562	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
NAB2	4665	broad.mit.edu	37	12	57485439	57485439	+	Silent	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:57485439G>C	ENST00000300131.3	+	2	993	c.615G>C	c.(613-615)tcG>tcC	p.S205S	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000342556.6_Silent_p.S205S|NAB2_ENST00000357680.4_Silent_p.S205S	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	205					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGGCTGGCTCGCCCCCCTTCT	0.726																																					p.S205S													.	NAB2-92	0			c.G615C						.						12.0	17.0	15.0					12																	57485439		2194	4280	6474	SO:0001819	synonymous_variant	4665	exon2			TGGCTCGCCCCCC	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.615G>C	12.37:g.57485439G>C		55	0		46	10	NM_005967	0	0	6	6	0	B2RAK3|O76006|Q14797	Silent	SNP	ENST00000300131.3	37	CCDS8930.1																																																																																			.		0.726	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
NAB2	4665	bcgsc.ca	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:57485446T>C	ENST00000300131.3	+	2	1000	c.622T>C	c.(622-624)Ttc>Ctc	p.F208L	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000342556.6_Missense_Mutation_p.F208L|NAB2_ENST00000357680.4_Missense_Mutation_p.F208L	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	208					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.F208L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTCGCCCCCCTTCTCCCCCCC	0.716																																					p.F208L													.	NAB2-92	1	Substitution - Missense(1)	lung(1)	c.T622C						.						12.0	17.0	15.0					12																	57485446		2196	4277	6473	SO:0001583	missense	4665	exon2			CCCCCCTTCTCCC	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.622T>C	12.37:g.57485446T>C	ENSP00000300131:p.Phe208Leu	61	0		50	19	NM_005967	0	0	6	6	0	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473597	0.26423	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.15	4.15	0.48705	NAB co-repressor, domain (1);	0.441905	0.22768	N	0.055868	T	0.21801	0.0525	N	0.11427	0.14	0.33270	D	0.560932	P	0.43826	0.818	B	0.41466	0.358	T	0.14392	-1.0474	9	0.10902	T	0.67	-12.462	9.5058	0.39046	0.0:0.0:0.0:1.0	.	208	Q15742	NAB2_HUMAN	L	208	.	ENSP00000300131:F208L	F	+	1	0	NAB2	55771713	0.994000	0.37717	0.852000	0.33557	0.975000	0.68041	0.652000	0.24888	1.732000	0.51606	0.379000	0.24179	TTC	.		0.716	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
ANAPC7	51434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110813921	110813921	+	Silent	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:110813921T>C	ENST00000455511.3	-	10	1560	c.1560A>G	c.(1558-1560)gtA>gtG	p.V520V	ANAPC7_ENST00000450008.2_Silent_p.V520V|ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	520					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						CATTGACAGCTACAAGGAAAT	0.498																																					p.V520V		.											.	ANAPC7-226	0			c.A1560G						.						141.0	119.0	126.0					12																	110813921		2203	4300	6503	SO:0001819	synonymous_variant	51434	exon10			GACAGCTACAAGG	AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1560A>G	12.37:g.110813921T>C		76	0		75	14	NM_016238	0	0	40	51	11	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	ENST00000455511.3	37	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	T	10.12	1.263642	0.23136	.	.	ENSG00000196510	ENST00000552087	.	.	.	5.55	2.43	0.29744	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50415	-0.8831	4	.	.	.	-22.9206	9.4319	0.38615	0.0:0.3125:0.0:0.6875	.	.	.	.	G	70	.	.	S	-	1	0	ANAPC7	109298304	0.916000	0.31088	1.000000	0.80357	0.998000	0.95712	-0.028000	0.12350	0.179000	0.19938	0.459000	0.35465	AGC	.		0.498	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
BRAP	8315	bcgsc.ca	37	12	112098449	112098449	+	Silent	SNP	G	G	C	rs201734278		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:112098449G>C	ENST00000327551.6	-	7	977	c.837C>G	c.(835-837)ccC>ccG	p.P279P	BRAP_ENST00000539060.1_Silent_p.P130P|BRAP_ENST00000419234.4_Silent_p.P309P			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	203					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CTACTGGCTCGGGCGTTTGAC	0.408																																					p.P309P	Pancreas(146;846 1904 7830 25130 26065)												.	BRAP-710	0			c.C927G						.						157.0	152.0	154.0					12																	112098449		2203	4300	6503	SO:0001819	synonymous_variant	8315	exon7			TGGCTCGGGCGTT	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.837C>G	12.37:g.112098449G>C		201	1		149	28	NM_006768	0	0	2	2	0	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	ENST00000327551.6	37																																																																																				G|0.999;C|0.001		0.408	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
DNAH10	196385	hgsc.bcm.edu	37	12	124414245	124414245	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:124414245A>G	ENST00000409039.3	+	71	12222	c.12197A>G	c.(12196-12198)aAa>aGa	p.K4066R	DNAH10OS_ENST00000514254.2_3'UTR|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4066					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACTTAACGAAAGCCTTCCAG	0.512																																					p.K4066R		.											.	DNAH10-95	0			c.A12197G						.						46.0	45.0	45.0					12																	124414245		1895	4111	6006	SO:0001583	missense	196385	exon71			TAACGAAAGCCTT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12197A>G	12.37:g.124414245A>G	ENSP00000386770:p.Lys4066Arg	36	0		28	2	NM_207437	0	0	1	1	0	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912785	0.52439	.	.	ENSG00000197653	ENST00000409039	T	0.08634	3.07	5.06	5.06	0.68205	Dynein heavy chain (1);	0.112207	0.64402	D	0.000016	T	0.22322	0.0538	L	0.54965	1.715	0.80722	D	1	D	0.63880	0.993	D	0.63381	0.914	T	0.00351	-1.1796	10	0.56958	D	0.05	.	15.1038	0.72303	1.0:0.0:0.0:0.0	.	4066	Q8IVF4	DYH10_HUMAN	R	4066	ENSP00000386770:K4066R	ENSP00000386770:K4066R	K	+	2	0	DNAH10	122980198	1.000000	0.71417	0.965000	0.40720	0.157000	0.22087	7.196000	0.77805	2.038000	0.60285	0.533000	0.62120	AAA	.		0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
SHISA2	387914	hgsc.bcm.edu	37	13	26625047	26625047	+	Silent	SNP	G	G	A	rs4770911	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr13:26625047G>A	ENST00000319420.3	-	1	122	c.67C>T	c.(67-69)Ctg>Ttg	p.L23L	LINC00415_ENST00000439079.1_lincRNA	NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	23					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						AGCGCAGCCAGCAGCAGCTGC	0.731													G|||	768	0.153355	0.1036	0.1167	5008	,	,		13796	0.1032		0.171	False		,,,				2504	0.2802				p.L23L		.											.	SHISA2-69	0			c.C67T						.	G		241,2763		3,235,1264	2.0	2.0	2.0		67	4.4	1.0	13	dbSNP_111	2	750,5346		25,700,2323	no	coding-synonymous	SHISA2	NM_001007538.1		28,935,3587	AA,AG,GG		12.3031,8.0226,10.8901		23/296	26625047	991,8109	1502	3048	4550	SO:0001819	synonymous_variant	387914	exon1			CAGCCAGCAGCAG		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.67C>T	13.37:g.26625047G>A		2	0		4	3	NM_001007538	0	0	0	0	0	B9EH70|Q5W0G8	Silent	SNP	ENST00000319420.3	37	CCDS31951.1																																																																																			G|0.870;A|0.130		0.731	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
MYO16	23026	hgsc.bcm.edu	37	13	109792825	109792825	+	Missense_Mutation	SNP	C	C	T	rs199777754	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr13:109792825C>T	ENST00000357550.2	+	31	4240	c.4199C>T	c.(4198-4200)gCg>gTg	p.A1400V	MYO16_ENST00000356711.2_Missense_Mutation_p.A1400V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCCCGGCGGCGCCTCCGGGT	0.776													C|||	29	0.00579073	0.0015	0.0086	5008	,	,		6517	0.0		0.0179	False		,,,				2504	0.0031				p.A1422V		.											.	MYO16-142	0			c.C4265T						.	C	VAL/ALA,VAL/ALA	6,3528		0,6,1761	3.0	4.0	3.0		4265,4199	-6.2	0.0	13		3	61,7069		0,61,3504	yes	missense,missense	MYO16	NM_001198950.1,NM_015011.1	64,64	0,67,5265	TT,TC,CC		0.8555,0.1698,0.6283	benign,benign	1422/1881,1400/1859	109792825	67,10597	1767	3565	5332	SO:0001583	missense	23026	exon32			CGGCGGCGCCTCC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4199C>T	13.37:g.109792825C>T	ENSP00000350160:p.Ala1400Val	4	1		12	10	NM_001198950	0	0	0	0	0		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	2.716	-0.267762	0.05754	0.001698	0.008555	ENSG00000041515	ENST00000356711;ENST00000357550	T;T	0.80909	-1.43;-1.43	4.18	-6.23	0.02052	.	1.421560	0.05654	U	0.585757	T	0.44456	0.1294	N	0.08118	0	0.09310	N	0.999997	B	0.22414	0.069	B	0.14578	0.011	T	0.34950	-0.9808	9	.	.	.	.	1.1331	0.01749	0.2674:0.1192:0.1351:0.4783	.	1400	Q9Y6X6	MYO16_HUMAN	V	1400	ENSP00000349145:A1400V;ENSP00000350160:A1400V	.	A	+	2	0	MYO16	108590826	0.972000	0.33761	0.000000	0.03702	0.005000	0.04900	2.028000	0.41088	-0.850000	0.04152	0.313000	0.20887	GCG	.		0.776	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
MAP1A	4130	bcgsc.ca	37	15	43821989	43821989	+	Missense_Mutation	SNP	A	A	C	rs200714150		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:43821989A>C	ENST00000300231.5	+	5	8627	c.8177A>C	c.(8176-8178)gAc>gCc	p.D2726A	MAP1A_ENST00000399453.1_Missense_Mutation_p.D2726A|MAP1A_ENST00000382031.1_Missense_Mutation_p.D2964A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2726					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGTGGGAATGACCCTGCCAAT	0.577																																					p.D2726A													.	MAP1A-141	0			c.A8177C						.						61.0	66.0	64.0					15																	43821989		2094	4232	6326	SO:0001583	missense	4130	exon5			GGAATGACCCTGC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.8177A>C	15.37:g.43821989A>C	ENSP00000300231:p.Asp2726Ala	88	6		67	28	NM_002373	0	0	1	1	0	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.856398	0.51376	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.03468	3.92;3.92;3.93	4.91	4.91	0.64330	.	.	.	.	.	T	0.17746	0.0426	M	0.74258	2.255	0.54753	D	0.99998	D	0.89917	1.0	D	0.97110	1.0	T	0.00261	-1.1868	9	0.87932	D	0	-18.353	14.7125	0.69244	1.0:0.0:0.0:0.0	.	2726	P78559	MAP1A_HUMAN	A	2964;2726;2726	ENSP00000371462:D2964A;ENSP00000382380:D2726A;ENSP00000300231:D2726A	ENSP00000300231:D2726A	D	+	2	0	MAP1A	41609281	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.139000	0.94554	2.059000	0.61396	0.379000	0.24179	GAC	A|0.999;C|0.001		0.577	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
SQRDL	58472	bcgsc.ca	37	15	45968443	45968443	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:45968443C>G	ENST00000260324.7	+	6	1185	c.799C>G	c.(799-801)Cga>Gga	p.R267G	RP11-96O20.4_ENST00000564080.1_Missense_Mutation_p.R267G|SQRDL_ENST00000568606.1_Missense_Mutation_p.R267G	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	267					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		CATTGAAGTCCGAGCCGATAA	0.483																																					p.R267G													.	SQRDL-91	0			c.C799G						.						112.0	112.0	112.0					15																	45968443		2198	4297	6495	SO:0001583	missense	58472	exon6			GAAGTCCGAGCCG	AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.799C>G	15.37:g.45968443C>G	ENSP00000260324:p.Arg267Gly	199	1		124	38	NM_021199	0	0	27	27	0	Q9UQM8	Missense_Mutation	SNP	ENST00000260324.7	37	CCDS10127.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011089	0.75046	.	.	ENSG00000137767	ENST00000260324	T	0.41065	1.01	5.74	4.77	0.60923	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.56426	0.1984	M	0.86268	2.805	0.80722	D	1	P	0.34562	0.457	B	0.43478	0.421	T	0.61357	-0.7079	10	0.52906	T	0.07	.	14.3248	0.66512	0.1489:0.8511:0.0:0.0	.	267	Q9Y6N5	SQRD_HUMAN	G	267	ENSP00000260324:R267G	ENSP00000260324:R267G	R	+	1	2	SQRDL	43755735	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.318000	0.43779	2.715000	0.92844	0.655000	0.94253	CGA	.		0.483	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254319.2		
DMXL2	23312	bcgsc.ca	37	15	51766637	51766637	+	Missense_Mutation	SNP	C	C	A	rs374313651|rs371331405		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:51766637C>A	ENST00000251076.5	-	28	7401	c.7114G>T	c.(7114-7116)Gca>Tca	p.A2372S	DMXL2_ENST00000543779.2_Missense_Mutation_p.A2373S|DMXL2_ENST00000449909.3_Missense_Mutation_p.A1736S|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2372						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GGGTGGGCTGCAAGCCGAAAT	0.383																																					p.A2373S													.	DMXL2-99	0			c.G7117T						.						59.0	60.0	60.0					15																	51766637		2196	4293	6489	SO:0001583	missense	23312	exon28			GGGCTGCAAGCCG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7114G>T	15.37:g.51766637C>A	ENSP00000251076:p.Ala2372Ser	68	0		58	27	NM_001174116	0	0	0	0	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089982	0.76756	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.25085	1.97;1.97;1.82	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	L	0.39245	1.2	0.80722	D	1	D;D;D;B	0.69078	0.997;0.994;0.997;0.25	D;D;D;B	0.75020	0.909;0.97;0.985;0.041	T	0.08700	-1.0709	10	0.36615	T	0.2	.	19.5897	0.95503	0.0:1.0:0.0:0.0	.	2373;1736;2372;2373	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	S	2372;2373;1736	ENSP00000251076:A2372S;ENSP00000441858:A2373S;ENSP00000400855:A1736S	ENSP00000251076:A2372S	A	-	1	0	DMXL2	49553929	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.757000	0.68766	2.635000	0.89317	0.655000	0.94253	GCA	.		0.383	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
CCNB2	9133	bcgsc.ca	37	15	59406999	59406999	+	Missense_Mutation	SNP	T	T	G	rs200615810		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:59406999T>G	ENST00000288207.2	+	5	712	c.521T>G	c.(520-522)gTa>gGa	p.V174G	CCNB2_ENST00000559622.1_Missense_Mutation_p.V93G	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2	174					G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						GATTGGCTGGTACAAGTCCAC	0.453																																					p.V174G													.	CCNB2-226	0			c.T521G						.						192.0	180.0	184.0					15																	59406999		2191	4291	6482	SO:0001583	missense	9133	exon5			GGCTGGTACAAGT	AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.521T>G	15.37:g.59406999T>G	ENSP00000288207:p.Val174Gly	265	11		249	66	NM_004701	0	0	2	2	0	B3KM93|Q6FI99	Missense_Mutation	SNP	ENST00000288207.2	37	CCDS10170.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.078656	0.76528	.	.	ENSG00000157456	ENST00000288207	T	0.13538	2.58	5.54	5.54	0.83059	Cyclin, N-terminal (2);Cyclin-like (3);	0.056803	0.64402	D	0.000001	T	0.43166	0.1235	M	0.91090	3.175	0.80722	D	1	D;D	0.61080	0.989;0.978	P;P	0.61070	0.883;0.844	T	0.55444	-0.8140	10	0.87932	D	0	.	14.8548	0.70329	0.0:0.0:0.0:1.0	.	174;174	Q53HG9;O95067	.;CCNB2_HUMAN	G	174	ENSP00000288207:V174G	ENSP00000288207:V174G	V	+	2	0	CCNB2	57194291	1.000000	0.71417	0.950000	0.38849	0.791000	0.44710	8.040000	0.89188	2.103000	0.63969	0.533000	0.62120	GTA	.		0.453	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1	NM_004701	
TRIP4	9325	hgsc.bcm.edu	37	15	64692969	64692969	+	Silent	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:64692969T>C	ENST00000261884.3	+	5	706	c.646T>C	c.(646-648)Tta>Cta	p.L216L	RN7SL595P_ENST00000582065.1_RNA|TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	216					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						ACAAGATATTTTACAGCGTGA	0.363																																					p.L216L		.											.	TRIP4-188	0			c.T646C						.						96.0	94.0	95.0					15																	64692969		2203	4300	6503	SO:0001819	synonymous_variant	9325	exon5			GATATTTTACAGC	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.646T>C	15.37:g.64692969T>C		30	0		32	2	NM_016213	0	0	7	7	0	B2RAS0|Q96ED7|Q9UKH0	Silent	SNP	ENST00000261884.3	37	CCDS10194.1																																																																																			.		0.363	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
AKAP13	11214	bcgsc.ca	37	15	86287035	86287035	+	Missense_Mutation	SNP	A	A	C	rs79101360		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr15:86287035A>C	ENST00000394518.2	+	36	8466	c.8371A>C	c.(8371-8373)Acc>Ccc	p.T2791P	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.T2795P|RP11-158M2.3_ENST00000558375.1_RNA|AKAP13_ENST00000394510.2_Missense_Mutation_p.T1036P	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2791	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAAGAACAAAACCAGCCGCTC	0.542																																					p.T2795P	Melanoma(94;603 1453 3280 32295 32951)												.	AKAP13-258	0			c.A8383C						.						34.0	37.0	36.0					15																	86287035		2196	4288	6484	SO:0001583	missense	11214	exon36			AACAAAACCAGCC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.8371A>C	15.37:g.86287035A>C	ENSP00000378026:p.Thr2791Pro	81	4		50	23	NM_006738	0	0	3	4	1	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.974617	0.34848	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.48201	0.82;0.82;0.82	5.59	3.7	0.42460	.	.	.	.	.	T	0.26268	0.0641	N	0.08118	0	0.23962	N	0.996336	B;P	0.34977	0.347;0.478	B;B	0.26416	0.031;0.069	T	0.09335	-1.0679	9	0.66056	D	0.02	.	11.4408	0.50096	0.1299:0.0:0.8701:0.0	.	2791;2795	Q12802;Q12802-2	AKP13_HUMAN;.	P	2795;2791;2794;2770;1036	ENSP00000354718:T2795P;ENSP00000378026:T2791P;ENSP00000378018:T1036P	ENSP00000354718:T2795P	T	+	1	0	AKAP13	84088039	1.000000	0.71417	0.827000	0.32855	0.425000	0.31504	4.301000	0.59086	0.702000	0.31825	-0.899000	0.02877	ACC	.		0.542	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
PKD1	5310	hgsc.bcm.edu	37	16	2164808	2164808	+	Missense_Mutation	SNP	C	C	T	rs40433	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr16:2164808C>T	ENST00000262304.4	-	11	2424	c.2216G>A	c.(2215-2217)cGg>cAg	p.R739Q	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.R739Q	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	739			R -> Q (in dbSNP:rs40433). {ECO:0000269|PubMed:11857740, ECO:0000269|PubMed:18837007, ECO:0000269|PubMed:7663510}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTACGGGGCCCGGGGACCAGG	0.711													t|||	4904	0.979233	0.9947	0.964	5008	,	,		11377	1.0		0.9453	False		,,,				2504	0.9826				p.R739Q		.											.	PKD1-91	0			c.G2216A						.						1.0	1.0	1.0					16																	2164808		369	697	1066	SO:0001583	missense	5310	exon11			GGGGCCCGGGGAC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2216G>A	16.37:g.2164808C>T	ENSP00000262304:p.Arg739Gln	1	1		2	2	NM_000296	0	0	0	12	12	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	1980	0.9065934065934066	441	0.8963414634146342	337	0.930939226519337	535	0.9353146853146853	667	0.8799472295514512	t	0.012	-1.660303	0.00772	.	.	ENSG00000008710	ENST00000262304;ENST00000423118	T;T	0.36157	1.27;1.27	5.39	-2.55	0.06288	Polycystin cation channel (1);	3.669600	0.00744	N	0.001030	T	0.00012	0.0000	N	0.00823	-1.155	0.80722	P	0.0	B;B	0.13145	0.005;0.007	B;B	0.04013	0.0;0.001	T	0.38735	-0.9647	9	0.02654	T	1	.	3.0572	0.06188	0.1042:0.3245:0.3205:0.2508	rs40433;rs3895634	739;739	P98161-3;P98161	.;PKD1_HUMAN	Q	739	ENSP00000262304:R739Q;ENSP00000399501:R739Q	ENSP00000262304:R739Q	R	-	2	0	PKD1	2104809	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.091000	0.15046	-0.934000	0.03733	-1.862000	0.00560	CGG	T|1.000;|0.000		0.711	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
MYLK3	91807	bcgsc.ca	37	16	46744687	46744687	+	Missense_Mutation	SNP	G	G	A	rs150139689|rs200890698		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr16:46744687G>A	ENST00000394809.4	-	11	2244	c.2129C>T	c.(2128-2130)tCc>tTc	p.S710F	MYLK3_ENST00000562104.1_5'UTR|MYLK3_ENST00000536476.1_Missense_Mutation_p.S369F	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	710	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TAGAAATGGGGACAAGCCACT	0.468																																					p.S710F													.	MYLK3-374	0			c.C2129T						.						79.0	88.0	85.0					16																	46744687		2203	4300	6503	SO:0001583	missense	91807	exon11			AATGGGGACAAGC	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.2129C>T	16.37:g.46744687G>A	ENSP00000378288:p.Ser710Phe	249	4		180	58	NM_182493	0	0	0	0	0	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944148	0.92593	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.39229	1.09;1.09	6.03	6.03	0.97812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35378	N	0.003248	T	0.60011	0.2236	L	0.39467	1.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59064	-0.7524	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	710	Q32MK0	MYLK3_HUMAN	F	710;369	ENSP00000378288:S710F;ENSP00000439297:S369F	ENSP00000378288:S710F	S	-	2	0	MYLK3	45302188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.799000	0.99117	2.861000	0.98227	0.655000	0.94253	TCC	.		0.468	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
FLII	2314	hgsc.bcm.edu	37	17	18154306	18154306	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:18154306A>G	ENST00000327031.4	-	14	1847	c.1622T>C	c.(1621-1623)cTc>cCc	p.L541P	FLII_ENST00000379450.4_Missense_Mutation_p.L455P|FLII_ENST00000545457.2_Missense_Mutation_p.L486P|FLII_ENST00000579294.1_Missense_Mutation_p.L530P|FLII_ENST00000578558.1_Missense_Mutation_p.L540P|FLII_ENST00000584444.1_5'Flank	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	541	Interaction with ACTL6A.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					CTCCCAGTTGAGGGAGCCGCT	0.587																																					p.L541P		.											.	FLII-91	0			c.T1622C						.						62.0	63.0	63.0					17																	18154306		2203	4300	6503	SO:0001583	missense	2314	exon14			CAGTTGAGGGAGC	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.1622T>C	17.37:g.18154306A>G	ENSP00000324573:p.Leu541Pro	77	1		50	3	NM_002018	0	0	68	68	0	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	37	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.530941	0.85706	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.19250	2.16;2.16	5.91	5.91	0.95273	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.50616	0.1626	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.974;0.974;0.974;0.995;0.999	T	0.55289	-0.8164	10	0.87932	D	0	-17.0341	16.3436	0.83110	1.0:0.0:0.0:0.0	.	455;455;541;541;510	E7EPM0;B4DIL0;F5H407;Q13045;B4DIX0	.;.;.;FLII_HUMAN;.	P	541;541;455	ENSP00000324573:L541P;ENSP00000368763:L455P	ENSP00000324573:L541P	L	-	2	0	FLII	18095031	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.944000	0.92980	2.269000	0.75478	0.533000	0.62120	CTC	.		0.587	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
ITGB3	3690	hgsc.bcm.edu	37	17	45361999	45361999	+	Missense_Mutation	SNP	C	C	A	rs202100960		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:45361999C>A	ENST00000559488.1	+	4	568	c.552C>A	c.(550-552)gaC>gaA	p.D184E	ITGB3_ENST00000571680.1_Missense_Mutation_p.D184E|ITGB3_ENST00000560629.1_Missense_Mutation_p.Q173K|ITGB3_ENST00000435993.2_Missense_Mutation_p.D137E	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	184	VWFA.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CATTTGTGGACAAGCCTGTGT	0.552																																					p.D184E		.											.	ITGB3-714	0			c.C552A						.						128.0	134.0	132.0					17																	45361999		2203	4300	6503	SO:0001583	missense	3690	exon4			TGTGGACAAGCCT		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.552C>A	17.37:g.45361999C>A	ENSP00000452786:p.Asp184Glu	247	0		281	15	NM_000212	0	0	22	24	2	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	37	CCDS11511.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.385128	0.42308	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.98400	-4.91	5.86	4.87	0.63330	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98043	0.9355	M	0.66560	2.04	0.80722	D	1	D;D	0.64830	0.994;0.962	D;D	0.76575	0.988;0.954	D	0.97929	1.0319	10	0.02654	T	1	.	11.3787	0.49743	0.0:0.9067:0.0:0.0933	.	184;184	P05106;Q2YFE1	ITB3_HUMAN;.	E	184;137	ENSP00000407801:D137E	ENSP00000262017:D184E	D	+	3	2	C17orf57	42716998	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.226000	0.32563	1.399000	0.46721	0.655000	0.94253	GAC	.		0.552	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
SPATA20	64847	bcgsc.ca	37	17	48628511	48628511	+	Silent	SNP	C	C	A	rs149572077		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:48628511C>A	ENST00000356488.4	+	11	1571	c.1488C>A	c.(1486-1488)ccC>ccA	p.P496P	SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Silent_p.P512P|SPATA20_ENST00000393244.3_Silent_p.P452P	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	496					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGCATCGGCCCAAGCCGCACC	0.622											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P512P													.	SPATA20-90	0			c.C1536A						.						16.0	15.0	15.0					17																	48628511		2176	4270	6446	SO:0001819	synonymous_variant	64847	exon12			TCGGCCCAAGCCG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1488C>A	17.37:g.48628511C>A		59	0	119	26	7	NM_022827	0	0	43	44	1	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																			.		0.622	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
HELZ	9931	hgsc.bcm.edu	37	17	65212033	65212033	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:65212033C>G	ENST00000358691.5	-	5	395	c.229G>C	c.(229-231)Gat>Cat	p.D77H	HELZ_ENST00000580662.1_5'UTR|HELZ_ENST00000580168.1_Missense_Mutation_p.D77H	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	77						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CAATCTTCATCAGCTTGCACA	0.284																																					p.D77H		.											.	HELZ-92	0			c.G229C						.						61.0	57.0	59.0					17																	65212033		1805	4071	5876	SO:0001583	missense	9931	exon5			CTTCATCAGCTTG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.229G>C	17.37:g.65212033C>G	ENSP00000351524:p.Asp77His	9	0		32	2	NM_014877	0	0	3	3	0	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324423	0.41197	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	T;T	0.73681	-0.77;-0.77	4.86	4.86	0.63082	.	0.046573	0.85682	D	0.000000	T	0.80193	0.4578	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.999;0.992;1.0	D;P;D	0.81914	0.995;0.863;0.993	T	0.82690	-0.0332	10	0.62326	D	0.03	-7.5014	18.0445	0.89328	0.0:1.0:0.0:0.0	.	77;77;77	B7ZLW2;F8WBX6;P42694	.;.;HELZ_HUMAN	H	77	ENSP00000351524:D77H;ENSP00000411144:D77H	ENSP00000351524:D77H	D	-	1	0	HELZ	62642495	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.757000	0.74924	2.260000	0.74910	0.539000	0.68188	GAT	.		0.284	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
FADS6	283985	hgsc.bcm.edu	37	17	72878831	72878831	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:72878831C>G	ENST00000310226.6	-	3	381	c.367G>C	c.(367-369)Gcc>Ccc	p.A123P		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	129					fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					GCAGTGAAGGCTGTGCACACC	0.612																																					p.A123P		.											.	FADS6-22	0			c.G367C						.						55.0	58.0	57.0					17																	72878831		2175	4273	6448	SO:0001583	missense	283985	exon3			TGAAGGCTGTGCA	AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.367G>C	17.37:g.72878831C>G	ENSP00000307821:p.Ala123Pro	20	0		34	2	NM_178128	0	0	0	0	0	Q17RQ7|Q6XYE1	Missense_Mutation	SNP	ENST00000310226.6	37	CCDS54163.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.03|16.03	3.006645|3.006645	0.54361|0.54361	.|.	.|.	ENSG00000172782|ENSG00000172782	ENST00000310226|ENST00000413142	T|.	0.17054|.	2.3|.	5.26|5.26	-3.94|-3.94	0.04130|0.04130	Fatty acid desaturase, type 1 (1);|.	0.512064|.	0.21539|.	N|.	0.072933|.	T|T	0.41627|0.41627	0.1167|0.1167	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	P|B	0.50819|0.02656	0.939|0.0	P|B	0.55455|0.04013	0.776|0.001	T|T	0.42565|0.42565	-0.9444|-0.9444	10|8	0.46703|0.54805	T|T	0.11|0.06	-26.0152|-26.0152	13.8207|13.8207	0.63318|0.63318	0.5539:0.386:0.0:0.0601|0.5539:0.386:0.0:0.0601	.|.	129|39	Q8N9I5|B4DEP0	FADS6_HUMAN|.	P|H	123|39	ENSP00000307821:A123P|.	ENSP00000307821:A123P|ENSP00000396743:Q39H	A|Q	-|-	1|3	0|2	FADS6|FADS6	70390426|70390426	0.059000|0.059000	0.20769|0.20769	0.064000|0.064000	0.19789|0.19789	0.030000|0.030000	0.12068|0.12068	0.551000|0.551000	0.23361|0.23361	-0.693000|-0.693000	0.05121|0.05121	-0.797000|-0.797000	0.03246|0.03246	GCC|CAG	.		0.612	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1		
FOXK2	3607	hgsc.bcm.edu	37	17	80559303	80559303	+	Silent	SNP	C	C	A	rs201366286		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:80559303C>A	ENST00000335255.5	+	9	2085	c.1911C>A	c.(1909-1911)ggC>ggA	p.G637G	RP13-638C3.4_ENST00000576912.1_RNA|FOXK2_ENST00000529652.1_3'UTR	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	637					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			CAGAAGACGGCGAGGGCATCG	0.607																																					p.G637G		.											.	FOXK2-226	0			c.C1911A						.						59.0	51.0	54.0					17																	80559303		2203	4300	6503	SO:0001819	synonymous_variant	3607	exon9			AGACGGCGAGGGC	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1911C>A	17.37:g.80559303C>A		84	0		60	3	NM_004514	0	0	14	14	0	A6NEP5|Q13622|Q13623|Q13624	Silent	SNP	ENST00000335255.5	37	CCDS11813.1																																																																																			C|0.999;T|0.001		0.607	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430	
POTEC	388468	bcgsc.ca	37	18	14533088	14533088	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr18:14533088C>T	ENST00000358970.5	-	5	1026	c.1027G>A	c.(1027-1029)Gag>Aag	p.E343K	RNU6-1021P_ENST00000363262.1_RNA|POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	343										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						ACAGCATACTCTCTGGCCGTC	0.353																																					p.E343K													.	POTEC-3	0			c.G1027A						.																																			SO:0001583	missense	388468	exon5			CATACTCTCTGGC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1027G>A	18.37:g.14533088C>T	ENSP00000351856:p.Glu343Lys	308	0		400	49	NM_001137671	0	0	0	0	0		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	C	3.226	-0.158502	0.06544	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.63913	-0.07	1.09	1.09	0.20402	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.46464	0.1394	L	0.41415	1.275	0.09310	N	1	P	0.43938	0.822	B	0.37550	0.253	T	0.38045	-0.9679	9	0.52906	T	0.07	.	5.5934	0.17313	0.0:1.0:0.0:0.0	.	343	B2RU33	POTEC_HUMAN	K	343	ENSP00000351856:E343K	ENSP00000351856:E343K	E	-	1	0	POTEC	14523088	0.002000	0.14202	0.018000	0.16275	0.080000	0.17528	0.255000	0.18333	0.927000	0.37143	0.194000	0.17425	GAG	.		0.353	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
SBNO2	22904	hgsc.bcm.edu	37	19	1122146	1122146	+	Missense_Mutation	SNP	C	C	G	rs192343149	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:1122146C>G	ENST00000361757.3	-	11	1378	c.1141G>C	c.(1141-1143)Gag>Cag	p.E381Q	SBNO2_ENST00000587024.1_Missense_Mutation_p.E381Q|SBNO2_ENST00000438103.2_Missense_Mutation_p.E324Q	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	381					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGACGCCCTCGAAGGCCTCC	0.677													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		15103	0.0		0.002	False		,,,				2504	0.0				p.E381Q		.											.	.	0			c.G1141C						.	C	GLN/GLU,GLN/GLU	1,4079		0,1,2039	17.0	20.0	19.0		970,1141	3.5	0.9	19		19	22,8226		0,22,4102	yes	missense,missense	SBNO2	NM_001100122.1,NM_014963.2	29,29	0,23,6141	GG,GC,CC		0.2667,0.0245,0.1866	benign,benign	324/1310,381/1367	1122146	23,12305	2040	4124	6164	SO:0001583	missense	22904	exon11			CGCCCTCGAAGGC	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1141G>C	19.37:g.1122146C>G	ENSP00000354733:p.Glu381Gln	3	1		5	2	NM_014963	0	0	0	0	0	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	19.33	3.806906	0.70797	2.45E-4	0.002667	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.93307	-3.2;-3.2	3.5	3.5	0.40072	.	0.056732	0.64402	D	0.000001	D	0.92296	0.7556	L	0.46157	1.445	0.45076	D	0.998091	P;B;P;P	0.42908	0.793;0.023;0.793;0.754	P;B;B;B	0.47075	0.536;0.08;0.433;0.306	D	0.93015	0.6435	10	0.59425	D	0.04	-18.1776	14.5373	0.67969	0.0:1.0:0.0:0.0	.	324;381;381;324	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	Q	381;324;405	ENSP00000354733:E381Q;ENSP00000400762:E324Q	ENSP00000250872:E405Q	E	-	1	0	SBNO2	1073146	1.000000	0.71417	0.932000	0.37286	0.907000	0.53573	7.439000	0.80444	1.939000	0.56221	0.561000	0.74099	GAG	C|0.999;G|0.001		0.677	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
DOT1L	84444	hgsc.bcm.edu	37	19	2193778	2193778	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:2193778C>T	ENST00000398665.3	+	6	620	c.584C>T	c.(583-585)gCg>gTg	p.A195V		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	195	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAAGTATGCGGAGGTGAGC	0.607																																					p.A195V		.											.	DOT1L-132	0			c.C584T						.						87.0	90.0	89.0					19																	2193778		2179	4268	6447	SO:0001583	missense	84444	exon6			AGTATGCGGAGGT	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.584C>T	19.37:g.2193778C>T	ENSP00000381657:p.Ala195Val	91	0		37	2	NM_032482	0	0	0	0	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817061	0.90790	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000452696	T;T	0.37235	1.21;1.21	4.34	4.34	0.51931	.	0.112447	0.64402	D	0.000012	T	0.68329	0.2989	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.78375	-0.2228	10	0.87932	D	0	-11.0759	15.988	0.80176	0.0:1.0:0.0:0.0	.	195	Q8TEK3-2	.	V	195;195;171	ENSP00000381657:A195V;ENSP00000404284:A171V	ENSP00000221482:A195V	A	+	2	0	DOT1L	2144778	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.528000	0.67129	2.249000	0.74217	0.561000	0.74099	GCG	.		0.607	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
PTPRS	5802	hgsc.bcm.edu	37	19	5220167	5220167	+	Splice_Site	SNP	T	T	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:5220167T>A	ENST00000587303.1	-	21	3649		c.e21-2		PTPRS_ENST00000357368.4_Splice_Site|PTPRS_ENST00000592099.1_Splice_Site|PTPRS_ENST00000372412.4_Splice_Site|PTPRS_ENST00000348075.2_Splice_Site|PTPRS_ENST00000353284.2_Splice_Site|PTPRS_ENST00000588012.1_Splice_Site|PTPRS_ENST00000262963.6_Splice_Site|PTPRS_ENST00000588552.1_Splice_Site			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S						cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CTGGATGAGCTGCGGGAACAG	0.632																																					.		.											.	PTPRS-357	0			c.3550-2A>T						.						25.0	27.0	26.0					19																	5220167		2203	4300	6503	SO:0001630	splice_region_variant	5802	exon23			ATGAGCTGCGGGA	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.3550-2A>T	19.37:g.5220167T>A		42	0		41	3	NM_002850	0	0	0	0	0	O75255|O75870|Q15718|Q16341|Q2M3R7	Splice_Site	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.150456	0.57151	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	.	.	.	3.75	3.75	0.43078	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6563	0.56790	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRS	5171167	1.000000	0.71417	0.947000	0.38551	0.648000	0.38561	6.953000	0.75995	1.583000	0.49898	0.533000	0.62120	.	.		0.632	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		Intron
DNMT1	1786	bcgsc.ca	37	19	10270719	10270719	+	Missense_Mutation	SNP	C	C	G	rs201945078		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:10270719C>G	ENST00000340748.4	-	14	1251	c.1016G>C	c.(1015-1017)cGc>cCc	p.R339P	DNMT1_ENST00000540357.1_Missense_Mutation_p.R339P|DNMT1_ENST00000359526.4_Missense_Mutation_p.R355P			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	339	DNA replication foci-targeting sequence. {ECO:0000250}.|Homodimerization.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R339P(2)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	TGTTTTGGCGCGAGCCATTTT	0.478																																					p.R355P													.	DNMT1-660	2	Substitution - Missense(2)	prostate(2)	c.G1064C						.						66.0	78.0	74.0					19																	10270719		2202	4300	6502	SO:0001583	missense	1786	exon15			TTGGCGCGAGCCA	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.1016G>C	19.37:g.10270719C>G	ENSP00000345739:p.Arg339Pro	186	1		133	29	NM_001130823	0	0	5	5	0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525134	0.27299	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.80393	-1.37;1.54;1.54	3.95	0.695	0.18070	.	0.911290	0.09314	N	0.819141	T	0.64638	0.2616	N	0.22421	0.69	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.001;0.004;0.0	T	0.47787	-0.9090	10	0.25106	T	0.35	.	5.6138	0.17420	0.0:0.639:0.0:0.361	.	339;355;339	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	P	355;339;339;207	ENSP00000352516:R355P;ENSP00000440457:R339P;ENSP00000345739:R339P	ENSP00000345739:R339P	R	-	2	0	DNMT1	10131719	0.095000	0.21747	0.032000	0.17829	0.368000	0.29767	0.288000	0.18939	0.251000	0.21505	0.650000	0.86243	CGC	.		0.478	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
CDC37	11140	bcgsc.ca	37	19	10506724	10506724	+	Silent	SNP	G	G	C	rs140896014	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:10506724G>C	ENST00000222005.2	-	2	311	c.258C>G	c.(256-258)gcC>gcG	p.A86A		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	86					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GCTGTGCCTCGGCCTGCAGGC	0.657																																					p.A86A													.	CDC37-522	0			c.C258G						.						104.0	98.0	100.0					19																	10506724		2203	4300	6503	SO:0001819	synonymous_variant	11140	exon2			TGCCTCGGCCTGC	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.258C>G	19.37:g.10506724G>C		222	1		170	50	NM_007065	0	0	81	82	1	Q53YA2	Silent	SNP	ENST00000222005.2	37	CCDS12237.1																																																																																			G|0.999;A|0.001		0.657	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
C19orf44	84167	bcgsc.ca	37	19	16614154	16614154	+	Missense_Mutation	SNP	C	C	G	rs202132782		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:16614154C>G	ENST00000221671.3	+	3	1194	c.1038C>G	c.(1036-1038)gaC>gaG	p.D346E	C19orf44_ENST00000594035.1_Missense_Mutation_p.D346E|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	346										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AGACTGTGGACGAGCCAGTCT	0.557																																					p.D346E													.	C19orf44-90	0			c.C1038G						.						56.0	56.0	56.0					19																	16614154		2203	4300	6503	SO:0001583	missense	84167	exon3			TGTGGACGAGCCA	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1038C>G	19.37:g.16614154C>G	ENSP00000221671:p.Asp346Glu	115	2		67	30	NM_032207	0	0	1	1	0	Q8N6Y7	Missense_Mutation	SNP	ENST00000221671.3	37	CCDS12345.1	.	.	.	.	.	.	.	.	.	.	C	0.379	-0.929661	0.02359	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.66	-9.33	0.00639	.	0.774565	0.11603	N	0.547535	T	0.12475	0.0303	N	0.21097	0.63	0.09310	N	1	B;B;B	0.19583	0.017;0.037;0.033	B;B;B	0.20384	0.016;0.019;0.029	T	0.34900	-0.9810	9	0.02654	T	1	0.0565	2.6963	0.05136	0.1427:0.2354:0.1275:0.4944	.	346;19;346	Q9H6X5;B4DN63;Q9H6X5-2	CS044_HUMAN;.;.	E	346	.	ENSP00000221671:D346E	D	+	3	2	C19orf44	16475154	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.817000	0.00751	-2.754000	0.00373	-2.167000	0.00324	GAC	.		0.557	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207	
GDF15	9518	bcgsc.ca	37	19	18499106	18499106	+	Silent	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:18499106A>G	ENST00000252809.3	+	2	320	c.288A>G	c.(286-288)ggA>ggG	p.G96G	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	96					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						TGCGGCTGGGATCCGGCGGCC	0.667											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G96G													.	GDF15-650	0			c.A288G						.						20.0	24.0	23.0					19																	18499106		2178	4275	6453	SO:0001819	synonymous_variant	9518	exon2			GCTGGGATCCGGC	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.288A>G	19.37:g.18499106A>G		96	0	726	55	13	NM_004864	0	0	1	1	0	O14629|P78360|Q9BWA0|Q9NRT0	Silent	SNP	ENST00000252809.3	37	CCDS12376.1																																																																																			.		0.667	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
PHLDB3	653583	hgsc.bcm.edu	37	19	43991217	43991217	+	Missense_Mutation	SNP	C	C	T	rs138387298	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:43991217C>T	ENST00000292140.5	-	10	1568	c.1208G>A	c.(1207-1209)aGc>aAc	p.S403N		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	403							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TCCTCTCTGGCTCCCCCTCTC	0.582													C|||	28	0.00559105	0.0	0.0058	5008	,	,		15086	0.0		0.004	False		,,,				2504	0.0204				p.S403N		.											.	PHLDB3-68	0			c.G1208A						.	C	ASN/SER	5,3761		0,5,1878	13.0	15.0	14.0		1208	2.2	0.6	19	dbSNP_134	14	58,8136		0,58,4039	yes	missense	PHLDB3	NM_198850.3	46	0,63,5917	TT,TC,CC		0.7078,0.1328,0.5268	possibly-damaging	403/641	43991217	63,11897	1883	4097	5980	SO:0001583	missense	653583	exon10			CTCTGGCTCCCCC		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1208G>A	19.37:g.43991217C>T	ENSP00000292140:p.Ser403Asn	3	2		11	4	NM_198850	0	0	0	0	0	Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	CCDS12621.2	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	0	0.0	3	0.00395778364116095	C	11.07	1.530742	0.27387	0.001328	0.007078	ENSG00000176531	ENST00000292140	T	0.46819	0.86	4.47	2.25	0.28309	.	.	.	.	.	T	0.25938	0.0632	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.31318	0.319;0.01	B;B	0.31751	0.135;0.002	T	0.20174	-1.0283	9	0.56958	D	0.05	.	6.1303	0.20201	0.0:0.703:0.1911:0.1059	.	107;403	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	N	403	ENSP00000292140:S403N	ENSP00000292140:S403N	S	-	2	0	PHLDB3	48683057	0.980000	0.34600	0.609000	0.28983	0.559000	0.35586	1.647000	0.37260	0.421000	0.25980	0.281000	0.19383	AGC	C|0.997;T|0.003		0.582	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2		
PVRL2	5819	bcgsc.ca	37	19	45381871	45381871	+	Intron	SNP	T	T	C	rs199691943		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:45381871T>C	ENST00000252483.5	+	6	1042				PVRL2_ENST00000252485.4_Silent_p.Y478Y	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		GGGCAGTTTATGTGTGACCTG	0.627																																					p.Y478Y													.	PVRL2-90	0			c.T1434C						.						42.0	40.0	40.0					19																	45381871		2203	4297	6500	SO:0001627	intron_variant	5819	exon6			AGTTTATGTGTGA	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1043-3597T>C	19.37:g.45381871T>C		63	0		74	5	NM_002856	0	0	29	29	0	A8K5L5|O75455|Q6IBI6|Q96J29	Silent	SNP	ENST00000252483.5	37	CCDS42576.1																																																																																			T|0.999;C|0.001		0.627	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
AP2A1	160	broad.mit.edu	37	19	50305818	50305818	+	Silent	SNP	C	C	T	rs200480269	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:50305818C>T	ENST00000359032.5	+	16	2142	c.2142C>T	c.(2140-2142)agC>agT	p.S714S	AP2A1_ENST00000354293.5_Intron	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	714					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCCCCGAGAGCCCCATGGCTT	0.667													C|||	3	0.000599042	0.0	0.0029	5008	,	,		10699	0.0		0.0	False		,,,				2504	0.001				p.S714S													.	AP2A1-92	0			c.C2142T						.	C	,	1,3771		0,1,1885	13.0	14.0	14.0		2142,	5.1	1.0	19		14	13,8155		0,13,4071	no	coding-synonymous,intron	AP2A1	NM_014203.2,NM_130787.2	,	0,14,5956	TT,TC,CC		0.1592,0.0265,0.1173	,	714/978,	50305818	14,11926	1886	4084	5970	SO:0001819	synonymous_variant	160	exon16			CGAGAGCCCCATG	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.2142C>T	19.37:g.50305818C>T		30	0		20	3	NM_014203	0	0	0	0	0	Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	37	CCDS46148.1																																																																																			C|1.000;T|0.000		0.667	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
PNKP	11284	bcgsc.ca	37	19	50370425	50370425	+	Missense_Mutation	SNP	C	C	G	rs201218221|rs371086920		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:50370425C>G	ENST00000322344.3	-	2	146	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	PNKP_ENST00000600573.1_Missense_Mutation_p.E13Q|PNKP_ENST00000595792.1_5'UTR|PNKP_ENST00000596014.1_Missense_Mutation_p.E13Q|PNKP_ENST00000600910.1_Missense_Mutation_p.E13Q	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	13	FHA.				dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		GGGGGGCTCTCGAGCCACAAG	0.711								Other BER factors																													p.E13Q													.	PNKP-253	0			c.G37C						.						9.0	12.0	11.0					19																	50370425		2019	4021	6040	SO:0001583	missense	11284	exon2			GGCTCTCGAGCCA	AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.37G>C	19.37:g.50370425C>G	ENSP00000323511:p.Glu13Gln	65	1		40	24	NM_007254	0	0	10	10	0	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Missense_Mutation	SNP	ENST00000322344.3	37	CCDS12783.1	.	.	.	.	.	.	.	.	.	.	C	3.736	-0.054620	0.07362	.	.	ENSG00000039650	ENST00000322344	T	0.23147	1.92	5.58	3.2	0.36748	SMAD/FHA domain (1);	0.404404	0.25099	N	0.033157	T	0.15219	0.0367	N	0.19112	0.55	0.22468	N	0.999075	B	0.11235	0.004	B	0.04013	0.001	T	0.18777	-1.0326	10	0.12766	T	0.61	-38.1299	13.2167	0.59865	0.0:0.6623:0.3377:0.0	.	13	Q96T60	PNKP_HUMAN	Q	13	ENSP00000323511:E13Q	ENSP00000323511:E13Q	E	-	1	0	PNKP	55062237	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	1.873000	0.39558	1.312000	0.45043	0.655000	0.94253	GAG	.		0.711	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1	NM_007254	
ZSCAN18	65982	bcgsc.ca	37	19	58600106	58600106	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:58600106T>G	ENST00000240727.6	-	3	901	c.502A>C	c.(502-504)Agc>Cgc	p.S168R	ZSCAN18_ENST00000600404.1_Missense_Mutation_p.S224R|ZSCAN18_ENST00000421612.2_Missense_Mutation_p.S33R|ZSCAN18_ENST00000601144.1_Missense_Mutation_p.S168R	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	168					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TGGCTGGGGCTCGCGAGCTCG	0.647																																					p.S224R													.	ZSCAN18-90	0			c.A670C						.						29.0	29.0	29.0					19																	58600106		2203	4298	6501	SO:0001583	missense	65982	exon3			TGGGGCTCGCGAG	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.502A>C	19.37:g.58600106T>G	ENSP00000240727:p.Ser168Arg	89	1		55	26	NM_001145542	0	0	8	8	0	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Missense_Mutation	SNP	ENST00000240727.6	37	CCDS12971.1	.	.	.	.	.	.	.	.	.	.	T	0.455	-0.891769	0.02491	.	.	ENSG00000121413	ENST00000433686;ENST00000240727;ENST00000421612	T;T	0.03272	4.62;3.99	2.43	2.43	0.29744	.	.	.	.	.	T	0.04003	0.0112	N	0.12182	0.205	0.09310	N	1	B;B;B;B;D	0.67145	0.039;0.068;0.001;0.008;0.996	B;B;B;B;P	0.53649	0.018;0.044;0.0;0.022;0.731	T	0.48958	-0.8988	9	0.34782	T	0.22	-1.6031	6.787	0.23679	0.0:0.0:0.0:1.0	.	224;33;238;168;168	B4DG23;E9PBI0;Q6ZMK6;Q8TBC5-2;Q8TBC5	.;.;.;.;ZSC18_HUMAN	R	224;168;33	ENSP00000240727:S168R;ENSP00000392653:S33R	ENSP00000240727:S168R	S	-	1	0	ZSCAN18	63291918	0.002000	0.14202	0.019000	0.16419	0.053000	0.15095	0.721000	0.25911	1.375000	0.46248	0.459000	0.35465	AGC	.		0.647	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
PLB1	151056	hgsc.bcm.edu	37	2	28772929	28772929	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:28772929A>G	ENST00000327757.5	+	16	1105	c.1061A>G	c.(1060-1062)cAg>cGg	p.Q354R	PLB1_ENST00000422425.2_Missense_Mutation_p.Q365R|PLB1_ENST00000329020.6_Missense_Mutation_p.Q42R	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	354	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					ACCAGACTGCAGAAACCCCAA	0.463																																					p.Q365R		.											.	PLB1-141	0			c.A1094G						.						89.0	77.0	81.0					2																	28772929		2203	4300	6503	SO:0001583	missense	151056	exon16			GACTGCAGAAACC		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1061A>G	2.37:g.28772929A>G	ENSP00000330442:p.Gln354Arg	40	0		33	2	NM_001170585	0	0	0	0	0	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.653|5.653	0.305110|0.305110	0.10678|0.10678	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020|ENST00000404858	T;T;T;T|.	0.11821|.	2.74;2.74;2.74;2.75|.	4.83|4.83	-9.66|-9.66	0.00534|0.00534	.|.	2.571820|.	0.01222|.	N|.	0.008128|.	T|T	0.11067|0.11067	0.0270|0.0270	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.25272|.	0.122;0.046;0.002|.	B;B;B|.	0.34824|.	0.19;0.011;0.008|.	T|T	0.14172|0.14172	-1.0482|-1.0482	10|5	0.15952|.	T|.	0.53|.	13.3363|13.3363	2.0146|2.0146	0.03495|0.03495	0.4036:0.1057:0.0955:0.3951|0.4036:0.1057:0.0955:0.3951	.|.	365;42;354|.	Q6P1J6-3;Q6P1J6-2;Q6P1J6|.	.;.;PLB1_HUMAN|.	R|G	354;365;64;42|364	ENSP00000330442:Q354R;ENSP00000416440:Q365R;ENSP00000392493:Q64R;ENSP00000330729:Q42R|.	ENSP00000330442:Q354R|.	Q|R	+|+	2|1	0|2	PLB1|PLB1	28626433|28626433	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.013000|0.013000	0.08279|0.08279	-2.790000|-2.790000	0.00767|0.00767	-1.769000|-1.769000	0.01297|0.01297	-0.396000|-0.396000	0.06452|0.06452	CAG|AGA	.		0.463	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
GALM	130589	bcgsc.ca	37	2	38908566	38908566	+	Missense_Mutation	SNP	C	C	A	rs74917735		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:38908566C>A	ENST00000272252.5	+	3	742	c.490C>A	c.(490-492)Caa>Aaa	p.Q164K	GALM_ENST00000410063.1_Intron	NM_138801.2	NP_620156.1	Q96C23	GALM_HUMAN	galactose mutarotase (aldose 1-epimerase)	164					galactose metabolic process (GO:0006012)|glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldose 1-epimerase activity (GO:0004034)|carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	14		all_hematologic(82;0.248)				CTACAGAGCACAAGCCAGTCA	0.512																																					p.Q164K													.	GALM-90	0			c.C490A						.																																			SO:0001583	missense	130589	exon3			AGAGCACAAGCCA		CCDS1797.1	2p22.3	2008-02-05			ENSG00000143891	ENSG00000143891			24063	protein-coding gene	gene with protein product	"""aldose 1 epimerase"""	608883				12753898	Standard	NM_138801		Approved		uc002rqy.3	Q96C23	OTTHUMG00000102077	ENST00000272252.5:c.490C>A	2.37:g.38908566C>A	ENSP00000272252:p.Gln164Lys	180	1		130	41	NM_138801	0	0	100	106	6	Q53RY1|Q8NIA2|V9HWA8	Missense_Mutation	SNP	ENST00000272252.5	37	CCDS1797.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978033	0.53720	.	.	ENSG00000143891	ENST00000272252;ENST00000434934	T;T	0.38722	1.12;1.12	5.4	5.4	0.78164	Glycoside hydrolase-type carbohydrate-binding, subgroup (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.065779	0.64402	D	0.000004	T	0.30386	0.0763	N	0.16602	0.42	0.80722	D	1	B	0.30193	0.272	B	0.24155	0.051	T	0.06789	-1.0807	10	0.39692	T	0.17	-18.4737	19.1893	0.93658	0.0:1.0:0.0:0.0	.	164	Q96C23	GALM_HUMAN	K	164;44	ENSP00000272252:Q164K;ENSP00000399473:Q44K	ENSP00000272252:Q164K	Q	+	1	0	GALM	38762070	0.999000	0.42202	0.997000	0.53966	0.572000	0.35998	4.169000	0.58223	2.527000	0.85204	0.561000	0.74099	CAA	.		0.512	GALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219891.2	NM_138801	
ABCG5	64240	hgsc.bcm.edu	37	2	44049984	44049984	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:44049984A>G	ENST00000260645.1	-	10	1554	c.1415T>C	c.(1414-1416)cTc>cCc	p.L472P	ABCG5_ENST00000543989.1_Missense_Mutation_p.L77P|ABCG5_ENST00000405322.1_Missense_Mutation_p.L301P	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	472	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	GCTGAAGGGGAGGACGTGCAG	0.597																																					p.L472P		.											.	ABCG5-92	0			c.T1415C						.						111.0	78.0	89.0					2																	44049984		2203	4300	6503	SO:0001583	missense	64240	exon10			AAGGGGAGGACGT	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1415T>C	2.37:g.44049984A>G	ENSP00000260645:p.Leu472Pro	56	0		51	3	NM_022436	0	0	0	0	0	Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	a	14.70	2.613097	0.46631	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	T;T;T	0.74947	-0.89;-0.89;-0.89	4.9	4.9	0.64082	ABC-2 type transporter (1);	2.503810	0.01622	N	0.023076	D	0.87931	0.6302	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.99	T	0.72174	-0.4370	10	0.87932	D	0	.	14.347	0.66672	1.0:0.0:0.0:0.0	.	301;472	E7EX35;Q9H222	.;ABCG5_HUMAN	P	472;301;77	ENSP00000260645:L472P;ENSP00000384513:L301P;ENSP00000445107:L77P	ENSP00000260645:L472P	L	-	2	0	ABCG5	43903488	1.000000	0.71417	0.159000	0.22649	0.049000	0.14656	8.648000	0.91062	2.038000	0.60285	0.456000	0.33151	CTC	.		0.597	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436	
ANKRD30BL	554226	bcgsc.ca	37	2	133014537	133014537	+	Intron	SNP	G	G	C	rs202204698		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:133014537G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCGGCTCGGGGAGAAACCTCA	0.721																																					.													.	.	0			.						.						13.0	23.0	20.0					2																	133014537		1544	3553	5097	SO:0001627	intron_variant	554226	.			CTCGGGGAGAAAC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+564C>G	2.37:g.133014537G>C		50	1		43	8	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.994;C|0.006		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
SLC16A14	151473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	230910735	230910735	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:230910735G>A	ENST00000295190.4	-	4	1565	c.1107C>T	c.(1105-1107)atC>atT	p.I369I		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	369						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.I369I(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TGACGCCCAGGATCACTTTTC	0.433																																					p.I369I		.											.	SLC16A14-96	1	Substitution - coding silent(1)	ovary(1)	c.C1107T						.						98.0	87.0	91.0					2																	230910735		2203	4300	6503	SO:0001819	synonymous_variant	151473	exon4			GCCCAGGATCACT	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.1107C>T	2.37:g.230910735G>A		101	1		105	23	NM_152527	0	0	0	1	1	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1																																																																																			.		0.433	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
AGAP1	116987	hgsc.bcm.edu	37	2	236839507	236839507	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:236839507G>A	ENST00000304032.8	+	12	2003	c.1423G>A	c.(1423-1425)Gtc>Atc	p.V475I	AGAP1_ENST00000428334.2_Missense_Mutation_p.V314I|AGAP1_ENST00000409538.1_Intron|AGAP1_ENST00000336665.5_Intron	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	475	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTCCTACTCAGTCTCCAGTGC	0.612																																					p.V475I		.											.	AGAP1-93	0			c.G1423A						.						71.0	60.0	63.0					2																	236839507		2203	4300	6503	SO:0001583	missense	116987	exon12			TACTCAGTCTCCA	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1423G>A	2.37:g.236839507G>A	ENSP00000307634:p.Val475Ile	77	0		51	3	NM_001037131	0	0	8	8	0	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.42|16.42	3.117268|3.117268	0.56505|0.56505	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000448025|ENST00000304032;ENST00000428334	T|T;T	0.76709|0.77358	-1.04|-1.09;-1.09	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Pleckstrin homology domain (3);	.|0.420852	.|0.20846	.|N	.|0.084619	D|D	0.84252|0.84252	0.5431|0.5431	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	.|D	.|0.63046	.|0.992	.|D	.|0.77004	.|0.989	T|T	0.79022|0.79022	-0.1973|-0.1973	7|10	0.24483|0.18710	T|T	0.36|0.47	.|.	19.0672|19.0672	0.93116|0.93116	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|475	.|Q9UPQ3	.|AGAP1_HUMAN	N|I	108|475;314	ENSP00000403482:S108N|ENSP00000307634:V475I;ENSP00000411824:V314I	ENSP00000403482:S108N|ENSP00000307634:V475I	S|V	+|+	2|1	0|0	AGAP1|AGAP1	236504246|236504246	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.996000|0.996000	0.88848|0.88848	9.388000|9.388000	0.97237|0.97237	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	AGT|GTC	.		0.612	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
PTPRT	11122	bcgsc.ca	37	20	40710579	40710579	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr20:40710579G>A	ENST00000373187.1	-	30	4214	c.4215C>T	c.(4213-4215)gaC>gaT	p.D1405D	PTPRT_ENST00000373184.1_Silent_p.D1415D|PTPRT_ENST00000373198.4_Silent_p.D1424D|PTPRT_ENST00000356100.2_Silent_p.D1414D|PTPRT_ENST00000373201.1_Silent_p.D1395D|PTPRT_ENST00000373193.3_Silent_p.D1408D|PTPRT_ENST00000373190.1_Silent_p.D1404D			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1405	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGTGGAACACGTCAATGATGT	0.498																																					p.D1424D													.	PTPRT-664	0			c.C4272T						.						185.0	184.0	184.0					20																	40710579		2110	4236	6346	SO:0001819	synonymous_variant	11122	exon31			GAACACGTCAATG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.4215C>T	20.37:g.40710579G>A		88	1		145	7	NM_133170	0	0	0	0	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																			.		0.498	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
RIMS4	140730	bcgsc.ca	37	20	43384935	43384935	+	Missense_Mutation	SNP	C	C	G	rs199569233		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr20:43384935C>G	ENST00000372851.3	-	6	716	c.650G>C	c.(649-651)cGc>cCc	p.R217P	RIMS4_ENST00000541604.2_Missense_Mutation_p.R218P	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	217	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.R217P(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				CAGCAGCACGCGAGCCACACC	0.637																																					p.R218P													.	RIMS4-94	1	Substitution - Missense(1)	large_intestine(1)	c.G653C						.						55.0	48.0	51.0					20																	43384935		2203	4300	6503	SO:0001583	missense	140730	exon6			AGCACGCGAGCCA		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.650G>C	20.37:g.43384935C>G	ENSP00000361942:p.Arg217Pro	82	0		76	32	NM_001205317	0	0	0	0	0	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546798	0.65198	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.79653	-1.29;-1.29	5.07	5.07	0.68467	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.81536	0.4843	L	0.55990	1.75	0.58432	D	0.999998	P;P	0.42375	0.778;0.778	P;P	0.48488	0.579;0.579	D	0.83484	0.0066	10	0.87932	D	0	.	11.9083	0.52725	0.0:0.9205:0.0:0.0795	.	218;217	E1P613;Q9H426	.;RIMS4_HUMAN	P	217;218	ENSP00000361942:R217P;ENSP00000439287:R218P	ENSP00000361942:R217P	R	-	2	0	RIMS4	42818349	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	3.229000	0.51278	2.355000	0.79922	0.655000	0.94253	CGC	.		0.637	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
KCNE2	9992	hgsc.bcm.edu	37	21	35743147	35743147	+	Nonstop_Mutation	SNP	T	T	C	rs45610936		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr21:35743147T>C	ENST00000290310.3	+	2	510	c.370T>C	c.(370-372)Tga>Cga	p.*124R	AP000320.6_ENST00000440403.1_RNA	NM_172201.1	NP_751951.1	Q9Y6J6	KCNE2_HUMAN	potassium voltage-gated channel, Isk-related family, member 2	0					aging (GO:0007568)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular protein localization (GO:0034613)|cellular response to drug (GO:0035690)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|positive regulation of proteasomal protein catabolic process (GO:1901800)|potassium ion export (GO:0071435)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of cyclic nucleotide-gated ion channel activity (GO:1902159)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of inward rectifier potassium channel activity (GO:1901979)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|tongue development (GO:0043586)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|large_intestine(1)	2						AATGTCCCCCTGATAAGGGAG	0.473																																					p.X124R		.											.	KCNE2-68	0			c.T370C						.						36.0	33.0	34.0					21																	35743147		2203	4300	6503	SO:0001578	stop_lost	9992	exon2			TCCCCCTGATAAG	AF071002	CCDS13635.1	21q22.1	2014-09-17			ENSG00000159197	ENSG00000159197		"""Potassium channels"""	6242	protein-coding gene	gene with protein product		603796				10219239	Standard	NM_172201		Approved	MiRP1, LQT6	uc002ytt.1	Q9Y6J6	OTTHUMG00000086189	ENST00000290310.3:c.370T>C	21.37:g.35743147T>C	ENSP00000290310:p.*124Argext*1	55	0		47	3	NM_172201	0	0	2	2	0	A5H1P3|D3DSF8|Q52LJ5	Missense_Mutation	SNP	ENST00000290310.3	37	CCDS13635.1	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869146	0.72065	.	.	ENSG00000159197	ENST00000290310	.	.	.	5.63	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7923	0.18367	0.0:0.0866:0.2254:0.6879	.	.	.	.	R	124	.	.	X	+	1	0	KCNE2	34665017	0.960000	0.32886	0.792000	0.32020	0.672000	0.39443	1.194000	0.32174	2.143000	0.66587	0.529000	0.55759	TGA	.		0.473	KCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194068.2		
BAIAP2L2	80115	ucsc.edu	37	22	38483204	38483204	+	Missense_Mutation	SNP	C	C	T	rs201090429	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr22:38483204C>T	ENST00000381669.3	-	11	1330	c.1186G>A	c.(1186-1188)Gtg>Atg	p.V396M	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	396					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					atgggggtcacgggggtcatg	0.627													C|||	25	0.00499201	0.0068	0.0	5008	,	,		13610	0.003		0.005	False		,,,				2504	0.0082				p.V396M													.	BAIAP2L2-91	0			c.G1186A						.						37.0	45.0	42.0					22																	38483204		1928	4122	6050	SO:0001583	missense	80115	exon11			GGGTCACGGGGGT	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1186G>A	22.37:g.38483204C>T	ENSP00000371085:p.Val396Met	65	0		43	1	NM_025045	0	0	31	31	0	B0QYE2|Q96BG7	Missense_Mutation	SNP	ENST00000381669.3	37	CCDS43018.1	.	.	.	.	.	.	.	.	.	.	C	7.609	0.674489	0.14841	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000428572	T;T	0.21932	1.98;1.98	3.32	-3.36	0.04913	.	1.502590	0.04754	N	0.425150	T	0.11110	0.0271	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33240	-0.9876	10	0.45353	T	0.12	-10.8299	4.4703	0.11708	0.2523:0.4451:0.0:0.3026	.	396	Q6UXY1	BI2L2_HUMAN	M	396;396;87	ENSP00000371085:V396M;ENSP00000410074:V87M	ENSP00000371085:V396M	V	-	1	0	BAIAP2L2	36813150	.	.	0.275000	0.24674	0.069000	0.16628	.	.	-0.339000	0.08401	-1.449000	0.01048	GTG	C|0.997;T|0.003		0.627	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
KCNH8	131096	hgsc.bcm.edu;broad.mit.edu	37	3	19389246	19389246	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:19389246G>A	ENST00000328405.2	+	5	866	c.600G>A	c.(598-600)ccG>ccA	p.P200P	KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	200					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CAGCATTTCCGGAGTATAAAG	0.358																																					p.P200P	NSCLC(124;1625 1765 8018 24930 42026)	.											.	KCNH8-524	0			c.G600A						.						123.0	117.0	119.0					3																	19389246		2203	4300	6503	SO:0001819	synonymous_variant	131096	exon5			ATTTCCGGAGTAT	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.600G>A	3.37:g.19389246G>A		91	0		121	7	NM_144633	0	0	0	0	0	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	CCDS2632.1																																																																																			.		0.358	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376113	113376113	+	Silent	SNP	C	C	T	rs62265537|rs59601191|rs112313093|rs59990801|rs397990842|rs10606566		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:113376113C>T	ENST00000478658.1	-	5	4433	c.4416G>A	c.(4414-4416)caG>caA	p.Q1472Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1472Q			Q68DE3	K2018_HUMAN	KIAA2018	1472	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgctgttgctgctgctgct	0.502																																					p.Q1472Q		.											.	KIAA2018-93	0			c.G4416A						.						68.0	71.0	70.0					3																	113376113		2188	4274	6462	SO:0001819	synonymous_variant	205717	exon7			CTGTTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4416G>A	3.37:g.113376113C>T		34	0		43	4	NM_001009899	0	0	1	1	0	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.502	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
AP2M1	1173	bcgsc.ca	37	3	183898702	183898702	+	Silent	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:183898702T>G	ENST00000292807.5	+	6	643	c.495T>G	c.(493-495)ggT>ggG	p.G165G	AP2M1_ENST00000461733.1_3'UTR|AP2M1_ENST00000411763.2_Silent_p.G190G|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000382456.3_Silent_p.G163G|AP2M1_ENST00000439647.1_Silent_p.G163G	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	165					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGCGAGAGGGTATCAAGTATC	0.532																																					p.G163G													.	AP2M1-90	0			c.T489G						.						131.0	144.0	140.0					3																	183898702		2052	4189	6241	SO:0001819	synonymous_variant	1173	exon5			AGAGGGTATCAAG	U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.495T>G	3.37:g.183898702T>G		306	3		288	71	NM_001025205	1	1	221	237	14	A6NE12|D3DNT1|P20172|P53679	Silent	SNP	ENST00000292807.5	37	CCDS43177.1																																																																																			.		0.532	AP2M1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346013.1	NM_004068	
KIAA0226	9711	bcgsc.ca	37	3	197410204	197410204	+	Missense_Mutation	SNP	C	C	A	rs80094312		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:197410204C>A	ENST00000296343.5	-	13	1953	c.1954G>T	c.(1954-1956)Gtc>Ttc	p.V652F	KIAA0226_ENST00000273582.5_Missense_Mutation_p.V607F|KIAA0226_ENST00000389665.5_Missense_Mutation_p.V677F	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	652					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TGCTCCGGGACAAGCCACTCC	0.597																																					p.V652F	Esophageal Squamous(3;167 355 3763 15924)												.	KIAA0226-22	0			c.G1954T						.						56.0	63.0	61.0					3																	197410204		1978	4151	6129	SO:0001583	missense	9711	exon13			CCGGGACAAGCCA	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.1954G>T	3.37:g.197410204C>A	ENSP00000296343:p.Val652Phe	132	8		104	50	NM_014687	0	0	0	0	0	Q96CK5	Missense_Mutation	SNP	ENST00000296343.5	37	CCDS43195.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	20.2|20.2|20.2	3.946469|3.946469|3.946469	0.73672|0.73672|0.73672	.|.|.	.|.|.	ENSG00000145016|ENSG00000145016|ENSG00000145016	ENST00000413360|ENST00000415452|ENST00000273582;ENST00000296343;ENST00000389665	.|T|T;T;T	.|0.47869|0.48522	.|0.83|0.81;0.81;0.81	5.46|5.46|5.46	5.46|5.46|5.46	0.80206|0.80206|0.80206	.|.|.	.|.|0.147664	.|.|0.45126	.|.|D	.|.|0.000400	T|T|T	0.70544|0.70544|0.70544	0.3236|0.3236|0.3236	M|M|M	0.74467|0.74467|0.74467	2.265|2.265|2.265	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D	.|.|0.89917	.|.|1.0;1.0;1.0	.|.|D;D;D	.|.|0.80764	.|.|0.992;0.994;0.99	T|T|T	0.73585|0.73585|0.73585	-0.3936|-0.3936|-0.3936	5|6|10	.|.|0.87932	.|.|D	.|.|0	.|.|.	19.2993|19.2993|19.2993	0.94136|0.94136|0.94136	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|677;607;652	.|.|Q92622-3;Q92622-2;Q92622	.|.|.;.;RUBIC_HUMAN	F|F|F	613|435|607;652;677	.|ENSP00000409618:L435F|ENSP00000273582:V607F;ENSP00000296343:V652F;ENSP00000374316:V677F	.|.|ENSP00000273582:V607F	C|L|V	-|-|-	2|3|1	0|2|0	KIAA0226|KIAA0226|KIAA0226	198894601|198894601|198894601	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.931000|0.931000|0.931000	0.37212|0.37212|0.37212	0.101000|0.101000|0.101000	0.19017|0.19017|0.19017	7.783000|7.783000|7.783000	0.85696|0.85696|0.85696	2.580000|2.580000|2.580000	0.87095|0.87095|0.87095	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	TGT|TTG|GTC	C|0.999;A|0.001		0.597	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
LMLN	89782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	197687183	197687183	+	Missense_Mutation	SNP	T	T	A	rs375365578		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:197687183T>A	ENST00000330198.4	+	1	113	c.91T>A	c.(91-93)Tgg>Agg	p.W31R	LMLN_ENST00000420910.2_Missense_Mutation_p.W31R|IQCG_ENST00000480302.1_5'Flank|LMLN_ENST00000482695.1_Missense_Mutation_p.L19Q|LMLN_ENST00000332636.5_Missense_Mutation_p.L19Q|IQCG_ENST00000265239.6_5'Flank	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	31					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CCGGTGGCGCTGGAGCGGGTC	0.687																																					p.W31R		.											.	LMLN-91	0			c.T91A						.	T	ARG/TRP,ARG/TRP	1,4405	2.1+/-5.4	0,1,2202	30.0	36.0	34.0		91,91	-0.9	0.0	3		34	0,8596		0,0,4298	no	missense,missense	LMLN	NM_033029.3,NM_001136049.2	101,101	0,1,6500	AA,AT,TT		0.0,0.0227,0.0077	benign,benign	31/656,31/693	197687183	1,13001	2203	4298	6501	SO:0001583	missense	89782	exon1			TGGCGCTGGAGCG	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.91T>A	3.37:g.197687183T>A	ENSP00000328829:p.Trp31Arg	136	0		97	19	NM_001136049	0	0	1	1	0	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	37	CCDS3332.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.21|12.21	1.869215|1.869215	0.32977|0.32977	2.27E-4|2.27E-4	0.0|0.0	ENSG00000185621|ENSG00000185621	ENST00000482695;ENST00000332636|ENST00000330198;ENST00000420910	T;T|T;T	0.47528|0.41400	0.85;0.84|1.01;1.0	4.02|4.02	-0.95|-0.95	0.10372|0.10372	.|.	.|0.745603	.|0.11975	.|N	.|0.511342	T|T	0.22322|0.22322	0.0538|0.0538	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|B;B	0.24963|0.02656	0.115;0.115|0.0;0.0	B;B|B;B	0.28709|0.04013	0.093;0.093|0.0;0.001	T|T	0.24512|0.24512	-1.0158|-1.0158	9|10	0.13853|0.18276	T|T	0.58|0.48	-0.5349|-0.5349	7.0655|7.0655	0.25149|0.25149	0.0:0.4606:0.0:0.5394|0.0:0.4606:0.0:0.5394	.|.	19;19|31;31	F8WCE5;Q96KR4-2|Q96KR4;F8WB28	.;.|LMLN_HUMAN;.	Q|R	19|31	ENSP00000418324:L19Q;ENSP00000328611:L19Q|ENSP00000328829:W31R;ENSP00000410926:W31R	ENSP00000328611:L19Q|ENSP00000328829:W31R	L|W	+|+	2|1	0|0	LMLN|LMLN	199171580|199171580	0.031000|0.031000	0.19500|0.19500	0.003000|0.003000	0.11579|0.11579	0.735000|0.735000	0.41995|0.41995	0.079000|0.079000	0.14782|0.14782	-0.032000|-0.032000	0.13758|0.13758	0.374000|0.374000	0.22700|0.22700	CTG|TGG	.		0.687	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
ANAPC4	29945	bcgsc.ca	37	4	25398292	25398292	+	Silent	SNP	G	G	C	rs34015658	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr4:25398292G>C	ENST00000315368.3	+	15	1210	c.1068G>C	c.(1066-1068)tcG>tcC	p.S356S	ANAPC4_ENST00000510092.1_Silent_p.S356S	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	356					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				ATAGTGGCTCGGAGTCTTTAT	0.358																																					p.S356S													.	ANAPC4-293	0			c.G1068C						.						74.0	80.0	78.0					4																	25398292		2203	4300	6503	SO:0001819	synonymous_variant	29945	exon15			TGGCTCGGAGTCT	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.1068G>C	4.37:g.25398292G>C		78	1		58	19	NM_013367	0	0	0	0	0	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1																																																																																			G|0.963;A|0.037		0.358	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
SLC10A7	84068	hgsc.bcm.edu	37	4	147363940	147363940	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr4:147363940A>G	ENST00000507030.1	-	5	429	c.430T>C	c.(430-432)Ttt>Ctt	p.F144L	SLC10A7_ENST00000511315.1_5'UTR|SLC10A7_ENST00000511374.1_3'UTR|SLC10A7_ENST00000394059.4_Missense_Mutation_p.F144L|SLC10A7_ENST00000335472.7_Missense_Mutation_p.F144L|SLC10A7_ENST00000432059.2_Intron|SLC10A7_ENST00000264986.3_3'UTR|SLC10A7_ENST00000394062.3_Missense_Mutation_p.F144L			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	144					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					CTTACCAAAAAACTTCCAAAG	0.284																																					p.F144L		.											.	SLC10A7-22	0			c.T430C						.						44.0	43.0	43.0					4																	147363940		2195	4288	6483	SO:0001583	missense	84068	exon5			CCAAAAAACTTCC	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.430T>C	4.37:g.147363940A>G	ENSP00000421275:p.Phe144Leu	22	0		40	2	NM_032128	0	0	0	0	0	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	ENST00000507030.1	37	CCDS34073.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027891	0.35797	.	.	ENSG00000120519	ENST00000335472;ENST00000507030;ENST00000394062;ENST00000394059	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.42517	0.1206	N	0.12471	0.22	0.80722	D	1	B;B;B	0.34147	0.438;0.384;0.337	B;B;B	0.40782	0.34;0.066;0.175	T	0.38243	-0.9670	9	0.02654	T	1	-23.5223	16.4221	0.83766	1.0:0.0:0.0:0.0	.	144;144;144	Q0GE19;Q0GE19-5;Q0GE19-2	NTCP7_HUMAN;.;.	L	144	.	ENSP00000334594:F144L	F	-	1	0	SLC10A7	147583390	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.778000	0.75043	2.283000	0.76528	0.477000	0.44152	TTT	.		0.284	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	
CMYA5	202333	bcgsc.ca	37	5	79029464	79029464	+	Missense_Mutation	SNP	G	G	A	rs74757618		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:79029464G>A	ENST00000446378.2	+	2	4907	c.4876G>A	c.(4876-4878)Gac>Aac	p.D1626N		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1626					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGAGAAGAAAGACAAGCCACA	0.443																																					p.D1626N													.	CMYA5-77	0			c.G4876A						.						85.0	88.0	87.0					5																	79029464		1855	4103	5958	SO:0001583	missense	202333	exon2			AAGAAAGACAAGC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4876G>A	5.37:g.79029464G>A	ENSP00000394770:p.Asp1626Asn	151	2		117	26	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	9.307	1.054490	0.19907	.	.	ENSG00000164309	ENST00000446378	T	0.56776	0.44	4.34	2.5	0.30297	.	1.235380	0.05940	N	0.636733	T	0.43590	0.1254	L	0.39898	1.24	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.27400	-1.0075	10	0.14656	T	0.56	.	9.9471	0.41616	0.1937:0.0:0.8063:0.0	.	1626	Q8N3K9	CMYA5_HUMAN	N	1626	ENSP00000394770:D1626N	ENSP00000394770:D1626N	D	+	1	0	CMYA5	79065220	0.005000	0.15991	0.001000	0.08648	0.025000	0.11179	0.252000	0.18278	0.318000	0.23185	-1.134000	0.01955	GAC	.		0.443	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CMYA5	202333	bcgsc.ca	37	5	79029466	79029466	+	Missense_Mutation	SNP	C	C	A	rs79207557		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:79029466C>A	ENST00000446378.2	+	2	4909	c.4878C>A	c.(4876-4878)gaC>gaA	p.D1626E		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1626					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGAAGAAAGACAAGCCACACC	0.443																																					p.D1626E													.	CMYA5-77	0			c.C4878A						.						92.0	94.0	94.0					5																	79029466		1855	4102	5957	SO:0001583	missense	202333	exon2			GAAAGACAAGCCA	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4878C>A	5.37:g.79029466C>A	ENSP00000394770:p.Asp1626Glu	154	4		122	40	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015143	0.35511	.	.	ENSG00000164309	ENST00000446378	T	0.55760	0.5	4.47	-3.73	0.04398	.	1.235380	0.05940	N	0.636733	T	0.34542	0.0901	L	0.39898	1.24	0.09310	N	1	B	0.27625	0.183	B	0.20184	0.028	T	0.15178	-1.0446	10	0.33141	T	0.24	.	1.6141	0.02700	0.1485:0.2814:0.1289:0.4412	.	1626	Q8N3K9	CMYA5_HUMAN	E	1626	ENSP00000394770:D1626E	ENSP00000394770:D1626E	D	+	3	2	CMYA5	79065222	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.428000	0.02439	-0.622000	0.05626	-0.176000	0.13171	GAC	.		0.443	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
BRD8	10902	bcgsc.ca	37	5	137503737	137503737	+	Missense_Mutation	SNP	C	C	A	rs370927725		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:137503737C>A	ENST00000254900.5	-	9	1044	c.673G>T	c.(673-675)Ggc>Tgc	p.G225C	BRD8_ENST00000230901.5_Missense_Mutation_p.G298C|BRD8_ENST00000402931.1_Missense_Mutation_p.G225C|BRD8_ENST00000455658.2_Missense_Mutation_p.G184C|BRD8_ENST00000411594.2_Missense_Mutation_p.G298C	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	225					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTCAGGTGGCCAGAAGCCACA	0.517																																					p.G298C													.	BRD8-91	0			c.G892T						.						75.0	74.0	75.0					5																	137503737		2203	4300	6503	SO:0001583	missense	10902	exon10			GGTGGCCAGAAGC	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.673G>T	5.37:g.137503737C>A	ENSP00000254900:p.Gly225Cys	200	2		121	44	NM_001164326	0	0	3	3	0	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846551	0.51164	.	.	ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824	T;T;T;T;T;T;T	0.34472	1.7;1.36;1.36;1.49;1.48;1.36;1.47	5.29	2.52	0.30459	.	0.528222	0.22011	N	0.065867	T	0.40670	0.1126	N	0.24115	0.695	0.48395	D	0.999647	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.963;1.0;1.0;1.0	D;D;D;D;P;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.654;1.0;1.0;1.0	T	0.23868	-1.0176	10	0.72032	D	0.01	-3.3377	7.0587	0.25113	0.1403:0.7116:0.0:0.1481	.	184;209;184;298;298;158;298;225	F8W820;B4DN43;B4DEG9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9	.;.;.;.;.;.;.;BRD8_HUMAN	C	225;293;293;298;225;298;158;184;113	ENSP00000254900:G225C;ENSP00000398067:G293C;ENSP00000398873:G293C;ENSP00000230901:G298C;ENSP00000384845:G225C;ENSP00000394330:G298C;ENSP00000408396:G184C	ENSP00000230901:G298C	G	-	1	0	BRD8	137531636	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.504000	0.53347	0.365000	0.24400	0.591000	0.81541	GGC	.		0.517	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
NRG2	9542	hgsc.bcm.edu	37	5	139422525	139422525	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:139422525C>T	ENST00000361474.1	-	1	354	c.130G>A	c.(130-132)Ggc>Agc	p.G44S	NRG2_ENST00000394770.1_Missense_Mutation_p.G44S|NRG2_ENST00000541337.1_Missense_Mutation_p.G44S|NRG2_ENST00000289422.7_Missense_Mutation_p.G44S|NRG2_ENST00000289409.4_Missense_Mutation_p.G44S|NRG2_ENST00000358522.3_Missense_Mutation_p.G44S|NRG2_ENST00000545385.1_Missense_Mutation_p.G44S	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	44	Poly-Ser.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ctgctgctgccgctctcgctg	0.706																																					p.G44S		.											.	NRG2-526	0			c.G130A						.						4.0	3.0	3.0					5																	139422525		1307	2784	4091	SO:0001583	missense	9542	exon1			TGCTGCCGCTCTC		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.130G>A	5.37:g.139422525C>T	ENSP00000354910:p.Gly44Ser	6	1		5	2	NM_013982	0	0	0	0	0		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	.	.	.	.	.	.	.	.	.	.	C	0.048	-1.259663	0.01445	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000378238	T;T;T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	3.8	-1.94	0.07571	.	.	.	.	.	T	0.48241	0.1489	N	0.08118	0	0.21762	N	0.999559	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.40997	-0.9533	9	0.05525	T	0.97	0.2815	5.3685	0.16127	0.1349:0.3857:0.0:0.4795	.	44;44;44;44	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	S	44	ENSP00000444235:G44S;ENSP00000289422:G44S;ENSP00000354910:G44S;ENSP00000438753:G44S;ENSP00000378251:G44S;ENSP00000289409:G44S;ENSP00000351323:G44S;ENSP00000367483:G44S	ENSP00000289409:G44S	G	-	1	0	NRG2	139402709	0.693000	0.27728	0.766000	0.31476	0.487000	0.33371	-0.501000	0.06398	-0.217000	0.10033	0.491000	0.48974	GGC	.		0.706	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
DND1	373863	hgsc.bcm.edu	37	5	140051086	140051086	+	Nonsense_Mutation	SNP	C	C	T	rs560601583	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:140051086C>T	ENST00000542735.1	-	4	897	c.854G>A	c.(853-855)tGg>tAg	p.W285*	WDR55_ENST00000358337.5_3'UTR|WDR55_ENST00000520764.1_3'UTR	NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	285					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCGGTGCCAGCCAGCAGG	0.612													C|||	80	0.0159744	0.0015	0.0159	5008	,	,		21508	0.001		0.0497	False		,,,				2504	0.0164				p.W285X		.											.	DND1-90	0			c.G854A						.						9.0	9.0	9.0					5																	140051086		2169	4220	6389	SO:0001587	stop_gained	373863	exon4			CGGTGCCAGCCAG	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.854G>A	5.37:g.140051086C>T	ENSP00000445366:p.Trp285*	28	1		21	4	NM_194249	0	0	8	8	0		Nonsense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014746	0.75161	.	.	ENSG00000256453	ENST00000542735	.	.	.	5.37	4.5	0.54988	.	0.187603	0.38605	N	0.001639	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1421	13.1357	0.59407	0.0:0.9222:0.0:0.0778	.	.	.	.	X	285	.	ENSP00000445366:W285X	W	-	2	0	DND1	140031270	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	3.792000	0.55476	1.520000	0.48965	-0.268000	0.10319	TGG	.		0.612	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251669.2	NM_194249	
FAT2	2196	bcgsc.ca	37	5	150948147	150948147	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:150948147T>G	ENST00000261800.5	-	1	358	c.346A>C	c.(346-348)Acc>Ccc	p.T116P		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	116	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGATGAGGGTGTAGCTGTCT	0.502																																					p.T116P													.	FAT2-96	0			c.A346C						.						137.0	135.0	136.0					5																	150948147		2203	4300	6503	SO:0001583	missense	2196	exon1			TGAGGGTGTAGCT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.346A>C	5.37:g.150948147T>G	ENSP00000261800:p.Thr116Pro	228	15		215	64	NM_001447	0	0	0	0	0	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.853594	0.51270	.	.	ENSG00000086570	ENST00000261800	T	0.62105	0.05	5.45	5.45	0.79879	Cadherin (3);Cadherin-like (1);	0.170932	0.41500	D	0.000865	T	0.67552	0.2905	M	0.82823	2.61	0.38714	D	0.953294	P	0.50710	0.938	P	0.45971	0.499	T	0.72814	-0.4179	10	0.35671	T	0.21	.	11.5219	0.50555	0.0:0.0:0.1496:0.8504	.	116	Q9NYQ8	FAT2_HUMAN	P	116	ENSP00000261800:T116P	ENSP00000261800:T116P	T	-	1	0	FAT2	150928340	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	1.690000	0.37711	2.065000	0.61736	0.454000	0.30748	ACC	.		0.502	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
VWA7	80737	bcgsc.ca	37	6	31733787	31733787	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:31733787T>C	ENST00000375688.4	-	16	2572	c.2372A>G	c.(2371-2373)gAg>gGg	p.E791G	SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Missense_Mutation_p.E791G|VWA7_ENST00000467576.1_5'Flank			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	791						extracellular region (GO:0005576)											ATCTGGGACCTCCAGCCACAG	0.627																																					p.E791G													.	.	0			c.A2372G						.						87.0	112.0	103.0					6																	31733787		1507	2707	4214	SO:0001583	missense	80737	exon16			GGGACCTCCAGCC		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2372A>G	6.37:g.31733787T>C	ENSP00000364840:p.Glu791Gly	363	1		192	30	NM_025258	0	0	14	14	0	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369798	0.61624	.	.	ENSG00000204396	ENST00000375688;ENST00000375686	T;T	0.15139	2.66;2.45	4.75	4.75	0.60458	.	0.149328	0.42821	D	0.000658	T	0.06050	0.0157	L	0.29908	0.895	0.80722	D	1	B	0.33238	0.403	B	0.33890	0.172	T	0.22312	-1.0220	10	0.33940	T	0.23	-11.7908	10.8128	0.46557	0.0:0.0:0.0:1.0	.	791	Q9Y334	G7C_HUMAN	G	791	ENSP00000364840:E791G;ENSP00000364838:E791G	ENSP00000364838:E791G	E	-	2	0	C6orf27	31841766	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.761000	0.26489	2.125000	0.65367	0.460000	0.39030	GAG	.		0.627	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
C6orf222	389384	bcgsc.ca	37	6	36294451	36294451	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:36294451G>T	ENST00000437635.2	-	5	1049	c.872C>A	c.(871-873)aCa>aAa	p.T291K		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	291										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						CTTGAGGCTTGTCTTTTTCTC	0.562																																					p.T291K													.	C6orf222-93	0			c.C872A						.						173.0	182.0	179.0					6																	36294451		2203	4300	6503	SO:0001583	missense	389384	exon5			AGGCTTGTCTTTT		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.872C>A	6.37:g.36294451G>T	ENSP00000418983:p.Thr291Lys	262	0		233	26	NM_001010903	0	0	0	0	0	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803436	0.50315	.	.	ENSG00000189325	ENST00000437635	T	0.45276	0.9	3.92	3.92	0.45320	.	1.008970	0.07961	N	0.982350	T	0.18257	0.0438	L	0.29908	0.895	0.09310	N	1	P	0.38020	0.615	B	0.34722	0.188	T	0.10497	-1.0627	10	0.66056	D	0.02	.	11.7334	0.51750	0.0:0.0:1.0:0.0	.	291	P0C671	CF222_HUMAN	K	291	ENSP00000418983:T291K	ENSP00000418983:T291K	T	-	2	0	C6orf222	36402429	0.058000	0.20735	0.006000	0.13384	0.036000	0.12997	3.731000	0.55013	2.483000	0.83821	0.455000	0.32223	ACA	.		0.562	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
PIM1	5292	bcgsc.ca	37	6	37139029	37139029	+	Silent	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:37139029C>G	ENST00000373509.5	+	4	742	c.369C>G	c.(367-369)ccC>ccG	p.P123P		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	214					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TGGAGAGGCCCGAGCCGGTGC	0.622			T	BCL6	NHL																																p.P214P				Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1-1493	0			c.C642G						.						78.0	92.0	87.0					6																	37139029		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			GAGGCCCGAGCCG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.369C>G	6.37:g.37139029C>G		345	1		220	57	NM_001243186	0	0	10	11	1	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.		0.622	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
KCNK5	8645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	39161945	39161945	+	Splice_Site	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:39161945C>T	ENST00000359534.3	-	4	972	c.634G>A	c.(634-636)Ggt>Agt	p.G212S		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	212					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						AGGGACTCACCGGCCACAAAG	0.542																																					p.G212S		.											.	KCNK5-227	0			c.G634A						.						92.0	79.0	84.0					6																	39161945		2203	4300	6503	SO:0001630	splice_region_variant	8645	exon4			ACTCACCGGCCAC	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.634+1G>A	6.37:g.39161945C>T		65	0		78	20	NM_003740	0	0	0	1	1	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	ENST00000359534.3	37	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	C	34	5.402436	0.96030	.	.	ENSG00000164626	ENST00000359534	T	0.30448	1.53	5.68	5.68	0.88126	Ion transport 2 (1);	0.101608	0.64402	D	0.000002	T	0.39911	0.1096	L	0.52759	1.655	0.80722	D	1	P	0.46512	0.879	P	0.58820	0.846	T	0.01909	-1.1249	9	.	.	.	.	19.7891	0.96450	0.0:1.0:0.0:0.0	.	212	O95279	KCNK5_HUMAN	S	212	ENSP00000352527:G212S	.	G	-	1	0	KCNK5	39269923	1.000000	0.71417	0.981000	0.43875	0.542000	0.35054	7.747000	0.85070	2.692000	0.91855	0.561000	0.74099	GGT	.		0.542	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	Missense_Mutation
YIPF3	25844	hgsc.bcm.edu	37	6	43481182	43481182	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:43481182G>C	ENST00000372422.2	-	5	631	c.449C>G	c.(448-450)gCa>gGa	p.A150G	YIPF3_ENST00000506469.1_Missense_Mutation_p.A156G|LRRC73_ENST00000372441.1_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	150					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GAGTTCACCTGCAATTTTCTG	0.488																																					p.A150G		.											.	YIPF3-90	0			c.C449G						.						99.0	103.0	101.0					6																	43481182		2203	4300	6503	SO:0001583	missense	25844	exon5			TCACCTGCAATTT	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.449C>G	6.37:g.43481182G>C	ENSP00000361499:p.Ala150Gly	50	0		53	3	NM_015388	0	0	0	0	0	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	ENST00000372422.2	37	CCDS4899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.4|23.4	4.417351|4.417351	0.83449|0.83449	.|.	.|.	ENSG00000137207|ENSG00000137207	ENST00000372422;ENST00000504851;ENST00000506469;ENST00000503972|ENST00000500090	T;T;T|.	0.41065|.	1.01;1.01;1.01|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53594|0.53594	0.1806|0.1806	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	P;D;D;D|.	0.67145|.	0.874;0.994;0.996;0.996|.	P;D;D;D|.	0.77557|.	0.546;0.955;0.99;0.99|.	T|T	0.57573|0.57573	-0.7788|-0.7788	10|6	0.49607|0.02654	T|T	0.09|1	-12.2644|-12.2644	18.2414|18.2414	0.89968|0.89968	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	99;156;115;150|.	D6RED8;E7EQR8;Q5JTD5;Q9GZM5|.	.;.;.;YIPF3_HUMAN|.	G|E	150;99;156;150|88	ENSP00000361499:A150G;ENSP00000425494:A156G;ENSP00000421461:A150G|.	ENSP00000361499:A150G|ENSP00000259737:Q135E	A|Q	-|-	2|1	0|0	YIPF3|YIPF3	43589160|43589160	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.990000|0.990000	0.78478|0.78478	7.666000|7.666000	0.83877|0.83877	2.755000|2.755000	0.94549|0.94549	0.655000|0.655000	0.94253|0.94253	GCA|CAG	.		0.488	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
TDRD6	221400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46658247	46658247	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:46658247C>G	ENST00000316081.6	+	1	2382	c.2382C>G	c.(2380-2382)aaC>aaG	p.N794K	TDRD6_ENST00000544460.1_Missense_Mutation_p.N794K|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	794					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGACCAGGAACATACAAGGAC	0.428																																					p.N794K		.											.	TDRD6-138	0			c.C2382G						.						81.0	83.0	82.0					6																	46658247		2203	4300	6503	SO:0001583	missense	221400	exon1			CAGGAACATACAA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2382C>G	6.37:g.46658247C>G	ENSP00000346065:p.Asn794Lys	74	0		79	10	NM_001168359	0	0	0	0	0	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444596	0.25987	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.12879	2.64;2.64	5.75	3.93	0.45458	Maternal tudor protein (1);	0.375482	0.34178	N	0.004185	T	0.07143	0.0181	L	0.41356	1.27	0.19575	N	0.999962	P;P	0.40834	0.548;0.73	B;P	0.51415	0.439;0.669	T	0.31024	-0.9958	10	0.24483	T	0.36	-13.6225	7.3207	0.26526	0.1058:0.6679:0.1027:0.1236	.	794;794	F5H5M3;O60522	.;TDRD6_HUMAN	K	794	ENSP00000443299:N794K;ENSP00000346065:N794K	ENSP00000346065:N794K	N	+	3	2	TDRD6	46766206	0.072000	0.21174	0.342000	0.25602	0.870000	0.49936	0.453000	0.21811	0.342000	0.23796	-0.797000	0.03246	AAC	.		0.428	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
ULBP1	80329	bcgsc.ca	37	6	150290454	150290454	+	Nonsense_Mutation	SNP	G	G	T	rs75999880		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:150290454G>T	ENST00000229708.3	+	3	626	c.583G>T	c.(583-585)Gaa>Taa	p.E195*		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	195	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GATGTGGCTTGAAGAATTTTT	0.448																																					p.E195X													.	ULBP1-91	0			c.G583T						.						97.0	99.0	99.0					6																	150290454		2203	4300	6503	SO:0001587	stop_gained	80329	exon3			TGGCTTGAAGAAT	AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.583G>T	6.37:g.150290454G>T	ENSP00000229708:p.Glu195*	176	0		157	37	NM_025218	0	0	0	0	0	Q5VY81|Q8IZW3|Q8IZX6	Nonsense_Mutation	SNP	ENST00000229708.3	37	CCDS5223.1	.	.	.	.	.	.	.	.	.	.	g	12.52	1.961165	0.34565	.	.	ENSG00000111981	ENST00000367345;ENST00000229708	.	.	.	2.13	-0.927	0.10451	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	2.6859	0.05107	0.3243:0.2633:0.4125:0.0	.	.	.	.	X	195	.	ENSP00000229708:E195X	E	+	1	0	ULBP1	150332147	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-2.984000	0.00661	-0.252000	0.09528	0.195000	0.17529	GAA	.		0.448	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042677.2		
PDK4	5166	bcgsc.ca	37	7	95216415	95216415	+	Missense_Mutation	SNP	C	C	A	rs200015612		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr7:95216415C>A	ENST00000005178.5	-	10	1199	c.1002G>T	c.(1000-1002)ttG>ttT	p.L334F		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	334	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GAGAAATTGGCAAGCCGTAAC	0.398																																					p.L334F													.	PDK4-358	0			c.G1002T						.						56.0	58.0	58.0					7																	95216415		2203	4300	6503	SO:0001583	missense	5166	exon10			AATTGGCAAGCCG	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.1002G>T	7.37:g.95216415C>A	ENSP00000005178:p.Leu334Phe	57	2		40	22	NM_002612	0	0	110	121	11		Missense_Mutation	SNP	ENST00000005178.5	37	CCDS5643.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675098	0.67928	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.64991	-0.13	5.23	1.4	0.22301	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.067304	0.64402	D	0.000009	D	0.87822	0.6274	H	0.99948	5.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87906	0.2694	10	0.87932	D	0	.	10.2405	0.43310	0.0:0.7297:0.0:0.2703	.	334	Q16654	PDK4_HUMAN	F	334;298	ENSP00000005178:L334F	ENSP00000005178:L334F	L	-	3	2	PDK4	95054351	0.982000	0.34865	0.998000	0.56505	0.931000	0.56810	0.214000	0.17541	0.154000	0.19237	0.591000	0.81541	TTG	C|0.998;A|0.002		0.398	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612	
FBXO24	26261	bcgsc.ca	37	7	100192051	100192051	+	Missense_Mutation	SNP	A	A	C	rs200752657		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr7:100192051A>C	ENST00000241071.6	+	6	1161	c.839A>C	c.(838-840)gAc>gCc	p.D280A	FBXO24_ENST00000465843.1_Missense_Mutation_p.D266A|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000468962.1_Missense_Mutation_p.D268A|FBXO24_ENST00000427939.2_Missense_Mutation_p.D318A|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000360609.2_Missense_Mutation_p.D266A	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	280					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					ACCCAGCTTGACCAGCCACGC	0.552																																					p.D318A													.	FBXO24-229	0			c.A953C						.						111.0	97.0	102.0					7																	100192051		2203	4300	6503	SO:0001583	missense	26261	exon6			AGCTTGACCAGCC	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.839A>C	7.37:g.100192051A>C	ENSP00000241071:p.Asp280Ala	120	0		104	34	NM_012172	0	0	0	0	0	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582482	0.46006	.	.	ENSG00000106336	ENST00000241071;ENST00000360609;ENST00000465843;ENST00000468962;ENST00000427939	T;T;T;T;T	0.80123	-1.34;0.6;0.6;-1.34;-1.34	5.03	5.03	0.67393	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.080894	0.50627	D	0.000102	T	0.59500	0.2198	N	0.08118	0	0.41980	D	0.990791	P;P;P;B	0.39782	0.524;0.688;0.524;0.4	B;B;B;B	0.33960	0.095;0.095;0.095;0.173	T	0.62501	-0.6841	10	0.19147	T	0.46	-18.0956	12.7928	0.57543	1.0:0.0:0.0:0.0	.	268;318;280;266	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	A	280;266;266;268;318	ENSP00000241071:D280A;ENSP00000353821:D266A;ENSP00000419602:D266A;ENSP00000420239:D268A;ENSP00000416558:D318A	ENSP00000241071:D280A	D	+	2	0	FBXO24	100029987	0.997000	0.39634	1.000000	0.80357	0.939000	0.58152	2.681000	0.46926	2.137000	0.66172	0.392000	0.25879	GAC	.		0.552	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	68995502	68995502	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr8:68995502A>T	ENST00000288368.4	+	18	2183	c.1906A>T	c.(1906-1908)Att>Ttt	p.I636F	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	636	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CGGGAAAAAGATTTTTGCTAT	0.318																																					p.I636F		.											.	PREX2-390	0			c.A1906T						.						93.0	94.0	93.0					8																	68995502		2203	4300	6503	SO:0001583	missense	80243	exon18			AAAAAGATTTTTG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1906A>T	8.37:g.68995502A>T	ENSP00000288368:p.Ile636Phe	58	0		78	6	NM_025170	0	0	1	1	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358895	0.82353	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.37235	1.21	5.77	5.77	0.91146	PDZ/DHR/GLGF (3);	0.144361	0.50627	D	0.000115	T	0.50718	0.1632	L	0.52573	1.65	0.54753	D	0.999989	P;P;P	0.52692	0.906;0.955;0.906	P;P;P	0.57101	0.578;0.781;0.813	T	0.51553	-0.8691	10	0.87932	D	0	.	16.3948	0.83586	1.0:0.0:0.0:0.0	.	636;636;636	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	F	636	ENSP00000288368:I636F	ENSP00000288368:I636F	I	+	1	0	PREX2	69158056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.744000	0.55112	2.326000	0.78906	0.533000	0.62120	ATT	.		0.318	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
DEPTOR	64798	bcgsc.ca	37	8	120977570	120977570	+	Missense_Mutation	SNP	T	T	G	rs201433054		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr8:120977570T>G	ENST00000286234.5	+	4	654	c.524T>G	c.(523-525)gTt>gGt	p.V175G	DEPTOR_ENST00000523492.1_Missense_Mutation_p.V74G	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	175	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)		p.V175G(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						GACTGGCTGGTTCAGGAAGGT	0.567																																					p.V175G													.	DEPTOR-227	1	Substitution - Missense(1)	large_intestine(1)	c.T524G						.						109.0	92.0	98.0					8																	120977570		2203	4300	6503	SO:0001583	missense	64798	exon4			GGCTGGTTCAGGA		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.524T>G	8.37:g.120977570T>G	ENSP00000286234:p.Val175Gly	124	6		98	37	NM_022783	0	0	6	6	0	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	ENST00000286234.5	37	CCDS6331.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.224562	0.58668	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	T;T	0.24538	1.85;1.85	5.31	5.31	0.75309	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.142649	0.50627	D	0.000113	T	0.44244	0.1284	M	0.78285	2.405	0.80722	D	1	D;P	0.60575	0.988;0.922	P;P	0.52554	0.702;0.702	T	0.51301	-0.8723	10	0.87932	D	0	-19.4284	15.2821	0.73794	0.0:0.0:0.0:1.0	.	74;175	E7EV87;Q8TB45	.;DPTOR_HUMAN	G	74;175	ENSP00000430457:V74G;ENSP00000286234:V175G	ENSP00000286234:V175G	V	+	2	0	DEPTOR	121046751	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	4.589000	0.61006	2.013000	0.59113	0.533000	0.62120	GTT	.		0.567	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783	
ASPN	54829	hgsc.bcm.edu	37	9	95237063	95237063	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:95237063A>T	ENST00000375544.3	-	2	360	c.117T>A	c.(115-117)gaT>gaA	p.D39E	ASPN_ENST00000395538.3_Missense_Mutation_p.D39E|ASPN_ENST00000450139.2_Missense_Mutation_p.D11E|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Missense_Mutation_p.D39E	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	39	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						catcatcatcatcatcTGTGT	0.403																																					p.D39E		.											.	ASPN-514	0			c.T117A						.						102.0	97.0	99.0					9																	95237063		2203	4300	6503	SO:0001583	missense	54829	exon2			ATCATCATCATCT	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.117T>A	9.37:g.95237063A>T	ENSP00000364694:p.Asp39Glu	40	1		44	5	NM_001193335	0	0	0	0	0	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	A	1.685	-0.505411	0.04261	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.53857	0.6;0.78;0.78	.	.	.	.	.	.	.	.	T	0.42426	0.1202	M	0.61703	1.905	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33033	-0.9884	7	0.15952	T	0.53	.	.	.	.	.	39;39	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	39;39;39;11	ENSP00000364694:D39E;ENSP00000364693:D39E;ENSP00000378909:D39E	ENSP00000364693:D39E	D	-	3	2	ASPN	94276884	0.422000	0.25473	0.022000	0.16811	0.452000	0.32318	0.163000	0.16520	0.064000	0.16427	0.063000	0.15292	GAT	.		0.403	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
FAM120A	23196	bcgsc.ca	37	9	96326681	96326681	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:96326681G>C	ENST00000277165.6	+	18	3410	c.3216G>C	c.(3214-3216)agG>agC	p.R1072S	AL353629.1_ENST00000582353.1_RNA|FAM120A_ENST00000340893.4_Missense_Mutation_p.R1026S|FAM120A_ENST00000333936.5_Missense_Mutation_p.R1100S	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	1072	RNA binding.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTGACGCCAGGGCCCCCAGCC	0.542																																					p.R1072S													.	FAM120A-90	0			c.G3216C						.						49.0	54.0	52.0					9																	96326681		2203	4299	6502	SO:0001583	missense	23196	exon18			CGCCAGGGCCCCC	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.3216G>C	9.37:g.96326681G>C	ENSP00000277165:p.Arg1072Ser	142	0		98	27	NM_014612	0	0	18	18	0	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782024	0.31502	.	.	ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765	T;T;T;T	0.46063	1.45;1.43;1.46;0.88	5.45	4.54	0.55810	.	0.000000	0.64402	D	0.000001	T	0.30603	0.0770	L	0.27053	0.805	0.49798	D	0.999822	P;P;B	0.36837	0.546;0.571;0.106	B;B;B	0.34722	0.188;0.163;0.069	T	0.05209	-1.0899	10	0.31617	T	0.26	-19.3611	14.6358	0.68689	0.0716:0.0:0.9284:0.0	.	1026;1100;1072	Q9NZB2-4;Q9NZB2-6;Q9NZB2	.;.;F120A_HUMAN	S	1072;1100;1026;448	ENSP00000277165:R1072S;ENSP00000334918:R1100S;ENSP00000344698:R1026S;ENSP00000412440:R448S	ENSP00000277165:R1072S	R	+	3	2	FAM120A	95366502	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.446000	0.73460	1.270000	0.44297	0.591000	0.81541	AGG	.		0.542	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612	
SLC25A25	114789	bcgsc.ca	37	9	130854243	130854243	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:130854243A>C	ENST00000373066.5	+	1	501	c.94A>C	c.(94-96)Acc>Ccc	p.T32P	SLC25A25_ENST00000432073.2_Missense_Mutation_p.T32P|SLC25A25_ENST00000373069.5_Intron|SLC25A25_ENST00000373068.2_Intron|RP11-379C10.4_ENST00000453870.1_RNA	NM_001265614.2	NP_001252543.1	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	0					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						AGTCAGAGGCACCCCAGCCCC	0.582																																					p.T32P													.	SLC25A25-90	0			c.A94C						.						99.0	114.0	109.0					9																	130854243		1935	4132	6067	SO:0001583	missense	114789	exon1			AGAGGCACCCCAG	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373066.5:c.94A>C	9.37:g.130854243A>C	ENSP00000362157:p.Thr32Pro	326	4		202	45	NM_001006642	0	0	0	0	0	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	ENST00000373066.5	37	CCDS59146.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.318171	0.40996	.	.	ENSG00000148339	ENST00000432073;ENST00000373066	T;T	0.80738	-1.15;-1.41	6.07	4.87	0.63330	.	.	.	.	.	T	0.72637	0.3485	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.69851	-0.5033	8	0.52906	T	0.07	.	11.1225	0.48298	0.8459:0.154:0.0:0.0	.	32;32	Q6KCM7-5;Q6KCM7-4	.;.	P	32	ENSP00000410053:T32P;ENSP00000362157:T32P	ENSP00000362157:T32P	T	+	1	0	SLC25A25	129894064	0.558000	0.26554	1.000000	0.80357	0.976000	0.68499	0.739000	0.26173	2.326000	0.78906	0.533000	0.62120	ACC	.		0.582	SLC25A25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054406.1	NM_052901	
ZER1	10444	hgsc.bcm.edu	37	9	131515582	131515582	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:131515582C>G	ENST00000291900.2	-	4	1013	c.607G>C	c.(607-609)Gcc>Ccc	p.A203P	ZER1_ENST00000494461.1_5'Flank	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	203					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						AGGTCCAAGGCAGCCAGGGAG	0.617																																					p.A203P		.											.	ZER1-91	0			c.G607C						.						47.0	37.0	41.0					9																	131515582		2202	4300	6502	SO:0001583	missense	10444	exon4			CCAAGGCAGCCAG	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.607G>C	9.37:g.131515582C>G	ENSP00000291900:p.Ala203Pro	35	0		35	2	NM_006336	0	0	24	24	0	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939837	0.52972	.	.	ENSG00000160445	ENST00000291900	T	0.17691	2.26	5.32	4.43	0.53597	.	0.053817	0.64402	D	0.000001	T	0.15176	0.0366	L	0.36672	1.1	0.58432	D	0.999999	B	0.30021	0.265	B	0.31191	0.125	T	0.05084	-1.0907	10	0.36615	T	0.2	-26.2778	13.2885	0.60258	0.0:0.9243:0.0:0.0757	.	203	Q7Z7L7	ZER1_HUMAN	P	203	ENSP00000291900:A203P	ENSP00000291900:A203P	A	-	1	0	ZER1	130555403	0.980000	0.34600	0.888000	0.34837	0.488000	0.33401	2.530000	0.45641	1.475000	0.48197	0.655000	0.94253	GCC	.		0.617	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
OBP2B	29989	hgsc.bcm.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000372032.2_Intron|OBP2B_ENST00000461961.1_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N		.											.	OBP2B-68	1	Substitution - Missense(1)	large_intestine(1)	c.G183C						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989	exon2			TTCCAACTTCCCA	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	58	1		55	3	NM_014581	0	0	0	1	1	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG	.		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
PCDH19	57526	hgsc.bcm.edu	37	X	99661616	99661616	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrX:99661616G>C	ENST00000373034.4	-	1	3655	c.1980C>G	c.(1978-1980)atC>atG	p.I660M	PCDH19_ENST00000420881.2_Missense_Mutation_p.I660M|PCDH19_ENST00000255531.7_Missense_Mutation_p.I660M	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	660	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GGGACAAGTAGATTAGGACGA	0.547																																					p.I660M		.											.	PCDH19-110	0			c.C1980G						.						67.0	66.0	66.0					X																	99661616		2065	4185	6250	SO:0001583	missense	57526	exon1			CAAGTAGATTAGG	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1980C>G	X.37:g.99661616G>C	ENSP00000362125:p.Ile660Met	23	0		24	2	NM_001184880	0	0	0	0	0	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	G	8.605	0.887772	0.17540	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.68025	-0.3;-0.3;-0.3	5.84	4.06	0.47325	Cadherin (4);Cadherin-like (1);	0.185233	0.49305	D	0.000142	D	0.83257	0.5215	M	0.88979	2.995	0.51767	D	0.99993	D;D;D	0.60575	0.988;0.973;0.979	D;P;D	0.63703	0.917;0.859;0.913	D	0.85025	0.0914	10	0.66056	D	0.02	.	16.0391	0.80651	0.0:0.0:0.602:0.398	.	660;660;660	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	M	660	ENSP00000400327:I660M;ENSP00000362125:I660M;ENSP00000255531:I660M	ENSP00000255531:I660M	I	-	3	3	PCDH19	99548272	1.000000	0.71417	0.985000	0.45067	0.678000	0.39670	0.814000	0.27239	0.223000	0.20920	-1.471000	0.01009	ATC	.		0.547	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
PRRG3	79057	hgsc.bcm.edu	37	X	150869296	150869296	+	Silent	SNP	C	C	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrX:150869296C>A	ENST00000370353.3	+	4	877	c.487C>A	c.(487-489)Cgg>Agg	p.R163R	PRRG3_ENST00000538575.1_Silent_p.R163R			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	163						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GGGGCCCAGTCGGGGGGGCAG	0.672																																					p.R163R		.											.	PRRG3-134	0			c.C487A						.						30.0	28.0	29.0					X																	150869296		2202	4298	6500	SO:0001819	synonymous_variant	79057	exon4			CCCAGTCGGGGGG	AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.487C>A	X.37:g.150869296C>A		43	0		27	2	NM_024082	0	0	0	0	0	A1A523|A1A575|Q8N2N6	Silent	SNP	ENST00000370353.3	37	CCDS14699.1																																																																																			.		0.672	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	NM_024082	
FATE1	89885	bcgsc.ca	37	X	150891105	150891105	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrX:150891105T>G	ENST00000370350.3	+	5	511	c.426T>G	c.(424-426)taT>taG	p.Y142*		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	142						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGCTGTATGCAGTCAACC	0.612																																					p.Y142X													.	FATE1-131	0			c.T426G						.						57.0	64.0	62.0					X																	150891105		2203	4298	6501	SO:0001587	stop_gained	89885	exon5			GCTGTATGCAGTC	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.426T>G	X.37:g.150891105T>G	ENSP00000359375:p.Tyr142*	82	0		98	4	NM_033085	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000370350.3	37	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.329167	0.24167	.	.	ENSG00000147378	ENST00000370350	.	.	.	4.55	-9.11	0.00711	.	2.770910	0.01081	N	0.004990	.	.	.	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	11.7727	2.708	0.05166	0.2388:0.3595:0.2921:0.1096	.	.	.	.	X	142	.	ENSP00000359375:Y142X	Y	+	3	2	FATE1	150641761	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.221000	0.00140	-4.843000	0.00030	-1.019000	0.02448	TAT	.		0.612	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
USP19	10869	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	49148785	49148785	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:49148785delC	ENST00000398888.2	-	21	3240	c.2922delG	c.(2920-2922)gggfs	p.G974fs	USP19_ENST00000453664.1_Frame_Shift_Del_p.G1065fs|USP19_ENST00000417901.1_Frame_Shift_Del_p.G1077fs|USP19_ENST00000398898.2_Frame_Shift_Del_p.G1014fs|USP19_ENST00000398896.1_Frame_Shift_Del_p.G782fs|USP19_ENST00000398892.3_Frame_Shift_Del_p.G1014fs|USP19_ENST00000434032.2_Frame_Shift_Del_p.G1075fs	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	974	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GATGCTGGTACCCAGGCACAG	0.532																																					p.G1077fs		.											.	USP19-663	0			c.3231delG						.						101.0	106.0	105.0					3																	49148785		2047	4201	6248	SO:0001589	frameshift_variant	10869	exon22			.	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2922delG	3.37:g.49148785delC	ENSP00000381863:p.Gly974fs	96	0		105	20	NM_001199161	0	0	0	0	0	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Frame_Shift_Del	DEL	ENST00000398888.2	37	CCDS43090.1																																																																																			.		0.532	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
CLIP1	6249	broad.mit.edu	37	12	122812690	122812691	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:122812690_122812691insT	ENST00000540338.1	-	16	3093_3094	c.3052_3053insA	c.(3052-3054)agcfs	p.S1018fs	CLIP1_ENST00000361654.4_Frame_Shift_Ins_p.S896fs|CLIP1_ENST00000302528.7_Frame_Shift_Ins_p.S1007fs|CLIP1_ENST00000545889.1_Frame_Shift_Ins_p.S593fs|CLIP1_ENST00000537178.1_Frame_Shift_Ins_p.S972fs|CLIP1_ENST00000358808.2_Frame_Shift_Ins_p.S1007fs			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1018					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGTTGTGGCTTGTTTCCATT	0.505																																					p.S1018fs													.	CLIP1-155	0			c.3053_3054insA						.																																			SO:0001589	frameshift_variant	6249	exon17			TTGTGGCTTGTTT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3053dupA	12.37:g.122812692_122812692dupT	ENSP00000439093:p.Ser1018fs	203	0		191	12	NM_001247997	0	0	0	0	0	A0AVD3|Q17RS4|Q29RG0	Frame_Shift_Ins	INS	ENST00000540338.1	37	CCDS58285.1																																																																																			.		0.505	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
KCNE1L	23630	bcgsc.ca	37	X	108868162	108868163	+	Missense_Mutation	DNP	CC	CC	AA	rs200894798		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrX:108868162_108868163CC>AA	ENST00000372101.2	-	1	230_231	c.87_88GG>TT	c.(85-90)ttGGgc>ttTTgc	p.29_30LG>FC		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	29					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GGGCCAGCGCCCAAGCCGCTGG	0.663																																					p.LG29FC													.	KCNE1L-130	0			c.G87T						.																																			SO:0001583	missense	23630	exon1			AGCGCCCAAGCCG	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.87_88delinsAA	X.37:g.108868162_108868163delinsAA	ENSP00000361173:p.L29_G30delinsFC	34	4		12	8	NM_012282	0	0	0	0	0		Missense_Mutation	DNP	ENST00000372101.2	37	CCDS14547.1																																																																																			.		0.663	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1	NM_012282	
