#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLCN6	1185	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	11888206	11888206	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:11888206G>A	ENST00000346436.6	+	11	936	c.884G>A	c.(883-885)cGt>cAt	p.R295H	CLCN6_ENST00000312413.6_Missense_Mutation_p.R295H|CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376487.3_Missense_Mutation_p.R273H|CLCN6_ENST00000376496.3_Missense_Mutation_p.R295H	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	295					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AACTTCTTCCGTTCTGGGATT	0.483																																					p.R295H		.											.	CLCN6-90	0			c.G884A						.						224.0	231.0	229.0					1																	11888206		2203	4300	6503	SO:0001583	missense	1185	exon11			TCTTCCGTTCTGG	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.884G>A	1.37:g.11888206G>A	ENSP00000234488:p.Arg295His	636	0		990	54	NM_001286	0	0	3	3	0	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	35	5.415466	0.96092	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376487;ENST00000376496;ENST00000376492	D;D;D;D	0.94232	-3.36;-3.38;-3.38;-3.38	5.06	5.06	0.68205	Chloride channel, core (2);	0.048615	0.85682	D	0.000000	D	0.96046	0.8712	.	.	.	0.80722	D	1	D;D;D	0.76494	0.989;0.999;0.992	P;P;P	0.60117	0.459;0.869;0.594	D	0.96294	0.9216	9	0.66056	D	0.02	-10.0688	17.6173	0.88071	0.0:0.0:1.0:0.0	.	273;295;295	F8W9R3;P51797-3;P51797	.;.;CLCN6_HUMAN	H	295;295;273;295;295	ENSP00000308367:R295H;ENSP00000234488:R295H;ENSP00000365670:R273H;ENSP00000365679:R295H	ENSP00000308367:R295H	R	+	2	0	CLCN6	11810793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.625000	0.88918	0.655000	0.94253	CGT	.		0.483	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
PRAMEF18	391003	hgsc.bcm.edu	37	1	13474718	13474718	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:13474718T>G	ENST00000376126.2	-	3	1410	c.1411A>C	c.(1411-1413)Aat>Cat	p.N471H		NM_001099850.1	NP_001093320.1	Q5VWM3	PRA18_HUMAN	PRAME family member 18	471					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(2)|ovary(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCAAAAATTGAACTCCAGT	0.483																																					p.N471H		.											.	.	0			c.A1411C						.						1.0	1.0	1.0					1																	13474718		362	930	1292	SO:0001583	missense	645414	exon3			AAAAATTGAACTC			1p36.21	2013-01-17			ENSG00000204491			"""-"""	30693	protein-coding gene	gene with protein product							Standard			Approved	OTTHUMG00000002932		Q5VWM3	OTTHUMG00000002932	ENST00000376126.2:c.1411A>C	1.37:g.13474718T>G	ENSP00000365294:p.Asn471His	175	0		304	105	NM_001099790	0	0	0	0	0		Missense_Mutation	SNP	ENST00000376126.2	37	CCDS41258.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.563802	0.00903	.	.	ENSG00000204491	ENST00000376126	T	0.01287	5.05	1.25	0.028	0.14157	.	24.652700	0.00166	N	0.000001	T	0.00906	0.0030	N	0.04018	-0.295	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.45556	-0.9253	10	0.15066	T	0.55	.	3.0129	0.06049	0.0:0.2956:0.0:0.7044	.	471	Q5VWM3	PRA18_HUMAN	H	471	ENSP00000365294:N471H	ENSP00000365294:N471H	N	-	1	0	PRAMEF18	13347305	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.371000	0.07513	-0.016000	0.14127	0.164000	0.16699	AAT	.		0.483	PRAMEF18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008177.2	NM_001099850	
FGR	2268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27943508	27943508	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:27943508G>A	ENST00000374005.3	-	7	830	c.542C>T	c.(541-543)tCc>tTc	p.S181F	FGR_ENST00000399173.1_Missense_Mutation_p.S181F|FGR_ENST00000545953.1_Missense_Mutation_p.S115F|FGR_ENST00000374004.1_Missense_Mutation_p.S181F	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	181	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GATGGACAGGGAGTAGGCACC	0.567																																					p.S181F		.											.	FGR-547	0			c.C542T						.						103.0	96.0	99.0					1																	27943508		2203	4300	6503	SO:0001583	missense	2268	exon7			GACAGGGAGTAGG	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.542C>T	1.37:g.27943508G>A	ENSP00000363117:p.Ser181Phe	183	0		225	128	NM_001042729	0	0	0	0	0	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328135	0.81690	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	4.38	4.38	0.52667	SH2 motif (5);	0.000000	0.56097	D	0.000031	D	0.95079	0.8406	H	0.98199	4.17	0.50813	D	0.999899	D	0.57571	0.98	P	0.50754	0.649	D	0.97122	0.9812	10	0.87932	D	0	.	16.3789	0.83431	0.0:0.0:1.0:0.0	.	181	P09769	FGR_HUMAN	F	181;115;181;181;181;181	ENSP00000363117:S181F;ENSP00000445302:S115F;ENSP00000382126:S181F;ENSP00000363116:S181F;ENSP00000363115:S181F;ENSP00000407670:S181F	ENSP00000363115:S181F	S	-	2	0	FGR	27816095	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.670000	0.68088	2.348000	0.79779	0.491000	0.48974	TCC	.		0.567	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
PABPC4	8761	hgsc.bcm.edu;bcgsc.ca	37	1	40038244	40038244	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:40038244C>A	ENST00000372857.3	-	2	1000	c.208G>T	c.(208-210)Gac>Tac	p.D70Y	PABPC4_ENST00000372856.3_Missense_Mutation_p.D70Y|PABPC4_ENST00000529216.1_5'Flank|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372858.3_Missense_Mutation_p.D70Y|PABPC4_ENST00000372862.3_Missense_Mutation_p.D70Y	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	70	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTCATGGTGTCCAAAGCCCGC	0.463																																					p.D70Y		.											.	PABPC4-68	0			c.G208T						.						81.0	75.0	77.0					1																	40038244		2203	4300	6503	SO:0001583	missense	8761	exon2			TGGTGTCCAAAGC	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.208G>T	1.37:g.40038244C>A	ENSP00000361948:p.Asp70Tyr	177	0		118	35	NM_001135653	0	0	60	60	0	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	37	CCDS438.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994504	0.93167	.	.	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856;ENST00000451091	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	5.69	5.69	0.88448	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	L	0.46157	1.445	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.76575	0.964;0.988;0.924	T	0.05649	-1.0872	10	0.87932	D	0	.	19.8057	0.96531	0.0:1.0:0.0:0.0	.	70;70;70	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	Y	70	ENSP00000361953:D70Y;ENSP00000361949:D70Y;ENSP00000361948:D70Y;ENSP00000361947:D70Y;ENSP00000406675:D70Y	ENSP00000361947:D70Y	D	-	1	0	PABPC4	39810831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.705000	0.84606	2.682000	0.91365	0.655000	0.94253	GAC	.		0.463	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
PBX1	5087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	164761796	164761796	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:164761796A>T	ENST00000420696.2	+	3	519	c.331A>T	c.(331-333)Atg>Ttg	p.M111L	PBX1_ENST00000540236.1_Missense_Mutation_p.M111L|PBX1_ENST00000560641.1_Missense_Mutation_p.M6L|PBX1_ENST00000540246.1_Missense_Mutation_p.M6L|PBX1_ENST00000367897.1_Missense_Mutation_p.M111L|PBX1_ENST00000559240.1_Missense_Mutation_p.M111L|PBX1_ENST00000401534.1_Missense_Mutation_p.M111L	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	111					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GCTGGACAACATGCTGTTAGC	0.627			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.M111L		.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1-659	0			c.A331T						.						32.0	35.0	34.0					1																	164761796		2203	4300	6503	SO:0001583	missense	5087	exon3			GACAACATGCTGT	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.331A>T	1.37:g.164761796A>T	ENSP00000405890:p.Met111Leu	84	1		131	43	NM_001204963	0	0	1	4	3	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	A	34	5.311091	0.95629	.	.	ENSG00000185630	ENST00000340699;ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	5.5	5.5	0.81552	PBX (1);	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	M	0.87758	2.905	0.09310	N	1.0	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.997;0.999;0.998;0.999;0.999	T	0.68640	-0.5355	9	0.72032	D	0.01	-12.8606	15.255	0.73579	1.0:0.0:0.0:0.0	.	6;111;111;111;111	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	L	111;111;111;111;111;6	ENSP00000341455:M111L;ENSP00000405890:M111L;ENSP00000356872:M111L;ENSP00000439943:M111L;ENSP00000384856:M111L;ENSP00000440869:M6L	ENSP00000341455:M111L	M	+	1	0	PBX1	163028420	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.813000	0.91963	2.066000	0.61787	0.460000	0.39030	ATG	.		0.627	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201039482	201039482	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:201039482G>A	ENST00000362061.3	-	17	2504	c.2278C>T	c.(2278-2280)Ccc>Tcc	p.P760S	CACNA1S_ENST00000367338.3_Missense_Mutation_p.P760S	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	760					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCAGCCAGGGGACGTGGTCGG	0.587																																					p.P760S		.											.	CACNA1S-94	0			c.C2278T						.						70.0	75.0	73.0					1																	201039482		2203	4300	6503	SO:0001583	missense	779	exon17			CCAGGGGACGTGG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2278C>T	1.37:g.201039482G>A	ENSP00000355192:p.Pro760Ser	250	0		385	121	NM_000069	0	0	0	0	0	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.105070	0.56291	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.95821	-3.82;-3.73	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.97492	0.9179	M	0.79805	2.47	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.97283	0.9919	10	0.37606	T	0.19	.	16.8708	0.86040	0.0:0.0:1.0:0.0	.	760	Q13698	CAC1S_HUMAN	S	760	ENSP00000355192:P760S;ENSP00000356307:P760S	ENSP00000355192:P760S	P	-	1	0	CACNA1S	199306105	1.000000	0.71417	0.292000	0.24919	0.289000	0.27227	7.945000	0.87732	2.032000	0.59987	0.643000	0.83706	CCC	.		0.587	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
FMOD	2331	broad.mit.edu	37	1	203311609	203311609	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:203311609G>T	ENST00000354955.4	-	3	1456	c.993C>A	c.(991-993)agC>agA	p.S331R	FMOD_ENST00000493296.1_5'UTR	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	331					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.S331R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			TGCAGAAGCTGCTGATGGAGA	0.597											OREG0014119	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S331R													.	FMOD-137	1	Substitution - Missense(1)	prostate(1)	c.C993A						.						36.0	34.0	34.0					1																	203311609		2203	4300	6503	SO:0001583	missense	2331	exon3			GAAGCTGCTGATG	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.993C>A	1.37:g.203311609G>T	ENSP00000347041:p.Ser331Arg	57	1	2136	102	12	NM_002023	0	0	0	0	0	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	CCDS30976.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527763	0.64860	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.04603	3.59	5.42	3.17	0.36434	.	0.193950	0.53938	N	0.000041	T	0.08268	0.0206	L	0.42686	1.345	0.43047	D	0.99464	P	0.52463	0.953	P	0.52109	0.69	T	0.10636	-1.0621	10	0.66056	D	0.02	-8.0803	7.9269	0.29880	0.0856:0.0:0.6317:0.2827	.	331	Q06828	FMOD_HUMAN	R	318;331	ENSP00000347041:S331R	ENSP00000347041:S331R	S	-	3	2	FMOD	201578232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.007000	0.49536	1.259000	0.44117	-0.182000	0.12963	AGC	.		0.597	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023	
EGLN1	54583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	231502192	231502192	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:231502192T>A	ENST00000366641.3	-	5	4401	c.1246A>T	c.(1246-1248)Aaa>Taa	p.K416*	EGLN1_ENST00000476717.1_5'UTR	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				TCTGAAGGTTTATTGAGTTCA	0.378																																					p.K416X		.											.	EGLN1-226	0			c.A1246T						.						104.0	98.0	100.0					1																	231502192		2203	4300	6503	SO:0001587	stop_gained	54583	exon5			AAGGTTTATTGAG	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.1246A>T	1.37:g.231502192T>A	ENSP00000355601:p.Lys416*	143	2		68	20	NM_022051	0	0	26	65	39		Nonsense_Mutation	SNP	ENST00000366641.3	37	CCDS1595.1	.	.	.	.	.	.	.	.	.	.	T	57	27.737614	0.99972	.	.	ENSG00000135766	ENST00000366641	.	.	.	5.47	5.47	0.80525	.	0.163488	0.53938	D	0.000058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8574	15.562	0.76256	0.0:0.0:0.0:1.0	.	.	.	.	X	416	.	ENSP00000355601:K416X	K	-	1	0	EGLN1	229568815	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.890000	0.75633	2.073000	0.62155	0.533000	0.62120	AAA	.		0.378	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092879.1	NM_022051	
ZNF692	55657	broad.mit.edu	37	1	249150136	249150136	+	Silent	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:249150136A>G	ENST00000306601.4	-	7	835	c.669T>C	c.(667-669)ccT>ccC	p.P223P	ZNF692_ENST00000451251.1_Silent_p.P228P|ZNF692_ENST00000468455.1_5'UTR|ZNF692_ENST00000366469.5_Silent_p.P222P|ZNF692_ENST00000366471.3_Silent_p.P178P|ZNF692_ENST00000427146.1_Silent_p.P178P	NM_017865.3	NP_060335.2	Q9BU19	ZN692_HUMAN	zinc finger protein 692	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)	17	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			TGGGGGCATCAGGCTCACTAC	0.567																																					p.P228P													.	ZNF692-90	0			c.T684C						.						36.0	38.0	37.0					1																	249150136		2203	4300	6503	SO:0001819	synonymous_variant	55657	exon7			GGCATCAGGCTCA	BC002948	CCDS31127.1, CCDS44348.1, CCDS53487.1	1q44	2013-01-08			ENSG00000171163	ENSG00000171163		"""Zinc fingers, C2H2-type"""	26049	protein-coding gene	gene with protein product						12477932	Standard	NM_001136036		Approved	FLJ20531, Zfp692	uc001ifc.2	Q9BU19	OTTHUMG00000040423	ENST00000306601.4:c.669T>C	1.37:g.249150136A>G		55	0		118	3	NM_001136036	0	0	4	4	0	B4DXZ0|Q5SRA5|Q5SRA6|Q9HBC9|Q9NW93|Q9NWY6|Q9UF97	Silent	SNP	ENST00000306601.4	37	CCDS31127.1	.	.	.	.	.	.	.	.	.	.	A	1.433	-0.569664	0.03910	.	.	ENSG00000171163	ENST00000476503	.	.	.	4.73	-0.628	0.11537	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1888	4.3099	0.10965	0.4905:0.092:0.0:0.4174	.	.	.	.	R	3	.	.	X	-	1	0	ZNF692	247116759	0.062000	0.20869	0.715000	0.30552	0.101000	0.19017	-0.240000	0.08952	-0.189000	0.10482	-0.695000	0.03696	TGA	.		0.567	ZNF692-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097298.1	NM_017865	
ABI1	10006	hgsc.bcm.edu	37	10	27040641	27040641	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr10:27040641G>C	ENST00000376142.2	-	11	1308	c.1237C>G	c.(1237-1239)Ccc>Gcc	p.P413A	ABI1_ENST00000536334.1_Missense_Mutation_p.P299A|ABI1_ENST00000346832.5_Missense_Mutation_p.P401A|ABI1_ENST00000359188.4_Missense_Mutation_p.P385A|ABI1_ENST00000376166.1_Missense_Mutation_p.P351A|ABI1_ENST00000376139.2_Missense_Mutation_p.P381A|ABI1_ENST00000376140.3_Missense_Mutation_p.P386A|ABI1_ENST00000376138.3_Missense_Mutation_p.P357A|ABI1_ENST00000376170.4_Missense_Mutation_p.P356A|ABI1_ENST00000376134.3_Missense_Mutation_p.P387A|ABI1_ENST00000376160.1_Missense_Mutation_p.P380A|ABI1_ENST00000376137.4_Missense_Mutation_p.P328A|ABI1_ENST00000490841.2_Missense_Mutation_p.P234A|ABI1_ENST00000355394.4_Missense_Mutation_p.P414A	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	413	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGTGGTGGGGGAGGTGGAGAG	0.478																																					p.P413A		.											.	ABI1-1082	0			c.C1237G						.						115.0	123.0	120.0					10																	27040641		2203	4300	6503	SO:0001583	missense	10006	exon11			GTGGGGGAGGTGG	U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.1237C>G	10.37:g.27040641G>C	ENSP00000365312:p.Pro413Ala	124	0		34	2	NM_005470	0	0	31	31	0	A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	ENST00000376142.2	37	CCDS7150.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846505	0.51164	.	.	ENSG00000136754	ENST00000376138;ENST00000376170;ENST00000376166;ENST00000376160;ENST00000376142;ENST00000359188;ENST00000376139;ENST00000355394;ENST00000346832;ENST00000376134;ENST00000376137;ENST00000536334;ENST00000490841;ENST00000376140	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.47177	2.25;2.25;2.25;0.95;0.92;0.94;0.96;1.02;2.25;0.85;1.1;2.25;1.04;0.94	5.18	4.28	0.50868	Src homology-3 domain (1);	0.357554	0.36200	N	0.002724	T	0.62527	0.2435	L	0.56769	1.78	0.35986	D	0.836389	B;B;B;B;P;B;D;P;P;P;P;P;D	0.89917	0.3;0.018;0.131;0.206;0.948;0.413;0.997;0.917;0.556;0.95;0.855;0.917;1.0	B;B;B;B;P;B;D;P;B;P;P;P;D	0.87578	0.039;0.007;0.039;0.086;0.65;0.265;0.98;0.64;0.403;0.775;0.64;0.709;0.998	T	0.67499	-0.5655	10	0.29301	T	0.29	-2.6224	13.6422	0.62257	0.0764:0.0:0.9236:0.0	.	298;327;234;293;223;351;381;385;401;357;381;386;413	B6VEX4;B6VEX3;B4DQ58;Q8IZP0-10;B4DKX2;Q5T2R9;Q59G41;Q8IZP0-6;B3KX62;Q8IZP0-3;Q8IZP0-5;Q8IZP0-9;Q8IZP0	.;.;.;.;.;.;.;.;.;.;.;.;ABI1_HUMAN	A	357;356;351;380;413;385;381;414;401;387;328;299;234;386	ENSP00000365308:P357A;ENSP00000365340:P356A;ENSP00000365336:P351A;ENSP00000365330:P380A;ENSP00000365312:P413A;ENSP00000352114:P385A;ENSP00000365309:P381A;ENSP00000347555:P414A;ENSP00000279599:P401A;ENSP00000365304:P387A;ENSP00000365307:P328A;ENSP00000439646:P299A;ENSP00000440101:P234A;ENSP00000365310:P386A	ENSP00000279599:P401A	P	-	1	0	ABI1	27080647	1.000000	0.71417	0.753000	0.31225	0.381000	0.30169	7.809000	0.86057	1.318000	0.45170	0.563000	0.77884	CCC	.		0.478	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470	
PGAM1	5223	hgsc.bcm.edu	37	10	99192203	99192203	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr10:99192203C>T	ENST00000334828.5	+	4	835	c.687C>T	c.(685-687)ccC>ccT	p.P229P	PGAM1_ENST00000467867.1_3'UTR	NM_002629.2	NP_002620.1	P18669	PGAM1_HUMAN	phosphoglycerate mutase 1 (brain)	229					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|regulation of glycolytic process (GO:0006110)|regulation of pentose-phosphate shunt (GO:0043456)|respiratory burst (GO:0045730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)|protein kinase binding (GO:0019901)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(252;0.162)		Epithelial(162;8.36e-10)|all cancers(201;5.62e-08)		CTATCAAGCCCATGCAGTTTC	0.532																																					p.P229P		.											.	PGAM1-226	0			c.C687T						.						102.0	102.0	102.0					10																	99192203		2202	4281	6483	SO:0001819	synonymous_variant	5223	exon4			CAAGCCCATGCAG	BC010038	CCDS7458.1	10q25.3	2012-10-02			ENSG00000171314	ENSG00000171314	5.4.2.1		8888	protein-coding gene	gene with protein product	"""Phosphoglycerate mutase A, nonmuscle form"""	172250		PGAMA		2846553	Standard	NM_002629		Approved	PGAM-B	uc001knh.3	P18669	OTTHUMG00000018846	ENST00000334828.5:c.687C>T	10.37:g.99192203C>T		294	1		445	131	NM_002629	0	0	268	488	220	Q9BWC0	Silent	SNP	ENST00000334828.5	37	CCDS7458.1																																																																																			.		0.532	PGAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049652.1	NM_002629	
FAM45A	404636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	120879873	120879873	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr10:120879873A>T	ENST00000361432.2	+	5	528	c.502A>T	c.(502-504)Atg>Ttg	p.M168L	FAM45A_ENST00000535029.1_Intron|FAM45A_ENST00000544016.1_Missense_Mutation_p.M17L|FAM45A_ENST00000489988.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	168										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		TCAGTTTGGAATGGAAACTGT	0.343																																					p.M168L		.											.	FAM45A-91	0			c.A502T						.						87.0	84.0	85.0					10																	120879873		2203	4300	6503	SO:0001583	missense	404636	exon5			TTTGGAATGGAAA	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.502A>T	10.37:g.120879873A>T	ENSP00000354688:p.Met168Leu	121	0		137	42	NM_207009	0	0	11	16	5	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	A	8.904	0.957092	0.18507	.	.	ENSG00000119979	ENST00000546291;ENST00000361432;ENST00000544016	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.51719	0.1691	L	0.42245	1.32	0.58432	D	0.999999	B;B;B;B	0.22414	0.051;0.069;0.01;0.051	B;B;B;B	0.24701	0.055;0.04;0.022;0.037	T	0.48625	-0.9019	9	0.02654	T	1	.	15.0195	0.71617	1.0:0.0:0.0:0.0	.	95;17;160;168	B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.;.;.;FA45A_HUMAN	L	168;168;17	.	ENSP00000354688:M168L	M	+	1	0	FAM45A	120869863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.380000	0.90149	2.285000	0.76669	0.533000	0.62120	ATG	.		0.343	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
FANK1	92565	broad.mit.edu	37	10	127585218	127585218	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr10:127585218C>A	ENST00000368693.1	+	1	111	c.7C>A	c.(7-9)Ccc>Acc	p.P3T	FANK1_ENST00000449042.2_5'UTR|FANK1_ENST00000368695.1_5'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	3						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GACCATGGAGCCCCAGAGTAA	0.761																																					p.P3T													.	FANK1-91	0			c.C7A						.						9.0	12.0	11.0					10																	127585218		2171	4258	6429	SO:0001583	missense	92565	exon1			ATGGAGCCCCAGA	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.7C>A	10.37:g.127585218C>A	ENSP00000357682:p.Pro3Thr	25	0		29	3	NM_145235	0	0	0	0	0	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.288816	0.23478	.	.	ENSG00000203780	ENST00000368693	T	0.43688	0.94	2.62	2.62	0.31277	.	.	.	.	.	T	0.25195	0.0612	N	0.22421	0.69	0.80722	D	1	B;B	0.12013	0.003;0.005	B;B	0.12837	0.007;0.008	T	0.05835	-1.0861	9	0.18276	T	0.48	.	8.8836	0.35389	0.0:1.0:0.0:0.0	.	3;3	Q8TC84-3;Q8TC84	.;FANK1_HUMAN	T	3	ENSP00000357682:P3T	ENSP00000357682:P3T	P	+	1	0	FANK1	127575208	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	2.904000	0.48719	1.756000	0.51951	0.462000	0.41574	CCC	.		0.761	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
MICAL2	9645	ucsc.edu	37	11	12225946	12225946	+	Silent	SNP	G	G	A	rs3763823	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:12225946G>A	ENST00000256194.4	+	4	702	c.414G>A	c.(412-414)cgG>cgA	p.R138R	MICAL2_ENST00000527546.1_Silent_p.R138R|MICAL2_ENST00000342902.5_Silent_p.R138R|MICAL2_ENST00000527195.1_3'UTR|MICAL2_ENST00000379612.3_Silent_p.R138R|MICAL2_ENST00000537344.1_Silent_p.R138R	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	138	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		ATGACCTTCGTGGCCTGGGAG	0.547																																					p.R138R													.	MICAL2-92	0			c.T414A						.						114.0	101.0	105.0					11																	12225946		2201	4294	6495	SO:0001819	synonymous_variant	9645	exon4			CCTTCGTGGCCTG	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.414G>A	11.37:g.12225946G>A		198	0		234	104	NM_014632	0	0	1	1	0	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	ENST00000256194.4	37	CCDS7809.1																																																																																			G|0.668;T|0.332		0.547	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
TRIM48	79097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55032729	55032729	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:55032729G>T	ENST00000417545.2	+	2	484	c.398G>T	c.(397-399)aGc>aTc	p.S133I		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	117						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CTGTGCTCCAGCTCTCAGGAG	0.507																																					p.S133I		.											.	TRIM48-130	0			c.G398T						.						53.0	49.0	50.0					11																	55032729		2190	4261	6451	SO:0001583	missense	79097	exon2			GCTCCAGCTCTCA	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.398G>T	11.37:g.55032729G>T	ENSP00000402414:p.Ser133Ile	54	0		16	8	NM_024114	0	0	0	0	0	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	g	7.071	0.568353	0.13560	.	.	ENSG00000150244	ENST00000417545	T	0.42900	0.96	0.596	-1.19	0.09585	Zinc finger, B-box (3);	.	.	.	.	T	0.36524	0.0970	N	0.20610	0.595	0.09310	N	1	P	0.49961	0.93	P	0.57009	0.811	T	0.23797	-1.0178	9	0.62326	D	0.03	.	4.2471	0.10677	0.7213:0.0:0.2787:0.0	.	117	Q8IWZ4	TRI48_HUMAN	I	133	ENSP00000402414:S133I	ENSP00000402414:S133I	S	+	2	0	TRIM48	54789305	0.000000	0.05858	0.045000	0.18777	0.232000	0.25224	-0.139000	0.10358	-0.425000	0.07371	-0.506000	0.04501	AGC	.		0.507	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
COX8A	1351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63743765	63743765	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:63743765C>G	ENST00000314133.3	+	2	257	c.183C>G	c.(181-183)caC>caG	p.H61Q	AP000721.4_ENST00000535431.1_Intron	NM_004074.2	NP_004065.1	P10176	COX8A_HUMAN	cytochrome c oxidase subunit VIIIA (ubiquitous)	61					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)										TCCTGTCACACCTGGAGACCT	0.587																																					p.H61Q		.											.	COX8A-226	0			c.C183G						.						200.0	160.0	173.0					11																	63743765		2201	4297	6498	SO:0001583	missense	1351	exon2			GTCACACCTGGAG	J04823	CCDS8054.1	11q12-q13	2011-07-04	2010-04-27	2004-03-24	ENSG00000176340	ENSG00000176340	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2294	protein-coding gene	gene with protein product		123870	"""cytochrome c oxidase subunit VIII"", ""cytochrome c oxidase subunit 8A (ubiquitous)"""	COX8		2543673, 2847943	Standard	NM_004074		Approved	COX8-2, COX8L, VIII-L, COX, VIII	uc001nye.3	P10176	OTTHUMG00000167785	ENST00000314133.3:c.183C>G	11.37:g.63743765C>G	ENSP00000321260:p.His61Gln	314	0		522	139	NM_004074	0	0	427	745	318	P15955	Missense_Mutation	SNP	ENST00000314133.3	37	CCDS8054.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425954	0.62733	.	.	ENSG00000176340	ENST00000314133	.	.	.	5.75	3.88	0.44766	Cytochrome c oxidase subunit VIII/photosystem I reaction centre subunit IX (1);	0.064498	0.64402	D	0.000010	T	0.47002	0.1422	.	.	.	0.34757	D	0.732368	B	0.33940	0.433	B	0.37091	0.241	T	0.59337	-0.7473	8	0.87932	D	0	-8.3625	8.2466	0.31693	0.0:0.7603:0.1565:0.0832	.	61	P10176	COX8A_HUMAN	Q	61	.	ENSP00000321260:H61Q	H	+	3	2	COX8A	63500341	0.967000	0.33354	0.996000	0.52242	0.629000	0.37895	0.650000	0.24858	0.774000	0.33427	0.655000	0.94253	CAC	.		0.587	COX8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396273.1	NM_004074	
SCYL1	57410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	65305494	65305494	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:65305494G>A	ENST00000270176.5	+	16	2165	c.2088G>A	c.(2086-2088)tgG>tgA	p.W696*	SCYL1_ENST00000279270.6_Nonsense_Mutation_p.W696*|SCYL1_ENST00000524944.1_Nonsense_Mutation_p.W696*|SCYL1_ENST00000527009.1_Nonsense_Mutation_p.W553*|SCYL1_ENST00000420247.2_Nonsense_Mutation_p.W679*|SCYL1_ENST00000533862.1_Missense_Mutation_p.G684E|SCYL1_ENST00000525364.1_Nonsense_Mutation_p.W695*|SCYL1_ENST00000534462.1_3'UTR	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	696					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						GGAGCAGCTGGGAAGCTGAGG	0.637																																					p.W696X		.											.	SCYL1-333	0			c.G2088A						.						34.0	36.0	35.0					11																	65305494		1905	4127	6032	SO:0001587	stop_gained	57410	exon16			CAGCTGGGAAGCT	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.2088G>A	11.37:g.65305494G>A	ENSP00000270176:p.Trp696*	35	0		45	18	NM_020680	0	0	62	73	11	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Nonsense_Mutation	SNP	ENST00000270176.5	37	CCDS41672.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.30|12.30	1.897578|1.897578	0.33535|0.33535	.|.	.|.	ENSG00000142186|ENSG00000142186	ENST00000533862|ENST00000270176;ENST00000525364;ENST00000420247;ENST00000279270;ENST00000524944;ENST00000527009;ENST00000528545	T|.	0.12774|.	2.65|.	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.000000	.|0.50627	.|D	.|0.000105	T|.	0.43612|.	0.1255|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	B|.	0.22746|.	0.074|.	B|.	0.20955|.	0.032|.	T|.	0.48375|.	-0.9041|.	7|.	0.05436|0.11485	T|T	0.98|0.65	.|.	12.6154|12.6154	0.56573|0.56573	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	684|.	Q96KG9-6|.	.|.	E|X	684|696;695;679;696;696;553;168	ENSP00000437254:G684E|.	ENSP00000437254:G684E|ENSP00000270176:W696X	G|W	+|+	2|3	0|0	SCYL1|SCYL1	65062070|65062070	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.319000|0.319000	0.28217|0.28217	6.160000|6.160000	0.71862|0.71862	2.126000|2.126000	0.65437|0.65437	0.561000|0.561000	0.74099|0.74099	GGG|TGG	.		0.637	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
FGF3	2248	hgsc.bcm.edu;bcgsc.ca	37	11	69625465	69625465	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:69625465G>T	ENST00000334134.2	-	3	418	c.328C>A	c.(328-330)Cac>Aac	p.H110N		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	110					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GCGCTGTAGTGCTCCTGCGGG	0.637																																					p.H110N		.											.	FGF3-847	0			c.C328A						.						33.0	37.0	35.0					11																	69625465		2194	4284	6478	SO:0001583	missense	2248	exon3			TGTAGTGCTCCTG		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.328C>A	11.37:g.69625465G>T	ENSP00000334122:p.His110Asn	128	1		168	53	NM_005247	0	0	1	1	0	Q0VG69	Missense_Mutation	SNP	ENST00000334134.2	37	CCDS8195.1	.	.	.	.	.	.	.	.	.	.	G	9.674	1.147585	0.21288	.	.	ENSG00000186895	ENST00000334134	T	0.80214	-1.35	3.92	1.64	0.23874	.	0.604005	0.17897	N	0.158317	T	0.54046	0.1834	N	0.02420	-0.555	0.25235	N	0.989798	B	0.09022	0.002	B	0.08055	0.003	T	0.38714	-0.9648	9	.	.	.	.	10.459	0.44567	0.0:0.0:0.4125:0.5875	.	110	P11487	FGF3_HUMAN	N	110	ENSP00000334122:H110N	.	H	-	1	0	FGF3	69334646	0.322000	0.24634	0.971000	0.41717	0.966000	0.64601	2.097000	0.41748	0.055000	0.16094	0.462000	0.41574	CAC	.		0.637	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	133805658	133805658	+	Splice_Site	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:133805658C>T	ENST00000321016.8	-	7	1052		c.e7-1		IGSF9B_ENST00000533871.2_Splice_Site			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B						homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTTCAGGTCGCTGCAAAGCGG	0.617																																					.		.											.	IGSF9B-68	0			c.822-1G>A						.						20.0	24.0	22.0					11																	133805658		2117	4221	6338	SO:0001630	splice_region_variant	22997	exon8			AGGTCGCTGCAAA	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.822-1G>A	11.37:g.133805658C>T		63	0		60	32	NM_014987	0	0	0	7	7	G5EA26	Splice_Site	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	C	33	5.219946	0.95139	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0502	0.93039	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF9B	133310868	1.000000	0.71417	0.166000	0.22797	0.790000	0.44656	5.713000	0.68415	2.560000	0.86352	0.561000	0.74099	.	.		0.617	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	Intron
CACNA1C	775	broad.mit.edu	37	12	2794927	2794927	+	Missense_Mutation	SNP	C	C	T	rs369421219		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:2794927C>T	ENST00000347598.4	+	46	5743	c.5743C>T	c.(5743-5745)Cgg>Tgg	p.R1915W	CACNA1C_ENST00000399634.1_Missense_Mutation_p.R1938W|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R1938W|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R1867W|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R1873W|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1902W|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R1902W|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R1886W|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R1892W|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R1875W|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R1867W|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R1875W|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R1908W|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R1867W|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R1886W|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R1867W|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R1867W|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R1884W|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R1895W|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R1887W|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R1886W|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R1867W	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1950					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGACGAAAATCGGCAACTGAC	0.602																																					p.R1950W													.	CACNA1C-34	0			c.C5848T						.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4017		0,1,2008	49.0	49.0	49.0		5599,5743,5722,5704,5683,5659,5656,5656,5656,5650,5623,5623,5617,5599,5599,5599,5599,5590,5566,5599,5704,5779,5848	3.3	0.9	12		49	0,8318		0,0,4159	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	CACNA1C	NM_000719.6,NM_001129827.1,NM_001129829.1,NM_001129830.1,NM_001129831.1,NM_001129832.1,NM_001129833.1,NM_001129834.1,NM_001129835.1,NM_001129836.1,NM_001129837.1,NM_001129838.1,NM_001129839.1,NM_001129840.1,NM_001129841.1,NM_001129842.1,NM_001129843.1,NM_001129844.1,NM_001129846.1,NM_001167623.1,NM_001167624.1,NM_001167625.1,NM_199460.2	101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101,101	0,1,6167	TT,TC,CC		0.0,0.0249,0.0081	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1867/2139,1915/2187,1908/2180,1902/2174,1895/2167,1887/2159,1886/2158,1886/2158,1886/2158,1884/2156,1875/2147,1875/2147,1873/2145,1867/2139,1867/2139,1867/2139,1867/2139,1864/2136,1856/2128,1867/2139,1902/2174,1927/2199,1950/2222	2794927	1,12335	2009	4159	6168	SO:0001583	missense	775	exon47			GAAAATCGGCAAC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5743C>T	12.37:g.2794927C>T	ENSP00000266376:p.Arg1915Trp	107	0		177	12	NM_199460	0	0	2	2	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165127	0.57476	2.49E-4	0.0	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51	4.26	3.28	0.37604	.	6.168900	0.00682	N	0.000692	T	0.70596	0.3242	L	0.50333	1.59	0.23478	N	0.997598	D;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.995;1.0;0.999;0.84;1.0;1.0;0.999;1.0;0.999;0.999;1.0;0.999;0.998;0.993;0.999;0.975;0.998;0.989;1.0;0.966;0.996;1.0;1.0;0.998;0.999	P;D;D;B;D;D;D;D;D;P;D;P;P;P;P;B;P;P;D;P;P;D;D;P;D	0.85130	0.757;0.977;0.932;0.368;0.997;0.951;0.926;0.967;0.944;0.888;0.967;0.859;0.861;0.685;0.803;0.386;0.861;0.827;0.953;0.71;0.791;0.967;0.953;0.802;0.932	T	0.56896	-0.7903	10	0.87932	D	0	.	11.5771	0.50869	0.2538:0.7462:0.0:0.0	.	558;1908;1864;1950;1902;1886;1867;1884;1895;1867;1887;1867;1898;1915;1867;1902;1938;1875;1873;1875;1856;1886;1886;1867;1867	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	W	1892;1867;1867;1895;1867;1886;1886;1875;1867;1915;1887;1867;1908;1884;1902;1873;1886;1867;1938;1902;1938;1875;1768	ENSP00000336982:R1892W;ENSP00000382563:R1867W;ENSP00000382552:R1867W;ENSP00000382547:R1895W;ENSP00000382506:R1867W;ENSP00000382530:R1886W;ENSP00000382546:R1886W;ENSP00000382500:R1875W;ENSP00000382549:R1867W;ENSP00000266376:R1915W;ENSP00000382515:R1887W;ENSP00000382510:R1867W;ENSP00000341092:R1908W;ENSP00000382537:R1884W;ENSP00000329877:R1902W;ENSP00000382557:R1873W;ENSP00000385724:R1886W;ENSP00000382512:R1867W;ENSP00000382542:R1938W;ENSP00000382526:R1902W;ENSP00000385896:R1938W;ENSP00000382504:R1875W	ENSP00000323129:R1768W	R	+	1	2	CACNA1C	2665188	0.998000	0.40836	0.950000	0.38849	0.685000	0.39939	1.926000	0.40084	2.202000	0.70862	0.449000	0.29647	CGG	.		0.602	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
MFSD5	84975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53647275	53647275	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:53647275T>G	ENST00000329548.4	+	2	847	c.656T>G	c.(655-657)cTt>cGt	p.L219R	MFSD5_ENST00000534842.1_Missense_Mutation_p.L326R	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	219					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						GCCTTGGCCCTTCGAAACTGG	0.662																																					p.L326R		.											.	MFSD5-93	0			c.T977G						.						56.0	61.0	59.0					12																	53647275		2203	4300	6503	SO:0001583	missense	84975	exon2			TGGCCCTTCGAAA	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.656T>G	12.37:g.53647275T>G	ENSP00000332624:p.Leu219Arg	195	1		347	124	NM_001170790	0	0	15	34	19	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	37	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009159	0.54361	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	D;D	0.81659	-1.52;-1.52	4.25	4.25	0.50352	Major facilitator superfamily domain, general substrate transporter (1);	0.083569	0.50627	D	0.000110	T	0.78591	0.4307	L	0.43598	1.365	0.53688	D	0.999976	P;D	0.54601	0.512;0.967	B;P	0.49085	0.286;0.6	T	0.79855	-0.1627	10	0.51188	T	0.08	-3.4608	12.4702	0.55783	0.0:0.0:0.0:1.0	.	219;326	Q6N075;G3V1N7	MFSD5_HUMAN;.	R	326;326;326;219	ENSP00000442688:L326R;ENSP00000332624:L219R	ENSP00000331231:L326R	L	+	2	0	MFSD5	51933542	1.000000	0.71417	0.901000	0.35422	0.859000	0.49053	5.709000	0.68384	1.783000	0.52377	0.459000	0.35465	CTT	.		0.662	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
SMARCC2	6601	broad.mit.edu;bcgsc.ca	37	12	56559482	56559482	+	Splice_Site	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:56559482A>G	ENST00000267064.4	-	26	2845	c.2759T>C	c.(2758-2760)cTg>cCg	p.L920P	SMARCC2_ENST00000394023.3_Splice_Site_p.L951P|SMARCC2_ENST00000550164.1_Splice_Site_p.L951P|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Splice_Site_p.L951P	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	920					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTGATACTCCAGCTGCCAGTG	0.527																																					p.L951P													.	SMARCC2-229	0			c.T2852C						.						41.0	42.0	42.0					12																	56559482		2195	4272	6467	SO:0001630	splice_region_variant	6601	exon27			TACTCCAGCTGCC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.2758-1T>C	12.37:g.56559482A>G		78	2		111	29	NM_139067	0	0	2	6	4	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072625	0.76415	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.64803	1.07;-0.12;-0.01;-0.04	4.51	4.51	0.55191	.	0.109060	0.37178	N	0.002208	T	0.78298	0.4261	M	0.79475	2.455	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.999;0.998	D;D;D;D;D	0.83275	0.994;0.996;0.994;0.994;0.996	T	0.81577	-0.0869	10	0.87932	D	0	-3.3912	13.2826	0.60224	1.0:0.0:0.0:0.0	.	840;951;955;920;951	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	P	951;951;951;920	ENSP00000377591:L951P;ENSP00000449396:L951P;ENSP00000302919:L951P;ENSP00000267064:L920P	ENSP00000267064:L920P	L	-	2	0	SMARCC2	54845749	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.755000	0.91646	2.042000	0.60477	0.529000	0.55759	CTG	.		0.527	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		Missense_Mutation
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	81661720	81661720	+	Silent	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:81661720A>G	ENST00000549396.1	-	29	3617	c.3457T>C	c.(3457-3459)Tta>Cta	p.L1153L	PPFIA2_ENST00000407050.4_Silent_p.L1052L|PPFIA2_ENST00000552948.1_Silent_p.L1132L|PPFIA2_ENST00000550359.2_Silent_p.L1000L|PPFIA2_ENST00000549325.1_Silent_p.L1138L|PPFIA2_ENST00000550584.2_Silent_p.L1153L|PPFIA2_ENST00000333447.7_Silent_p.L1141L|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000541570.2_Silent_p.L689L|PPFIA2_ENST00000443686.3_Silent_p.L1048L|PPFIA2_ENST00000548586.1_Silent_p.L1147L|PPFIA2_ENST00000541017.1_Silent_p.L339L|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1153	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						ATCTGTAATAATAAAGCTAAG	0.363																																					p.L1153L		.											.	PPFIA2-231	0			c.T3457C						.						68.0	66.0	67.0					12																	81661720		1846	4101	5947	SO:0001819	synonymous_variant	8499	exon28			GTAATAATAAAGC	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3457T>C	12.37:g.81661720A>G		33	0		32	8	NM_001220473	0	0	2	2	0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	37	CCDS55857.1																																																																																			.		0.363	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
ATXN2	6311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	111963052	111963052	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:111963052A>G	ENST00000377617.3	-	6	1281	c.1120T>C	c.(1120-1122)Tgg>Cgg	p.W374R	ATXN2_ENST00000608853.1_Missense_Mutation_p.W214R|ATXN2_ENST00000535949.1_Missense_Mutation_p.W85R|ATXN2_ENST00000389153.4_Missense_Mutation_p.W109R|ATXN2_ENST00000542287.2_Missense_Mutation_p.W109R|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000550104.1_Missense_Mutation_p.W374R	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	374					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CCTGCATCCCAGGGCTCCAGG	0.418																																					p.W374R		.											.	ATXN2-136	0			c.T1120C						.						160.0	139.0	146.0					12																	111963052		2203	4300	6503	SO:0001583	missense	6311	exon6			CATCCCAGGGCTC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1120T>C	12.37:g.111963052A>G	ENSP00000366843:p.Trp374Arg	218	1		116	42	NM_002973	0	0	12	18	6	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391860	0.83011	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000471866;ENST00000548492	D;D	0.89617	-2.2;-2.54	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.93641	0.7969	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.998;1.0	D;D;D;D	0.87578	0.996;0.996;0.994;0.998	D	0.94295	0.7532	10	0.87932	D	0	-4.5283	15.8835	0.79222	1.0:0.0:0.0:0.0	.	109;374;85;109	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	R	109;374;374;109;85;50;117	ENSP00000366843:W374R;ENSP00000446576:W374R	ENSP00000366843:W374R	W	-	1	0	ATXN2	110447435	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	8.648000	0.91062	2.212000	0.71576	0.460000	0.39030	TGG	.		0.418	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
ZNF10	7556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	133732280	133732280	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:133732280G>C	ENST00000248211.6	+	5	670	c.448G>C	c.(448-450)Gtg>Ctg	p.V150L	CTD-2140B24.4_ENST00000540096.2_Intron|ZNF10_ENST00000426665.2_Missense_Mutation_p.V150L|ZNF268_ENST00000416488.1_Intron|ZNF10_ENST00000402932.2_Intron	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	150				Missing (in Ref. 1). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TTTGAGGCAAGTGGCATTCAC	0.428																																					p.V150L		.											.	ZNF10-154	0			c.G448C						.						110.0	106.0	107.0					12																	133732280		2203	4300	6503	SO:0001583	missense	7556	exon5			AGGCAAGTGGCAT	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.448G>C	12.37:g.133732280G>C	ENSP00000248211:p.Val150Leu	148	0		43	10	NM_015394	0	0	8	12	4	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273178	0.40194	.	.	ENSG00000256223	ENST00000248211;ENST00000426665;ENST00000537119	T;T;T	0.05447	3.44;3.44;4.56	4.44	4.44	0.53790	.	0.698949	0.11773	N	0.530882	T	0.04137	0.0115	N	0.16708	0.43	0.80722	D	1	P	0.34662	0.462	B	0.31614	0.133	T	0.51252	-0.8729	9	.	.	.	.	8.5148	0.33239	0.1041:0.0:0.8959:0.0	.	150	P21506	ZNF10_HUMAN	L	150;150;108	ENSP00000248211:V150L;ENSP00000393814:V150L;ENSP00000437397:V108L	.	V	+	1	0	ZNF10	132242353	0.671000	0.27521	1.000000	0.80357	0.991000	0.79684	1.986000	0.40677	2.460000	0.83146	0.655000	0.94253	GTG	.		0.428	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
IL17D	53342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21295994	21295994	+	Silent	SNP	C	C	T	rs372465901		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr13:21295994C>T	ENST00000304920.3	+	3	618	c.510C>T	c.(508-510)gtC>gtT	p.V170V		NM_138284.1	NP_612141.1	Q8TAD2	IL17D_HUMAN	interleukin 17D	170					inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|skin(1)	2		all_cancers(29;9.63e-24)|all_epithelial(30;1.09e-19)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000301)|Epithelial(112;0.000633)|OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Lung(94;0.0154)|LUSC - Lung squamous cell carcinoma(192;0.0414)		GCACCTGCGTCCCCGAGCCGG	0.706																																					p.V170V		.											.	IL17D-90	0			c.C510T						.						39.0	39.0	39.0					13																	21295994		2190	4279	6469	SO:0001819	synonymous_variant	53342	exon3			CTGCGTCCCCGAG	AY078238	CCDS9292.1	13q11	2008-07-18			ENSG00000172458	ENSG00000172458		"""Interleukins and interleukin receptors"""	5984	protein-coding gene	gene with protein product	"""interleukin 27"""	607587				12097364	Standard	NM_138284		Approved	IL-22, IL-27, IL-17D, IL27, FLJ30846	uc001unm.3	Q8TAD2	OTTHUMG00000016521	ENST00000304920.3:c.510C>T	13.37:g.21295994C>T		104	0		209	72	NM_138284	0	0	0	0	0	B1AM69	Silent	SNP	ENST00000304920.3	37	CCDS9292.1																																																																																			.		0.706	IL17D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044087.1	NM_138284	
UPF3A	65110	hgsc.bcm.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		21	0		26	4	NM_080687	0	0	23	23	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
TCL1B	9623	ucsc.edu	37	14	96157639	96157639	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr14:96157639A>G	ENST00000340722.7	+	3	419	c.368A>G	c.(367-369)cAg>cGg	p.Q123R	RP11-1070N10.6_ENST00000461160.1_RNA	NM_004918.3	NP_004909.1	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	123										cervix(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		CTAACATATCAGCCGGAGAGG	0.547																																					p.Q123R													.	TCL1B-91	0			c.A368G						.						90.0	79.0	82.0					14																	96157639		2203	4300	6503	SO:0001583	missense	9623	exon3			CATATCAGCCGGA	AB018563	CCDS32151.1	14q32.1	2008-09-05			ENSG00000213231	ENSG00000213231			11649	protein-coding gene	gene with protein product		603769				10077617	Standard	NM_004918		Approved	TML1	uc001yez.3	O95988	OTTHUMG00000028912	ENST00000340722.7:c.368A>G	14.37:g.96157639A>G	ENSP00000343223:p.Gln123Arg	38	0		51	4	NM_004918	0	0	0	0	0	A6NEK7|Q6IAR7|Q9UBQ4	Missense_Mutation	SNP	ENST00000340722.7	37	CCDS32151.1	.	.	.	.	.	.	.	.	.	.	A	3.956	-0.011387	0.07727	.	.	ENSG00000213231	ENST00000340722;ENST00000538038	T	0.29397	1.57	2.4	-3.21	0.05140	.	.	.	.	.	T	0.10637	0.0260	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.31447	-0.9943	9	0.14656	T	0.56	0.0694	2.2796	0.04111	0.2791:0.0:0.3108:0.4101	.	123	O95988	TCL1B_HUMAN	R	123	ENSP00000343223:Q123R	ENSP00000343223:Q123R	Q	+	2	0	TCL1B	95227392	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.046000	0.01409	-0.616000	0.05671	0.260000	0.18958	CAG	.		0.547	TCL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315123.2		
AP4E1	23431	hgsc.bcm.edu;broad.mit.edu	37	15	51285604	51285604	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr15:51285604T>G	ENST00000261842.5	+	17	2234	c.2128T>G	c.(2128-2130)Tgg>Ggg	p.W710G	AP4E1_ENST00000560508.1_Missense_Mutation_p.W635G	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	710					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AAAGAAATTGTGGGGGAAAGA	0.383																																					p.W710G		.											.	AP4E1-90	0			c.T2128G						.						66.0	61.0	63.0					15																	51285604		2196	4294	6490	SO:0001583	missense	23431	exon17			AAATTGTGGGGGA	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2128T>G	15.37:g.51285604T>G	ENSP00000261842:p.Trp710Gly	106	0		25	3	NM_007347	0	0	3	6	3	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	37	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936539	0.73442	.	.	ENSG00000081014	ENST00000261842	T	0.60920	0.15	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.70517	-0.4850	10	0.87932	D	0	-4.9167	14.4124	0.67124	0.0:0.0:0.0:1.0	.	710	Q9UPM8	AP4E1_HUMAN	G	710	ENSP00000261842:W710G	ENSP00000261842:W710G	W	+	1	0	AP4E1	49072896	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.406000	0.73276	1.988000	0.58038	0.460000	0.39030	TGG	.		0.383	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
IGF1R	3480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	99465632	99465632	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr15:99465632C>A	ENST00000268035.6	+	11	3068	c.2457C>A	c.(2455-2457)aaC>aaA	p.N819K	IGF1R_ENST00000558762.1_Missense_Mutation_p.N819K	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	819	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCGCCTCCAACTTCGTCTTTG	0.517																																					p.N819K		.											.	IGF1R-1490	0			c.C2457A						.						105.0	102.0	103.0					15																	99465632		2197	4297	6494	SO:0001583	missense	3480	exon11			CTCCAACTTCGTC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2457C>A	15.37:g.99465632C>A	ENSP00000268035:p.Asn819Lys	209	0		350	122	NM_000875	0	0	8	18	10	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695512	0.48202	.	.	ENSG00000140443	ENST00000268035	T	0.68624	-0.34	5.5	4.59	0.56863	Immunoglobulin-like fold (1);	0.086755	0.47455	N	0.000239	T	0.57169	0.2035	L	0.44542	1.39	0.50171	D	0.999854	B;B	0.33964	0.434;0.18	B;B	0.34489	0.184;0.109	T	0.58747	-0.7582	10	0.54805	T	0.06	.	9.3354	0.38047	0.1455:0.7829:0.0:0.0716	.	819;819	C9J5X1;P08069	.;IGF1R_HUMAN	K	819	ENSP00000268035:N819K	ENSP00000268035:N819K	N	+	3	2	IGF1R	97283155	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.087000	0.30865	1.319000	0.45190	-0.127000	0.14921	AAC	.		0.517	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
MKL2	57496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14346228	14346228	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:14346228T>G	ENST00000341243.5	+	13	2539	c.2539T>G	c.(2539-2541)Tca>Gca	p.S847A	MKL2_ENST00000574045.1_Missense_Mutation_p.S808A|MKL2_ENST00000571589.1_Missense_Mutation_p.S858A|MKL2_ENST00000318282.5_Missense_Mutation_p.S808A			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	847					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACAGCCTAGTTCACCCCCGCC	0.522																																					p.S808A		.											.	MKL2-95	0			c.T2422G						.						111.0	107.0	108.0					16																	14346228		2197	4300	6497	SO:0001583	missense	57496	exon15			CCTAGTTCACCCC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.2539T>G	16.37:g.14346228T>G	ENSP00000345841:p.Ser847Ala	208	0		246	70	NM_014048	0	0	2	2	0	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		.	.	.	.	.	.	.	.	.	.	T	15.37	2.812492	0.50527	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.98	4.89	0.63831	.	0.443487	0.25106	N	0.033091	T	0.29882	0.0747	L	0.41710	1.295	0.20563	N	0.999886	B;B	0.19583	0.022;0.037	B;B	0.15052	0.005;0.012	T	0.19353	-1.0308	9	0.22706	T	0.39	-7.812	6.5315	0.22330	0.1376:0.0725:0.0:0.7899	.	858;808	B4DGT8;Q9ULH7-4	.;.	A	808;847	.	ENSP00000339086:S808A	S	+	1	0	MKL2	14253729	1.000000	0.71417	0.041000	0.18516	0.317000	0.28152	4.265000	0.58865	1.089000	0.41292	-0.250000	0.11733	TCA	.		0.522	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
BFAR	51283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14755800	14755800	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:14755800C>G	ENST00000261658.2	+	6	1112	c.835C>G	c.(835-837)Ccc>Gcc	p.P279A	BFAR_ENST00000563971.1_Missense_Mutation_p.P154A|BFAR_ENST00000426842.2_Missense_Mutation_p.P151A	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	279					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CAAGAGCTCCCCCAGGCTGAG	0.567																																					p.P279A		.											.	BFAR-92	0			c.C835G						.						222.0	192.0	202.0					16																	14755800		2197	4300	6497	SO:0001583	missense	51283	exon6			AGCTCCCCCAGGC	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.835C>G	16.37:g.14755800C>G	ENSP00000261658:p.Pro279Ala	325	0		478	175	NM_016561	0	0	22	36	14	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	ENST00000261658.2	37	CCDS10554.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524396	0.64747	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.55760	2.85;0.5	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.991;0.997;0.996	T	0.67142	-0.5745	10	0.87932	D	0	.	18.1703	0.89743	0.0:1.0:0.0:0.0	.	151;279;279	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	A	279;151	ENSP00000261658:P279A;ENSP00000400634:P151A	ENSP00000261658:P279A	P	+	1	0	BFAR	14663301	1.000000	0.71417	0.584000	0.28653	0.249000	0.25844	7.391000	0.79828	2.513000	0.84729	0.655000	0.94253	CCC	.		0.567	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
SMG1	23049	broad.mit.edu;ucsc.edu	37	16	18851234	18851234	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:18851234C>T	ENST00000446231.2	-	42	7143	c.6731G>A	c.(6730-6732)gGa>gAa	p.G2244E	SMG1_ENST00000389467.3_Missense_Mutation_p.G2244E			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2244	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GGGTACAATTCCAGGATTCTG	0.388																																					p.G2244E													.	SMG1-1160	0			c.G6731A						.						36.0	32.0	33.0					16																	18851234		1802	4074	5876	SO:0001583	missense	23049	exon42			ACAATTCCAGGAT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6731G>A	16.37:g.18851234C>T	ENSP00000402515:p.Gly2244Glu	28	0		14	3	NM_015092	0	0	8	14	6	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292945	0.60086	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01005	5.45;5.45	5.71	5.71	0.89125	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.101740	0.44483	D	0.000456	T	0.01156	0.0038	N	0.20766	0.605	0.29434	N	0.859676	B;B	0.31413	0.275;0.322	B;B	0.37422	0.161;0.249	T	0.55780	-0.8087	10	0.26408	T	0.33	.	15.3437	0.74317	0.0:0.861:0.139:0.0	.	2104;2244	Q96Q15-2;Q96Q15	.;SMG1_HUMAN	E	2244	ENSP00000402515:G2244E;ENSP00000374118:G2244E	ENSP00000374118:G2244E	G	-	2	0	SMG1	18758735	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.464000	0.53057	2.701000	0.92244	0.563000	0.77884	GGA	.		0.388	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
GPRC5B	51704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19884048	19884048	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:19884048G>A	ENST00000300571.2	-	2	311	c.120C>T	c.(118-120)gaC>gaT	p.D40D	GPRC5B_ENST00000535671.1_Silent_p.D40D|GPRC5B_ENST00000537135.1_Silent_p.D66D|GPRC5B_ENST00000569479.1_Silent_p.D40D|GPRC5B_ENST00000569847.1_Silent_p.D40D	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	40					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GAGGGAGGAGGTCCAGCCCAC	0.637																																					p.D40D		.											.	GPRC5B-523	0			c.C120T						.						50.0	51.0	51.0					16																	19884048		2197	4300	6497	SO:0001819	synonymous_variant	51704	exon2			GAGGAGGTCCAGC	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.120C>T	16.37:g.19884048G>A		115	0		207	82	NM_016235	0	0	1	7	6	D2DFB0|O75205|Q8NBZ8	Silent	SNP	ENST00000300571.2	37	CCDS10581.1																																																																																			.		0.637	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1		
BCL7C	9274	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	30899187	30899187	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:30899187C>T	ENST00000215115.4	-	6	1668	c.653G>A	c.(652-654)tGa>tAa	p.*218*	AC106782.20_ENST00000572471.1_RNA|BCL7C_ENST00000380317.4_Intron|MIR4519_ENST00000565573.1_RNA|MIR4519_ENST00000570025.1_RNA|MIR4519_ENST00000564901.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	0					apoptotic process (GO:0006915)			p.*218L(1)		large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			GCCGGCTTCTCAGGGGTCAGG	0.592																																					p.X218X		.											.	BCL7C-227	1	Nonstop extension(1)	lung(1)	c.G653A						.						81.0	107.0	98.0					16																	30899187		2196	4300	6496	SO:0001819	synonymous_variant	9274	exon6			GCTTCTCAGGGGT	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.653G>A	16.37:g.30899187C>T		404	0		677	259	NM_004765	0	0	27	54	27	O43770|Q6PD89	Silent	SNP	ENST00000215115.4	37	CCDS10693.1																																																																																			.		0.592	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765	
ZNF423	23090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	49671278	49671278	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:49671278G>T	ENST00000561648.1	-	4	1838	c.1785C>A	c.(1783-1785)caC>caA	p.H595Q	ZNF423_ENST00000562871.1_Missense_Mutation_p.H535Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.H535Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.H478Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.H595Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.H478Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.H535Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	595					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ACTTCTTGCTGTGGGCCAGTG	0.572																																					p.H595Q		.											.	ZNF423-228	0			c.C1785A						.						127.0	100.0	109.0					16																	49671278		2198	4300	6498	SO:0001583	missense	23090	exon4			CTTGCTGTGGGCC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1785C>A	16.37:g.49671278G>T	ENSP00000455426:p.His595Gln	150	0		318	99	NM_015069	0	0	0	6	6	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	8.424	0.846973	0.17034	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08634	3.07;3.14	4.78	2.8	0.32819	.	0.047718	0.85682	D	0.000000	T	0.05273	0.0140	N	0.24115	0.695	0.37616	D	0.921121	B	0.26120	0.142	B	0.24394	0.053	T	0.43702	-0.9375	9	.	.	.	.	8.2567	0.31760	0.2436:0.0:0.7564:0.0	.	595	Q2M1K9	ZN423_HUMAN	Q	595;478	ENSP00000262383:H595Q;ENSP00000442321:H478Q	.	H	-	3	2	ZNF423	48228779	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.823000	0.55715	0.439000	0.26476	0.561000	0.74099	CAC	.		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
BBS2	583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56531663	56531663	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:56531663G>A	ENST00000245157.5	-	14	2209	c.1789C>T	c.(1789-1791)Cta>Tta	p.L597L	BBS2_ENST00000568104.1_Intron	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	597					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						ACCTTAACTAGCACCTTTCGT	0.373									Bardet-Biedl syndrome																												p.L597L		.											.	BBS2-91	0			c.C1789T						.						141.0	133.0	136.0					16																	56531663		2198	4300	6498	SO:0001819	synonymous_variant	583	exon14	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TAACTAGCACCTT	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.1789C>T	16.37:g.56531663G>A		282	0		75	31	NM_031885	0	0	0	4	4	Q96CM0|Q96SN9	Silent	SNP	ENST00000245157.5	37	CCDS32451.1																																																																																			.		0.373	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
ZC3H18	124245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88653023	88653023	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:88653023G>T	ENST00000301011.5	+	3	819	c.619G>T	c.(619-621)Gaa>Taa	p.E207*	ZC3H18_ENST00000452588.2_Nonsense_Mutation_p.E207*	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	207						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TGACCTGGAAGAAGGTGAAGT	0.542																																					p.E207X	Ovarian(121;375 2276 20373 38669)	.											.	ZC3H18-69	0			c.G619T						.						136.0	105.0	116.0					16																	88653023		2198	4300	6498	SO:0001587	stop_gained	124245	exon3			CTGGAAGAAGGTG	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.619G>T	16.37:g.88653023G>T	ENSP00000301011:p.Glu207*	93	0		166	40	NM_144604	0	0	12	14	2	Q96DG4|Q96MP7	Nonsense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	G	41	8.860379	0.98980	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-25.7045	18.3833	0.90457	0.0:0.0:1.0:0.0	.	.	.	.	X	207;207;207;90	.	ENSP00000289509:E207X	E	+	1	0	ZC3H18	87180524	1.000000	0.71417	0.978000	0.43139	0.763000	0.43281	9.161000	0.94739	2.350000	0.79820	0.462000	0.41574	GAA	.		0.542	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
C17orf107	100130311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4800540	4800540	+	5'Flank	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:4800540T>G	ENST00000381365.3	+	0	0				MINK1_ENST00000355280.6_Silent_p.V1319V|MINK1_ENST00000453408.3_Silent_p.V1299V|MINK1_ENST00000347992.7_Silent_p.V1290V|C17orf107_ENST00000521575.1_5'Flank	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107											endometrium(2)	2						GCAGCCAAGTTTACTTCATGA	0.612																																					p.V1319V		.											.	MINK1-943	0			c.T3957G						.						71.0	73.0	72.0					17																	4800540		1933	4140	6073	SO:0001631	upstream_gene_variant	50488	exon32			CCAAGTTTACTTC	AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838		17.37:g.4800540T>G	Exception_encountered	72	0		96	26	NM_153827	0	0	65	142	77		Silent	SNP	ENST00000381365.3	37	CCDS45591.1																																																																																			.		0.612	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380556.1	NM_001145536	
YBX2	51087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7193332	7193332	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:7193332C>A	ENST00000007699.5	-	6	866	c.803G>T	c.(802-804)gGa>gTa	p.G268V	YBX2_ENST00000570627.1_5'Flank	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	268	Pro-rich.|Required for mRNA-binding.				mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						TCGCTCATCTCCCTGCTGTTG	0.632																																					p.G268V		.											.	YBX2-90	0			c.G803T						.						52.0	55.0	54.0					17																	7193332		2203	4300	6503	SO:0001583	missense	51087	exon6			TCATCTCCCTGCT	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.803G>T	17.37:g.7193332C>A	ENSP00000007699:p.Gly268Val	151	0		274	112	NM_015982	0	0	0	0	0	D3DTP1|Q8N4P0	Missense_Mutation	SNP	ENST00000007699.5	37	CCDS11098.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845908	0.51164	.	.	ENSG00000006047	ENST00000007699	T	0.29142	1.58	5.34	5.34	0.76211	.	0.251035	0.34750	N	0.003707	T	0.52370	0.1730	M	0.62723	1.935	0.53688	D	0.999978	D	0.89917	1.0	D	0.74023	0.982	T	0.52426	-0.8577	10	0.72032	D	0.01	-13.9828	14.9276	0.70890	0.0:1.0:0.0:0.0	.	268	Q9Y2T7	YBOX2_HUMAN	V	268	ENSP00000007699:G268V	ENSP00000007699:G268V	G	-	2	0	YBX2	7134056	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.987000	0.49378	2.689000	0.91719	0.462000	0.41574	GGA	.		0.632	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440172.2	NM_015982	
SPEM1	374768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7324267	7324267	+	Silent	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:7324267C>A	ENST00000323675.3	+	3	298	c.273C>A	c.(271-273)gtC>gtA	p.V91V	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	91					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CTCCTGCAGTCCATCTTCGGT	0.597																																					p.V91V		.											.	SPEM1-90	0			c.C273A						.						112.0	120.0	117.0					17																	7324267		2106	4203	6309	SO:0001819	synonymous_variant	374768	exon3			TGCAGTCCATCTT	AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.273C>A	17.37:g.7324267C>A		176	0		335	133	NM_199339	0	0	0	0	0		Silent	SNP	ENST00000323675.3	37	CCDS42254.1																																																																																			.		0.597	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440932.1	NM_199339	
GUCY2D	3000	hgsc.bcm.edu;broad.mit.edu	37	17	7919305	7919305	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:7919305A>C	ENST00000254854.4	+	17	3254	c.3104A>C	c.(3103-3105)tAc>tCc	p.Y1035S		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	1035					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GACTCGGGCTACCAGGTGGAG	0.697																																					p.Y1035S		.											.	GUCY2D-319	0			c.A3104C						.						34.0	29.0	30.0					17																	7919305		2202	4299	6501	SO:0001583	missense	3000	exon17			CGGGCTACCAGGT	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.3104A>C	17.37:g.7919305A>C	ENSP00000254854:p.Tyr1035Ser	32	1		37	12	NM_000180	0	0	0	0	0	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.268354	0.59540	.	.	ENSG00000132518	ENST00000254854	T	0.80824	-1.42	4.22	3.12	0.35913	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.133374	0.34652	N	0.003784	D	0.86797	0.6019	M	0.90977	3.165	0.30085	N	0.808806	P	0.48503	0.911	P	0.51974	0.686	D	0.84338	0.0525	10	0.87932	D	0	.	7.7707	0.29006	0.352:0.0:0.0:0.648	.	1035	Q02846	GUC2D_HUMAN	S	1035	ENSP00000254854:Y1035S	ENSP00000254854:Y1035S	Y	+	2	0	GUCY2D	7860030	0.971000	0.33674	0.996000	0.52242	0.784000	0.44337	1.713000	0.37951	0.753000	0.32945	0.260000	0.18958	TAC	.		0.697	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
NCOR1	9611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	15964734	15964734	+	Silent	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:15964734A>G	ENST00000268712.3	-	37	6119	c.5862T>C	c.(5860-5862)agT>agC	p.S1954S	NCOR1_ENST00000395851.1_Intron|NCOR1_ENST00000395857.3_Silent_p.S538S	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1954	Interaction with C1D. {ECO:0000250}.|Poly-Ser.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AAGAGTCTGAACTTTGAGAGC	0.428																																					p.S1954S		.											.	NCOR1-229	0			c.T5862C						.						219.0	200.0	206.0					17																	15964734		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon37			GTCTGAACTTTGA	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5862T>C	17.37:g.15964734A>G		367	0		325	87	NM_006311	0	0	15	28	13	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	CCDS11175.1																																																																																			.		0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
MAPK7	5598	hgsc.bcm.edu	37	17	19285267	19285267	+	Missense_Mutation	SNP	C	C	T	rs144954037	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:19285267C>T	ENST00000308406.5	+	5	2037	c.1651C>T	c.(1651-1653)Ccc>Tcc	p.P551S	MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000299612.7_Missense_Mutation_p.P412S|MAPK7_ENST00000395602.4_Missense_Mutation_p.P551S|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395604.3_Missense_Mutation_p.P551S	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	551	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CTCTGGGGGCCCCTCCACTGA	0.677													C|||	36	0.0071885	0.0257	0.0029	5008	,	,		10870	0.0		0.0	False		,,,				2504	0.0				p.P551S		.											.	MAPK7-1402	0			c.C1651T						.	C	SER/PRO,SER/PRO,SER/PRO,SER/PRO	72,3880		1,70,1905	10.0	20.0	17.0		1651,1234,1651,1651	4.2	1.0	17	dbSNP_134	17	0,7860		0,0,3930	yes	missense,missense,missense,missense	MAPK7	NM_002749.3,NM_139032.2,NM_139033.2,NM_139034.2	74,74,74,74	1,70,5835	TT,TC,CC		0.0,1.8219,0.6095	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	551/817,412/678,551/817,551/817	19285267	72,11740	1976	3930	5906	SO:0001583	missense	5598	exon5			GGGGGCCCCTCCA	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1651C>T	17.37:g.19285267C>T	ENSP00000311005:p.Pro551Ser	3	2		9	7	NM_002749	0	0	10	24	14	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	22	0.010073260073260074	19	0.03861788617886179	0	0.0	1	0.0017482517482517483	2	0.002638522427440633	C	17.38	3.374357	0.61735	0.018219	0.0	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.73152	-0.49;-0.72;-0.49;-0.49	5.16	4.19	0.49359	.	0.251911	0.30455	N	0.009581	T	0.25044	0.0608	L	0.27053	0.805	0.27227	N	0.959505	B	0.02656	0.0	B	0.04013	0.001	T	0.42310	-0.9459	10	0.59425	D	0.04	-8.4654	11.3923	0.49822	0.0:0.9108:0.0:0.0892	.	551	Q13164	MK07_HUMAN	S	551;412;551;551	ENSP00000311005:P551S;ENSP00000299612:P412S;ENSP00000378968:P551S;ENSP00000378966:P551S	ENSP00000299612:P412S	P	+	1	0	MAPK7	19225860	0.024000	0.19004	0.993000	0.49108	0.942000	0.58702	1.510000	0.35790	1.162000	0.42619	0.561000	0.74099	CCC	C|0.990;T|0.010		0.677	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
PLEKHH3	79990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40821477	40821477	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:40821477C>A	ENST00000591022.1	-	12	2563	c.2176G>T	c.(2176-2178)Gag>Tag	p.E726*	PLEKHH3_ENST00000412503.1_Nonsense_Mutation_p.E549*|PLEKHH3_ENST00000293349.6_Nonsense_Mutation_p.E723*|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	726	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		AGCTGGCTCTCTCCCACCCTC	0.622																																					p.E726X		.											.	PLEKHH3-158	0			c.G2176T						.						20.0	23.0	22.0					17																	40821477		2202	4300	6502	SO:0001587	stop_gained	79990	exon12			GGCTCTCTCCCAC	BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.2176G>T	17.37:g.40821477C>A	ENSP00000468678:p.Glu726*	68	0		114	48	NM_024927	0	0	25	49	24	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Nonsense_Mutation	SNP	ENST00000591022.1	37	CCDS11434.1	.	.	.	.	.	.	.	.	.	.	C	41	8.827108	0.98968	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	.	.	.	4.43	4.43	0.53597	.	0.336296	0.21518	N	0.073272	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-10.0927	16.1774	0.81862	0.0:1.0:0.0:0.0	.	.	.	.	X	726;549	.	ENSP00000293349:E726X	E	-	1	0	PLEKHH3	38075003	0.999000	0.42202	0.997000	0.53966	0.955000	0.61496	3.927000	0.56499	2.465000	0.83290	0.655000	0.94253	GAG	.		0.622	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	NM_024927	
UBTF	7343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42289718	42289718	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:42289718C>G	ENST00000302904.4	-	8	1257	c.765G>C	c.(763-765)gaG>gaC	p.E255D	UBTF_ENST00000527034.1_Intron|UBTF_ENST00000529383.1_Missense_Mutation_p.E255D|UBTF_ENST00000533177.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000393606.3_Intron|UBTF_ENST00000343638.5_Intron|UBTF_ENST00000526094.1_Intron|UBTF_ENST00000436088.1_Missense_Mutation_p.E255D			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	255					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TAACCTCGTACTCCTTCCGCT	0.617																																					p.E255D		.											.	UBTF-90	0			c.G765C						.						97.0	90.0	93.0					17																	42289718		2203	4300	6503	SO:0001583	missense	7343	exon8			CTCGTACTCCTTC	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.765G>C	17.37:g.42289718C>G	ENSP00000302640:p.Glu255Asp	192	2		290	103	NM_014233	0	0	0	0	0	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	c	12.04	1.818327	0.32145	.	.	ENSG00000108312	ENST00000302904;ENST00000436088;ENST00000529383	D;D;D	0.98207	-4.79;-4.79;-4.79	4.15	4.15	0.48705	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.520474	0.19709	N	0.107851	D	0.91908	0.7438	N	0.02539	-0.55	0.36012	D	0.838154	B	0.09022	0.002	B	0.15052	0.012	D	0.90257	0.4298	10	0.30078	T	0.28	-23.3092	10.3677	0.44035	0.0:0.9073:0.0:0.0927	.	255	P17480	UBF1_HUMAN	D	255	ENSP00000302640:E255D;ENSP00000390669:E255D;ENSP00000435708:E255D	ENSP00000302640:E255D	E	-	3	2	UBTF	39645244	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.080000	0.50112	2.305000	0.77605	0.456000	0.33151	GAG	.		0.617	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
MEX3D	399664	hgsc.bcm.edu	37	19	1555892	1555892	+	Silent	SNP	G	G	A	rs543107043	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:1555892G>A	ENST00000402693.4	-	2	1625	c.1626C>T	c.(1624-1626)tcC>tcT	p.S542S	MEX3D_ENST00000388824.6_Silent_p.S542S|AC027307.2_ENST00000581992.1_RNA|AC027307.1_ENST00000410788.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D	542					mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTCGCCAGGACAGCGCGC	0.816													G|||	65	0.0129792	0.0477	0.0029	5008	,	,		4540	0.0		0.0	False		,,,				2504	0.0				p.S542S		.											.	MEX3D-658	0			c.C1626T						.						1.0	1.0	1.0					19																	1555892		484	1166	1650	SO:0001819	synonymous_variant	399664	exon2			TCGCCAGGACAGC	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.1626C>T	19.37:g.1555892G>A		0	0		2	2	NM_203304	0	0	0	0	0	A0PJL8|A1L023|E9PAL6|Q71M49	Silent	SNP	ENST00000402693.4	37	CCDS32865.2																																																																																			.		0.816	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
GNA11	2767	hgsc.bcm.edu	37	19	3110145	3110145	+	Splice_Site	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:3110145A>C	ENST00000078429.4	+	2	378		c.e2-1			NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)						action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CCCGTCCCCCAGGCACGGGCG	0.692			Mis		uveal melanoma																																.		.		Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	.	GNA11-1957	0			c.137-2A>C						.						24.0	19.0	21.0					19																	3110145		2202	4299	6501	SO:0001630	splice_region_variant	2767	exon2			TCCCCCAGGCACG	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.137-1A>C	19.37:g.3110145A>C		18	2		39	5	NM_002067	0	0	0	0	0	O15109|Q14350|Q6IB00	Splice_Site	SNP	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	A	12.98	2.100153	0.37048	.	.	ENSG00000088256	ENST00000078429	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8583	0.52451	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GNA11	3061145	1.000000	0.71417	0.957000	0.39632	0.158000	0.22134	9.110000	0.94302	1.468000	0.48064	0.454000	0.30748	.	.		0.692	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2	NM_002067	Intron
TIMM44	10469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8002997	8002997	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:8002997T>A	ENST00000270538.3	-	3	495	c.227A>T	c.(226-228)gAa>gTa	p.E76V		NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	76					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TTCTTTCATTTCTTTGTTTTT	0.393																																					p.E76V		.											.	TIMM44-91	0			c.A227T						.						194.0	192.0	193.0					19																	8002997		2203	4300	6503	SO:0001583	missense	10469	exon3			TTCATTTCTTTGT	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.227A>T	19.37:g.8002997T>A	ENSP00000270538:p.Glu76Val	319	0		485	164	NM_006351	0	0	16	32	16	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	ENST00000270538.3	37	CCDS12192.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.629496	0.87660	.	.	ENSG00000104980	ENST00000270538	D	0.87491	-2.26	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.93625	0.7964	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94461	0.7676	10	0.87932	D	0	-30.5113	13.3329	0.60500	0.0:0.0:0.0:1.0	.	76	O43615	TIM44_HUMAN	V	76	ENSP00000270538:E76V	ENSP00000270538:E76V	E	-	2	0	TIMM44	7908997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	2.047000	0.60756	0.528000	0.53228	GAA	.		0.393	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3		
OR7E24	26648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9362275	9362275	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:9362275T>G	ENST00000456448.1	+	1	670	c.556T>G	c.(556-558)Tgc>Ggc	p.C186G		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						ACAGCTCACCTGCTTCAAGGA	0.403																																					p.C186G		.											.	OR7E24-47	0			c.T556G						.						96.0	100.0	99.0					19																	9362275		2015	4185	6200	SO:0001583	missense	26648	exon1			CTCACCTGCTTCA	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.556T>G	19.37:g.9362275T>G	ENSP00000387523:p.Cys186Gly	107	0		47	12	NM_001079935	0	0	0	0	0	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	37	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	t	10.40	1.340959	0.24339	.	.	ENSG00000237521	ENST00000456448	T	0.00224	8.51	2.21	-0.132	0.13489	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00241	0.0007	L	0.53249	1.67	0.09310	N	1	D	0.52996	0.957	P	0.50490	0.642	T	0.48614	-0.9020	9	0.87932	D	0	.	6.5019	0.22174	0.0:0.4011:0.0:0.5989	.	186	Q6IFN5	O7E24_HUMAN	G	186	ENSP00000387523:C186G	ENSP00000387523:C186G	C	+	1	0	OR7E24	9223275	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.214000	0.32419	-0.264000	0.09365	-0.483000	0.04790	TGC	.		0.403	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
RDH8	50700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10132218	10132218	+	Silent	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:10132218C>A	ENST00000171214.1	+	6	978	c.729C>A	c.(727-729)gtC>gtA	p.V243V	RDH8_ENST00000591589.1_Silent_p.V263V	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	243					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	AGGCCATTGTCAACGTCATCA	0.632																																					p.V263V		.											.	RDH8-94	0			c.C789A						.						77.0	71.0	73.0					19																	10132218		2203	4300	6503	SO:0001819	synonymous_variant	50700	exon6			CATTGTCAACGTC	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.729C>A	19.37:g.10132218C>A		105	1		201	67	NM_015725	0	0	0	0	0	Q9H838	Silent	SNP	ENST00000171214.1	37																																																																																				.		0.632	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
C19orf44	84167	ucsc.edu	37	19	16612294	16612294	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:16612294G>A	ENST00000221671.3	+	2	847	c.691G>A	c.(691-693)Gaa>Aaa	p.E231K	C19orf44_ENST00000594035.1_Missense_Mutation_p.E231K|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	231										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						CTCTTCTAGAGAAAAAAACAC	0.373																																					p.E231K													.	C19orf44-90	0			c.G691A						.						63.0	66.0	65.0					19																	16612294		2202	4299	6501	SO:0001583	missense	84167	exon2			TCTAGAGAAAAAA	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.691G>A	19.37:g.16612294G>A	ENSP00000221671:p.Glu231Lys	148	0		266	1	NM_032207	0	0	7	8	1	Q8N6Y7	Missense_Mutation	SNP	ENST00000221671.3	37	CCDS12345.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886468	0.33348	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.81	2.62	0.31277	.	1.056350	0.07363	N	0.884396	T	0.57344	0.2047	L	0.56769	1.78	0.09310	N	1	D;D	0.89917	0.996;1.0	D;D	0.72338	0.93;0.977	T	0.37009	-0.9724	9	0.38643	T	0.18	-2.8439	7.3233	0.26540	0.0929:0.1729:0.7341:0.0	.	231;231	Q9H6X5;Q9H6X5-2	CS044_HUMAN;.	K	231	.	ENSP00000221671:E231K	E	+	1	0	C19orf44	16473294	0.979000	0.34478	0.028000	0.17463	0.062000	0.15995	3.222000	0.51223	1.130000	0.42092	-0.176000	0.13171	GAA	.		0.373	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207	
UPF1	5976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18963808	18963808	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:18963808A>G	ENST00000599848.1	+	7	1194	c.985A>G	c.(985-987)Atc>Gtc	p.I329V	UPF1_ENST00000262803.5_Missense_Mutation_p.I329V			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	329	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TCAAGATAACATCACTGTCAG	0.537																																					p.I329V		.											.	UPF1-91	0			c.A985G						.						131.0	115.0	120.0					19																	18963808		2203	4300	6503	SO:0001583	missense	5976	exon7			GATAACATCACTG	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.985A>G	19.37:g.18963808A>G	ENSP00000470142:p.Ile329Val	231	0		287	92	NM_002911	0	0	17	25	8	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	A	11.03	1.518996	0.27211	.	.	ENSG00000005007	ENST00000262803	D	0.88975	-2.45	4.16	4.16	0.48862	.	0.052684	0.64402	D	0.000001	T	0.79052	0.4381	N	0.16903	0.455	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.003;0.007	T	0.72077	-0.4399	10	0.18276	T	0.48	-35.3027	12.395	0.55380	1.0:0.0:0.0:0.0	.	329;329	Q92900;Q92900-2	RENT1_HUMAN;.	V	329	ENSP00000262803:I329V	ENSP00000262803:I329V	I	+	1	0	UPF1	18824808	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.925000	0.92832	1.534000	0.49203	0.438000	0.28831	ATC	.		0.537	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
SARS2	54938	broad.mit.edu	37	19	39412717	39412717	+	Intron	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:39412717A>T	ENST00000221431.6	-	3	553				CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000600042.1_Splice_Site_p.V132E|SARS2_ENST00000430193.3_Intron|SARS2_ENST00000594171.1_Intron|SARS2_ENST00000448145.2_Intron	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial						gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			atccagccgcacctgaagcca	0.448																																					p.V132E													.	SARS2-93	0			c.T395A						.						60.0	65.0	64.0					19																	39412717		692	1591	2283	SO:0001627	intron_variant	54938	exon4			AGCCGCACCTGAA	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.393+160T>A	19.37:g.39412717A>T		15	0		44	17	NM_001145901	0	0	11	14	3	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	A	1.368	-0.586872	0.03827	.	.	ENSG00000104835	ENST00000430193	.	.	.	3.73	0.283	0.15696	.	.	.	.	.	T	0.12987	0.0315	N	0.08118	0	.	.	.	B	0.33694	0.421	B	0.34824	0.19	T	0.31280	-0.9949	7	0.02654	T	1	.	3.1998	0.06646	0.5259:0.217:0.2571:0.0	.	132	B4DE10	.	E	132	.	ENSP00000406754:V132E	V	-	2	0	FBXO17	44104557	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-0.852000	0.04308	-0.018000	0.14079	0.379000	0.24179	GTG	.		0.448	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
HSD17B14	51171	hgsc.bcm.edu;broad.mit.edu	37	19	49316535	49316535	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:49316535A>C	ENST00000263278.4	-	9	976	c.710T>G	c.(709-711)tTc>tGc	p.F237C	BCAT2_ENST00000597011.1_5'Flank|HSD17B14_ENST00000599157.1_Missense_Mutation_p.F213C|BCAT2_ENST00000545387.2_5'Flank|BCAT2_ENST00000316273.6_5'Flank|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000599246.1_5'Flank|BCAT2_ENST00000402551.1_5'Flank|BCAT2_ENST00000598162.1_5'Flank	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	237					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		GCCCGTGCAGAAGTTGGCTTC	0.677																																					p.F237C		.											.	HSD17B14-90	0			c.T710G						.						24.0	22.0	23.0					19																	49316535		2201	4294	6495	SO:0001583	missense	51171	exon9			GTGCAGAAGTTGG	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.710T>G	19.37:g.49316535A>C	ENSP00000263278:p.Phe237Cys	18	0		46	22	NM_016246	0	0	8	14	6	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	37	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.414225	0.42817	.	.	ENSG00000087076	ENST00000263278	T	0.25250	1.81	4.54	4.54	0.55810	NAD(P)-binding domain (1);	0.056642	0.64402	D	0.000001	T	0.48732	0.1516	M	0.70787	2.145	0.48571	D	0.99967	D	0.89917	1.0	D	0.97110	1.0	T	0.51888	-0.8648	10	0.72032	D	0.01	.	12.4586	0.55718	1.0:0.0:0.0:0.0	.	237	Q9BPX1	DHB14_HUMAN	C	237	ENSP00000263278:F237C	ENSP00000263278:F237C	F	-	2	0	HSD17B14	54008347	1.000000	0.71417	0.995000	0.50966	0.070000	0.16714	4.249000	0.58766	1.991000	0.58162	0.379000	0.24179	TTC	.		0.677	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466212.1	NM_016246	
MYCN	4613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	16086058	16086058	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:16086058G>C	ENST00000281043.3	+	3	1531	c.1234G>C	c.(1234-1236)Gta>Cta	p.V412L		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	412	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			GCCGGAGTTGGTAAAGAATGA	0.572			A		neuroblastoma																																p.V412L		.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN-1271	0			c.G1234C						.						90.0	100.0	97.0					2																	16086058		2203	4300	6503	SO:0001583	missense	4613	exon3			GAGTTGGTAAAGA	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1234G>C	2.37:g.16086058G>C	ENSP00000281043:p.Val412Leu	304	0		496	163	NM_005378	0	0	0	0	0	Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	37	CCDS1687.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959315	0.53400	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	D	0.97976	-4.64	5.14	4.26	0.50523	Helix-loop-helix DNA-binding (5);	0.515918	0.19319	N	0.117200	D	0.94535	0.8240	L	0.27053	0.805	0.39651	D	0.970461	P	0.40144	0.704	B	0.40864	0.342	D	0.93971	0.7249	10	0.56958	D	0.05	-13.1384	10.2421	0.43319	0.1524:0.0:0.8476:0.0	.	412	P04198	MYCN_HUMAN	L	412;330	ENSP00000281043:V412L	ENSP00000281043:V412L	V	+	1	0	MYCN	16003509	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	4.154000	0.58125	1.331000	0.45412	-0.192000	0.12808	GTA	.		0.572	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
EMILIN1	11117	hgsc.bcm.edu	37	2	27305348	27305348	+	Silent	SNP	C	C	T	rs375569765	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:27305348C>T	ENST00000380320.4	+	4	1408	c.909C>T	c.(907-909)tcC>tcT	p.S303S		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	303					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTCCTGCTCCGTGTGCCTGG	0.726													C|||	2	0.000399361	0.0015	0.0	5008	,	,		14262	0.0		0.0	False		,,,				2504	0.0				p.S303S		.											.	EMILIN1-91	0			c.C909T						.	C		5,4113		0,5,2054	4.0	7.0	6.0		909	-10.2	0.7	2		6	1,8207		0,1,4103	no	coding-synonymous	EMILIN1	NM_007046.3		0,6,6157	TT,TC,CC		0.0122,0.1214,0.0487		303/1017	27305348	6,12320	2059	4104	6163	SO:0001819	synonymous_variant	11117	exon4			CTGCTCCGTGTGC	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.909C>T	2.37:g.27305348C>T		3	0		14	7	NM_007046	0	0	4	8	4	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Silent	SNP	ENST00000380320.4	37	CCDS1733.1																																																																																			.		0.726	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1	NM_007046	
ANXA4	307	ucsc.edu	37	2	70037724	70037724	+	Splice_Site	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:70037724A>G	ENST00000394295.4	+	7	645		c.e7-1		ANXA4_ENST00000536030.1_Splice_Site|ANXA4_ENST00000409920.1_Splice_Site	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4						epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						CTCTCTTGCTAGAATATGGAC	0.488																																					.													.	ANXA4-90	0			c.398-2A>G						.						118.0	109.0	112.0					2																	70037724		2203	4300	6503	SO:0001630	splice_region_variant	307	exon7			CTTGCTAGAATAT	M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.398-1A>G	2.37:g.70037724A>G		73	0		96	1	NM_001153	0	0	8	8	0	B4DDF9|Q96F33|Q9BWK1	Splice_Site	SNP	ENST00000394295.4	37	CCDS1894.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163658	0.78226	.	.	ENSG00000196975	ENST00000409920;ENST00000394295;ENST00000536030	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9622	0.64188	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANXA4	69891228	1.000000	0.71417	0.961000	0.40146	0.940000	0.58332	7.600000	0.82769	2.190000	0.69967	0.533000	0.62120	.	.		0.488	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251848.2	NM_001153	Intron
RGPD8	727851	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C	rs370761877		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:113127775G>C	ENST00000302558.3	-	23	5469	c.5278C>G	c.(5278-5280)Cct>Gct	p.P1760A	RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1760				P -> A (in Ref. 3; CAI56757). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)	p.P1760A(12)		endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						GAACGGGAAGGATTTTCTTCC	0.308																																					p.P1760A													.	.	12	Substitution - Missense(12)	prostate(6)|urinary_tract(2)|endometrium(2)|kidney(2)	c.C5278G						.						235.0	168.0	189.0					2																	113127775		686	1558	2244	SO:0001583	missense	727851	exon23			GGGAAGGATTTTC	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.5278C>G	2.37:g.113127775G>C	ENSP00000306637:p.Pro1760Ala	65	1		48	3	NM_001164463	0	0	2	24	22	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.892319	0.00522	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36520	1.25;1.25	0.719	0.719	0.18208	.	.	.	.	.	T	0.11239	0.0274	N	0.02011	-0.69	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	9	0.10902	T	0.67	-6.3628	6.3935	0.21599	0.0:0.6881:0.3119:0.0	.	1760	O14715	RGPD8_HUMAN	A	1760;1620	ENSP00000306637:P1760A;ENSP00000386511:P1620A	ENSP00000306637:P1760A	P	-	1	0	RGPD8	112844246	0.746000	0.28272	0.842000	0.33263	0.015000	0.08874	0.243000	0.18106	-0.105000	0.12132	-1.123000	0.02005	CCT	C|1.000;|0.000		0.308	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
BAZ2B	29994	hgsc.bcm.edu	37	2	160287392	160287392	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:160287392T>G	ENST00000392783.2	-	10	2671	c.2176A>C	c.(2176-2178)Act>Cct	p.T726P	BAZ2B_ENST00000392782.1_Missense_Mutation_p.T724P|BAZ2B_ENST00000355831.2_Missense_Mutation_p.T726P|BAZ2B_ENST00000343439.5_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	726					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GGGCTTGAAGTAAGTGTGGAA	0.408																																					p.T726P		.											.	BAZ2B-94	0			c.A2176C						.						110.0	105.0	107.0					2																	160287392		1886	4123	6009	SO:0001583	missense	29994	exon10			TTGAAGTAAGTGT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2176A>C	2.37:g.160287392T>G	ENSP00000376534:p.Thr726Pro	161	1		39	2	NM_013450	0	0	3	3	0	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	T	14.40	2.524028	0.44866	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831	T;T;T	0.22743	1.94;1.94;1.94	5.64	4.42	0.53409	DNA-binding, integrase-type (1);	0.219310	0.22744	U	0.056164	T	0.13457	0.0326	N	0.14661	0.345	0.80722	D	1	B;B;B	0.14438	0.01;0.005;0.007	B;B;B	0.15484	0.013;0.011;0.005	T	0.05550	-1.0878	10	0.66056	D	0.02	-15.8483	11.6182	0.51102	0.1332:0.0:0.0:0.8668	.	530;724;726	Q9UIF8-4;Q9UIF8-5;Q9UIF8	.;.;BAZ2B_HUMAN	P	724;726;726	ENSP00000376533:T724P;ENSP00000376534:T726P;ENSP00000348087:T726P	ENSP00000348087:T726P	T	-	1	0	BAZ2B	159995638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.673000	0.37534	2.148000	0.66965	0.523000	0.50628	ACT	.		0.408	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
C2orf80	389073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	209045533	209045533	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:209045533A>C	ENST00000341287.4	-	6	497	c.302T>G	c.(301-303)aTc>aGc	p.I101S	C2orf80_ENST00000451346.1_Missense_Mutation_p.I82S|C2orf80_ENST00000453017.1_Missense_Mutation_p.I101S	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	101										endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						CTCAATCGGGATACTGTTCTG	0.363																																					p.I101S		.											.	C2orf80-69	0			c.T302G						.						98.0	92.0	94.0					2																	209045533		1810	4083	5893	SO:0001583	missense	389073	exon6			ATCGGGATACTGT	AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.302T>G	2.37:g.209045533A>C	ENSP00000343171:p.Ile101Ser	133	0		86	26	NM_001099334	0	0	0	0	0	A6NKZ3	Missense_Mutation	SNP	ENST00000341287.4	37	CCDS42809.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.20|14.20	2.465820|2.465820	0.43839|0.43839	.|.	.|.	ENSG00000188674|ENSG00000188674	ENST00000451342;ENST00000341287;ENST00000451346;ENST00000453017;ENST00000423952|ENST00000428015	T;T;T;T;T|.	0.54866|.	1.04;1.51;1.46;0.55;1.02|.	4.67|4.67	3.47|3.47	0.39725|0.39725	.|.	0.384012|.	0.22416|.	N|.	0.060357|.	T|.	0.33381|.	0.0861|.	L|L	0.32530|0.32530	0.975|0.975	0.28843|0.28843	N|N	0.896464|0.896464	B|.	0.29646|.	0.253|.	B|.	0.33799|.	0.17|.	T|.	0.22068|.	-1.0227|.	10|.	0.87932|.	D|.	0|.	-4.0257|-4.0257	7.2927|7.2927	0.26374|0.26374	0.8979:0.0:0.1021:0.0|0.8979:0.0:0.1021:0.0	.|.	101|.	Q0P641|.	CB080_HUMAN|.	S|X	26;101;82;101;14|52	ENSP00000389385:I26S;ENSP00000343171:I101S;ENSP00000405393:I82S;ENSP00000397144:I101S;ENSP00000413016:I14S|.	ENSP00000343171:I101S|.	I|Y	-|-	2|3	0|2	C2orf80|C2orf80	208753778|208753778	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.941000|0.941000	0.58515|0.58515	2.253000|2.253000	0.43205|0.43205	0.883000|0.883000	0.36040|0.36040	0.455000|0.455000	0.32223|0.32223	ATC|TAT	.		0.363	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336931.1	NM_001099334	
SP140	11262	hgsc.bcm.edu	37	2	231176275	231176275	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:231176275C>G	ENST00000392045.3	+	26	2584	c.2470C>G	c.(2470-2472)Cgc>Ggc	p.R824G	SP140_ENST00000420434.3_Missense_Mutation_p.R797G|SP140_ENST00000486687.2_Missense_Mutation_p.R748G|SP140_ENST00000350136.5_Missense_Mutation_p.R693G|SP140_ENST00000343805.6_Missense_Mutation_p.R764G|SP140_ENST00000417495.3_Missense_Mutation_p.R710G	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	824	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ACAAGACATGCGCCTCATCTT	0.507																																					p.R824G		.											.	SP140-90	0			c.C2470G						.						31.0	31.0	31.0					2																	231176275		1784	4036	5820	SO:0001583	missense	11262	exon26			GACATGCGCCTCA	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.2470C>G	2.37:g.231176275C>G	ENSP00000375899:p.Arg824Gly	422	0		321	22	NM_007237	0	0	24	26	2	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450333	0.43531	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	2.9	-1.45	0.08828	Bromodomain (5);	.	.	.	.	T	0.49490	0.1560	M	0.85373	2.75	0.24352	N	0.994912	D;D;D;D	0.69078	0.997;0.976;0.986;0.989	D;P;P;D	0.70227	0.968;0.727;0.859;0.913	T	0.39396	-0.9616	9	0.87932	D	0	-9.1463	2.5578	0.04764	0.3978:0.3475:0.0:0.2547	.	797;710;764;824	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	G	748;693;824;710;764;797	ENSP00000440107:R748G;ENSP00000345846:R693G;ENSP00000375899:R824G;ENSP00000342096:R764G;ENSP00000398210:R797G	ENSP00000342096:R764G	R	+	1	0	SP140	230884519	0.805000	0.28982	0.517000	0.27799	0.964000	0.63967	0.246000	0.18160	-0.360000	0.08138	0.563000	0.77884	CGC	.		0.507	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
SP140L	93349	hgsc.bcm.edu	37	2	231266487	231266487	+	Missense_Mutation	SNP	C	C	G	rs367571251		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:231266487C>G	ENST00000415673.2	+	18	1695	c.1609C>G	c.(1609-1611)Cgc>Ggc	p.R537G	SP140L_ENST00000396563.4_3'UTR|SP140L_ENST00000243810.6_3'UTR	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	537	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						ACAAGACATGCGCCTCATCTT	0.507																																					p.R537G		.											.	SP140L-23	0			c.C1609G						.						27.0	27.0	27.0					2																	231266487		1777	4026	5803	SO:0001583	missense	93349	exon18			GACATGCGCCTCA	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1609C>G	2.37:g.231266487C>G	ENSP00000397911:p.Arg537Gly	378	0		278	61	NM_138402	0	0	24	26	2	Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173538	0.38413	.	.	ENSG00000185404	ENST00000415673	T	0.31510	1.49	3.14	1.16	0.20824	.	.	.	.	.	T	0.52517	0.1739	M	0.89414	3.03	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.49579	-0.8925	9	0.87932	D	0	.	3.4797	0.07598	0.2626:0.5932:0.0:0.1442	.	537	Q9H930-4	.	G	537	ENSP00000397911:R537G	ENSP00000397911:R537G	R	+	1	0	SP140L	230974731	0.851000	0.29673	0.755000	0.31263	0.732000	0.41865	0.637000	0.24659	0.136000	0.18733	0.298000	0.19748	CGC	.		0.507	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
CHGB	1114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	5903027	5903027	+	Silent	SNP	A	A	G	rs199738388		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:5903027A>G	ENST00000378961.4	+	4	441	c.237A>G	c.(235-237)acA>acG	p.T79T		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	79						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						ATGAAAACACAAAGTTTGAAG	0.453													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19556	0.0		0.0	False		,,,				2504	0.0				p.T79T		.											.	CHGB-96	0			c.A237G						.						61.0	61.0	61.0					20																	5903027		2203	4300	6503	SO:0001819	synonymous_variant	1114	exon4			AAACACAAAGTTT		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.237A>G	20.37:g.5903027A>G		134	1		132	54	NM_001819	0	0	1	1	0	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Silent	SNP	ENST00000378961.4	37	CCDS13092.1																																																																																			A|0.999;G|0.000		0.453	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
NKX2-4	644524	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	21376576	21376576	+	Silent	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:21376576G>T	ENST00000351817.4	-	2	1666	c.1038C>A	c.(1036-1038)gcC>gcA	p.A346A	RP11-227D2.3_ENST00000419666.2_RNA|RP11-227D2.3_ENST00000552439.1_RNA	NM_033176.1	NP_149416.1	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	346					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|upper_aerodigestive_tract(1)	3						AGAGCAGGTTGGCGCCCAGGA	0.736																																					p.A346A		.											.	NKX2-4-22	0			c.C1038A						.						18.0	19.0	18.0					20																	21376576		1266	2943	4209	SO:0001819	synonymous_variant	644524	exon2			CAGGTTGGCGCCC		CCDS42855.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125816	ENSG00000125816		"""Homeoboxes / ANTP class : NKL subclass"""	7837	protein-coding gene	gene with protein product		607808	"""NK-2 (Drosophila) homolog D"", ""NK2 transcription factor related, locus 4 (Drosophila)"""	NKX2D		1346742, 10818213	Standard	NM_033176		Approved	NKX2.4	uc010gcz.3	Q9H2Z4	OTTHUMG00000032022	ENST00000351817.4:c.1038C>A	20.37:g.21376576G>T		63	0		105	30	NM_033176	0	0	0	0	0	Q5VZV8	Silent	SNP	ENST00000351817.4	37	CCDS42855.1																																																																																			.		0.736	NKX2-4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078270.2		
ACTR5	79913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	37400319	37400319	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:37400319G>C	ENST00000243903.4	+	9	1721	c.1684G>C	c.(1684-1686)Gga>Cga	p.G562R		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	562					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				AGAAAAGGGAGGAGAGTACCT	0.557																																					p.G562R		.											.	ACTR5-90	0			c.G1684C						.						108.0	88.0	94.0					20																	37400319		2203	4300	6503	SO:0001583	missense	79913	exon9			AAGGGAGGAGAGT	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1684G>C	20.37:g.37400319G>C	ENSP00000243903:p.Gly562Arg	123	0		187	75	NM_024855	0	0	2	5	3	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160871	0.94727	.	.	ENSG00000101442	ENST00000243903	T	0.07688	3.17	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00166	-1.1966	10	0.87932	D	0	-21.9656	20.6086	0.99469	0.0:0.0:1.0:0.0	.	562	Q9H9F9	ARP5_HUMAN	R	562	ENSP00000243903:G562R	ENSP00000243903:G562R	G	+	1	0	ACTR5	36833733	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.960000	0.93117	2.880000	0.98712	0.655000	0.94253	GGA	.		0.557	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
YTHDF1	54915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61833792	61833792	+	Silent	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:61833792T>C	ENST00000370339.3	-	4	1841	c.1500A>G	c.(1498-1500)aaA>aaG	p.K500K	YTHDF1_ENST00000370334.4_Intron|YTHDF1_ENST00000370333.4_Silent_p.K450K	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	500	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.						N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						TTGTGACCGGTTTGTTGTCGT	0.483																																					p.K500K		.											.	YTHDF1-92	0			c.A1500G						.						156.0	131.0	139.0					20																	61833792		2203	4300	6503	SO:0001819	synonymous_variant	54915	exon4			GACCGGTTTGTTG	AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.1500A>G	20.37:g.61833792T>C		134	1		275	48	NM_017798	0	0	44	53	9	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Silent	SNP	ENST00000370339.3	37	CCDS13511.1																																																																																			.		0.483	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798	
PRDM15	63977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43221789	43221789	+	Missense_Mutation	SNP	C	C	G	rs139717863		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr21:43221789C>G	ENST00000269844.3	-	31	4245	c.4135G>C	c.(4135-4137)Gcg>Ccg	p.A1379P	PRDM15_ENST00000538201.1_Missense_Mutation_p.A1033P|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000422911.1_Missense_Mutation_p.A1070P|PRDM15_ENST00000447207.2_Missense_Mutation_p.A1013P|PRDM15_ENST00000398548.1_Missense_Mutation_p.A1050P	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						AACTGAGTCGCGGCCGCAGTG	0.582																																					p.A1379P		.											.	PRDM15-90	0			c.G4135C						.						47.0	47.0	47.0					21																	43221789		2203	4300	6503	SO:0001583	missense	63977	exon31			GAGTCGCGGCCGC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4135G>C	21.37:g.43221789C>G	ENSP00000269844:p.Ala1379Pro	65	1		143	54	NM_022115	0	0	1	2	1	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	c	9.656	1.142945	0.21205	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	4.47	4.47	0.54385	.	.	.	.	.	T	0.21590	0.0520	N	0.14661	0.345	0.20975	N	0.999815	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.12293	-1.0553	9	0.34782	T	0.22	-29.0395	16.1585	0.81681	0.0:1.0:0.0:0.0	.	1379;1070;1050	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	P	1070;1050;1033;1013;1379	ENSP00000408592:A1070P;ENSP00000381556:A1050P;ENSP00000444044:A1033P;ENSP00000390245:A1013P;ENSP00000269844:A1379P	ENSP00000269844:A1379P	A	-	1	0	PRDM15	42094858	0.970000	0.33590	0.915000	0.36163	0.244000	0.25665	3.534000	0.53568	2.039000	0.60335	0.558000	0.71614	GCG	C|1.000;T|0.000		0.582	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
COL18A1	80781	hgsc.bcm.edu	37	21	46925137	46925137	+	Silent	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr21:46925137T>C	ENST00000359759.4	+	34	4224	c.4203T>C	c.(4201-4203)ccT>ccC	p.P1401P	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000400337.2_Silent_p.P986P|COL18A1_ENST00000355480.5_Silent_p.P1166P			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1401	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCCAGGGCCCTCCCGGCCCCC	0.741																																					p.P1163P		.											.	COL18A1-90	0			c.T3489C						.						7.0	11.0	10.0					21																	46925137		1716	3956	5672	SO:0001819	synonymous_variant	80781	exon35			GGGCCCTCCCGGC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4203T>C	21.37:g.46925137T>C		12	0		20	2	NM_030582	0	0	50	50	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37																																																																																				.		0.741	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
CECR2	27443	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18028580	18028580	+	Silent	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr22:18028580T>A	ENST00000400585.2	+	17	3549	c.3111T>A	c.(3109-3111)ccT>ccA	p.P1037P	CECR2_ENST00000262608.8_Silent_p.P1180P|CECR2_ENST00000400573.5_Silent_p.P1179P			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	1221					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGCGAACTCCTTACTATGCCT	0.592																																					.													.	CECR2-70	0			.						.						64.0	67.0	66.0					22																	18028580		1998	4157	6155	SO:0001819	synonymous_variant	27443	.			AACTCCTTACTAT	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.3111T>A	22.37:g.18028580T>A		100	0		154	53	.	0	0	5	7	2	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000400585.2	37																																																																																				.		0.592	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413	
RGL4	266747	hgsc.bcm.edu;broad.mit.edu	37	22	24041048	24041048	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr22:24041048A>T	ENST00000290691.5	+	11	2570	c.1400A>T	c.(1399-1401)cAg>cTg	p.Q467L	KB-1572G7.2_ENST00000421064.1_RNA|RGL4_ENST00000401461.1_Missense_Mutation_p.Q331L	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	467	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						CTGTCCTGCCAGCTGGAGCCC	0.627																																					p.Q467L		.											.	RGL4-228	0			c.A1400T						.						43.0	37.0	39.0					22																	24041048		2203	4300	6503	SO:0001583	missense	266747	exon11			CCTGCCAGCTGGA		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1400A>T	22.37:g.24041048A>T	ENSP00000290691:p.Gln467Leu	29	1		51	15	NM_153615	0	0	0	0	0	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	37	CCDS13811.1	.	.	.	.	.	.	.	.	.	.	-	7.165	0.586422	0.13749	.	.	ENSG00000159496	ENST00000401461;ENST00000290691	T;T	0.30182	1.54;1.54	1.53	-0.347	0.12617	Guanine-nucleotide dissociation stimulator CDC25 (2);Ras guanine nucleotide exchange factor, domain (1);	.	.	.	.	T	0.18299	0.0439	L	0.28192	0.835	0.20563	N	0.999887	B	0.17268	0.021	B	0.12837	0.008	T	0.25012	-1.0144	9	0.87932	D	0	.	3.8135	0.08806	0.4614:0.0:0.0:0.5386	.	467	Q8IZJ4	RGDSR_HUMAN	L	331;467	ENSP00000383951:Q331L;ENSP00000290691:Q467L	ENSP00000290691:Q467L	Q	+	2	0	RGL4	22371048	1.000000	0.71417	0.009000	0.14445	0.002000	0.02628	1.510000	0.35790	-0.226000	0.09899	0.439000	0.28862	CAG	.		0.627	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	
MKL1	57591	hgsc.bcm.edu	37	22	40814737	40814737	+	Missense_Mutation	SNP	C	C	T	rs144888766		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr22:40814737C>T	ENST00000355630.3	-	12	2295	c.1705G>A	c.(1705-1707)Gcc>Acc	p.A569T	MKL1_ENST00000407029.1_Missense_Mutation_p.A569T|MKL1_ENST00000396617.3_Missense_Mutation_p.A569T|MKL1_ENST00000402042.1_Missense_Mutation_p.A519T	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	569	Pro-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CCGAGgggggcgggggcgggg	0.716			T	RBM15	acute megakaryocytic leukemia																																p.A569T		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1-948	0			c.G1705A						.	C	THR/ALA	116,2310		0,116,1097	2.0	2.0	2.0		1705	-3.5	0.0	22	dbSNP_134	2	5,5439		0,5,2717	yes	missense	MKL1	NM_020831.3	58	0,121,3814	TT,TC,CC		0.0918,4.7815,1.5375	benign	569/932	40814737	121,7749	1213	2722	3935	SO:0001583	missense	57591	exon12			GGGGGGCGGGGGC	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1705G>A	22.37:g.40814737C>T	ENSP00000347847:p.Ala569Thr	7	2		11	4	NM_020831	0	0	0	1	1	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	44	0.020146520146520148	39	0.07926829268292683	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	C	9.145	1.014937	0.19355	0.047815	9.18E-4	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	4.41	-3.45	0.04781	.	1.271760	0.05835	N	0.618279	T	0.00815	0.0027	N	0.08118	0	0.09310	N	1	B;B;B	0.12630	0.006;0.006;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.12293	-1.0553	10	0.14252	T	0.57	0.1113	2.1801	0.03872	0.1212:0.4293:0.2367:0.2129	.	519;569;569	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	T	569;569;519;569	ENSP00000347847:A569T;ENSP00000379861:A569T;ENSP00000385584:A519T;ENSP00000385835:A569T	ENSP00000347847:A569T	A	-	1	0	MKL1	39144683	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.029000	0.12329	-0.242000	0.09667	-1.320000	0.01293	GCC	C|0.980;T|0.020		0.716	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
EP300	2033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41572951	41572951	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr22:41572951T>A	ENST00000263253.7	+	31	6455	c.5236T>A	c.(5236-5238)Tgc>Agc	p.C1746S	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1746	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GGTCCATGCTTGCCAGTGTCG	0.572			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.C1746S		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.T5236A						.						88.0	74.0	79.0					22																	41572951		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	CATGCTTGCCAGT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5236T>A	22.37:g.41572951T>A	ENSP00000263253:p.Cys1746Ser	142	1		241	84	NM_001429	0	0	15	26	11	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.667060	0.67814	.	.	ENSG00000100393	ENST00000263253	D	0.81659	-1.52	5.75	5.75	0.90469	Zinc finger, TAZ-type (5);	0.000000	0.53938	D	0.000056	D	0.86723	0.6001	L	0.51853	1.615	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.85515	0.1200	10	0.35671	T	0.21	-5.0783	16.0573	0.80814	0.0:0.0:0.0:1.0	.	1746	Q09472	EP300_HUMAN	S	1746	ENSP00000263253:C1746S	ENSP00000263253:C1746S	C	+	1	0	EP300	39902897	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.040000	0.89188	2.191000	0.70037	0.528000	0.53228	TGC	.		0.572	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
OGG1	4968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9793597	9793597	+	Missense_Mutation	SNP	A	A	G	rs144249605	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:9793597A>G	ENST00000344629.7	+	3	872	c.529A>G	c.(529-531)Acc>Gcc	p.T177A	OGG1_ENST00000349503.5_Missense_Mutation_p.T177A|OGG1_ENST00000302008.8_Missense_Mutation_p.T177A|OGG1_ENST00000302003.7_Missense_Mutation_p.T177A|OGG1_ENST00000339511.5_Missense_Mutation_p.T177A|OGG1_ENST00000383826.5_Missense_Mutation_p.T177A|OGG1_ENST00000302036.7_Missense_Mutation_p.T177A|OGG1_ENST00000449570.2_Missense_Mutation_p.T177A			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	177					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					TGATGATGTCACCTACCATGG	0.572								Base excision repair (BER), DNA glycosylases																													p.T177A		.											.	OGG1-660	0			c.A529G						.						86.0	82.0	83.0					3																	9793597		2203	4300	6503	SO:0001583	missense	4968	exon3			GATGTCACCTACC	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.529A>G	3.37:g.9793597A>G	ENSP00000342851:p.Thr177Ala	133	2		193	64	NM_016819	0	0	14	22	8	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	CCDS2581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.43|12.43	1.935498|1.935498	0.34189|0.34189	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000352937;ENST00000416333|ENST00000302003;ENST00000344629;ENST00000302036;ENST00000349503;ENST00000339511;ENST00000449570;ENST00000302008;ENST00000383826;ENST00000339542	.|T;T;T;T;T;T;T;T	.|0.54071	.|0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.51|5.51	-3.55|-3.55	0.04639|0.04639	.|HhH-GPD domain (2);DNA glycosylase (2);	.|0.639505	.|0.18056	.|N	.|0.153083	T|T	0.27559|0.27559	0.0677|0.0677	L|L	0.33245|0.33245	0.995|0.995	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;B;B;B	.|0.30236	.|0.274;0.002;0.038;0.006;0.0;0.0;0.008;0.0;0.0	.|B;B;B;B;B;B;B;B;B	.|0.31751	.|0.135;0.004;0.004;0.01;0.009;0.005;0.009;0.003;0.002	T|T	0.19745|0.19745	-1.0296|-1.0296	5|10	.|0.12103	.|T	.|0.63	-6.2946|-6.2946	0.5751|0.5751	0.00702|0.00702	0.3173:0.2684:0.2179:0.1964|0.3173:0.2684:0.2179:0.1964	.|.	.|20;177;177;177;177;177;177;177;177	.|F8WA07;E5KPM8;E5KPM6;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2	.|.;.;.;.;.;.;.;OGG1_HUMAN;.	R|A	82;4|177;177;177;177;177;177;177;177;20	.|ENSP00000305584:T177A;ENSP00000342851:T177A;ENSP00000306561:T177A;ENSP00000303132:T177A;ENSP00000345520:T177A;ENSP00000403598:T177A;ENSP00000305527:T177A;ENSP00000373337:T177A	.|ENSP00000305584:T177A	H|T	+|+	2|1	0|0	OGG1|OGG1	9768597|9768597	0.001000|0.001000	0.12720|0.12720	0.928000|0.928000	0.36995|0.36995	0.968000|0.968000	0.65278|0.65278	-0.152000|-0.152000	0.10159|0.10159	-0.208000|-0.208000	0.10171|0.10171	0.533000|0.533000	0.62120|0.62120	CAC|ACC	A|0.999;T|0.001		0.572	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
MON1A	84315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49946456	49946456	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:49946456G>A	ENST00000417270.1	-	7	2376	c.1683C>T	c.(1681-1683)ctC>ctT	p.L561L	MON1A_ENST00000296473.3_Silent_p.L650L|CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000455683.2_Silent_p.L488L|MON1A_ENST00000483022.1_5'Flank			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	553										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ATCAATAGGTGAGGGGCGTGA	0.607																																					p.L650L		.											.	MON1A-280	0			c.C1950T						.						48.0	43.0	45.0					3																	49946456		2203	4300	6503	SO:0001819	synonymous_variant	84315	exon6			ATAGGTGAGGGGC	AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.1683C>T	3.37:g.49946456G>A		68	0		126	38	NM_032355	0	0	10	11	1	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Silent	SNP	ENST00000417270.1	37																																																																																				.		0.607	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355	
RPL29	6159	hgsc.bcm.edu	37	3	52027876	52027876	+	Silent	SNP	G	G	T	rs545891070		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:52027876G>T	ENST00000466397.1	-	4	509	c.369C>A	c.(367-369)gcC>gcA	p.A123A	RPL29_ENST00000475248.1_Silent_p.A123A|RPL29_ENST00000479017.1_Silent_p.A123A|RPL29_ENST00000294189.6_Silent_p.A123A|RPL29_ENST00000495383.1_Silent_p.A123A			P47914	RL29_HUMAN	ribosomal protein L29	123					cellular protein metabolic process (GO:0044267)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ccttggccttggcctttggcc	0.627																																					p.A123A		.											.	RPL29-90	0			c.C369A						.																																			SO:0001819	synonymous_variant	6159	exon4			GGCCTTGGCCTTT	U10248	CCDS2845.1	3p21.3-p21.2	2013-03-11			ENSG00000162244	ENSG00000162244		"""L ribosomal proteins"""	10331	protein-coding gene	gene with protein product	"""60S ribosomal protein L29"", ""heparin/heparan sulfate-interacting protein"", ""HP/HS-interacting protein"", ""heparin/heparan sulfate-binding protein"", ""cell surface heparin-binding protein HIP"""	601832	"""ribosomal protein L29 pseudogene 10"""	RPL29P10		8597591	Standard	NM_000992		Approved	HIP, HUMRPL29, L29	uc003dcs.3	P47914	OTTHUMG00000155262	ENST00000466397.1:c.369C>A	3.37:g.52027876G>T		60	2		120	10	NM_000992	0	0	1679	1681	2	A8K0H3|B2R4M8|Q6IPY3	Silent	SNP	ENST00000466397.1	37	CCDS2845.1																																																																																			.		0.627	RPL29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349680.2	NM_000992	
TMF1	7110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69096707	69096707	+	Silent	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:69096707T>C	ENST00000398559.2	-	2	1365	c.1149A>G	c.(1147-1149)acA>acG	p.T383T	CTD-2013N24.2_ENST00000596732.1_RNA|TMF1_ENST00000543976.1_Silent_p.T383T|MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	383					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GTATAACTAATGTTTCATTTA	0.383																																					p.T383T		.											.	TMF1-90	0			c.A1149G						.						129.0	121.0	123.0					3																	69096707		1871	4109	5980	SO:0001819	synonymous_variant	7110	exon2			AACTAATGTTTCA		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1149A>G	3.37:g.69096707T>C		229	0		106	42	NM_007114	0	0	4	14	10	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	37	CCDS43105.1																																																																																			.		0.383	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
GPR128	84873	hgsc.bcm.edu;broad.mit.edu	37	3	100349576	100349576	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:100349576T>G	ENST00000273352.3	+	3	525	c.257T>G	c.(256-258)aTg>aGg	p.M86R		NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	86					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						AGTACCTATATGGGTTTTACT	0.318																																					p.M86R	Pancreas(87;185 1975 7223 18722)	.											.	GPR128-94	0			c.T257G						.						69.0	71.0	70.0					3																	100349576		2203	4300	6503	SO:0001583	missense	84873	exon3			CCTATATGGGTTT	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.257T>G	3.37:g.100349576T>G	ENSP00000273352:p.Met86Arg	139	0		14	3	NM_032787	0	0	0	0	0	Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	CCDS2938.1	.	.	.	.	.	.	.	.	.	.	T	1.740	-0.491891	0.04322	.	.	ENSG00000144820	ENST00000273352	T	0.37915	1.17	5.82	-11.6	0.00059	.	4.439820	0.00397	N	0.000057	T	0.21921	0.0528	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15122	-1.0448	10	0.12430	T	0.62	.	8.0964	0.30831	0.2366:0.0663:0.5446:0.1525	.	86	Q96K78	GP128_HUMAN	R	86	ENSP00000273352:M86R	ENSP00000273352:M86R	M	+	2	0	GPR128	101832266	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.466000	0.02355	-4.377000	0.00053	-0.323000	0.08544	ATG	.		0.318	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1		
ZBTB11	27107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101370247	101370247	+	Missense_Mutation	SNP	T	T	G	rs374150569		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:101370247T>G	ENST00000312938.4	-	11	3505	c.2925A>C	c.(2923-2925)caA>caC	p.Q975H		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	975					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CACTGCTTTCTTGTTCCTGCA	0.448																																					p.Q975H		.											.	ZBTB11-91	0			c.A2925C						.						202.0	171.0	181.0					3																	101370247		2203	4300	6503	SO:0001583	missense	27107	exon11			GCTTTCTTGTTCC	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2925A>C	3.37:g.101370247T>G	ENSP00000326200:p.Gln975His	421	1		258	75	NM_014415	0	0	6	10	4	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	37	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652999	0.67472	.	.	ENSG00000066422	ENST00000312938	T	0.12672	2.66	5.49	-2.58	0.06228	.	0.060521	0.64402	D	0.000003	T	0.10252	0.0251	N	0.24115	0.695	0.80722	D	1	D	0.62365	0.991	P	0.51999	0.687	T	0.20874	-1.0262	10	0.02654	T	1	-14.7598	12.7952	0.57556	0.0:0.4538:0.0:0.5462	.	975	O95625	ZBT11_HUMAN	H	975	ENSP00000326200:Q975H	ENSP00000326200:Q975H	Q	-	3	2	ZBTB11	102852937	0.931000	0.31567	0.982000	0.44146	0.882000	0.50991	-0.067000	0.11579	-0.456000	0.07043	0.454000	0.30748	CAA	.		0.448	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
PVRL3	25945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	110830989	110830989	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:110830989G>A	ENST00000485303.1	+	2	548	c.273G>A	c.(271-273)tgG>tgA	p.W91*	PVRL3_ENST00000488016.1_3'UTR|PVRL3_ENST00000319792.3_Nonsense_Mutation_p.W91*|PVRL3_ENST00000493615.1_Nonsense_Mutation_p.W68*	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	91	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AGATTTCATGGGAGAAGATAC	0.378																																					p.W91X		.											.	PVRL3-92	0			c.G273A						.						79.0	75.0	77.0					3																	110830989		2203	4300	6503	SO:0001587	stop_gained	25945	exon2			TTCATGGGAGAAG	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.273G>A	3.37:g.110830989G>A	ENSP00000418070:p.Trp91*	178	0		13	4	NM_001243286	0	0	4	6	2	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Nonsense_Mutation	SNP	ENST00000485303.1	37	CCDS2957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.619371|5.619371	0.96649|0.96649	.|.	.|.	ENSG00000177707|ENSG00000177707	ENST00000486596|ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	.|.	.|.	.|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.45875|.	0.1364|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38001|.	-0.9681|.	3|.	.|0.02654	.|T	.|1	.|.	17.649|17.649	0.88157|0.88157	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	91|44;91;91;68;76	.|.	.|ENSP00000321514:W91X	G|W	+|+	1|3	0|0	PVRL3|PVRL3	112313679|112313679	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.517000|8.517000	0.90555|0.90555	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.		0.378	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480	
PIGZ	80235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	196675120	196675120	+	Silent	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:196675120A>T	ENST00000412723.1	-	3	794	c.648T>A	c.(646-648)ctT>ctA	p.L216L	PIGZ_ENST00000443835.1_3'UTR	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	216					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CAATGCCTCCAAGAAGCCAGC	0.637																																					p.L216L		.											.	PIGZ-93	0			c.T648A						.						59.0	67.0	64.0					3																	196675120		2203	4299	6502	SO:0001819	synonymous_variant	80235	exon3			GCCTCCAAGAAGC	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.648T>A	3.37:g.196675120A>T		139	0		271	114	NM_025163	0	0	3	10	7	Q9H9G6	Silent	SNP	ENST00000412723.1	37	CCDS3324.1																																																																																			.		0.637	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
GRK4	2868	broad.mit.edu	37	4	3039108	3039108	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:3039108C>T	ENST00000398052.4	+	14	1758	c.1415C>T	c.(1414-1416)gCc>gTc	p.A472V	GRK4_ENST00000509545.1_3'UTR|GRK4_ENST00000345167.6_Missense_Mutation_p.A440V|GRK4_ENST00000504933.1_Missense_Mutation_p.A472V|GRK4_ENST00000398051.4_Missense_Mutation_p.A440V	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	472	AGC-kinase C-terminal.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CAGCCTCATGCCGTTTACTGT	0.522											OREG0016045	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A472V													.	GRK4-507	0			c.C1415T						.						244.0	236.0	239.0					4																	3039108		2203	4300	6503	SO:0001583	missense	2868	exon14			CTCATGCCGTTTA		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.1415C>T	4.37:g.3039108C>T	ENSP00000381129:p.Ala472Val	428	1	608	695	6	NM_182982	0	0	0	0	0	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721254	0.48728	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	4.85	4.01	0.46588	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	T	0.35970	0.0950	L	0.58583	1.82	0.80722	D	1	D;P;D;D	0.64830	0.994;0.944;0.994;0.99	B;B;P;P	0.54346	0.43;0.242;0.749;0.565	T	0.07520	-1.0768	10	0.23891	T	0.37	-12.343	12.6443	0.56725	0.0:0.9193:0.0:0.0807	.	440;440;472;472	P32298-3;P32298-2;P32298-4;P32298	.;.;.;GRK4_HUMAN	V	440;472;440;472	ENSP00000381128:A440V;ENSP00000381129:A472V;ENSP00000264764:A440V;ENSP00000427445:A472V	ENSP00000264764:A440V	A	+	2	0	GRK4	3008906	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	4.724000	0.61972	1.172000	0.42781	0.511000	0.50034	GCC	.		0.522	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
RFC1	5981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39325032	39325032	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:39325032C>T	ENST00000381897.1	-	7	781	c.648G>A	c.(646-648)gaG>gaA	p.E216E	RFC1_ENST00000349703.2_Silent_p.E216E|RFC1_ENST00000418436.1_5'UTR	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	216					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCAACTGCCTCTCCAGCTGTA	0.373																																					p.E216E	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1-230	0			c.G648A						.						149.0	124.0	132.0					4																	39325032		2203	4300	6503	SO:0001819	synonymous_variant	5981	exon7			CTGCCTCTCCAGC	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.648G>A	4.37:g.39325032C>T		169	0		33	12	NM_002913	0	0	0	0	0	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	ENST00000381897.1	37	CCDS56329.1																																																																																			.		0.373	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
UGT2B7	7364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	69968643	69968643	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:69968643A>T	ENST00000508661.1	+	3	1016	c.989A>T	c.(988-990)cAg>cTg	p.Q330L	UGT2B7_ENST00000509763.1_3'UTR|UGT2B7_ENST00000305231.7_Missense_Mutation_p.Q330L			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	330					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GCCCTGGCCCAGATCCCACAA	0.428																																					p.Q330L		.											.	UGT2B7-92	0			c.A989T						.						173.0	167.0	169.0					4																	69968643		2203	4300	6503	SO:0001583	missense	7364	exon3			TGGCCCAGATCCC	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.989A>T	4.37:g.69968643A>T	ENSP00000427659:p.Gln330Leu	438	0		51	17	NM_001074	0	0	127	334	207	B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000508661.1	37		.	.	.	.	.	.	.	.	.	.	A	7.768	0.706788	0.15239	.	.	ENSG00000171234	ENST00000502942;ENST00000305231;ENST00000508661	T;T;T	0.61158	0.13;0.13;0.13	3.0	1.8	0.24995	.	0.000000	0.64402	U	0.000001	T	0.75125	0.3807	M	0.93898	3.47	0.22961	N	0.998502	P;P	0.47545	0.875;0.897	P;P	0.59424	0.857;0.657	T	0.66097	-0.6008	9	.	.	.	.	6.2555	0.20872	0.8699:0.0:0.1301:0.0	.	330;330	E9PBP8;P16662	.;UD2B7_HUMAN	L	81;330;330	ENSP00000426206:Q81L;ENSP00000304811:Q330L;ENSP00000427659:Q330L	.	Q	+	2	0	UGT2B7	70003232	1.000000	0.71417	0.097000	0.21041	0.105000	0.19272	6.429000	0.73387	0.370000	0.24538	0.477000	0.44152	CAG	.		0.428	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
SULT1E1	6783	hgsc.bcm.edu	37	4	70713508	70713508	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:70713508G>C	ENST00000226444.3	-	6	611	c.499C>G	c.(499-501)Cct>Gct	p.P167A		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	167					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	GAACCATAAGGAACTAAAATT	0.338																																					p.P167A		.											.	SULT1E1-91	0			c.C499G						.						70.0	71.0	71.0					4																	70713508		2203	4299	6502	SO:0001583	missense	6783	exon6			CATAAGGAACTAA	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.499C>G	4.37:g.70713508G>C	ENSP00000226444:p.Pro167Ala	213	0		18	2	NM_005420	0	0	0	0	0	Q8N6X5	Missense_Mutation	SNP	ENST00000226444.3	37	CCDS3531.1	.	.	.	.	.	.	.	.	.	.	G	0.568	-0.842210	0.02671	.	.	ENSG00000109193	ENST00000226444	D	0.81739	-1.53	4.21	4.21	0.49690	Sulfotransferase domain (1);	0.243367	0.36200	N	0.002727	T	0.64692	0.2621	N	0.21448	0.665	0.34331	D	0.687687	B	0.13145	0.007	B	0.11329	0.006	T	0.63743	-0.6568	9	.	.	.	.	8.1688	0.31243	0.1058:0.0:0.8942:0.0	.	167	P49888	ST1E1_HUMAN	A	167	ENSP00000226444:P167A	.	P	-	1	0	SULT1E1	70748097	0.001000	0.12720	1.000000	0.80357	0.958000	0.62258	-0.134000	0.10436	2.631000	0.89168	0.650000	0.86243	CCT	.		0.338	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1	NM_005420	
ANTXR2	118429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	80992809	80992809	+	Splice_Site	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:80992809C>A	ENST00000307333.7	-	2	155		c.e2-1		ANTXR2_ENST00000346652.6_Splice_Site|ANTXR2_ENST00000404191.1_Splice_Site|ANTXR2_ENST00000295465.4_Splice_Site|ANTXR2_ENST00000403729.2_Splice_Site	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2						reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						ACTCCCAGACCTGAAAGATGA	0.383									Juvenile Hyaline Fibromatosis																												.		.											.	ANTXR2-23	0			c.153-1G>T						.						71.0	71.0	71.0					4																	80992809		1839	4093	5932	SO:0001630	splice_region_variant	118429	exon3	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	CCAGACCTGAAAG	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.153-1G>T	4.37:g.80992809C>A		112	0		79	21	NM_058172	0	0	0	0	0	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Splice_Site	SNP	ENST00000307333.7	37	CCDS47086.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826045	0.50739	.	.	ENSG00000163297	ENST00000403729;ENST00000346652;ENST00000307333;ENST00000295465	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5222	0.84320	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANTXR2	81211833	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.415000	0.66411	2.642000	0.89623	0.563000	0.77884	.	.		0.383	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	Intron
STPG2	285555	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	98865112	98865112	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:98865112T>G	ENST00000295268.3	-	8	1069	c.980A>C	c.(979-981)aAc>aCc	p.N327T		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	327																	GTTAGTCAAGTTAGGTAATTC	0.323																																					p.N327T		.											.	.	0			c.A980C						.						130.0	127.0	128.0					4																	98865112		2203	4300	6503	SO:0001583	missense	285555	exon8			GTCAAGTTAGGTA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.980A>C	4.37:g.98865112T>G	ENSP00000295268:p.Asn327Thr	329	0		29	9	NM_174952	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	4.606	0.112544	0.08831	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.48201	0.82;2.71	4.0	4.0	0.46444	.	1.315340	0.04739	N	0.422540	T	0.38878	0.1057	L	0.29908	0.895	0.25587	N	0.986734	B	0.33694	0.421	B	0.29862	0.108	T	0.32375	-0.9909	10	0.59425	D	0.04	-9.3556	9.6357	0.39806	0.0:0.0:0.0:1.0	.	327	Q8N412	CD037_HUMAN	T	41;327	ENSP00000428346:N41T;ENSP00000295268:N327T	ENSP00000295268:N327T	N	-	2	0	C4orf37	99084135	0.997000	0.39634	0.663000	0.29738	0.803000	0.45373	2.716000	0.47219	2.041000	0.60428	0.456000	0.33151	AAC	.		0.323	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
NPY2R	4887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	156136059	156136059	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:156136059T>G	ENST00000329476.3	+	2	1457	c.968T>G	c.(967-969)cTt>cGt	p.L323R	NPY2R_ENST00000506608.1_Missense_Mutation_p.L323R	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	323					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GCCAATCCCCTTCTCTATGGC	0.527																																					p.L323R		.											.	NPY2R-523	0			c.T968G						.						116.0	97.0	103.0					4																	156136059		2203	4300	6503	SO:0001583	missense	4887	exon2			ATCCCCTTCTCTA	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.968T>G	4.37:g.156136059T>G	ENSP00000332591:p.Leu323Arg	159	0		247	84	NM_000910	0	0	0	0	0	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.979528	0.74360	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.56275	0.47;0.47	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.285408	0.32970	N	0.005436	T	0.78342	0.4268	M	0.93939	3.475	0.80722	D	1	P	0.51240	0.943	D	0.63113	0.911	D	0.84029	0.0358	10	0.72032	D	0.01	.	15.2138	0.73247	0.0:0.0:0.0:1.0	.	323	P49146	NPY2R_HUMAN	R	323	ENSP00000332591:L323R;ENSP00000426366:L323R	ENSP00000332591:L323R	L	+	2	0	NPY2R	156355509	0.998000	0.40836	0.885000	0.34714	0.928000	0.56348	8.040000	0.89188	2.189000	0.69895	0.523000	0.50628	CTT	.		0.527	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187549407	187549407	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:187549407C>A	ENST00000441802.2	-	9	4920	c.4711G>T	c.(4711-4713)Gtt>Ttt	p.V1571F		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1571	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GATTCATAAACCCGCCCTTTG	0.527										HNSCC(5;0.00058)																											p.V1571F	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.G4711T						.						46.0	48.0	47.0					4																	187549407		2090	4237	6327	SO:0001583	missense	2195	exon9			CATAAACCCGCCC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4711G>T	4.37:g.187549407C>A	ENSP00000406229:p.Val1571Phe	50	2		90	34	NM_005245	0	0	19	31	12		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114458	0.77210	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.57436	0.4	5.49	5.49	0.81192	Cadherin (3);Cadherin-like (1);	0.056071	0.64402	D	0.000001	T	0.77191	0.4094	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79584	-0.1743	10	0.72032	D	0.01	.	19.5755	0.95441	0.0:1.0:0.0:0.0	.	1571	Q14517	FAT1_HUMAN	F	1571;1570	ENSP00000406229:V1571F	ENSP00000260147:V1570F	V	-	1	0	FAT1	187786401	1.000000	0.71417	0.925000	0.36789	0.201000	0.24016	7.651000	0.83577	2.865000	0.98341	0.655000	0.94253	GTT	.		0.527	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	26906161	26906161	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:26906161C>T	ENST00000231021.4	-	5	890	c.718G>A	c.(718-720)Gac>Aac	p.D240N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	240	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D240N(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CCACCCATGTCTTTGGCCTGT	0.448																																					p.D240N	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9-99	1	Substitution - Missense(1)	lung(1)	c.G718A						.						232.0	208.0	216.0					5																	26906161		2203	4300	6503	SO:0001583	missense	1007	exon5			CCATGTCTTTGGC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.718G>A	5.37:g.26906161C>T	ENSP00000231021:p.Asp240Asn	282	0		54	12	NM_016279	0	0	1	2	1	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553655	0.96501	.	.	ENSG00000113100	ENST00000231021	T	0.79940	-1.32	5.6	5.6	0.85130	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92548	0.7633	M	0.93939	3.475	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.93866	0.7158	9	.	.	.	.	18.5289	0.90984	0.0:1.0:0.0:0.0	.	240	Q9ULB4	CADH9_HUMAN	N	240	ENSP00000231021:D240N	.	D	-	1	0	CDH9	26941918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	2.802000	0.96397	0.650000	0.86243	GAC	.		0.448	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu	37	5	139908303	139908303	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:139908303G>C	ENST00000360839.2	+	29	5926	c.5772G>C	c.(5770-5772)gaG>gaC	p.E1924D	ANKHD1_ENST00000544120.1_Missense_Mutation_p.E307D|ANKHD1_ENST00000297183.6_Missense_Mutation_p.E1924D|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.E1924D|SNORD45_ENST00000363181.1_RNA	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1924						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCCTCAGAGTCTGCTGGAC	0.488																																					p.E1924D		.											.	ANKHD1-185	0			c.G5772C						.						81.0	77.0	78.0					5																	139908303		2203	4300	6503	SO:0001583	missense	54882	exon29			CTCAGAGTCTGCT	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5772G>C	5.37:g.139908303G>C	ENSP00000354085:p.Glu1924Asp	159	0		54	4	NM_017747	0	0	70	70	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.835|9.835	1.189371|1.189371	0.21954|0.21954	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000536646;ENST00000433049;ENST00000544120;ENST00000532219|ENST00000435794;ENST00000432301	T;T;T;T;T;T|.	0.65916|.	-0.14;-0.18;1.89;1.89;1.48;-0.18|.	4.98|4.98	1.47|1.47	0.22746|0.22746	.|.	0.238205|.	0.41396|.	D|.	0.000887|.	T|T	0.33789|0.33789	0.0875|0.0875	L|L	0.34521|0.34521	1.04|1.04	0.25479|0.25479	N|N	0.987752|0.987752	B;P;B;P;B;B|.	0.42409|.	0.184;0.779;0.28;0.462;0.231;0.231|.	B;B;B;B;B;B|.	0.35510|.	0.055;0.204;0.118;0.121;0.054;0.054|.	T|T	0.25152|0.25152	-1.0140|-1.0140	10|5	0.19590|.	T|.	0.45|.	.|.	8.8813|8.8813	0.35376|0.35376	0.3024:0.0:0.6976:0.0|0.3024:0.0:0.6976:0.0	.|.	307;354;307;1924;1924;1924|.	Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;.;ANKH1_HUMAN|.	D|L	1924;1924;1924;580;359;446;307;1924|415;375	ENSP00000354085:E1924D;ENSP00000297183:E1924D;ENSP00000393204:E580D;ENSP00000390034:E446D;ENSP00000437687:E307D;ENSP00000432016:E1924D|.	ENSP00000432016:E1924D|.	E|V	+|+	3|1	2|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139888487|139888487	0.997000|0.997000	0.39634|0.39634	0.996000|0.996000	0.52242|0.52242	0.985000|0.985000	0.73830|0.73830	0.224000|0.224000	0.17738|0.17738	0.419000|0.419000	0.25927|0.25927	0.650000|0.650000	0.86243|0.86243	GAG|GTC	.		0.488	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHA4	56144	hgsc.bcm.edu;broad.mit.edu	37	5	140186954	140186954	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:140186954C>T	ENST00000530339.1	+	1	182	c.182C>T	c.(181-183)cCg>cTg	p.P61L	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.P61L|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.P61L	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGGTGCCGCGCCTGTTC	0.632																																					p.P61L		.											.	PCDHA4-96	0			c.C182T						.						44.0	50.0	48.0					5																	140186954		2200	4295	6495	SO:0001583	missense	56144	exon1			TGGTGCCGCGCCT	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.182C>T	5.37:g.140186954C>T	ENSP00000435300:p.Pro61Leu	186	2		336	29	NM_031500	13	0	1	14	0	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	18.36	3.607643	0.66558	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.26660	1.72;1.72;1.72	4.73	4.73	0.59995	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.191976	0.25214	U	0.032282	T	0.40222	0.1108	M	0.66439	2.03	0.30870	N	0.732594	D;P;D	0.54964	0.969;0.938;0.966	P;B;P	0.49637	0.562;0.366;0.617	T	0.50355	-0.8838	10	0.72032	D	0.01	.	18.1393	0.89634	0.0:1.0:0.0:0.0	.	61;61;61	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	L	61	ENSP00000423470:P61L;ENSP00000349344:P61L;ENSP00000435300:P61L	ENSP00000349344:P61L	P	+	2	0	PCDHA4	140167138	0.002000	0.14202	1.000000	0.80357	0.910000	0.53928	1.293000	0.33353	2.369000	0.80426	0.461000	0.40582	CCG	.		0.632	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu	37	5	140221088	140221088	+	Missense_Mutation	SNP	C	C	T	rs376513525	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:140221088C>T	ENST00000531613.1	+	1	182	c.182C>T	c.(181-183)cCg>cTg	p.P61L	PCDHA8_ENST00000378123.3_Missense_Mutation_p.P61L|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGGTGCCGCGCCTGTTC	0.637																																					p.P61L		.											.	PCDHA8-92	0			c.C182T						.						38.0	50.0	46.0					5																	140221088		2203	4296	6499	SO:0001583	missense	56140	exon1			TGGTGCCGCGCCT	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.182C>T	5.37:g.140221088C>T	ENSP00000434655:p.Pro61Leu	241	0		455	26	NM_031856	13	0	1	14	0	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880274	0.72294	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.26660	1.72;1.72	3.95	3.95	0.45737	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.226637	0.22037	U	0.065506	T	0.30759	0.0775	M	0.72118	2.19	0.19775	N	0.999956	P;D	0.59357	0.938;0.985	B;B	0.40506	0.239;0.331	T	0.39583	-0.9607	10	0.87932	D	0	.	16.3451	0.83120	0.0:1.0:0.0:0.0	.	61;61	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	L	61	ENSP00000434655:P61L;ENSP00000367363:P61L	ENSP00000367363:P61L	P	+	2	0	PCDHA8	140201272	0.000000	0.05858	1.000000	0.80357	0.982000	0.71751	-0.108000	0.10857	1.905000	0.55150	0.557000	0.71058	CCG	.		0.637	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
MED7	9443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156565887	156565887	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:156565887T>G	ENST00000286317.5	-	2	937	c.556A>C	c.(556-558)Act>Cct	p.T186P	MED7_ENST00000420343.1_Missense_Mutation_p.T186P	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	186					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATTGGTTCAGTTTTTACTCTC	0.373																																					p.T186P		.											.	MED7-22	0			c.A556C						.						170.0	159.0	163.0					5																	156565887		2203	4300	6503	SO:0001583	missense	9443	exon2			GTTCAGTTTTTAC	AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.556A>C	5.37:g.156565887T>G	ENSP00000286317:p.Thr186Pro	267	0		121	45	NM_001100816	0	0	21	33	12		Missense_Mutation	SNP	ENST00000286317.5	37	CCDS4334.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291433	0.40494	.	.	ENSG00000155868	ENST00000286317;ENST00000420343;ENST00000524289	.	.	.	5.81	1.99	0.26369	.	0.426120	0.27048	N	0.021196	T	0.36248	0.0960	L	0.52573	1.65	0.35094	D	0.764574	P	0.45634	0.863	B	0.41271	0.352	T	0.40327	-0.9569	9	0.27082	T	0.32	-13.3431	5.9577	0.19283	0.1123:0.1921:0.0:0.6956	.	186	O43513	MED7_HUMAN	P	186	.	ENSP00000286317:T186P	T	-	1	0	MED7	156498465	0.995000	0.38212	0.985000	0.45067	0.991000	0.79684	0.479000	0.22228	0.098000	0.17522	0.533000	0.62120	ACT	.		0.373	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252567.2	NM_004270	
SLC25A27	9481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	46630133	46630133	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:46630133T>C	ENST00000371347.5	+	4	656	c.404T>C	c.(403-405)aTg>aCg	p.M135T	SLC25A27_ENST00000604908.1_3'UTR|SLC25A27_ENST00000411689.2_Missense_Mutation_p.M135T|SLC25A27_ENST00000452689.2_Missense_Mutation_p.M49T	NM_001204051.1|NM_004277.4	NP_001190980.1|NP_004268.3	O95847	UCP4_HUMAN	solute carrier family 25, member 27	135					cellular triglyceride homeostasis (GO:0035356)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|negative regulation of mitochondrial membrane potential (GO:0010917)|neuron death (GO:0070997)|positive regulation of cell proliferation (GO:0008284)|regulation of glucose import (GO:0046324)|transport (GO:0006810)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)				central_nervous_system(1)|kidney(1)|lung(4)|prostate(1)|urinary_tract(1)	8			Lung(136;0.192)			ATTGGAGGGATGATGGCTGGT	0.388																																					p.M135T		.											.	SLC25A27-90	0			c.T404C						.						97.0	92.0	94.0					6																	46630133		1856	4096	5952	SO:0001583	missense	9481	exon4			GAGGGATGATGGC	AK090871	CCDS43470.1, CCDS56431.1	6p12.3	2013-05-22			ENSG00000153291	ENSG00000153291		"""Solute carriers"""	21065	protein-coding gene	gene with protein product		613725				10025957, 10772343	Standard	NM_004277		Approved	UCP4, FLJ33552	uc003oyh.3	O95847	OTTHUMG00000014786	ENST00000371347.5:c.404T>C	6.37:g.46630133T>C	ENSP00000360398:p.Met135Thr	155	1		42	11	NM_001204051	0	0	11	15	4	F5GWR4|Q5VTS9|Q8N518	Missense_Mutation	SNP	ENST00000371347.5	37	CCDS43470.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544149	0.45280	.	.	ENSG00000153291	ENST00000371347;ENST00000411689;ENST00000452689;ENST00000425120	T;T;T	0.78816	-1.21;-1.21;-1.21	5.48	4.31	0.51392	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.66426	0.2788	M	0.64676	1.99	0.46927	D	0.999258	B;B;B;B	0.29805	0.142;0.257;0.257;0.101	B;B;B;B	0.36030	0.216;0.216;0.216;0.062	T	0.71163	-0.4673	10	0.49607	T	0.09	-8.7623	9.9319	0.41528	0.0:0.0835:0.0:0.9164	.	49;135;135;135	B4DZG4;Q5VTS9;O95847;F5GWR4	.;.;UCP4_HUMAN;.	T	135;135;49;65	ENSP00000360398:M135T;ENSP00000412024:M135T;ENSP00000412223:M49T	ENSP00000360398:M135T	M	+	2	0	SLC25A27	46738092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.266000	0.58871	2.089000	0.63090	0.460000	0.39030	ATG	.		0.388	SLC25A27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040791.1	NM_004277	
SLC22A16	85413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110757106	110757106	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:110757106G>A	ENST00000368919.3	-	6	1436	c.1370C>T	c.(1369-1371)gCa>gTa	p.A457V	SLC22A16_ENST00000330550.4_Missense_Mutation_p.A423V|SLC22A16_ENST00000439654.1_Missense_Mutation_p.A457V	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	457					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	GAGGCCAAATGCTGCCCCGAT	0.363																																					p.A457V		.											.	SLC22A16-91	0			c.C1370T						.						102.0	99.0	100.0					6																	110757106		2203	4300	6503	SO:0001583	missense	85413	exon6			CCAAATGCTGCCC		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1370C>T	6.37:g.110757106G>A	ENSP00000357915:p.Ala457Val	185	0		125	39	NM_033125	0	0	0	0	0	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095193	0.56075	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	4.75	0.519	0.17035	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.355691	0.31809	N	0.007039	T	0.81814	0.4902	L	0.56124	1.755	0.80722	D	1	B;B	0.31413	0.322;0.275	B;B	0.37550	0.253;0.164	T	0.76924	-0.2779	10	0.72032	D	0.01	.	8.3956	0.32555	0.3527:0.0:0.6473:0.0	.	457;423	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	V	457;374;423;457	ENSP00000357915:A457V;ENSP00000395642:A374V;ENSP00000328583:A423V;ENSP00000408799:A457V	ENSP00000328583:A423V	A	-	2	0	SLC22A16	110863799	0.999000	0.42202	0.000000	0.03702	0.591000	0.36615	2.826000	0.48104	-0.101000	0.12219	-0.339000	0.08088	GCA	.		0.363	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
MAP7	9053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	136709627	136709627	+	Missense_Mutation	SNP	G	G	A	rs369036954	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:136709627G>A	ENST00000354570.3	-	5	840	c.430C>T	c.(430-432)Cgg>Tgg	p.R144W	MAP7_ENST00000454590.1_Missense_Mutation_p.R166W|MAP7_ENST00000544465.1_Missense_Mutation_p.R129W|MAP7_ENST00000432797.2_De_novo_Start_OutOfFrame|MAP7_ENST00000438100.2_Missense_Mutation_p.R166W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	144					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		ATTGTGCGCCGTACAACAGCT	0.498													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18906	0.0		0.0	False		,,,				2504	0.0				p.R166W		.											.	MAP7-90	0			c.C496T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,,,,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	203.0	167.0	179.0		496,496,496,496,385,430,,,,430	1.8	0.0	6		179	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,intron,utr-5,utr-5,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	101,101,101,101,101,101,,,,101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,,,,probably-damaging	166/772,166/780,166/735,166/772,129/735,144/713,,,,144/750	136709627	2,13004	2203	4300	6503	SO:0001583	missense	9053	exon5			TGCGCCGTACAAC	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.430C>T	6.37:g.136709627G>A	ENSP00000346581:p.Arg144Trp	237	1		137	46	NM_001198611	0	0	16	30	14	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448214	0.43429	4.54E-4	0.0	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	6.06	1.84	0.25277	.	0.000000	0.51477	D	0.000099	T	0.29945	0.0749	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.998;0.999;0.999	T	0.45848	-0.9233	10	0.87932	D	0	-14.4911	15.6295	0.76893	0.0:0.0:0.429:0.571	.	166;166;129;166;166;144;144	B7Z290;B7ZB64;F5H1E2;E9PCP3;B7Z400;Q14244-2;Q14244	.;.;.;.;.;.;MAP7_HUMAN	W	144;166;129;166	ENSP00000346581:R144W;ENSP00000414712:R166W;ENSP00000445737:R129W;ENSP00000400790:R166W	ENSP00000346581:R144W	R	-	1	2	MAP7	136751320	0.998000	0.40836	0.049000	0.19019	0.644000	0.38419	2.739000	0.47409	0.849000	0.35215	0.655000	0.94253	CGG	.		0.498	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
SYNJ2	8871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	158449969	158449969	+	Silent	SNP	A	A	T	rs140060886		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:158449969A>T	ENST00000355585.4	+	3	471	c.396A>T	c.(394-396)tcA>tcT	p.S132S	SYNJ2_ENST00000367121.3_Silent_p.S132S|SYNJ2_ENST00000367122.2_Silent_p.S132S|SYNJ2_ENST00000449859.2_Silent_p.S81S	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	132	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCTATTTCTCATGGCCAAACG	0.542																																					p.S132S		.											.	SYNJ2-227	0			c.A396T						.						66.0	67.0	66.0					6																	158449969		2203	4300	6503	SO:0001819	synonymous_variant	8871	exon3			TTTCTCATGGCCA	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.396A>T	6.37:g.158449969A>T		133	0		235	70	NM_003898	0	0	2	2	0	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	A	4.185	0.032976	0.08101	.	.	ENSG00000078269	ENST00000367113	.	.	.	4.62	-9.25	0.00666	.	.	.	.	.	T	0.35219	0.0924	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68868	-0.5295	4	.	.	.	.	9.0699	0.36486	0.2544:0.577:0.1011:0.0675	.	.	.	.	L	107	.	.	H	+	2	0	SYNJ2	158369957	0.008000	0.16893	0.903000	0.35520	0.321000	0.28281	-1.071000	0.03437	1.946000	0.56461	0.533000	0.62120	CAT	A|1.000;G|0.000		0.542	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
DGKB	1607	broad.mit.edu	37	7	14712573	14712573	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:14712573G>T	ENST00000403951.2	-	13	1534	c.1115C>A	c.(1114-1116)aCa>aAa	p.T372K	DGKB_ENST00000406247.3_Missense_Mutation_p.T372K|DGKB_ENST00000258767.5_Missense_Mutation_p.T372K|DGKB_ENST00000407950.1_Missense_Mutation_p.T365K|DGKB_ENST00000444700.2_Missense_Mutation_p.T365K|DGKB_ENST00000402815.1_Missense_Mutation_p.T372K|DGKB_ENST00000399322.3_Missense_Mutation_p.T372K|DGKB_ENST00000403963.1_5'UTR			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	372					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TGGACAGATTGTTGTGGGTGG	0.383																																					p.T372K													.	DGKB-276	0			c.C1115A						.						92.0	90.0	91.0					7																	14712573		1866	4102	5968	SO:0001583	missense	1607	exon12			CAGATTGTTGTGG	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1115C>A	7.37:g.14712573G>T	ENSP00000385780:p.Thr372Lys	14	0		2	2	NM_145695	0	0	0	0	0	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286640	0.40494	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.79454	-1.16;-1.16;-1.16;-1.16;-1.16;-1.17;-1.27	5.77	5.77	0.91146	.	0.312306	0.34507	N	0.003915	T	0.73651	0.3614	L	0.40543	1.245	0.39165	D	0.962478	B;B;B;B	0.21309	0.032;0.016;0.016;0.054	B;B;B;B	0.25614	0.028;0.062;0.062;0.021	T	0.67875	-0.5557	10	0.30854	T	0.27	.	20.0007	0.97408	0.0:0.0:1.0:0.0	.	372;365;372;372	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	K	372;372;372;372;365;365;372	ENSP00000385780:T372K;ENSP00000382260:T372K;ENSP00000258767:T372K;ENSP00000384909:T372K;ENSP00000385031:T365K;ENSP00000388451:T365K;ENSP00000386066:T372K	ENSP00000258767:T372K	T	-	2	0	DGKB	14679098	0.995000	0.38212	0.946000	0.38457	0.998000	0.95712	5.461000	0.66699	2.726000	0.93360	0.650000	0.86243	ACA	.		0.383	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
NOD1	10392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	30475651	30475651	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:30475651T>A	ENST00000222823.4	-	11	3109	c.2584A>T	c.(2584-2586)Agg>Tgg	p.R862W		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	862					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						TGCAGGGCCCTCGCAAGGCTC	0.443																																					p.R862W		.											.	NOD1-229	0			c.A2584T						.						129.0	106.0	114.0					7																	30475651		2203	4300	6503	SO:0001583	missense	10392	exon11			GGGCCCTCGCAAG	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2584A>T	7.37:g.30475651T>A	ENSP00000222823:p.Arg862Trp	123	0		173	52	NM_006092	0	0	2	7	5	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	T	8.038	0.763254	0.15914	.	.	ENSG00000106100	ENST00000222823	T	0.55052	0.54	5.12	-1.83	0.07833	.	0.871180	0.09788	N	0.755710	T	0.39145	0.1067	L	0.49126	1.545	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36866	-0.9730	10	0.62326	D	0.03	.	1.2857	0.02050	0.1549:0.2137:0.3025:0.3289	.	862	Q9Y239	NOD1_HUMAN	W	862	ENSP00000222823:R862W	ENSP00000222823:R862W	R	-	1	2	NOD1	30442176	0.008000	0.16893	0.000000	0.03702	0.092000	0.18411	0.609000	0.24238	-0.810000	0.04375	-0.313000	0.08912	AGG	.		0.443	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
EIF4H	7458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73601993	73601993	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:73601993A>G	ENST00000265753.8	+	2	251	c.112A>G	c.(112-114)Aca>Gca	p.T38A	EIF4H_ENST00000353999.6_Missense_Mutation_p.T38A|EIF4H_ENST00000495187.1_3'UTR	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	38					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						GGAGTTGCCCACAGAGCCCCC	0.527																																					p.T38A		.											.	EIF4H-90	0			c.A112G						.						93.0	91.0	92.0					7																	73601993		2203	4297	6500	SO:0001583	missense	7458	exon2			TTGCCCACAGAGC		CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.112A>G	7.37:g.73601993A>G	ENSP00000265753:p.Thr38Ala	296	0		422	133	NM_022170	0	0	44	80	35	A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	ENST00000265753.8	37	CCDS5564.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053342	0.55218	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.74002	-0.8;-0.8	5.05	5.05	0.67936	Nucleotide-binding, alpha-beta plait (1);	0.118143	0.64402	D	0.000020	T	0.72020	0.3409	L	0.55990	1.75	0.54753	D	0.999988	B;B;B;B	0.20368	0.012;0.012;0.044;0.006	B;B;B;B	0.28916	0.096;0.096;0.047;0.054	T	0.70310	-0.4907	10	0.49607	T	0.09	-15.2629	13.9042	0.63823	1.0:0.0:0.0:0.0	.	38;38;38;38	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	A	38	ENSP00000265753:T38A;ENSP00000265754:T38A	ENSP00000265753:T38A	T	+	1	0	EIF4H	73239929	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.887000	0.63156	2.029000	0.59856	0.379000	0.24179	ACA	.		0.527	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252375.2	NM_022170	
POR	5447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	75615481	75615481	+	Missense_Mutation	SNP	A	A	G	rs72557954		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:75615481A>G	ENST00000461988.1	+	15	1925	c.1820A>G	c.(1819-1821)tAc>tGc	p.Y607C	POR_ENST00000394893.1_Missense_Mutation_p.Y607C|POR_ENST00000545601.1_Missense_Mutation_p.Y415C|POR_ENST00000419840.1_Intron|POR_ENST00000439269.1_Missense_Mutation_p.Y345C|POR_ENST00000450476.1_Missense_Mutation_p.Y506C|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	604					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	CCCCAGGTCTACGTCCAGCAC	0.632																																					p.Y607C		.											.	POR-23	0			c.A1820G	GRCh37	CM087168	POR	M	rs72557954	.						43.0	56.0	52.0					7																	75615481		2106	4224	6330	SO:0001583	missense	5447	exon15			AGGTCTACGTCCA	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1820A>G	7.37:g.75615481A>G	ENSP00000419970:p.Tyr607Cys	28	0		41	19	NM_000941	0	0	0	0	0	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.731367	0.30684	.	.	ENSG00000127948	ENST00000461988;ENST00000394893;ENST00000545601;ENST00000450476;ENST00000439269	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	3.59	3.59	0.41128	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.127712	0.53938	D	0.000041	D	0.94512	0.8233	H	0.99336	4.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95784	0.8819	10	0.87932	D	0	-33.1823	12.3556	0.55174	1.0:0.0:0.0:0.0	.	604;506;415;613	P16435;E7EVY7;F5H468;Q59ED7	NCPR_HUMAN;.;.;.	C	607;607;415;506;345	ENSP00000419970:Y607C;ENSP00000378355:Y607C;ENSP00000446149:Y415C;ENSP00000416572:Y506C;ENSP00000412490:Y345C	ENSP00000378355:Y607C	Y	+	2	0	POR	75453417	1.000000	0.71417	0.956000	0.39512	0.099000	0.18886	5.702000	0.68332	1.863000	0.54032	0.459000	0.35465	TAC	A|0.999;G|0.001		0.632	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
BAIAP2L1	55971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	97933661	97933661	+	Silent	SNP	G	G	A	rs555687728		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:97933661G>A	ENST00000005260.8	-	12	1484	c.1269C>T	c.(1267-1269)acC>acT	p.T423T		NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	423					filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)	p.T423T(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			ACAAGTTCACGGTGCTGATGC	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		18777	0.0		0.0	False		,,,				2504	0.001				p.T423T		.											.	BAIAP2L1-91	1	Substitution - coding silent(1)	breast(1)	c.C1269T						.						119.0	99.0	105.0					7																	97933661		2203	4300	6503	SO:0001819	synonymous_variant	55971	exon12			GTTCACGGTGCTG	AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1269C>T	7.37:g.97933661G>A		99	0		245	50	NM_018842	0	0	37	48	11	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	ENST00000005260.8	37	CCDS34687.1																																																																																			.		0.537	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334681.1	NM_018842	
POLR2J	5439	hgsc.bcm.edu;broad.mit.edu	37	7	102119282	102119282	+	Missense_Mutation	SNP	G	G	C	rs532470326	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:102119282G>C	ENST00000292614.5	-	1	72	c.26C>G	c.(25-27)tCg>tGg	p.S9W	AC093668.3_ENST00000607525.1_RNA|POLR2J_ENST00000393794.3_Missense_Mutation_p.S9W	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	9					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)			pancreas(2)	2						GAGCAAGAACGACTCGAAGGC	0.682											OREG0018232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3	0.000599042	0.0023	0.0	5008	,	,		9429	0.0		0.0	False		,,,				2504	0.0				p.S9W		.											.	POLR2J-91	0			c.C26G						.						17.0	22.0	20.0					7																	102119282		1948	3904	5852	SO:0001583	missense	5439	exon1			AAGAACGACTCGA	X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387	ENST00000292614.5:c.26C>G	7.37:g.102119282G>C	ENSP00000292614:p.Ser9Trp	95	2	1364	333	18	NM_006234	0	0	1346	1414	68	A5D6V8|O43375	Missense_Mutation	SNP	ENST00000292614.5	37	CCDS5724.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624348	0.87560	.	.	ENSG00000005075	ENST00000292614;ENST00000393794	D;D	0.92752	-3.1;-3.1	5.59	5.59	0.84812	DNA-directed RNA polymerase, RBP11-like (1);	0.000000	0.85682	D	0.000000	D	0.95796	0.8632	M	0.91090	3.175	0.80722	D	1	D	0.69078	0.997	P	0.53809	0.735	D	0.96375	0.9277	10	0.66056	D	0.02	-9.1512	17.0873	0.86614	0.0:0.0:1.0:0.0	.	9	P52435	RPB11_HUMAN	W	9	ENSP00000292614:S9W;ENSP00000377383:S9W	ENSP00000292614:S9W	S	-	2	0	POLR2J	101906287	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	7.941000	0.87700	2.647000	0.89833	0.555000	0.69702	TCG	.		0.682	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317913.1	NM_006234	
ANKRD7	56311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	117879989	117879989	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:117879989C>A	ENST00000265224.4	+	6	894	c.739C>A	c.(739-741)Cat>Aat	p.H247N	ANKRD7_ENST00000477532.1_3'UTR|ANKRD7_ENST00000357099.4_Missense_Mutation_p.H267N|ANKRD7_ENST00000433239.1_Missense_Mutation_p.H194N|ANKRD7_ENST00000417525.1_Silent_p.A192A	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	247					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						CACTGCGAGCCATGGAAAGAA	0.338																																					p.H247N		.											.	ANKRD7-90	0			c.C739A						.						95.0	90.0	92.0					7																	117879989		1874	4112	5986	SO:0001583	missense	56311	exon6			GCGAGCCATGGAA	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.739C>A	7.37:g.117879989C>A	ENSP00000265224:p.His247Asn	88	0		221	31	NM_019644	0	0	5	9	4	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	37	CCDS43638.1	.	.	.	.	.	.	.	.	.	.	C	8.240	0.806672	0.16467	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000433239	T;T;T	0.39787	1.07;1.18;1.06	3.96	-7.92	0.01160	.	7.917730	0.01487	U	0.016939	T	0.22551	0.0544	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08722	-1.0708	10	0.42905	T	0.14	-2.3393	0.7429	0.00977	0.3457:0.1668:0.1118:0.3758	.	247	Q92527	ANKR7_HUMAN	N	267;247;194	ENSP00000349612:H267N;ENSP00000265224:H247N;ENSP00000388473:H194N	ENSP00000265224:H247N	H	+	1	0	ANKRD7	117667225	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-0.364000	0.07583	-2.334000	0.00630	-2.920000	0.00090	CAT	.		0.338	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241029	+	Silent	SNP	G	G	C	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:131241029G>C	ENST00000378555.3	-	1	337	c.90C>G	c.(88-90)ccC>ccG	p.P30P	PODXL_ENST00000541194.1_Silent_p.P30P|PODXL_ENST00000322985.9_Silent_p.P30P|PODXL_ENST00000537928.1_Silent_p.P30P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcg	0.751																																					p.P30P		.											.	PODXL-136	0			c.C90G						.						5.0	7.0	6.0					7																	131241029		1981	3946	5927	SO:0001819	synonymous_variant	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.90C>G	7.37:g.131241029G>C		7	0		33	2	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.751	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
PRKAG2	51422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151262972	151262972	+	Splice_Site	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:151262972C>T	ENST00000287878.4	-	12	1738		c.e12-1		PRKAG2_ENST00000392801.2_Splice_Site|PRKAG2_ENST00000492843.1_Splice_Site|PRKAG2_ENST00000418337.2_Splice_Site|PRKAG2_ENST00000433631.2_Splice_Site	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TATCAGACATCTAAACGGAAG	0.418																																					.		.											.	PRKAG2-658	0			c.1234-1G>A						.						168.0	137.0	147.0					7																	151262972		2203	4300	6503	SO:0001630	splice_region_variant	51422	exon13			AGACATCTAAACG	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1234-1G>A	7.37:g.151262972C>T		151	0		87	31	NM_016203	0	0	1	3	2	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Splice_Site	SNP	ENST00000287878.4	37	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459439	0.84317	.	.	ENSG00000106617	ENST00000418337;ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.609	0.95594	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKAG2	150893905	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.538000	0.82048	2.882000	0.98803	0.655000	0.94253	.	.		0.418	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	Intron
SGCZ	137868	hgsc.bcm.edu	37	8	13948004	13948004	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr8:13948004G>C	ENST00000382080.1	-	8	1602	c.887C>G	c.(886-888)gCa>gGa	p.A296G	SGCZ_ENST00000421524.2_Missense_Mutation_p.A249G	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	283					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ACCTACTCCTGCTGGAGAAAG	0.498																																					p.A296G		.											.	SGCZ-93	0			c.C887G						.						175.0	159.0	164.0					8																	13948004		2203	4300	6503	SO:0001583	missense	137868	exon8			ACTCCTGCTGGAG	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.887C>G	8.37:g.13948004G>C	ENSP00000371512:p.Ala296Gly	230	0		26	2	NM_139167	0	0	0	0	0	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512227	0.85389	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.95069	-3.6;-3.6	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.97241	0.9098	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	D	0.97464	1.0036	10	0.72032	D	0.01	.	18.7556	0.91832	0.0:0.0:1.0:0.0	.	249;296	Q08AT0;Q96LD1-2	.;.	G	296;249	ENSP00000371512:A296G;ENSP00000405224:A249G	ENSP00000371512:A296G	A	-	2	0	SGCZ	13992375	1.000000	0.71417	0.994000	0.49952	0.955000	0.61496	9.476000	0.97823	2.760000	0.94817	0.655000	0.94253	GCA	.		0.498	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
FAM84B	157638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	127569250	127569250	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr8:127569250G>C	ENST00000304916.3	-	2	840	c.385C>G	c.(385-387)Cag>Gag	p.Q129E	RP11-89K10.1_ENST00000517773.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA|RP11-89K10.1_ENST00000519880.1_RNA|RP11-103H7.5_ENST00000524320.1_RNA|FAM84B_ENST00000517458.1_5'Flank	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	129						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			TGCGGGTACTGAGCCTGCGAC	0.637																																					p.Q129E		.											.	FAM84B-22	0			c.C385G						.						27.0	29.0	29.0					8																	127569250		2202	4299	6501	SO:0001583	missense	157638	exon2			GGTACTGAGCCTG	AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.385C>G	8.37:g.127569250G>C	ENSP00000302578:p.Gln129Glu	109	0		156	43	NM_174911	0	0	17	46	29		Missense_Mutation	SNP	ENST00000304916.3	37	CCDS6358.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.480872	0.44044	.	.	ENSG00000168672	ENST00000304916	T	0.03152	4.03	4.81	4.81	0.61882	.	0.057812	0.64402	D	0.000001	T	0.14270	0.0345	M	0.63428	1.95	0.51767	D	0.999933	D	0.71674	0.998	D	0.67725	0.953	T	0.06215	-1.0839	10	0.27785	T	0.31	-11.9573	16.8556	0.86005	0.0:0.0:1.0:0.0	.	129	Q96KN1	FA84B_HUMAN	E	129	ENSP00000302578:Q129E	ENSP00000302578:Q129E	Q	-	1	0	FAM84B	127638432	1.000000	0.71417	0.977000	0.42913	0.005000	0.04900	7.807000	0.86032	2.181000	0.69327	0.467000	0.42956	CAG	.		0.637	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381487.1	NM_174911	
EEF1D	1936	hgsc.bcm.edu	37	8	144660318	144660318	+	IGR	SNP	G	G	T	rs896951|rs35914195	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr8:144660318G>T	ENST00000529272.1	-	0	1311				NAPRT1_ENST00000276844.7_Silent_p.A57A|NAPRT1_ENST00000435154.3_Silent_p.A57A|RP11-661A12.9_ENST00000531730.1_RNA|RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|NAPRT1_ENST00000449291.2_Silent_p.A57A|NAPRT1_ENST00000426292.3_Silent_p.A57A			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GCAAGCCGGCGGCCAAGGCGA	0.756													G|||	105	0.0209665	0.0772	0.0043	5008	,	,		10107	0.0		0.0	False		,,,				2504	0.0				p.A57A		.											.	NAPRT1-91	0			c.C171A						.	G		128,2634		0,128,1253	2.0	3.0	3.0		171	2.1	1.0	8	dbSNP_86	3	4,5910		0,4,2953	no	coding-synonymous	NAPRT1	NM_145201.4		0,132,4206	TT,TG,GG		0.0676,4.6343,1.5214		57/539	144660318	132,8544	1381	2957	4338	SO:0001628	intergenic_variant	93100	exon1			GCCGGCGGCCAAG	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191		8.37:g.144660318G>T		6	2		14	9	NM_145201	0	0	3	3	0	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Silent	SNP	ENST00000529272.1	37	CCDS6405.1																																																																																			T|0.001;C|0.985		0.756	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
SPATA31E1	286234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	90501484	90501484	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:90501484C>T	ENST00000325643.5	+	4	2148	c.2082C>T	c.(2080-2082)acC>acT	p.T694T		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	694					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGCAGAAGACCGGGTTCAGGA	0.612																																					p.T694T		.											.	.	0			c.C2082T						.						54.0	69.0	64.0					9																	90501484		2203	4300	6503	SO:0001819	synonymous_variant	286234	exon4			GAAGACCGGGTTC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2082C>T	9.37:g.90501484C>T		160	0		234	65	NM_178828	0	0	0	0	0	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	CCDS6676.1																																																																																			.		0.612	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
NUP214	8021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	134010301	134010301	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:134010301A>T	ENST00000359428.5	+	8	992	c.848A>T	c.(847-849)cAc>cTc	p.H283L	RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.H283L|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.H283L|RP11-544A12.4_ENST00000587408.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	283	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GAAGAAAAGCACCCAGAGATA	0.378			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.H283L	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.A848T						.						69.0	67.0	67.0					9																	134010301		2203	4300	6503	SO:0001583	missense	8021	exon8			AAAAGCACCCAGA	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.848A>T	9.37:g.134010301A>T	ENSP00000352400:p.His283Leu	111	0		57	17	NM_005085	0	0	14	18	4	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.855209	0.71719	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375	D;D;D	0.93488	-3.23;-3.23;-3.23	5.69	3.32	0.38043	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.43110	D	0.000603	T	0.80954	0.4723	N	0.08118	0	0.31118	N	0.709181	B;B	0.33022	0.202;0.394	B;B	0.32022	0.099;0.139	T	0.75227	-0.3392	10	0.23891	T	0.37	-11.0116	3.1676	0.06541	0.5712:0.2182:0.2105:0.0	.	283;283	P35658-4;P35658	.;NU214_HUMAN	L	283	ENSP00000352400:H283L;ENSP00000396576:H283L;ENSP00000405014:H283L	ENSP00000352400:H283L	H	+	2	0	NUP214	133000122	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.069000	0.50026	0.950000	0.37743	0.528000	0.53228	CAC	.		0.378	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841260	15841260	+	Silent	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:15841260C>G	ENST00000307771.7	+	11	1368	c.1344C>G	c.(1342-1344)cgC>cgG	p.R448R		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	448	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					gccggagccgCAGGAGCCGCC	0.647			"""F, S, Mis"""		"""MDS, CLL"""																																p.R448R	NSCLC(197;1631 3042 5741 31152)	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2-133	0			c.C1344G						.						7.0	9.0	9.0					X																	15841260		1924	3790	5714	SO:0001819	synonymous_variant	8233	exon11			GAGCCGCAGGAGC	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1344C>G	X.37:g.15841260C>G		31	0		50	5	NM_005089	0	0	3	3	0	Q14D69	Silent	SNP	ENST00000307771.7	37	CCDS14172.1																																																																																			.		0.647	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350752	50350752	+	Silent	SNP	T	T	C	rs534812379		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:50350752T>C	ENST00000289292.7	-	6	3673	c.3390A>G	c.(3388-3390)caA>caG	p.Q1130Q	SHROOM4_ENST00000460112.3_Silent_p.Q1014Q|SHROOM4_ENST00000376020.2_Silent_p.Q1130Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1130	Gln-rich.			KQQ -> QQQQKQQE (in Ref. 1; BAA86516 and 3; AAI51241). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctcctcctgttgcttctgct	0.582																																					p.Q1130Q		.											.	SHROOM4-131	0			c.A3390G						.						15.0	15.0	15.0					X																	50350752		2198	4291	6489	SO:0001819	synonymous_variant	57477	exon6			CTCCTGTTGCTTC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3390A>G	X.37:g.50350752T>C		55	1		103	6	NM_020717	0	0	1	1	0	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
HEPH	9843	hgsc.bcm.edu	37	X	65423314	65423314	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:65423314A>C	ENST00000343002.2	+	12	2850	c.2186A>C	c.(2185-2187)tAc>tCc	p.Y729S	HEPH_ENST00000519389.1_Missense_Mutation_p.Y783S|HEPH_ENST00000374727.3_Missense_Mutation_p.Y732S|HEPH_ENST00000419594.1_Missense_Mutation_p.Y540S|HEPH_ENST00000441993.2_Missense_Mutation_p.Y732S|HEPH_ENST00000336279.5_Missense_Mutation_p.Y462S			Q9BQS7	HEPH_HUMAN	hephaestin	729					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CGCCAACGCTACCAAGCTGCA	0.537																																					p.Y783S		.											.	HEPH-135	0			c.A2348C						.						89.0	71.0	77.0					X																	65423314		2203	4300	6503	SO:0001583	missense	9843	exon13			AACGCTACCAAGC	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2186A>C	X.37:g.65423314A>C	ENSP00000343939:p.Tyr729Ser	140	0		32	2	NM_138737	0	0	2	2	0	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	A	15.22	2.767599	0.49574	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99252	-4.95;-4.95;-4.95;-4.95;-5.63;-4.95;-4.95	4.91	4.91	0.64330	Cupredoxin (1);	0.389120	0.26612	N	0.023404	D	0.98745	0.9578	L	0.45744	1.44	0.34243	D	0.677871	D;P;B;D	0.71674	0.983;0.603;0.203;0.998	P;B;B;P	0.61722	0.852;0.138;0.026;0.893	D	0.99964	1.1808	10	0.36615	T	0.2	.	12.4148	0.55488	1.0:0.0:0.0:0.0	.	783;129;540;729	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	S	783;732;462;732;540;729;686	ENSP00000430620:Y783S;ENSP00000363859:Y732S;ENSP00000337418:Y462S;ENSP00000411687:Y732S;ENSP00000413211:Y540S;ENSP00000343939:Y729S;ENSP00000398078:Y686S	ENSP00000337418:Y462S	Y	+	2	0	HEPH	65340039	1.000000	0.71417	0.974000	0.42286	0.805000	0.45488	3.735000	0.55044	1.812000	0.52913	0.486000	0.48141	TAC	.		0.537	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
TREX2	11219	broad.mit.edu	37	X	152710189	152710189	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:152710189G>T	ENST00000334497.2	-	11	1970	c.829C>A	c.(829-831)Ctg>Atg	p.L277M	TREX2_ENST00000370231.2_Missense_Mutation_p.L234M|TREX2_ENST00000402951.1_Missense_Mutation_p.L277M|HAUS7_ENST00000484394.1_5'Flank|TREX2_ENST00000330912.2_Missense_Mutation_p.L234M|TREX2_ENST00000370232.1_Missense_Mutation_p.L277M|TREX2_ENST00000393862.2_Missense_Mutation_p.L234M|TREX2_ENST00000338525.2_Missense_Mutation_p.L234M|TREX2_ENST00000414588.1_Missense_Mutation_p.L276M			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	277					DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)			endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGCCTCCAGGCTGGGGTCA	0.687								Editing and processing nucleases																													p.L234M													.	TREX2-227	0			c.C700A						.						13.0	10.0	11.0					X																	152710189		2184	4267	6451	SO:0001583	missense	11219	exon2			CCTCCAGGCTGGG	AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.829C>A	X.37:g.152710189G>T	ENSP00000334993:p.Leu277Met	12	0		19	5	NM_080701	0	0	0	0	0	Q45F08|Q9UN77	Missense_Mutation	SNP	ENST00000334497.2	37		.	.	.	.	.	.	.	.	.	.	G	11.73	1.725419	0.30593	.	.	ENSG00000183479	ENST00000393862;ENST00000330912;ENST00000338525;ENST00000334497;ENST00000370232;ENST00000402951;ENST00000414588;ENST00000370231	T;T;T;T;T;T;T;T	0.55588	0.69;0.69;0.69;0.55;0.55;0.55;0.51;0.69	4.35	-4.78	0.03209	.	1.591890	0.04555	U	0.390669	T	0.32376	0.0827	L	0.27053	0.805	0.09310	N	1	P;B	0.35982	0.531;0.255	B;B	0.32864	0.154;0.03	T	0.26573	-1.0099	10	0.59425	D	0.04	-15.9683	2.929	0.05793	0.0948:0.243:0.1692:0.493	.	276;277	Q06S70;Q9BQ50	.;TREX2_HUMAN	M	234;234;234;277;277;277;276;234	ENSP00000377442:L234M;ENSP00000333441:L234M;ENSP00000345218:L234M;ENSP00000334993:L277M;ENSP00000359252:L277M;ENSP00000386078:L277M;ENSP00000401692:L276M;ENSP00000359251:L234M	ENSP00000333441:L234M	L	-	1	2	TREX2	152363383	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.322000	0.08007	-0.747000	0.04759	-0.542000	0.04241	CTG	.		0.687	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000060966.1	NM_080701	
CA6	765	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	9009376	9009376	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:9009376delA	ENST00000377443.2	+	2	138	c.134delA	c.(133-135)cagfs	p.Q45fs	CA6_ENST00000480186.3_Frame_Shift_Del_p.Q45fs|CA6_ENST00000377436.3_Frame_Shift_Del_p.Q45fs|CA6_ENST00000377442.2_Intron|CA6_ENST00000476083.1_Intron	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	45					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	TGTGGGGGCCAGAGACAGTCG	0.602																																					p.Q45fs		.											.	CA6-516	0			c.134delA						.						44.0	42.0	43.0					1																	9009376		2203	4300	6503	SO:0001589	frameshift_variant	765	exon2			.	M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.134delA	1.37:g.9009376delA	ENSP00000366662:p.Gln45fs	80	0		153	59	NM_001270500	0	0	0	0	0	E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Frame_Shift_Del	DEL	ENST00000377443.2	37	CCDS30578.1																																																																																			.		0.602	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000004911.1		
PABPC4	8761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	40038242	40038242	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:40038242delG	ENST00000372857.3	-	2	1002	c.210delC	c.(208-210)gacfs	p.D70fs	PABPC4_ENST00000372856.3_Frame_Shift_Del_p.D70fs|PABPC4_ENST00000529216.1_5'Flank|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372858.3_Frame_Shift_Del_p.D70fs|PABPC4_ENST00000372862.3_Frame_Shift_Del_p.D70fs	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	70	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTCATGGTGTCCAAAGCCC	0.468																																					p.D70fs		.											.	PABPC4-68	0			c.210delC						.						83.0	77.0	79.0					1																	40038242		2203	4300	6503	SO:0001589	frameshift_variant	8761	exon2			.	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.210delC	1.37:g.40038242delG	ENSP00000361948:p.Asp70fs	179	0		117	34	NM_001135653	0	0	0	0	0	B1ANQ8|Q4VC03|Q6P0N3	Frame_Shift_Del	DEL	ENST00000372857.3	37	CCDS438.1																																																																																			.		0.468	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
PABPC4	8761	hgsc.bcm.edu	37	1	40038242	40038244	+	In_Frame_Del	DEL	GTC	GTC	-	rs1058524		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:40038242_40038244delGTC	ENST00000372857.3	-	2	1000_1002	c.208_210delGAC	c.(208-210)gacdel	p.D70del	PABPC4_ENST00000372856.3_In_Frame_Del_p.D70del|PABPC4_ENST00000529216.1_5'Flank|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372858.3_In_Frame_Del_p.D70del|PABPC4_ENST00000372862.3_In_Frame_Del_p.D70del	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	70	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTCATGGTGTCCAAAGCCCGC	0.463																																					p.70_70del		.											.	PABPC4-68	0			c.208_210del						.																																			SO:0001651	inframe_deletion	8761	exon2			.	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.208_210delGAC	1.37:g.40038242_40038244delGTC	ENSP00000361948:p.Asp70del	179	0		118	23	NM_001135653	0	0	0	0	0	B1ANQ8|Q4VC03|Q6P0N3	In_Frame_Del	DEL	ENST00000372857.3	37	CCDS438.1																																																																																			.		0.463	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
LRRC4C	57689	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	40136626	40136630	+	Frame_Shift_Del	DEL	AGCAC	AGCAC	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	AGCAC	AGCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:40136626_40136630delAGCAC	ENST00000278198.2	-	2	3176_3180	c.1213_1217delGTGCT	c.(1213-1218)gtgctcfs	p.VL405fs	LRRC4C_ENST00000528697.1_Frame_Shift_Del_p.VL405fs|LRRC4C_ENST00000527150.1_Frame_Shift_Del_p.VL405fs|LRRC4C_ENST00000530763.1_Frame_Shift_Del_p.VL405fs			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	405	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ACCATCACTGAGCACAGCTATCCGC	0.454																																					p.405_406del		.											.	LRRC4C-521	0			c.1213_1217del						.																																			SO:0001589	frameshift_variant	57689	exon7			.	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1213_1217delGTGCT	11.37:g.40136626_40136630delAGCAC	ENSP00000278198:p.Val405fs	484	0		222	50	NM_001258419	0	0	0	0	0	A8K0T1|Q7L0N3	Frame_Shift_Del	DEL	ENST00000278198.2	37	CCDS31464.1																																																																																			.		0.454	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
CLEC4D	338339	broad.mit.edu;bcgsc.ca	37	12	8667926	8667932	+	Splice_Site	DEL	TAAGTTA	TAAGTTA	-	rs374422007		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	TAAGTTA	TAAGTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:8667926_8667932delTAAGTTA	ENST00000299665.2	+	2	314		c.e2+2			NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D						innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					GTTGTTTGGGTAAGTTATTAGCCAAAG	0.372																																					.													.	CLEC4D-90	0			.						.																																			SO:0001630	splice_region_variant	338339	.			TTTGGGTAAGTTA	AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.121+2TAAGTTA>-	12.37:g.8667926_8667932delTAAGTTA		161	0		38	7	.	0	0	0	0	0	Q8N5J5	Splice_Site	DEL	ENST00000299665.2	37	CCDS8593.1																																																																																			.		0.372	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400565.1	NM_080387	Intron
ITGA7	3679	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56096870	56096870	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:56096870delT	ENST00000555728.1	-	2	327	c.299delA	c.(298-300)gagfs	p.E100fs	ITGA7_ENST00000347027.6_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000394229.2_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000257879.6_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000257880.7_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000553804.1_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000394230.2_Frame_Shift_Del_p.E100fs			Q13683	ITA7_HUMAN	integrin, alpha 7	100					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCAGTCAGTCTCCTCCAGGCT	0.642																																					p.E100fs		.											.	ITGA7-229	0			c.299delA						.						106.0	96.0	99.0					12																	56096870		2203	4300	6503	SO:0001589	frameshift_variant	3679	exon2			.		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.299delA	12.37:g.56096870delT	ENSP00000452387:p.Glu100fs	250	0		363	130	NM_002206	0	0	0	0	0	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Frame_Shift_Del	DEL	ENST00000555728.1	37																																																																																				.		0.642	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
KIAA1033	23325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	105512257	105512259	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:105512257_105512259delGTG	ENST00000332180.5	+	7	556_558	c.469_471delGTG	c.(469-471)gtgdel	p.V158del		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GTGCTATGAAGTGGTGATGAACG	0.34																																					p.157_157del		.											.	KIAA1033-91	0			c.469_471del						.																																			SO:0001651	inframe_deletion	23325	exon7			.	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.469_471delGTG	12.37:g.105512260_105512262delGTG	ENSP00000328062:p.Val158del	194	0		36	11	NM_015275	0	0	0	0	0		In_Frame_Del	DEL	ENST00000332180.5	37	CCDS41826.1																																																																																			.		0.340	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
OCA2	4948	broad.mit.edu	37	15	28200305	28200305	+	Splice_Site	DEL	T	T	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr15:28200305delT	ENST00000354638.3	-	17	1996	c.1841delA	c.(1840-1842)aag>ag	p.K614fs	OCA2_ENST00000353809.5_Splice_Site_p.K590fs|OCA2_ENST00000382996.2_Splice_Site_p.K614fs	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	614			K -> E (in OCA2). {ECO:0000269|PubMed:10987646}.|K -> N (in OCA2).		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GCTGGGTACCTTTTTTTGGAG	0.443									Oculocutaneous Albinism																												p.K614fs													.	OCA2-135	0			c.1841delA	GRCh37	CD000269	OCA2	D		.						224.0	217.0	219.0					15																	28200305		2203	4300	6503	SO:0001630	splice_region_variant	4948	exon17	Familial Cancer Database		GGTACCTTTTTTT		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1842+1A>-	15.37:g.28200305delT		317	0		498	7	NM_000275	0	0	0	0	0	Q15211|Q15212|Q96EN1|Q9UMI5	Frame_Shift_Del	DEL	ENST00000354638.3	37	CCDS10020.1																																																																																			.		0.443	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	Frame_Shift_Del
IRX3	79191	hgsc.bcm.edu	37	16	54317587	54317598	+	Stop_Codon_Del	DEL	TTTTTAAAGAAC	TTTTTAAAGAAC	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	TTTTTAAAGAAC	TTTTTAAAGAAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:54317587_54317598delTTTTTAAAGAAC	ENST00000329734.3	-	0	2218_2229					NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3						mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						TTTTTTGTTTTTTTTAAAGAACTAGGATGAGG	0.377																																					p.502_502del	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.1506_1922del						.																																			SO:0001567	stop_retained_variant	79191	exon4			.	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	Exception_encountered	16.37:g.54317587_54317598delTTTTTAAAGAAC	Exception_encountered	46	0		75	17	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Frame_Shift_Del	DEL	ENST00000329734.3	37	CCDS10750.1																																																																																			.		0.377	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
RAB11B	9230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8468330	8468331	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:8468330_8468331delCA	ENST00000328024.6	+	5	763_764	c.545_546delCA	c.(544-546)gcafs	p.A182fs		NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	182					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(1)|ovary(1)	4						AAACAGATCGCAGACCGCGCTG	0.653																																					p.182_182del		.											.	RAB11B-227	0			c.545_546del						.																																			SO:0001589	frameshift_variant	9230	exon5			.	X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.545_546delCA	19.37:g.8468330_8468331delCA	ENSP00000333547:p.Ala182fs	178	0		255	75	NM_004218	0	0	0	0	0	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Frame_Shift_Del	DEL	ENST00000328024.6	37	CCDS12201.1																																																																																			.		0.653	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460343.2	NM_004218	
DOCK6	57572	broad.mit.edu	37	19	11324999	11325018	+	Frame_Shift_Del	DEL	GGCACTCTGGGCACTGCCCA	GGCACTCTGGGCACTGCCCA	-	rs201987811		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GGCACTCTGGGCACTGCCCA	GGCACTCTGGGCACTGCCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:11324999_11325018delGGCACTCTGGGCACTGCCCA	ENST00000294618.7	-	34	4282_4301	c.4271_4290delTGGGCAGTGCCCAGAGTGCC	c.(4270-4290)ctgggcagtgcccagagtgccfs	p.LGSAQSA1424fs	DOCK6_ENST00000319867.7_Frame_Shift_Del_p.LGSAQSA763fs|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1424					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCAAGAAGAGGGCACTCTGGGCACTGCCCAGGCTGTACAG	0.568																																					p.1424_1430del													.	DOCK6-93	0			c.4271_4290del						.																																			SO:0001589	frameshift_variant	57572	exon34			GAAGAGGGCACTC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4271_4290delTGGGCAGTGCCCAGAGTGCC	19.37:g.11324999_11325018delGGCACTCTGGGCACTGCCCA	ENSP00000294618:p.Leu1424fs	60	0		114	14	NM_020812	0	0	0	0	0	A6H8X5|Q7Z7P4|Q9P2F2	Frame_Shift_Del	DEL	ENST00000294618.7	37	CCDS45975.1																																																																																			.		0.568	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
LCLAT1	253558	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	30863165	30863173	+	In_Frame_Del	DEL	GAAGAGAAA	GAAGAGAAA	-	rs200693287|rs150085223	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GAAGAGAAA	GAAGAGAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:30863165_30863173delGAAGAGAAA	ENST00000309052.4	+	7	1134_1142	c.925_933delGAAGAGAAA	c.(925-933)gaagagaaadel	p.EEK309del	LCLAT1_ENST00000491680.2_3'UTR|LCLAT1_ENST00000379509.3_In_Frame_Del_p.EEK271del|LCLAT1_ENST00000540623.1_In_Frame_Del_p.EEK271del	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	309					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						CAAACGGTGGGAAGAGAAAGAAGAGAGGC	0.498																																					p.309_311del		.											.	LCLAT1-92	0			c.925_933del						.																																			SO:0001651	inframe_deletion	253558	exon7			.	AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.925_933delGAAGAGAAA	2.37:g.30863165_30863173delGAAGAGAAA	ENSP00000310551:p.Glu309_Lys311del	226	0		178	28	NM_182551	0	0	0	0	0	A6H8Z7|Q8N1Q7	In_Frame_Del	DEL	ENST00000309052.4	37	CCDS1772.1																																																																																			.		0.498	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551	
MAT2A	4144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	85769094	85769097	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:85769094_85769097delAAGT	ENST00000306434.3	+	5	671_672	c.548_549delAAGT	c.(547-549)caa>c	p.Q183fs	MAT2A_ENST00000409017.1_Splice_Site_p.Q120fs|MAT2A_ENST00000490878.1_3'UTR	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	183					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TCTAAAACTCAAGTAAGTGATGAT	0.382																																					p.183_183del		.											.	MAT2A-90	0			c.548_549del						.																																			SO:0001630	splice_region_variant	4144	exon5			.		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.549+1AAGT>-	2.37:g.85769098_85769101delAAGT		151	0		52	14	NM_005911	0	0	0	0	0	A8K511|B4DN45|D6W5L1|Q53SP5	Frame_Shift_Del	DEL	ENST00000306434.3	37	CCDS1977.1																																																																																			.		0.382	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	Frame_Shift_Del
CEP250	11190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	34091451	34091451	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:34091451delA	ENST00000397527.1	+	30	5974	c.5254delA	c.(5254-5256)aaafs	p.K1752fs	CEP250_ENST00000342580.4_Frame_Shift_Del_p.K1696fs	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1752	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CCAGGAGCTCAAAGACCAGCT	0.577																																					p.K1752fs		.											.	CEP250-27	0			c.5254delA						.						81.0	80.0	80.0					20																	34091451		2203	4300	6503	SO:0001589	frameshift_variant	11190	exon30			.	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5254delA	20.37:g.34091451delA	ENSP00000380661:p.Lys1752fs	166	0		311	105	NM_007186	0	0	0	0	0	E1P5Q3|O14812|O60588|Q9H450	Frame_Shift_Del	DEL	ENST00000397527.1	37	CCDS13255.1																																																																																			.		0.577	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
C3orf17	25871	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	112736366	112736368	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:112736366_112736368delCAT	ENST00000314400.5	-	2	379_381	c.188_190delATG	c.(187-192)gatgtg>gtg	p.D63del	RP11-572M11.4_ENST00000496389.1_RNA|C3orf17_ENST00000383675.2_In_Frame_Del_p.D63del|RP11-572M11.4_ENST00000460707.1_RNA|RP11-572M11.4_ENST00000470313.1_RNA|RP11-572M11.4_ENST00000467342.1_RNA|C3orf17_ENST00000393857.2_Intron	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	63					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						GCACATAACACATCTGTTTCTGC	0.478																																					p.63_64del		.											.	C3orf17-90	0			c.188_190del						.																																			SO:0001651	inframe_deletion	25871	exon2			.	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.188_190delATG	3.37:g.112736366_112736368delCAT	ENSP00000320251:p.Asp63del	162	0		86	23	NM_015412	0	0	0	0	0	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	In_Frame_Del	DEL	ENST00000314400.5	37	CCDS33824.1																																																																																			.		0.478	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	RNA	DEL	AGAGCTCC	AGAGCTCC	-	rs367732188		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	AGAGCTCC	AGAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:74300557_74300564delAGAGCTCC	ENST00000423186.1	-	0	573_580							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)		p.E82fs*32(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572																																					.													.	.	2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)	.						.			96,356		38,20,168							0.0			1	208,1036		88,32,502	no	frameshift	STAG3L2	NM_001025202.2		126,52,670	A1A1,A1R,RR		16.7203,21.2389,17.9245				304,1392						442582	.			CAGTGAAGAGCTC			7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74300557_74300564delAGAGCTCC		273	0		413	8	.	0	0	0	0	0	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	DEL	ENST00000423186.1	37																																																																																				.		0.572	STAG3L2-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000343523.2	NM_001025202	
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	139369195	139369195	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:139369195delG	ENST00000371706.3	-	1	2372	c.2339delC	c.(2338-2340)cctfs	p.P780fs	SEC16A_ENST00000290037.6_Frame_Shift_Del_p.P780fs|SEC16A_ENST00000313050.7_Frame_Shift_Del_p.P958fs|SEC16A_ENST00000431893.2_Frame_Shift_Del_p.P780fs			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	780					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GCTTCCAGCAGGGCTATTAGC	0.507																																					p.P958fs		.											.	.	0			c.2873delC						.						65.0	64.0	64.0					9																	139369195		1939	4138	6077	SO:0001589	frameshift_variant	9919	exon3			.	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2339delC	9.37:g.139369195delG	ENSP00000360771:p.Pro780fs	104	0		213	76	NM_014866	0	0	0	0	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Frame_Shift_Del	DEL	ENST00000371706.3	37																																																																																				.		0.507	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
FGF3	2248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	69625463	69625464	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:69625463_69625464insT	ENST00000334134.2	-	3	419_420	c.329_330insA	c.(328-330)cacfs	p.H110fs		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	110					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			CGGCGCTGTAGTGCTCCTGCGG	0.639																																					p.H110fs		.											.	FGF3-847	0			c.330_331insA						.																																			SO:0001589	frameshift_variant	2248	exon3			.		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.330dupA	11.37:g.69625464_69625464dupT	ENSP00000334122:p.His110fs	132	0		174	54	NM_005247	0	0	0	0	0	Q0VG69	Frame_Shift_Ins	INS	ENST00000334134.2	37	CCDS8195.1																																																																																			.		0.639	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
SLC16A13	201232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	6942168	6942169	+	In_Frame_Ins	INS	-	-	ATA			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:6942168_6942169insATA	ENST00000308027.6	+	3	1349_1350	c.1041_1042insATA	c.(1042-1044)ata>ATAata	p.348_348I>II		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	348						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TGTTGCAGATGATAGAGAGCAT	0.589																																					p.M347delinsMI		.											.	SLC16A13-92	0			c.1041_1042insATA						.																																			SO:0001652	inframe_insertion	201232	exon3			.	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1042_1044dupATA	17.37:g.6942169_6942171dupATA	ENSP00000309751:p.Ile348dup	309	0		467	118	NM_201566	0	0	0	0	0	A3KMG3|A5PKU5|Q2VP92	In_Frame_Ins	INS	ENST00000308027.6	37	CCDS11085.1																																																																																			.		0.589	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2		
MZT2A	653784	hgsc.bcm.edu	37	2	132249519	132249520	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:132249519_132249520insA	ENST00000309451.6	-	2	293_294	c.248_249insT	c.(247-249)cagfs	p.Q83fs	MZT2A_ENST00000410036.2_5'UTR|MIR4784_ENST00000579560.1_RNA|AC093838.4_ENST00000438378.2_RNA	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A	83						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						TCGCTAGCCTCTGCCCGGCACA	0.703																																					p.Q83fs		.											.	MZT2A-68	0			c.249_250insT						.																																			SO:0001589	frameshift_variant	653784	exon2			.	BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606	ENST00000309451.6:c.248_249insT	2.37:g.132249519_132249520insA	ENSP00000311500:p.Gln83fs	38	0		49	17	NM_001085365	0	0	0	0	0	Q3SWV8|Q8WVB2	Frame_Shift_Ins	INS	ENST00000309451.6	37	CCDS42758.1																																																																																			.		0.703	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331811.2		
ZNFX1	57169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47864026	47864027	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:47864026_47864027GT>AG	ENST00000396105.1	-	14	5780_5781	c.5534_5535AC>CT	c.(5533-5535)cAC>cCT	p.H1845P	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.H1845P|ZNFX1_ENST00000469991.1_5'Flank	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1845							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACTTGAACCAGTGACCACGAGG	0.545																																					p.H1845P		.											.	ZNFX1	0			c.A5534C						.																																			SO:0001583	missense	57169	exon14			AACCAGTGACCAC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.5534_5535delinsAG	20.37:g.47864026_47864027delinsAG	ENSP00000379412:p.His1845Pro	142.0	0.0		229.0	85.0		0	0	0	0	0	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	DNP	ENST00000396105.1	37	CCDS13417.1																																																																																			.		0.545	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
