#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCG8	64241	broad.mit.edu;hgsc.bcm.edu	37	2	44079623	44079623	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:44079623C>T	ENST00000272286.2	+	5	782	c.692C>T	c.(691-693)cCa>cTa	p.P231L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	231	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		P -> T (in STSL). {ECO:0000269|PubMed:11099417, ECO:0000269|PubMed:11452359}.		ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.P231L(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CTGTGGAACCCAGGTGAGGGC	0.682																																																	1	Substitution - Missense(1)	kidney(1)											32.0	38.0	36.0					2																	44079623		2203	4300	6503	SO:0001583	missense	64241			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.692C>T	2.37:g.44079623C>T	ENSP00000272286:p.Pro231Leu		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701785	0.88924	.	.	ENSG00000143921	ENST00000272286	T	0.56444	0.46	5.3	5.3	0.74995	ABC transporter-like (2);	0.048644	0.85682	D	0.000000	D	0.82444	0.5038	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88628	0.3167	10	0.87932	D	0	.	17.9474	0.89043	0.0:1.0:0.0:0.0	.	231;231	Q9H221-2;Q9H221	.;ABCG8_HUMAN	L	231	ENSP00000272286:P231L	ENSP00000272286:P231L	P	+	2	0	ABCG8	43933127	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.538000	0.67193	2.474000	0.83562	0.561000	0.74099	CCA		0.682	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1		NM_022437	
ARID4A	5926	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	58830901	58830901	+	Silent	SNP	T	T	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr14:58830901T>A	ENST00000355431.3	+	20	2467	c.2094T>A	c.(2092-2094)tcT>tcA	p.S698S	ARID4A_ENST00000348476.3_Silent_p.S698S|ARID4A_ENST00000395168.3_Silent_p.S698S|ARID4A_ENST00000431317.2_Silent_p.S698S	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	698					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S698S(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CTTGTTCATCTGATAGTGAAA	0.229																																																	2	Substitution - coding silent(2)	kidney(2)											14.0	15.0	15.0					14																	58830901		1832	3964	5796	SO:0001819	synonymous_variant	5926			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2094T>A	14.37:g.58830901T>A			Q15991|Q15992|Q15993	Silent	SNP	ENST00000355431.3	37	CCDS9732.1																																																																																				0.229	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2		NM_023001	
ATP11A	23250	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	113481084	113481084	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr13:113481084C>A	ENST00000487903.1	+	12	1188	c.1100C>A	c.(1099-1101)aCg>aAg	p.T367K	ATP11A_ENST00000283558.8_Missense_Mutation_p.T367K|ATP11A_ENST00000375645.3_Missense_Mutation_p.T367K|ATP11A_ENST00000375630.2_Missense_Mutation_p.T367K			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	367					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T367K(2)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ATGTACGTCACGGTCGAGATG	0.547																																																	2	Substitution - Missense(2)	kidney(2)											142.0	124.0	130.0					13																	113481084		2203	4300	6503	SO:0001583	missense	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1100C>A	13.37:g.113481084C>A	ENSP00000420387:p.Thr367Lys		Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075916	0.76415	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	5.37	5.37	0.77165	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.97225	0.9093	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.998;0.997	D	0.98435	1.0584	10	0.87932	D	0	.	19.1132	0.93326	0.0:1.0:0.0:0.0	.	367;367;367	E9PCW5;E9PEJ6;P98196	.;.;AT11A_HUMAN	K	367	ENSP00000420387:T367K;ENSP00000364781:T367K;ENSP00000364796:T367K;ENSP00000283558:T367K	ENSP00000283558:T367K	T	+	2	0	ATP11A	112529085	1.000000	0.71417	0.954000	0.39281	0.183000	0.23260	7.490000	0.81461	2.515000	0.84797	0.557000	0.71058	ACG		0.547	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3		NM_015205	
PHF7	51533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52442523	52442523	+	5'Flank	DEL	A	A	-			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr3:52442523delA	ENST00000327906.3	+	0	0				BAP1_ENST00000460680.1_Frame_Shift_Del_p.D75fs|PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000296288.5_Frame_Shift_Del_p.D75fs	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.I72fs*7(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TCACAATATCATCATCAATCA	0.483																																																	1	Deletion - Frameshift(1)	pleura(1)											66.0	55.0	59.0					3																	52442523		2202	4299	6501	SO:0001631	upstream_gene_variant	8314			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52442523delA	Exception_encountered		K4DI82	Frame_Shift_Del	DEL	ENST00000327906.3	37	CCDS2854.1																																																																																				0.483	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1		NM_016483	
KIAA1551	55196	broad.mit.edu;ucsc.edu	37	12	32138193	32138193	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr12:32138193C>T	ENST00000312561.4	+	4	4718	c.4304C>T	c.(4303-4305)gCg>gTg	p.A1435V	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1435								p.A1435V(1)									GACACGAAAGCGAGTTCATCT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											77.0	86.0	83.0					12																	32138193		2203	4300	6503	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4304C>T	12.37:g.32138193C>T	ENSP00000310338:p.Ala1435Val		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	11.51	1.658838	0.29515	.	.	ENSG00000174718	ENST00000312561	T	0.11495	2.77	4.85	-0.327	0.12694	.	1.477240	0.03982	N	0.293445	T	0.07458	0.0188	N	0.22421	0.69	0.09310	N	1	P	0.51791	0.948	B	0.40101	0.319	T	0.29027	-1.0025	9	.	.	.	.	5.2772	0.15657	0.4968:0.3305:0.1726:0.0	.	1435	Q9HCM1	CL035_HUMAN	V	1435	ENSP00000310338:A1435V	.	A	+	2	0	C12orf35	32029460	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	0.334000	0.19787	-0.242000	0.09667	0.557000	0.71058	GCG		0.353	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2		NM_018169	
URI1	8725	hgsc.bcm.edu	37	19	30500143	30500143	+	Silent	SNP	T	T	C	rs1127493	byFrequency	TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:30500143T>C	ENST00000542441.2	+	8	1215	c.918T>C	c.(916-918)gaT>gaC	p.D306D	URI1_ENST00000392271.1_Silent_p.D230D|URI1_ENST00000360605.4_Silent_p.D288D|URI1_ENST00000312051.6_Silent_p.D266D			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	306	Poly-Asp.				cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										atgatgatgatgacgacgacg	0.403													t|||	18	0.00359425	0.0091	0.0014	5008	,	,		19444	0.0		0.005	False		,,,				2504	0.0																0													110.0	87.0	95.0					19																	30500143		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.918T>C	19.37:g.30500143T>C			A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	CCDS12420.1																																																																																				0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1		NM_134447	
SUGCT	79783	hgsc.bcm.edu	37	7	40535918	40535918	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr7:40535918delT	ENST00000335693.4	+	12	1066	c.1043delT	c.(1042-1044)cttfs	p.L348fs	C7orf10_ENST00000309930.5_Frame_Shift_Del_p.L348fs|C7orf10_ENST00000401647.2_Frame_Shift_Del_p.L300fs	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		348					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						TGGTTATATCTTTTTGAAGGC	0.383																																																	0													106.0	100.0	102.0					7																	40535918		1858	4104	5962	SO:0001589	frameshift_variant	79783																														ENST00000335693.4:c.1043delT	7.37:g.40535918delT	ENSP00000338475:p.Leu348fs		A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Frame_Shift_Del	DEL	ENST00000335693.4	37	CCDS55105.1																																																																																				0.383	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1			
CCNT2	905	hgsc.bcm.edu;ucsc.edu	37	2	135712132	135712132	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:135712132T>C	ENST00000264157.5	+	9	2137	c.2107T>C	c.(2107-2109)Tac>Cac	p.Y703H	CCNT2_ENST00000537343.1_3'UTR|CCNT2_ENST00000295238.6_3'UTR	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	703					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		CAATCACGAGTACAGTACAAG	0.488																																																	0													95.0	83.0	87.0					2																	135712132		2203	4300	6503	SO:0001583	missense	905			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.2107T>C	2.37:g.135712132T>C	ENSP00000264157:p.Tyr703His		A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.84|12.84	2.058891|2.058891	0.36277|0.36277	.|.	.|.	ENSG00000082258|ENSG00000082258	ENST00000452521|ENST00000264157	.|T	.|0.22945	.|1.93	5.43|5.43	4.24|4.24	0.50183|0.50183	.|.	.|0.747504	.|0.12685	.|N	.|0.447641	T|T	0.33556|0.33556	0.0867|0.0867	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|D	.|0.61080	.|0.989	.|P	.|0.53809	.|0.735	T|T	0.00953|0.00953	-1.1502|-1.1502	5|10	.|0.34782	.|T	.|0.22	.|.	11.5434|11.5434	0.50679|0.50679	0.1342:0.0:0.0:0.8658|0.1342:0.0:0.0:0.8658	.|.	.|703	.|O60583	.|CCNT2_HUMAN	A|H	121|703	.|ENSP00000264157:Y703H	.|ENSP00000264157:Y703H	V|Y	+|+	2|1	0|0	CCNT2|CCNT2	135428602|135428602	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.569000|4.569000	0.60865|0.60865	0.851000|0.851000	0.35264|0.35264	0.533000|0.533000	0.62120|0.62120	GTA|TAC		0.488	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1		NM_058241	
CEP97	79598	hgsc.bcm.edu;ucsc.edu	37	3	101476949	101476949	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr3:101476949G>A	ENST00000341893.3	+	9	2251	c.1499G>A	c.(1498-1500)aGt>aAt	p.S500N	CEP97_ENST00000327230.4_Missense_Mutation_p.S500N|CEP97_ENST00000494050.1_Missense_Mutation_p.S441N			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	500	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						GATAACCACAGTCTTACATTT	0.358																																																	0													112.0	118.0	116.0					3																	101476949		2203	4300	6503	SO:0001583	missense	79598			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1499G>A	3.37:g.101476949G>A	ENSP00000342510:p.Ser500Asn		B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	37	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	G	8.850	0.944259	0.18356	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.56103	0.62;0.58;0.48	4.85	0.626	0.17670	.	0.866657	0.10574	N	0.658817	T	0.33789	0.0875	L	0.32530	0.975	0.09310	N	1	B;B;B	0.15719	0.014;0.005;0.001	B;B;B	0.17979	0.02;0.007;0.003	T	0.22417	-1.0217	10	0.27082	T	0.32	-2.515	1.1628	0.01809	0.4022:0.1579:0.2951:0.1448	.	441;500;500	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	N	500;500;441	ENSP00000342510:S500N;ENSP00000325881:S500N;ENSP00000418185:S441N	ENSP00000325881:S500N	S	+	2	0	CEP97	102959639	0.000000	0.05858	0.334000	0.25495	0.709000	0.40893	-0.022000	0.12480	0.212000	0.20703	0.305000	0.20034	AGT		0.358	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2		NM_024548	
CLCA4	22802	hgsc.bcm.edu	37	1	87045902	87045902	+	Silent	SNP	A	A	T	rs1932809|rs4001061|rs77067122|rs56040873|rs574759485|rs368263974	byFrequency	TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:87045902A>T	ENST00000370563.3	+	14	2676	c.2634A>T	c.(2632-2634)acA>acT	p.T878T	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	878			Missing. {ECO:0000269|PubMed:10437792, ECO:0000269|PubMed:15489334}.		chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTGAtcctacacctactccta	0.348														35	0.00698882	0.0234	0.0014	5008	,	,		16699	0.002		0.001	False		,,,				2504	0.0																0								A		815,2361		278,259,1051	73.0	63.0	66.0		2634	-1.3	0.0	1	dbSNP_92	66	2425,4057		1007,411,1823	no	coding-synonymous	CLCA4	NM_012128.3		1285,670,2874	TT,TA,AA		37.4113,25.6612,33.5473		878/920	87045902	3240,6418	1588	3241	4829	SO:0001819	synonymous_variant	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2634A>T	1.37:g.87045902A>T			A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																				0.348	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1		NM_012128	
CLCA3P	9629	hgsc.bcm.edu;ucsc.edu	37	1	87104605	87104605	+	RNA	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:87104605C>T	ENST00000456587.1	-	0	294				CLCA3P_ENST00000466454.1_RNA																							CTGTATAGCACGACCATTCAG	0.398																																																	0													107.0	98.0	101.0					1																	87104605		2203	4300	6503			9629																															1.37:g.87104605C>T				RNA	SNP	ENST00000456587.1	37																																																																																					0.398	RP4-651E10.4-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000028263.1			
CLTCL1	8218	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	19175075	19175075	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr22:19175075A>T	ENST00000263200.10	-	29	4672	c.4600T>A	c.(4600-4602)Tac>Aac	p.Y1534N	CLTCL1_ENST00000353891.5_Intron|CLTCL1_ENST00000442042.2_Intron|CLTCL1_ENST00000427926.1_Missense_Mutation_p.Y1534N	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1534	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.Y1534N(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CCAACCTTGTAGAGATGATCC	0.557			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - Missense(1)	kidney(1)											96.0	105.0	102.0					22																	19175075		2060	4192	6252	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4600T>A	22.37:g.19175075A>T	ENSP00000445677:p.Tyr1534Asn		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.418245	0.83449	.	.	ENSG00000070371	ENST00000263200;ENST00000427926	T;T	0.22134	1.97;1.97	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000001	T	0.49949	0.1587	M	0.87269	2.87	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	T	0.60031	-0.7342	10	0.87932	D	0	-15.0462	13.2908	0.60270	1.0:0.0:0.0:0.0	.	1534	P53675	CLH2_HUMAN	N	1534	ENSP00000445677:Y1534N;ENSP00000441158:Y1534N	ENSP00000445677:Y1534N	Y	-	1	0	CLTCL1	17555075	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.286000	0.89916	1.738000	0.51689	0.533000	0.62120	TAC		0.557	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5		NM_007098	
CPS1	1373	hgsc.bcm.edu;ucsc.edu	37	2	211521332	211521332	+	Silent	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:211521332C>A	ENST00000233072.5	+	30	3838	c.3642C>A	c.(3640-3642)acC>acA	p.T1214T	CPS1_ENST00000451903.2_Silent_p.T763T|CPS1_ENST00000430249.2_Silent_p.T1220T	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1214	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CCACACAAACCATCAGCCAAG	0.403																																																	0													69.0	69.0	69.0					2																	211521332		2203	4300	6503	SO:0001819	synonymous_variant	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3642C>A	2.37:g.211521332C>A			B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1																																																																																				0.403	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			
CWC27	10283	hgsc.bcm.edu;ucsc.edu	37	5	64314067	64314067	+	Silent	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr5:64314067C>A	ENST00000381070.3	+	14	1555	c.1338C>A	c.(1336-1338)atC>atA	p.I446I	RP11-307L14.2_ENST00000606057.1_lincRNA|RP11-307L14.1_ENST00000607786.1_lincRNA|CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	446					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						CATTTGAAATCTATGATCCTC	0.358																																																	0													117.0	121.0	119.0					5																	64314067		2203	4300	6503	SO:0001819	synonymous_variant	10283			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1338C>A	5.37:g.64314067C>A			O60529|O60530|Q96EM3	Silent	SNP	ENST00000381070.3	37	CCDS3982.2																																																																																				0.358	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4		NM_005869	
CSF1R	1436	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	149449521	149449521	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr5:149449521C>G	ENST00000286301.3	-	10	1716	c.1425G>C	c.(1423-1425)gaG>gaC	p.E475D	CSF1R_ENST00000515239.1_5'Flank	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	475	Ig-like C2-type 5.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)	p.E475D(2)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GCTCTAAGGTCTCAACAGTCA	0.597																																																	2	Substitution - Missense(2)	kidney(2)											121.0	114.0	117.0					5																	149449521		2203	4300	6503	SO:0001583	missense	1436			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1425G>C	5.37:g.149449521C>G	ENSP00000286301:p.Glu475Asp		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	37	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	C	5.390	0.257183	0.10239	.	.	ENSG00000182578	ENST00000286301;ENST00000394307	T	0.03272	3.99	5.66	1.32	0.21799	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.837839	0.10415	N	0.677481	T	0.03390	0.0098	N	0.24115	0.695	0.09310	N	1	B;B	0.28783	0.121;0.222	B;B	0.37346	0.247;0.223	T	0.50541	-0.8816	10	0.27082	T	0.32	.	4.4679	0.11698	0.0:0.5242:0.1875:0.2883	.	327;475	B4E2Y8;P07333	.;CSF1R_HUMAN	D	475;327	ENSP00000286301:E475D	ENSP00000286301:E475D	E	-	3	2	CSF1R	149429714	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.224000	0.17738	0.231000	0.21079	0.455000	0.32223	GAG		0.597	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2		NM_005211	
DMKN	93099	hgsc.bcm.edu;ucsc.edu	37	19	36003991	36003991	+	Silent	SNP	G	G	A	rs200194624		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:36003991G>A	ENST00000339686.3	-	1	563	c.387C>T	c.(385-387)cgC>cgT	p.R129R	DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000440396.1_Silent_p.R129R|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000419602.1_Silent_p.R129R|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000418261.1_Silent_p.R129R|DMKN_ENST00000451297.2_Silent_p.R129R|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000447113.2_Silent_p.R129R|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000429837.1_Silent_p.R129R|DMKN_ENST00000424570.2_Silent_p.R129R|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000436012.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	129	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCCAGGAGCCGCGGACAGCAT	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17035	0.0		0.0	False		,,,				2504	0.0																0													78.0	80.0	79.0					19																	36003991		2203	4300	6503	SO:0001819	synonymous_variant	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.387C>T	19.37:g.36003991G>A			A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	ENST00000339686.3	37	CCDS12463.1																																																																																				0.617	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2		NM_033317	
ERGIC2	51290	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	29509405	29509405	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr12:29509405T>G	ENST00000360150.4	-	8	557	c.482A>C	c.(481-483)gAt>gCt	p.D161A		NM_016570.2	NP_057654.2	Q96RQ1	ERGI2_HUMAN	ERGIC and golgi 2	161					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)		p.D161A(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)					TGATGAATCATCTTCTCTGTT	0.308																																																	1	Substitution - Missense(1)	kidney(1)											121.0	117.0	118.0					12																	29509405		1814	4086	5900	SO:0001583	missense	51290			AF216751	CCDS41765.1	12p11.22	2006-02-08							30208	protein-coding gene	gene with protein product		612236				11445006, 12932305	Standard	NM_016570		Approved	PTX1, Erv41	uc001riv.3	Q96RQ1		ENST00000360150.4:c.482A>C	12.37:g.29509405T>G	ENSP00000353270:p.Asp161Ala		A6NHH6|Q53GY2|Q8N2Q9|Q9BVV9|Q9NZA3	Missense_Mutation	SNP	ENST00000360150.4	37	CCDS41765.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.39|12.39	1.924750|1.924750	0.34002|0.34002	.|.	.|.	ENSG00000087502|ENSG00000087502	ENST00000360150;ENST00000201023;ENST00000546839;ENST00000550353;ENST00000552132|ENST00000551467	.|.	.|.	.|.	4.96|4.96	3.78|3.78	0.43462|0.43462	.|.	0.101889|.	0.64402|.	D|.	0.000003|.	T|T	0.62660|0.62660	0.2446|0.2446	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	P|.	0.40534|.	0.72|.	B|.	0.40636|.	0.335|.	T|T	0.59064|0.59064	-0.7524|-0.7524	9|5	0.10377|.	T|.	0.69|.	.|.	9.9219|9.9219	0.41470|0.41470	0.0:0.0:0.1718:0.8281|0.0:0.0:0.1718:0.8281	.|.	161|.	Q96RQ1|.	ERGI2_HUMAN|.	A|L	161;169;161;143;161|18	.|.	ENSP00000201023:D169A|.	D|M	-|-	2|1	0|0	ERGIC2|ERGIC2	29400672|29400672	1.000000|1.000000	0.71417|0.71417	0.916000|0.916000	0.36221|0.36221	0.937000|0.937000	0.57800|0.57800	5.444000|5.444000	0.66587|0.66587	0.710000|0.710000	0.31997|0.31997	0.477000|0.477000	0.44152|0.44152	GAT|ATG		0.308	ERGIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403489.1		NM_016570	
MTFR1L	56181	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	26152903	26152903	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:26152903G>T	ENST00000374301.3	+	4	547		c.e4+1		MTFR1L_ENST00000374307.5_Splice_Site|MTFR1L_ENST00000466284.1_Splice_Site|MTFR1L_ENST00000374300.3_Splice_Site|MTFR1L_ENST00000526894.1_Splice_Site|MTFR1L_ENST00000474295.1_Splice_Site|MTFR1L_ENST00000469815.1_Intron|MTFR1L_ENST00000374303.2_Splice_Site|MTFR1L_ENST00000524618.1_Splice_Site	NM_019557.5	NP_062457.3	Q9H019	MFR1L_HUMAN	mitochondrial fission regulator 1-like									p.?(1)									CCCGGGTCAGGTAGTTGAGGC	0.552																																																	1	Unknown(1)	kidney(1)											59.0	60.0	60.0					1																	26152903		2173	4278	6451	SO:0001630	splice_region_variant	0				CCDS41284.1, CCDS44089.1	1p36.11	2012-11-30	2012-11-29	2012-11-29	ENSG00000117640	ENSG00000117640			28836	protein-coding gene	gene with protein product			"""family with sequence similarity 54, member B"""	FAM54B		8619474, 9110174	Standard	NM_019557		Approved		uc001bkq.4	Q9H019	OTTHUMG00000007377	ENST00000374301.3:c.239+1G>T	1.37:g.26152903G>T			A6NCB4|B7WNV5|D3DPJ4|Q63HP1|Q7Z2S7|Q9NUI7	Splice_Site	SNP	ENST00000374301.3	37	CCDS41284.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453678	0.84209	.	.	ENSG00000117640	ENST00000424294;ENST00000374303;ENST00000529116;ENST00000474295;ENST00000526894;ENST00000374307;ENST00000525713;ENST00000374301;ENST00000526158;ENST00000374300;ENST00000466284	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5799	0.91167	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM54B	26025490	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.717000	0.91425	2.629000	0.89072	0.655000	0.94253	.		0.552	MTFR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019319.1		NM_019557	Intron
GFM2	84340	hgsc.bcm.edu	37	5	74021853	74021853	+	Missense_Mutation	SNP	A	A	T	rs141759476		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr5:74021853A>T	ENST00000296805.3	-	18	2282	c.1825T>A	c.(1825-1827)Ttt>Att	p.F609I	RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000509430.1_Missense_Mutation_p.F609I|GFM2_ENST00000345239.2_Missense_Mutation_p.F562I|GFM2_ENST00000515125.1_5'UTR	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		GCATACTCAAACTCAATCACA	0.413																																																	0													121.0	127.0	125.0					5																	74021853		2203	4300	6503	SO:0001583	missense	84340			AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1825T>A	5.37:g.74021853A>T	ENSP00000296805:p.Phe609Ile			Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	-	0.921	-0.715891	0.03206	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.23147	1.92;1.92;1.92	.	.	.	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	.	.	.	.	T	0.08537	0.0212	N	0.01505	-0.83	0.09310	N	0.999998	.;B	0.15930	.;0.015	.;B	0.08055	.;0.003	T	0.27640	-1.0068	7	0.87932	D	0	.	.	.	.	.	562;609	Q969S9-2;Q969S9	.;RRF2M_HUMAN	I	609;562;609	ENSP00000296805:F609I;ENSP00000296804:F562I;ENSP00000427004:F609I	ENSP00000296805:F609I	F	-	1	0	GFM2	74057609	0.852000	0.29690	0.003000	0.11579	0.047000	0.14425	2.208000	0.42797	0.000000	0.14550	0.000000	0.15137	TTT		0.413	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2		NM_032380	
GGT5	2687	broad.mit.edu;ucsc.edu	37	22	24627459	24627459	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr22:24627459G>A	ENST00000327365.4	-	6	1210	c.794C>T	c.(793-795)cCc>cTc	p.P265L	GGT5_ENST00000398292.3_Missense_Mutation_p.P265L|GGT5_ENST00000418439.2_Missense_Mutation_p.P188L|GGT5_ENST00000263112.7_Missense_Mutation_p.P233L	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	265					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.P265L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						CACCACCTCGGGCTGGAACTT	0.622																																																	1	Substitution - Missense(1)	kidney(1)											28.0	25.0	26.0					22																	24627459		2192	4294	6486	SO:0001583	missense	2687			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.794C>T	22.37:g.24627459G>A	ENSP00000330080:p.Pro265Leu		Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199229	0.38806	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.06768	3.26;3.26;3.26;3.26	4.91	4.91	0.64330	.	0.127765	0.52532	D	0.000073	T	0.14657	0.0354	M	0.82056	2.57	0.32644	N	0.520345	P;B;B;B;B	0.41498	0.752;0.202;0.014;0.368;0.014	B;B;B;B;B	0.41764	0.366;0.135;0.026;0.142;0.026	T	0.12734	-1.0536	10	0.54805	T	0.06	-8.2213	9.6411	0.39839	0.0968:0.0:0.9032:0.0	.	188;233;265;265;265	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	L	265;233;180;265;188	ENSP00000330080:P265L;ENSP00000263112:P233L;ENSP00000381340:P265L;ENSP00000392146:P188L	ENSP00000263112:P233L	P	-	2	0	GGT5	22957459	0.819000	0.29175	0.848000	0.33437	0.833000	0.47200	2.949000	0.49074	2.470000	0.83445	0.485000	0.47835	CCC		0.622	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1		NM_004121	
GIMAP2	26157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150389838	150389838	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr7:150389838C>A	ENST00000223293.5	+	3	558	c.464C>A	c.(463-465)tCc>tAc	p.S155Y		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	155	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)	p.S155Y(1)		kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AATGGTGGCTCCCTGATGGAT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											81.0	58.0	65.0					7																	150389838		2203	4300	6503	SO:0001583	missense	26157			AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.464C>A	7.37:g.150389838C>A	ENSP00000223293:p.Ser155Tyr		Q96L25	Missense_Mutation	SNP	ENST00000223293.5	37	CCDS5905.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.627006	0.46840	.	.	ENSG00000106560	ENST00000223293	T	0.62364	0.03	3.9	1.9	0.25705	AIG1 (1);	0.151617	0.42821	D	0.000646	T	0.80008	0.4545	H	0.94620	3.56	0.09310	N	0.999993	D	0.76494	0.999	D	0.75484	0.986	T	0.67898	-0.5551	10	0.87932	D	0	.	4.8632	0.13594	0.0:0.658:0.22:0.122	.	155	Q9UG22	GIMA2_HUMAN	Y	155	ENSP00000223293:S155Y	ENSP00000223293:S155Y	S	+	2	0	GIMAP2	150020771	0.001000	0.12720	0.018000	0.16275	0.169000	0.22640	1.383000	0.34385	1.006000	0.39211	0.609000	0.83330	TCC		0.522	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1		NM_015660	
HERC2	8924	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	28473477	28473477	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr15:28473477C>A	ENST00000261609.7	-	35	5459	c.5351G>T	c.(5350-5352)cGc>cTc	p.R1784L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R1784L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGGAGGAAGCGGGCTTGCGG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											96.0	74.0	81.0					15																	28473477		2203	4300	6503	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5351G>T	15.37:g.28473477C>A	ENSP00000261609:p.Arg1784Leu			Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288109	0.80803	.	.	ENSG00000128731	ENST00000261609	T	0.61040	0.14	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.70439	0.3224	L	0.50333	1.59	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	T	0.74551	-0.3628	10	0.87932	D	0	.	17.4184	0.87507	0.0:1.0:0.0:0.0	.	1784	O95714	HERC2_HUMAN	L	1784	ENSP00000261609:R1784L	ENSP00000261609:R1784L	R	-	2	0	HERC2	26147072	1.000000	0.71417	0.994000	0.49952	0.828000	0.46876	7.252000	0.78309	2.403000	0.81681	0.555000	0.69702	CGC		0.602	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
ITPRIPL1	150771	broad.mit.edu;ucsc.edu	37	2	96993737	96993737	+	Silent	SNP	C	C	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:96993737C>G	ENST00000439118.2	+	3	1619	c.1368C>G	c.(1366-1368)ctC>ctG	p.L456L	ITPRIPL1_ENST00000542887.1_Silent_p.L448L|ITPRIPL1_ENST00000536814.1_Silent_p.L448L|ITPRIPL1_ENST00000361124.4_Silent_p.L464L	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	456						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.L464L(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCATGCACCTCTTGCTACGGC	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											98.0	96.0	97.0					2																	96993737		2203	4300	6503	SO:0001819	synonymous_variant	150771				CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.1368C>G	2.37:g.96993737C>G			F5H1L8|Q8NE61	Silent	SNP	ENST00000439118.2	37	CCDS46360.1	.	.	.	.	.	.	.	.	.	.	C	1.626	-0.520129	0.04171	.	.	ENSG00000198885	ENST00000420728	.	.	.	5.5	3.64	0.41730	.	.	.	.	.	T	0.59101	0.2169	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56733	-0.7930	4	.	.	.	-9.5761	9.2001	0.37254	0.0:0.4036:0.4633:0.1331	.	.	.	.	C	488	.	.	S	+	2	0	ITPRIPL1	96357464	0.732000	0.28121	0.989000	0.46669	0.715000	0.41141	0.587000	0.23909	1.555000	0.49500	-0.165000	0.13383	TCT		0.562	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1		NM_178495	
MTCL1	23255	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	8793068	8793068	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr18:8793068G>C	ENST00000359865.3	+	8	2102	c.1960G>C	c.(1960-1962)Gcc>Ccc	p.A654P	SOGA2_ENST00000400050.3_Intron|SOGA2_ENST00000517570.1_Intron|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000518815.1_Intron|SOGA2_ENST00000306329.11_Intron	NM_015210.3	NP_056025.2												p.A654P(1)									CGTGCAGGCGGCCAGACTGCA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											99.0	109.0	106.0					18																	8793068		2203	4300	6503	SO:0001583	missense	0																														ENST00000359865.3:c.1960G>C	18.37:g.8793068G>C	ENSP00000352927:p.Ala654Pro			Missense_Mutation	SNP	ENST00000359865.3	37	CCDS11841.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496922	0.44352	.	.	ENSG00000168502	ENST00000306329;ENST00000359865	T	0.43688	0.94	5.68	-1.89	0.07689	.	0.762462	0.11601	N	0.547742	T	0.21962	0.0529	N	0.08118	0	0.52501	D	0.999957	P	0.34757	0.467	B	0.37888	0.26	T	0.05971	-1.0853	10	0.35671	T	0.21	.	8.3738	0.32432	0.4585:0.109:0.4325:0.0	.	654	Q9Y4B5-3	.	P	675;654	ENSP00000352927:A654P	ENSP00000305027:A675P	A	+	1	0	CCDC165	8783068	1.000000	0.71417	0.491000	0.27477	0.894000	0.52154	0.921000	0.28718	-0.615000	0.05679	0.561000	0.74099	GCC		0.512	SOGA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254476.1			
KIF20B	9585	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	91497461	91497461	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr10:91497461C>A	ENST00000371728.3	+	20	2928	c.2863C>A	c.(2863-2865)Caa>Aaa	p.Q955K	KIF20B_ENST00000394289.2_Missense_Mutation_p.Q955K|KIF20B_ENST00000416354.1_Missense_Mutation_p.Q985K|KIF20B_ENST00000260753.4_Missense_Mutation_p.Q915K|KIF20B_ENST00000478929.1_3'UTR	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	955					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.Q915K(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAGTAAAAATCAAGAACAGGA	0.284																																																	1	Substitution - Missense(1)	kidney(1)											53.0	57.0	56.0					10																	91497461		2181	4285	6466	SO:0001583	missense	9585			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2863C>A	10.37:g.91497461C>A	ENSP00000360793:p.Gln955Lys		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	C	4.140	0.024243	0.08006	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.66280	-0.12;-0.13;-0.2;-0.14	5.8	3.84	0.44239	.	0.125717	0.36555	N	0.002522	T	0.47469	0.1447	L	0.51422	1.61	0.24797	N	0.992724	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.21484	-1.0244	10	0.15952	T	0.53	-6.6583	4.0994	0.10007	0.3521:0.4485:0.1228:0.0766	.	955;915	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	K	915;985;955;955	ENSP00000260753:Q915K;ENSP00000411545:Q985K;ENSP00000377830:Q955K;ENSP00000360793:Q955K	ENSP00000260753:Q915K	Q	+	1	0	KIF20B	91487441	0.994000	0.37717	1.000000	0.80357	0.385000	0.30292	0.389000	0.20751	1.448000	0.47680	-0.230000	0.12252	CAA		0.284	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1		NM_016195	
LEMD3	23592	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	65564430	65564430	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr12:65564430A>T	ENST00000308330.2	+	1	1080	c.1054A>T	c.(1054-1056)Agc>Tgc	p.S352C	LEMD3_ENST00000541171.1_Intron	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	352					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.S352C(1)		breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AGTGGACTCCAGCCCCGTTCC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											70.0	70.0	70.0					12																	65564430		2203	4300	6503	SO:0001583	missense	23592			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.1054A>T	12.37:g.65564430A>T	ENSP00000308369:p.Ser352Cys		Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	37	CCDS8972.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181867	0.57800	.	.	ENSG00000174106	ENST00000308330	T	0.53423	0.62	3.69	-0.0994	0.13624	.	0.514142	0.19448	N	0.114003	T	0.22360	0.0539	N	0.14661	0.345	0.26052	N	0.981466	B	0.06786	0.001	B	0.06405	0.002	T	0.11446	-1.0587	9	.	.	.	-2.2196	4.07	0.09877	0.6636:0.0:0.183:0.1534	.	352	Q9Y2U8	MAN1_HUMAN	C	352	ENSP00000308369:S352C	.	S	+	1	0	LEMD3	63850697	0.954000	0.32549	0.997000	0.53966	0.881000	0.50899	0.807000	0.27140	-0.026000	0.13895	0.379000	0.24179	AGC		0.607	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2			
MAGEB3	4114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	30254277	30254277	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chrX:30254277A>T	ENST00000361644.2	+	5	973	c.236A>T	c.(235-237)tAc>tTc	p.Y79F		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	79								p.Y79F(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						GATGTTTCTTACAAAAAGTCA	0.463																																																	1	Substitution - Missense(1)	kidney(1)											30.0	26.0	27.0					X																	30254277		2202	4300	6502	SO:0001583	missense	4114			AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.236A>T	X.37:g.30254277A>T	ENSP00000355198:p.Tyr79Phe		A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.738215	0.00681	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.04194	3.68;3.68	4.1	-8.21	0.01041	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.02230	0.0069	N	0.16656	0.425	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.30327	-0.9982	9	0.10377	T	0.69	.	6.4479	0.21887	0.1996:0.2634:0.4624:0.0747	.	79	O15480	MAGB3_HUMAN	F	79	ENSP00000368271:Y79F;ENSP00000355198:Y79F	ENSP00000355198:Y79F	Y	+	2	0	MAGEB3	30164198	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.060000	0.00303	-5.235000	0.00018	-1.232000	0.01568	TAC		0.463	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2		NM_002365	
MCOLN3	55283	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	85511028	85511028	+	Missense_Mutation	SNP	C	C	A	rs568979444		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:85511028C>A	ENST00000370589.2	-	2	68	c.16G>T	c.(16-18)Gta>Tta	p.V6L	MCOLN3_ENST00000370587.1_Missense_Mutation_p.V6L|WDR63_ENST00000370596.1_Intron|MCOLN3_ENST00000341115.4_Missense_Mutation_p.V6L	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	6					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V6L(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		CTCACAACTACCTCAGGATCT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											39.0	38.0	38.0					1																	85511028		2203	4300	6503	SO:0001583	missense	55283			AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.16G>T	1.37:g.85511028C>A	ENSP00000359621:p.Val6Leu		Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	37	CCDS701.1	.	.	.	.	.	.	.	.	.	.	C	5.376	0.254604	0.10185	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370588;ENST00000341115;ENST00000370587	D;D;D	0.85629	-1.71;-1.61;-2.01	5.55	1.6	0.23607	.	0.843268	0.10701	N	0.643993	T	0.54127	0.1839	N	0.22421	0.69	0.25801	N	0.9845	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.41805	-0.9488	10	0.27785	T	0.31	0.1021	6.4691	0.21997	0.0:0.6161:0.1173:0.2666	.	6;6;6	B1ANB7;Q8TDD5-2;Q8TDD5	.;.;MCLN3_HUMAN	L	6	ENSP00000359621:V6L;ENSP00000342698:V6L;ENSP00000359619:V6L	ENSP00000304843:V6L	V	-	1	0	MCOLN3	85283616	0.035000	0.19736	0.150000	0.22450	0.035000	0.12851	-0.186000	0.09670	0.317000	0.23160	-0.424000	0.05967	GTA		0.393	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2		NM_018298	
MED25	81857	broad.mit.edu;hgsc.bcm.edu	37	19	50338353	50338353	+	Silent	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:50338353C>T	ENST00000312865.6	+	14	1646	c.1593C>T	c.(1591-1593)agC>agT	p.S531S	MED25_ENST00000538643.1_Silent_p.S318S	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	531	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)	p.S531S(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		ACGACCAGAGCGGCTTCGTCA	0.607																																					GBM(51;894 1657 37868)												2	Substitution - coding silent(2)	kidney(2)											198.0	174.0	182.0					19																	50338353		2203	4300	6503	SO:0001819	synonymous_variant	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1593C>T	19.37:g.50338353C>T			A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	ENST00000312865.6	37	CCDS33075.1																																																																																				0.607	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1		NM_030973	
MME	4311	hgsc.bcm.edu;ucsc.edu	37	3	154858058	154858058	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr3:154858058T>C	ENST00000460393.1	+	10	1054	c.934T>C	c.(934-936)Ttt>Ctt	p.F312L	MME_ENST00000462745.1_Missense_Mutation_p.F312L|MME_ENST00000492661.1_Missense_Mutation_p.F312L|MME_ENST00000493237.1_Missense_Mutation_p.F312L|MME_ENST00000360490.2_Missense_Mutation_p.F312L	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	312					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CCAAAATAACTTTTCACTAGA	0.333																																																	0													68.0	63.0	65.0					3																	154858058		2203	4299	6502	SO:0001583	missense	4311				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.934T>C	3.37:g.154858058T>C	ENSP00000418525:p.Phe312Leu		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028334	0.35797	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.23	5.23	0.72850	Peptidase M13 (1);	0.117629	0.64402	D	0.000019	T	0.64789	0.2630	L	0.43757	1.38	0.49483	D	0.999799	B	0.21452	0.056	B	0.22880	0.042	T	0.61912	-0.6965	10	0.41790	T	0.15	-24.7486	15.4425	0.75195	0.0:0.0:0.0:1.0	.	312	P08473	NEP_HUMAN	L	312	ENSP00000420389:F312L;ENSP00000418525:F312L;ENSP00000419653:F312L;ENSP00000417079:F312L;ENSP00000353679:F312L	ENSP00000353679:F312L	F	+	1	0	MME	156340752	1.000000	0.71417	0.966000	0.40874	0.162000	0.22319	6.809000	0.75211	2.100000	0.63781	0.533000	0.62120	TTT		0.333	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1		NM_000902	
MOSPD2	158747	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	14891810	14891810	+	Splice_Site	SNP	G	G	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chrX:14891810G>A	ENST00000380492.3	+	2	97		c.e2-1		FANCB_ENST00000324138.3_5'Flank|MOSPD2_ENST00000497603.2_Splice_Site|MOSPD2_ENST00000482354.1_Splice_Site|FANCB_ENST00000398334.1_5'Flank	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2							integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.?(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					CTCCCATCCAGAATCACGCCC	0.557																																																	1	Unknown(1)	kidney(1)											203.0	189.0	194.0					X																	14891810		2203	4300	6503	SO:0001630	splice_region_variant	158747			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.10-1G>A	X.37:g.14891810G>A			Q8N3H2|Q8NA83	Splice_Site	SNP	ENST00000380492.3	37	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	g	9.832	1.188592	0.21954	.	.	ENSG00000130150	ENST00000380492	.	.	.	4.82	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999991	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6964	0.40161	0.1:0.0:0.9:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MOSPD2	14801731	0.806000	0.28996	0.043000	0.18650	0.419000	0.31324	2.923000	0.48868	1.161000	0.42604	-0.169000	0.13324	.		0.557	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1		NM_152581	Intron
MPEG1	219972	hgsc.bcm.edu;ucsc.edu	37	11	58978851	58978851	+	Silent	SNP	T	T	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr11:58978851T>A	ENST00000361050.3	-	1	1573	c.1488A>T	c.(1486-1488)tcA>tcT	p.S496S		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	496						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CGGCTGGGCATGACTGTGCAT	0.512																																																	0													72.0	70.0	70.0					11																	58978851		1872	4113	5985	SO:0001819	synonymous_variant	219972			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1488A>T	11.37:g.58978851T>A			Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																				0.512	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1		NM_001039396	
MTSS1	9788	broad.mit.edu;ucsc.edu	37	8	125568483	125568483	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr8:125568483G>A	ENST00000518547.1	-	12	1867	c.1394C>T	c.(1393-1395)gCt>gTt	p.A465V	MTSS1_ENST00000524090.1_Missense_Mutation_p.A355V|MTSS1_ENST00000325064.5_Missense_Mutation_p.A469V|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_Missense_Mutation_p.A183V|MTSS1_ENST00000378017.3_Missense_Mutation_p.A440V|MTSS1_ENST00000431961.2_Missense_Mutation_p.A183V|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000395508.2_Missense_Mutation_p.A239V	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	465					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.A465V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CCTGGTGGCAGCCGATACAGT	0.647																																					Esophageal Squamous(160;622 1893 3862 8546 12509)												1	Substitution - Missense(1)	kidney(1)											79.0	66.0	71.0					8																	125568483		2203	4300	6503	SO:0001583	missense	9788			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1394C>T	8.37:g.125568483G>A	ENSP00000429064:p.Ala465Val		J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	37	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	G	6.881	0.531932	0.13127	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	T;T;T;T;T;T;T	0.31769	1.48;1.51;1.53;1.51;1.51;1.53;1.5	4.65	4.65	0.58169	.	0.372036	0.28504	N	0.015110	T	0.25827	0.0629	L	0.29908	0.895	0.37148	D	0.902019	P;B;B;B;B;B;P	0.46987	0.598;0.027;0.001;0.01;0.002;0.02;0.888	B;B;B;B;B;B;B	0.42062	0.19;0.009;0.003;0.004;0.004;0.019;0.374	T	0.13361	-1.0512	10	0.24483	T	0.36	-14.3631	17.5388	0.87841	0.0:0.0:1.0:0.0	.	355;239;440;465;440;183;5	E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2;Q6ZTG0	.;.;.;MTSS1_HUMAN;.;.;.	V	440;465;183;239;469;183;355	ENSP00000367256:A440V;ENSP00000429064:A465V;ENSP00000346119:A183V;ENSP00000378884:A239V;ENSP00000322804:A469V;ENSP00000393606:A183V;ENSP00000428319:A355V	ENSP00000322804:A469V	A	-	2	0	MTSS1	125637664	0.999000	0.42202	0.920000	0.36463	0.976000	0.68499	5.740000	0.68629	2.133000	0.65898	0.455000	0.32223	GCT		0.647	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3		NM_014751	
MVP	9961	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	29858602	29858602	+	Missense_Mutation	SNP	G	G	A	rs200956879		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr16:29858602G>A	ENST00000357402.5	+	14	2488	c.2350G>A	c.(2350-2352)Gct>Act	p.A784T	MVP_ENST00000395353.1_Missense_Mutation_p.A784T	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	784					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.A784T(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GGTGAGCAAGGCTCAGCAGCT	0.597																																																	1	Substitution - Missense(1)	kidney(1)											59.0	57.0	58.0					16																	29858602		2197	4300	6497	SO:0001583	missense	9961			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.2350G>A	16.37:g.29858602G>A	ENSP00000349977:p.Ala784Thr		Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248651	0.59103	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.33654	1.4;1.4	6.08	6.08	0.98989	.	0.100602	0.64402	D	0.000002	T	0.32041	0.0816	L	0.34521	1.04	0.80722	D	1	B	0.22080	0.064	B	0.17722	0.019	T	0.02603	-1.1135	10	0.38643	T	0.18	-1.4796	18.1659	0.89727	0.0:0.0:1.0:0.0	.	784	Q14764	MVP_HUMAN	T	784	ENSP00000349977:A784T;ENSP00000378760:A784T	ENSP00000349977:A784T	A	+	1	0	MVP	29766103	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.879000	0.56138	2.894000	0.99253	0.591000	0.81541	GCT		0.597	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3		NM_005115	
NPY	4852	broad.mit.edu;ucsc.edu	37	7	24324865	24324865	+	Silent	SNP	A	A	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr7:24324865A>G	ENST00000407573.1	+	3	296	c.6A>G	c.(4-6)ctA>ctG	p.L2L	NPY_ENST00000242152.2_Silent_p.L2L|NPY_ENST00000405982.1_Silent_p.L2L			P01303	NPY_HUMAN	neuropeptide Y	2					adult feeding behavior (GO:0008343)|behavior (GO:0007610)|blood circulation (GO:0008015)|calcium ion transport (GO:0006816)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of appetite (GO:0032100)|regulation of blood pressure (GO:0008217)|synaptic transmission (GO:0007268)	cell (GO:0005623)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)	p.L2L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	9						TGCAGATGCTAGGTAACAAGC	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											91.0	81.0	84.0					7																	24324865		2203	4300	6503	SO:0001819	synonymous_variant	4852			K01911	CCDS5387.1	7p15.3	2013-02-26			ENSG00000122585	ENSG00000122585		"""Endogenous ligands"""	7955	protein-coding gene	gene with protein product	"""prepro-neuropeptide Y"""	162640					Standard	NM_000905		Approved	PYY4	uc003sww.2	P01303	OTTHUMG00000022973	ENST00000407573.1:c.6A>G	7.37:g.24324865A>G				Silent	SNP	ENST00000407573.1	37	CCDS5387.1																																																																																				0.677	NPY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326748.1		NM_000905	
OR4C6	219432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	55433031	55433031	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr11:55433031A>G	ENST00000314259.3	+	1	418	c.389A>G	c.(388-390)tAc>tGc	p.Y130C		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y130C(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						CCCCTGCACTACACGATCATC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											106.0	98.0	101.0					11																	55433031		2200	4296	6496	SO:0001583	missense	219432			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.389A>G	11.37:g.55433031A>G	ENSP00000324769:p.Tyr130Cys		B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880633	0.72294	.	.	ENSG00000181903	ENST00000314259	T	0.33865	1.39	3.77	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34986	N	0.003522	T	0.69196	0.3084	H	0.96142	3.775	0.35561	D	0.804696	D	0.89917	1.0	D	0.79108	0.992	T	0.82957	-0.0199	10	0.87932	D	0	.	11.4632	0.50223	1.0:0.0:0.0:0.0	.	130	Q8NH72	OR4C6_HUMAN	C	130	ENSP00000324769:Y130C	ENSP00000324769:Y130C	Y	+	2	0	OR4C6	55189607	1.000000	0.71417	0.887000	0.34795	0.901000	0.52897	7.559000	0.82265	1.383000	0.46405	0.438000	0.28831	TAC		0.522	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1		NM_001004704	
TENM4	26011	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	78516425	78516425	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr11:78516425T>G	ENST00000278550.7	-	15	2553	c.2091A>C	c.(2089-2091)ttA>ttC	p.L697F		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	697	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.L697F(2)									AACACTGGTCTAAGCATGTGG	0.612																																																	2	Substitution - Missense(2)	kidney(2)											51.0	58.0	56.0					11																	78516425		2109	4222	6331	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2091A>C	11.37:g.78516425T>G	ENSP00000278550:p.Leu697Phe		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.09|10.09	1.254086|1.254086	0.22965|0.22965	.|.	.|.	ENSG00000149256|ENSG00000149256	ENST00000278550|ENST00000533525	T|.	0.03272|.	3.99|.	5.1|5.1	3.03|3.03	0.35002|0.35002	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);|.	0.059200|.	0.64402|.	D|.	0.000003|.	T|.	0.42017|.	0.1184|.	N|N	0.21240|0.21240	0.645|0.645	0.44110|0.44110	D|D	0.996886|0.996886	P|.	0.35433|.	0.501|.	B|.	0.27500|.	0.08|.	T|.	0.11324|.	-1.0592|.	9|.	.|.	.|.	.|.	.|.	10.4748|10.4748	0.44659|0.44659	0.0:0.8109:0.0:0.1891|0.0:0.8109:0.0:0.1891	.|.	697|.	Q6N022|.	TEN4_HUMAN|.	F|S	697|11	ENSP00000278550:L697F|.	.|.	L|X	-|-	3|2	2|0	ODZ4|ODZ4	78194073|78194073	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	1.993000|1.993000	0.40747|0.40747	0.580000|0.580000	0.29522|0.29522	-0.376000|-0.376000	0.06991|0.06991	TTA|TAG		0.612	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			
PAN2	9924	broad.mit.edu;ucsc.edu	37	12	56720186	56720186	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr12:56720186G>C	ENST00000425394.2	-	8	1646	c.1270C>G	c.(1270-1272)Cca>Gca	p.P424A	PAN2_ENST00000440411.3_Missense_Mutation_p.P424A|PAN2_ENST00000548043.1_Missense_Mutation_p.P424A|PAN2_ENST00000257931.5_Missense_Mutation_p.P424A	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.P424A(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	TCCACGGGTGGTGCTCGCCTA	0.527																																																	1	Substitution - Missense(1)	kidney(1)											42.0	35.0	37.0					12																	56720186		2203	4299	6502	SO:0001583	missense	9924			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1270C>G	12.37:g.56720186G>C	ENSP00000401721:p.Pro424Ala			Missense_Mutation	SNP	ENST00000425394.2	37	CCDS44922.1	.	.	.	.	.	.	.	.	.	.	g	18.71	3.682030	0.68042	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.26373	1.75;1.75;1.74;1.75	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.30293	0.0760	L	0.50333	1.59	0.80722	D	1	P;P;P	0.40834	0.532;0.724;0.73	B;B;B	0.41135	0.263;0.348;0.282	T	0.05354	-1.0890	10	0.52906	T	0.07	-12.3528	17.7666	0.88480	0.0:0.0:1.0:0.0	.	424;424;424	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	A	424	ENSP00000401721:P424A;ENSP00000388231:P424A;ENSP00000257931:P424A;ENSP00000449861:P424A	ENSP00000257931:P424A	P	-	1	0	PAN2	55006453	1.000000	0.71417	0.974000	0.42286	0.964000	0.63967	9.608000	0.98331	2.562000	0.86427	0.580000	0.79431	CCA		0.527	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1		NM_014871	
PAPPA2	60676	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	176640128	176640128	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:176640128C>A	ENST00000367662.3	+	4	3178	c.2014C>A	c.(2014-2016)Ctg>Atg	p.L672M	PAPPA2_ENST00000367661.3_Missense_Mutation_p.L672M	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	672	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L672M(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGTGAAGGAGCTGAAGGAGGC	0.498																																																	2	Substitution - Missense(2)	kidney(2)											175.0	174.0	174.0					1																	176640128		1993	4177	6170	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2014C>A	1.37:g.176640128C>A	ENSP00000356634:p.Leu672Met		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220833	0.79464	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.29917	4.7;1.55	5.52	4.61	0.57282	.	0.000000	0.64402	D	0.000001	T	0.33000	0.0848	N	0.05199	-0.095	0.46849	D	0.999226	D;D	0.89917	0.995;1.0	D;D	0.85130	0.951;0.997	T	0.34030	-0.9845	10	0.36615	T	0.2	-10.6837	13.7359	0.62817	0.0:0.925:0.0:0.075	.	672;672	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	M	672	ENSP00000356634:L672M;ENSP00000356633:L672M	ENSP00000356633:L672M	L	+	1	2	PAPPA2	174906751	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.195000	0.51013	1.318000	0.45170	0.655000	0.94253	CTG		0.498	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			
PAX6	5080	broad.mit.edu;hgsc.bcm.edu	37	11	31816305	31816305	+	Silent	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr11:31816305C>T	ENST00000379132.3	-	7	835	c.555G>A	c.(553-555)gaG>gaA	p.E185E	PAX6_ENST00000241001.8_Silent_p.E185E|PAX6_ENST00000379123.5_Silent_p.E185E|PAX6_ENST00000419022.1_Silent_p.E199E|PAX6_ENST00000379107.2_Silent_p.E199E|PAX6_ENST00000379111.2_Silent_p.E185E|PAX6_ENST00000379129.2_Silent_p.E199E|PAX6_ENST00000379115.4_Silent_p.E199E			P26367	PAX6_HUMAN	paired box 6	185	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.E199E(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					AGTTGGTATTCTCTCCCCCTC	0.473									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								1	Substitution - coding silent(1)	kidney(1)											109.0	99.0	102.0					11																	31816305		2202	4299	6501	SO:0001819	synonymous_variant	5080	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.555G>A	11.37:g.31816305C>T			Q6N006|Q99413	Silent	SNP	ENST00000379132.3	37	CCDS31451.1																																																																																				0.473	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4		NM_001604	
RANBP17	64901	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	170380686	170380686	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr5:170380686G>T	ENST00000523189.1	+	13	1718	c.1554G>T	c.(1552-1554)atG>atT	p.M518I		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	518					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.M518I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATGATGCTATGGATGGAGAAT	0.333			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	kidney(1)											145.0	140.0	142.0					5																	170380686		2203	4300	6503	SO:0001583	missense	64901			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1554G>T	5.37:g.170380686G>T	ENSP00000427975:p.Met518Ile		Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789154	0.49997	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.64260	-0.09	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52533	0.1740	L	0.34521	1.04	0.58432	D	0.99999	B	0.16396	0.017	B	0.16722	0.016	T	0.48234	-0.9053	10	0.11794	T	0.64	-18.7485	19.3271	0.94267	0.0:0.0:1.0:0.0	.	518	Q9H2T7	RBP17_HUMAN	I	518;414	ENSP00000427975:M518I	ENSP00000373770:M518I	M	+	3	0	RANBP17	170313291	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.066000	0.89486	2.680000	0.91292	0.467000	0.42956	ATG		0.333	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1		NM_022897	
RFX5	5993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151315361	151315361	+	Silent	SNP	G	G	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:151315361G>T	ENST00000290524.4	-	11	1330	c.1152C>A	c.(1150-1152)atC>atA	p.I384I	RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Silent_p.I384I|RFX5_ENST00000452513.2_Silent_p.I344I|RFX5_ENST00000368870.2_Silent_p.I384I|RP11-126K1.8_ENST00000422153.1_RNA	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	384					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I384I(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAGTTGGTAAGATCATGTTAA	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	93.0	90.0					1																	151315361		2203	4300	6503	SO:0001819	synonymous_variant	5993				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1152C>A	1.37:g.151315361G>T			B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	ENST00000290524.4	37	CCDS994.1																																																																																				0.612	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6		NM_000449	
RIMBP2	23504	broad.mit.edu;ucsc.edu	37	12	130926444	130926444	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr12:130926444C>T	ENST00000261655.4	-	8	1565	c.1402G>A	c.(1402-1404)Gag>Aag	p.E468K	RIMBP2_ENST00000536002.1_Missense_Mutation_p.E376K|RIMBP2_ENST00000535703.1_Missense_Mutation_p.E376K	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	468	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.E468K(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCCCTTTGCTCCAGCGGGAGC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											47.0	47.0	47.0					12																	130926444		2203	4300	6503	SO:0001583	missense	23504			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1402G>A	12.37:g.130926444C>T	ENSP00000261655:p.Glu468Lys		Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	c	26.1	4.709007	0.89018	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.45668	0.89;0.89;0.89	4.13	4.13	0.48395	Fibronectin, type III (1);	0.059676	0.64402	D	0.000003	T	0.63931	0.2553	M	0.73962	2.25	0.58432	D	0.999994	D;D;D	0.69078	0.997;0.982;0.997	D;P;D	0.75020	0.985;0.894;0.98	T	0.68029	-0.5517	10	0.48119	T	0.1	-31.0974	16.3969	0.83610	0.0:1.0:0.0:0.0	.	376;376;468	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	K	468;376;376;376	ENSP00000261655:E468K;ENSP00000440347:E376K;ENSP00000439159:E376K	ENSP00000261655:E468K	E	-	1	0	RIMBP2	129492397	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.051000	0.71072	1.818000	0.53035	0.537000	0.68136	GAG		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1		NM_015347	
RYR2	6262	hgsc.bcm.edu;ucsc.edu	37	1	237538046	237538046	+	Silent	SNP	T	T	C			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:237538046T>C	ENST00000366574.2	+	7	731	c.414T>C	c.(412-414)tcT>tcC	p.S138S	RYR2_ENST00000360064.6_Silent_p.S136S|RYR2_ENST00000542537.1_Silent_p.S122S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	138	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCTCCCGGTCTTCAACTGATA	0.478																																																	0													124.0	120.0	121.0					1																	237538046		1956	4140	6096	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.414T>C	1.37:g.237538046T>C			Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																				0.478	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		NM_001035	
SLC39A10	57181	hgsc.bcm.edu;ucsc.edu	37	2	196548615	196548615	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:196548615A>G	ENST00000409086.3	+	3	1476	c.1201A>G	c.(1201-1203)Aat>Gat	p.N401D	SLC39A10_ENST00000541054.1_5'UTR|SLC39A10_ENST00000359634.5_Missense_Mutation_p.N401D	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	401					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AGATGAGGCAAATATAGGGGC	0.303																																																	0													54.0	58.0	56.0					2																	196548615		2203	4299	6502	SO:0001583	missense	57181				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1201A>G	2.37:g.196548615A>G	ENSP00000386766:p.Asn401Asp		A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	A	7.459	0.644339	0.14451	.	.	ENSG00000196950	ENST00000409086;ENST00000359634	T;T	0.63580	-0.05;-0.05	4.95	1.16	0.20824	.	0.932043	0.09208	N	0.833734	T	0.37320	0.0999	N	0.11064	0.09	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14671	-1.0464	10	0.13108	T	0.6	.	6.6939	0.23187	0.6316:0.2929:0.0755:0.0	.	401	Q9ULF5	S39AA_HUMAN	D	401	ENSP00000386766:N401D;ENSP00000352655:N401D	ENSP00000352655:N401D	N	+	1	0	SLC39A10	196256860	1.000000	0.71417	0.994000	0.49952	0.949000	0.60115	2.744000	0.47450	0.047000	0.15862	-0.263000	0.10527	AAT		0.303	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1		XM_047707	
SPATA17	128153	hgsc.bcm.edu;ucsc.edu	37	1	218036142	218036142	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:218036142T>G	ENST00000366933.4	+	10	1087	c.1032T>G	c.(1030-1032)ttT>ttG	p.F344L	SPATA17_ENST00000471021.1_3'UTR	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	344						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TACCATCATTTGAGCTCTTCT	0.279																																																	0													115.0	130.0	125.0					1																	218036142		2203	4294	6497	SO:0001583	missense	128153			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.1032T>G	1.37:g.218036142T>G	ENSP00000355900:p.Phe344Leu		A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939154	0.34189	.	.	ENSG00000162814	ENST00000366933	T	0.40476	1.03	5.38	4.26	0.50523	.	0.105307	0.39475	N	0.001346	T	0.33411	0.0862	L	0.50919	1.6	0.31143	N	0.706437	B	0.10296	0.003	B	0.04013	0.001	T	0.31613	-0.9937	10	0.18710	T	0.47	-3.3805	9.0532	0.36389	0.0:0.0833:0.0:0.9167	.	344	Q96L03	SPT17_HUMAN	L	344	ENSP00000355900:F344L	ENSP00000355900:F344L	F	+	3	2	SPATA17	216102765	1.000000	0.71417	0.997000	0.53966	0.853000	0.48598	2.805000	0.47939	0.881000	0.35993	0.477000	0.44152	TTT		0.279	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2		NM_138796	
SUPV3L1	6832	broad.mit.edu;ucsc.edu	37	10	70954975	70954975	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr10:70954975G>A	ENST00000359655.4	+	7	945	c.885G>A	c.(883-885)atG>atA	p.M295I		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	295	Helicase ATP-binding.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.M295I(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AAATTCAAATGATTAGAGATC	0.383																																																	1	Substitution - Missense(1)	kidney(1)											84.0	86.0	85.0					10																	70954975		2203	4300	6503	SO:0001583	missense	6832			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.885G>A	10.37:g.70954975G>A	ENSP00000352678:p.Met295Ile		A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	37	CCDS7287.1	.	.	.	.	.	.	.	.	.	.	G	36	5.709832	0.96821	.	.	ENSG00000156502	ENST00000359655;ENST00000422378	T;T	0.39787	1.06;1.29	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	M	0.88310	2.945	0.80722	D	1	P	0.51537	0.946	P	0.57620	0.824	T	0.73662	-0.3912	10	0.72032	D	0.01	-19.5863	20.1142	0.97922	0.0:0.0:1.0:0.0	.	295	Q8IYB8	SUV3_HUMAN	I	295;101	ENSP00000352678:M295I;ENSP00000409072:M101I	ENSP00000352678:M295I	M	+	3	0	SUPV3L1	70624981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.856000	0.99531	2.765000	0.95021	0.650000	0.86243	ATG		0.383	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2		NM_003171	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191543	10191546	+	Frame_Shift_Del	DEL	ACAT	ACAT	-	rs377715747		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	ACAT	ACAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr3:10191543_10191546delACAT	ENST00000256474.2	+	3	1376_1379	c.536_539delACAT	c.(535-540)gacatcfs	p.DI179fs	VHL_ENST00000345392.2_Frame_Shift_Del_p.DI138fs|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	179					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.I180N(4)|p.D179fs*>36(2)|p.D179_I180del(1)|p.D179fs*23(1)|p.L178_V181del(1)|p.D179A(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGGAGACTGGACATCGTCAGGTCG	0.52		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	10	Substitution - Missense(5)|Deletion - In frame(2)|Insertion - Frameshift(2)|Deletion - Frameshift(1)	kidney(9)|large_intestine(1)	GRCh37	CM941387	VHL	M																																				SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.536_539delACAT	3.37:g.10191543_10191546delACAT	ENSP00000256474:p.Asp179fs		B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.520	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR5	11091	hgsc.bcm.edu;ucsc.edu	37	9	137006663	137006663	+	Silent	SNP	G	G	A	rs142853576		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr9:137006663G>A	ENST00000358625.3	+	4	393	c.222G>A	c.(220-222)gcG>gcA	p.A74A	WDR5_ENST00000425041.1_Silent_p.A74A	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	74					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		TTTGGGGCGCGTATGATGGGA	0.438													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17560	0.0		0.0	False		,,,				2504	0.0																0								G	,	0,4406		0,0,2203	132.0	124.0	127.0		222,222	-9.2	0.8	9	dbSNP_134	127	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	WDR5	NM_017588.2,NM_052821.3	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	74/335,74/335	137006663	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	11091			AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.222G>A	9.37:g.137006663G>A			Q91VA5|Q9NWX7|Q9UGP9	Silent	SNP	ENST00000358625.3	37	CCDS6981.1																																																																																				0.438	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254621.1		NM_052821	
ZNF677	342926	hgsc.bcm.edu;ucsc.edu	37	19	53740495	53740495	+	Silent	SNP	G	G	A	rs574077624	byFrequency	TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:53740495G>A	ENST00000598513.1	-	5	1635	c.1485C>T	c.(1483-1485)gcC>gcT	p.A495A	ZNF677_ENST00000333952.4_Silent_p.A495A	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	495					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		GTTCAGTAAAGGCTTTGCCAC	0.368													G|||	4	0.000798722	0.0	0.0029	5008	,	,		19430	0.0		0.002	False		,,,				2504	0.0																0													85.0	83.0	84.0					19																	53740495		2203	4299	6502	SO:0001819	synonymous_variant	342926			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1485C>T	19.37:g.53740495G>A				Silent	SNP	ENST00000598513.1	37	CCDS12861.1																																																																																				0.368	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1		NM_182609	
ARHGAP23	57636	broad.mit.edu	37	17	36622485	36622485	+	Silent	SNP	G	G	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr17:36622485G>T	ENST00000431231.2	+	7	629	c.561G>T	c.(559-561)ccG>ccT	p.P187P	ARHGAP23_ENST00000437668.3_Silent_p.P187P|ARHGAP23_ENST00000443378.1_Silent_p.P93P	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	187	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)	p.P512P(1)		breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						AGCCACCGCCGATCTGCTACC	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											33.0	41.0	39.0					17																	36622485		692	1591	2283	SO:0001819	synonymous_variant	57636			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.561G>T	17.37:g.36622485G>T				Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																				0.662	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1		XM_290799	
BCAM	4059	broad.mit.edu	37	19	45317871	45317871	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:45317871A>G	ENST00000270233.6	+	8	954	c.932A>G	c.(931-933)gAg>gGg	p.E311G	BCAM_ENST00000589651.1_Missense_Mutation_p.E311G	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	311	Ig-like C2-type 1.|Interaction with laminin alpha5.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)	p.E311G(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GATGAGCAGGAGGAAGTGCTG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											85.0	77.0	80.0					19																	45317871		2203	4300	6503	SO:0001583	missense	4059			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.932A>G	19.37:g.45317871A>G	ENSP00000270233:p.Glu311Gly		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	15.32	2.799134	0.50208	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.03301	3.98;3.98	4.43	2.15	0.27550	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05960	0.0155	N	0.16166	0.38	0.20074	N	0.999932	D	0.89917	1.0	D	0.91635	0.999	T	0.42464	-0.9450	9	0.39692	T	0.17	-27.7249	4.1868	0.10402	0.6826:0.2073:0.1101:0.0	.	311	P50895	BCAM_HUMAN	G	311	ENSP00000270233:E311G;ENSP00000375817:E311G	ENSP00000270233:E311G	E	+	2	0	BCAM	50009711	0.993000	0.37304	0.414000	0.26521	0.215000	0.24574	4.083000	0.57643	0.689000	0.31550	0.379000	0.24179	GAG		0.612	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1		NM_005581	
C2orf81	388963	broad.mit.edu	37	2	74642858	74642858	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr2:74642858C>G	ENST00000517883.1	-	1	852	c.161G>C	c.(160-162)gGc>gCc	p.G54A	C2orf81_ENST00000290390.5_Missense_Mutation_p.G152A			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	145								p.G152A(1)		endometrium(3)|kidney(1)	4						GTTCTCCAGGCCCTCCGAGGT	0.637																																																	1	Substitution - Missense(1)	kidney(1)											41.0	52.0	48.0					2																	74642858		692	1591	2283	SO:0001583	missense	388963			AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.161G>C	2.37:g.74642858C>G	ENSP00000431103:p.Gly54Ala			Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	C	19.34	3.809136	0.70797	.	.	ENSG00000159239	ENST00000517883;ENST00000290390;ENST00000518863;ENST00000517896	.	.	.	4.84	-0.253	0.12996	.	1.151050	0.06474	N	0.731686	T	0.35885	0.0947	M	0.64997	1.995	0.09310	N	1	P	0.52061	0.95	P	0.51918	0.684	T	0.29912	-0.9996	9	0.02654	T	1	-5.2548	2.0943	0.03664	0.1373:0.491:0.1335:0.2383	.	152	G3XAA6	.	A	54;152;54;152	.	ENSP00000290390:G152A	G	-	2	0	C2orf81	74496366	0.000000	0.05858	0.000000	0.03702	0.345000	0.29048	0.098000	0.15189	-0.153000	0.11137	0.462000	0.41574	GGC		0.637	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1		NM_001145054	
CBWD3	445571	broad.mit.edu	37	9	70871861	70871861	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr9:70871861T>G	ENST00000360171.6	+	5	1006	c.455T>G	c.(454-456)gTt>gGt	p.V152G	CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	152							ATP binding (GO:0005524)	p.V152G(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		ATGTTTTGGGTTGATGCTGAA	0.254																																																	1	Substitution - Missense(1)	kidney(1)											25.0	31.0	29.0					9																	70871861		2189	4257	6446	SO:0001583	missense	445571			BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.455T>G	9.37:g.70871861T>G	ENSP00000353295:p.Val152Gly		B4DNG9|Q6VB91	Missense_Mutation	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	.	16.92	3.254210	0.59212	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	T	0.42131	0.98	3.38	3.38	0.38709	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.062819	0.64402	D	0.000006	T	0.47948	0.1473	L	0.41356	1.27	0.80722	D	1	P;B	0.38767	0.646;0.075	P;B	0.52823	0.71;0.189	T	0.51317	-0.8721	10	0.87932	D	0	-14.4918	11.0695	0.47995	0.0:0.0:0.0:1.0	.	152;152	E7ETY5;Q5JTY5	.;CBWD3_HUMAN	G	152;152;152;152;116	ENSP00000353295:V152G	ENSP00000353295:V152G	V	+	2	0	CBWD3	70061681	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.201000	0.77847	1.311000	0.45024	0.254000	0.18369	GTT		0.254	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1		NM_201453	
CXADRP2	646243	broad.mit.edu	37	15	22016431	22016431	+	IGR	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr15:22016431T>G								DKFZP547L112 (4381 upstream) : MIR3118-6 (32842 downstream)																							GGAGCTCTTTTCACTTTGCAC	0.393																																																	0																																										SO:0001628	intergenic_variant	646243																															15.37:g.22016431T>G				Missense_Mutation	SNP		37																																																																																				0	0.393									
CDAN1	146059	broad.mit.edu	37	15	43026473	43026473	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr15:43026473G>T	ENST00000356231.3	-	7	1231	c.1208C>A	c.(1207-1209)cCa>cAa	p.P403Q		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	403					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P403Q(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TTGCAGAGCTGGTGAGAAGCA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											65.0	63.0	64.0					15																	43026473		2203	4299	6502	SO:0001583	missense	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1208C>A	15.37:g.43026473G>T	ENSP00000348564:p.Pro403Gln		Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095956	0.94197	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.90197	-2.63	5.44	5.44	0.79542	.	0.056135	0.64402	D	0.000001	D	0.93818	0.8023	L	0.46157	1.445	0.54753	D	0.999989	D	0.89917	1.0	D	0.74674	0.984	D	0.94299	0.7535	10	0.87932	D	0	-9.079	19.2703	0.94006	0.0:0.0:1.0:0.0	.	403	Q8IWY9	CDAN1_HUMAN	Q	403;401	ENSP00000348564:P403Q	ENSP00000267892:P401Q	P	-	2	0	CDAN1	40813765	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.114000	0.94329	2.553000	0.86117	0.563000	0.77884	CCA		0.567	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1		XM_085300	
CHIAP2	149620	broad.mit.edu	37	1	111824291	111824291	+	RNA	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:111824291T>G	ENST00000369743.4	+	0	175					NR_003928.1				chitinase, acidic pseudogene 2																		TCTACGCCTTTGCTGGAATGC	0.507																																																	0																																												0					1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111824291T>G				RNA	SNP	ENST00000369743.4	37																																																																																					0.507	CHIAP2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000033667.3			
NBPF8	728841	broad.mit.edu	37	1	144220807	144220807	+	Missense_Mutation	SNP	A	A	C	rs375759831		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:144220807A>C	ENST00000369373.5	+	2	74	c.74A>C	c.(73-75)gAt>gCt	p.D25A				Q3BBV2	NBPF8_HUMAN	neuroblastoma breakpoint family, member 8	665						cytoplasm (GO:0005737)											GAGCTGCTGGATGAGAAAGAG	0.483																																																	0																																										SO:0001583	missense	400818			AY894572		1q21.1	2014-04-01	2013-04-24	2013-04-24	ENSG00000162825	ENSG00000162825		"""neuroblastoma breakpoint family"""	31990	protein-coding gene	gene with protein product		613998	"""neuroblastoma breakpoint family, member 8, pseudogene"""	NBPF8P		16079250	Standard	NM_001037501		Approved			Q3BBV2	OTTHUMG00000074805	ENST00000369373.5:c.74A>C	1.37:g.144220807A>C	ENSP00000358380:p.Asp25Ala			Missense_Mutation	SNP	ENST00000369373.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	7.405|7.405	0.633647|0.633647	0.14322|0.14322	.|.	.|.	ENSG00000162825|ENSG00000162825	ENST00000369373|ENST00000369365	T|.	0.07021|.	3.23|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39835|.	0.1093|.	.|.	.|.	.|.	0.80722|.	D|.	1.000000|.	P;.;B;B|.	0.52842|.	0.956;.;0.04;0.002|.	P;.;B;B|.	0.57502|.	0.822;.;0.074;0.015|.	T|.	0.29610|.	-1.0006|.	4|.	0.33940|.	T|.	0.23|.	.|.	.|.	.|.	.|.	.|.	431;598;373;440|.	Q5VTG8;B4DG53;Q8IX72;Q5TB04|.	.;.;.;.|.	A|L	25|3576	ENSP00000358380:D25A|.	ENSP00000358380:D25A|.	D|M	+|+	2|1	0|0	RP3-377D14.1|RP3-377D14.1	142932164|142932164	0.533000|0.533000	0.26354|0.26354	.|.	.|.	.|.	.|.	0.868000|0.868000	0.27982|0.27982	.|.	.|.	.|.	.|.	GAT|ATG		0.483	NBPF8-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding				
SHC1	6464	broad.mit.edu	37	1	154938670	154938670	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:154938670C>T	ENST00000368445.5	-	9	1434	c.1220G>A	c.(1219-1221)cGc>cAc	p.R407H	SHC1_ENST00000368453.4_Missense_Mutation_p.R297H|SHC1_ENST00000490667.1_5'Flank|SHC1_ENST00000448116.2_Missense_Mutation_p.R407H|PYGO2_ENST00000483463.1_5'Flank|SHC1_ENST00000606391.1_Missense_Mutation_p.R208H|SHC1_ENST00000368449.4_Missense_Mutation_p.R178H|SHC1_ENST00000368450.1_Missense_Mutation_p.R297H	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	407	CH1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.R297H(1)|p.R407H(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CATCTGTTTGCGGACTTCTGG	0.582																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)												2	Substitution - Missense(2)	kidney(2)											64.0	62.0	62.0					1																	154938670		2203	4300	6503	SO:0001583	missense	6464			U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.1220G>A	1.37:g.154938670C>T	ENSP00000357430:p.Arg407His		B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	C	8.733	0.917098	0.17907	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000368441;ENST00000414115	T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71	4.68	3.77	0.43336	.	0.289069	0.32918	N	0.005488	T	0.24547	0.0595	L	0.35723	1.085	0.41182	D	0.986241	B;P;P	0.46457	0.191;0.878;0.874	B;P;B	0.44477	0.013;0.451;0.215	T	0.05533	-1.0879	10	0.48119	T	0.1	.	7.8281	0.29326	0.0:0.7441:0.0:0.2559	.	186;407;407	Q59HB0;P29353-6;P29353	.;.;SHC1_HUMAN	H	407;407;208;297;297;343;79;160	ENSP00000357430:R407H;ENSP00000401303:R407H;ENSP00000357434:R208H;ENSP00000357438:R297H;ENSP00000357435:R297H;ENSP00000404908:R160H	ENSP00000357426:R79H	R	-	2	0	SHC1	153205294	0.219000	0.23619	1.000000	0.80357	0.929000	0.56500	0.808000	0.27154	1.208000	0.43306	0.557000	0.71058	CGC		0.582	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2		NM_183001	
KIRREL	55243	broad.mit.edu	37	1	158059420	158059420	+	Splice_Site	SNP	T	T	G			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr1:158059420T>G	ENST00000359209.6	+	9	1238		c.e9+2		KIRREL_ENST00000360089.4_Splice_Site|KIRREL_ENST00000368173.3_Splice_Site|KIRREL_ENST00000392272.2_Splice_Site|KIRREL_ENST00000368172.1_Splice_Site|KIRREL_ENST00000416935.2_Splice_Site			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)						excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.?(3)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					ATGTGAACGGTGAGTGAGTGG	0.612																																																	3	Unknown(3)	kidney(3)											62.0	66.0	64.0					1																	158059420		2203	4300	6503	SO:0001630	splice_region_variant	55243			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1171+2T>G	1.37:g.158059420T>G			Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Splice_Site	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	T	18.90	3.721185	0.68959	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4341	0.55590	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIRREL	156326044	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	7.450000	0.80656	2.034000	0.60081	0.377000	0.23210	.		0.612	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3		NM_018240	Intron
TYK2	7297	broad.mit.edu	37	19	10473019	10473019	+	Silent	SNP	C	C	A			TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr19:10473019C>A	ENST00000525621.1	-	11	2071	c.1590G>T	c.(1588-1590)ggG>ggT	p.G530G	TYK2_ENST00000529370.1_Silent_p.G530G|TYK2_ENST00000264818.6_Silent_p.G530G|TYK2_ENST00000524462.1_Silent_p.G345G	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	530					cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.G530G(1)		breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCAAGGCAGCCCCAAGTTCCC	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											36.0	39.0	38.0					19																	10473019		2203	4300	6503	SO:0001819	synonymous_variant	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1590G>T	19.37:g.10473019C>A			Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	37	CCDS12236.1																																																																																				0.652	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			
MIR4477B	100616194	broad.mit.edu	37	9	68414733	68414733	+	RNA	SNP	C	C	T	rs151269495		TCGA-CJ-5680-01A-11D-1534-10	TCGA-CJ-5680-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c718814-9d25-49a6-a430-2019071ec0ab	ef7a85b0-807b-4c98-9c63-856a0079d1fd	g.chr9:68414733C>T	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		tcaagaccagcctggccaaaa	0.453																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68414733C>T				RNA	SNP	ENST00000581659.1	37																																																																																					0.453	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
