#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WASF2	10163	hgsc.bcm.edu	37	1	27736340	27736340	+	Silent	SNP	A	A	G	rs71584884		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:27736340A>G	ENST00000430629.2	-	8	1400	c.1185T>C	c.(1183-1185)ccT>ccC	p.P395P	WASF2_ENST00000536657.1_Intron	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	395	Poly-Pro.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		gaggaggaggagggggaggag	0.642																																					p.P395P		.											.	WASF2-228	0			c.T1185C						.						51.0	53.0	52.0					1																	27736340		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon8			AGGAGGAGGGGGA	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1185T>C	1.37:g.27736340A>G		108	0		132	7	NM_006990	0	0	25	25	0	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	37	CCDS304.1																																																																																			A|0.500;T|0.500		0.642	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
FOXJ3	22887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	42744042	42744042	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:42744042T>A	ENST00000372572.1	-	5	657	c.346A>T	c.(346-348)Aga>Tga	p.R116*	FOXJ3_ENST00000361346.1_Nonsense_Mutation_p.R116*|FOXJ3_ENST00000372573.1_Nonsense_Mutation_p.R116*|FOXJ3_ENST00000361776.1_Nonsense_Mutation_p.R116*|FOXJ3_ENST00000545068.1_Nonsense_Mutation_p.R116*	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	116					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCAGCCTCTCTATAATATGGG	0.313																																					p.R116X		.											.	FOXJ3-228	0			c.A346T						.						70.0	71.0	70.0					1																	42744042		2203	4300	6503	SO:0001587	stop_gained	22887	exon3			CCTCTCTATAATA	AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.346A>T	1.37:g.42744042T>A	ENSP00000361653:p.Arg116*	111	0		88	34	NM_001198852	0	0	4	4	0	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Nonsense_Mutation	SNP	ENST00000372572.1	37	CCDS30689.1	.	.	.	.	.	.	.	.	.	.	T	40	8.346624	0.98769	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886;ENST00000454417	.	.	.	5.48	5.48	0.80851	.	0.066191	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.527	0.61601	0.0:0.0:0.0:1.0	.	.	.	.	X	116;116;116;116;116;116;73	.	ENSP00000354620:R116X	R	-	1	2	FOXJ3	42516629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.242000	0.72376	2.082000	0.62665	0.374000	0.22700	AGA	.		0.313	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947	
RHOC	389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113244309	113244309	+	Silent	SNP	C	C	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:113244309C>G	ENST00000285735.2	-	6	1644	c.435G>C	c.(433-435)cgG>cgC	p.R145R	RHOC_ENST00000369632.2_Silent_p.R145R|RHOC_ENST00000369636.2_Missense_Mutation_p.G125A|RHOC_ENST00000339083.7_Silent_p.R145R|RHOC_ENST00000369638.2_Silent_p.R145R|RHOC_ENST00000369642.3_Silent_p.R145R|RHOC_ENST00000369633.2_Silent_p.R145R|RP11-426L16.10_ENST00000471038.2_5'Flank|RHOC_ENST00000369637.1_Silent_p.R145R			P08134	RHOC_HUMAN	ras homolog family member C	145					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCGCCATGTCCCGGCCTTCCT	0.572																																					p.R145R		.											.	RHOC-848	0			c.G435C						.						107.0	95.0	99.0					1																	113244309		2203	4300	6503	SO:0001819	synonymous_variant	389	exon6			CATGTCCCGGCCT	BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.435G>C	1.37:g.113244309C>G		184	0		153	59	NM_175744	0	1	255	429	173	B3KSW1|Q6ICN3	Silent	SNP	ENST00000285735.2	37	CCDS854.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.706628	0.30232	.	.	ENSG00000155366	ENST00000369636	T	0.71222	-0.55	5.13	2.24	0.28232	.	0.480686	0.15126	U	0.279101	T	0.46347	0.1388	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37911	-0.9685	7	0.25106	T	0.35	-8.222	4.4249	0.11498	0.0:0.4765:0.1577:0.3659	.	.	.	.	A	125	ENSP00000358650:G125A	ENSP00000358650:G125A	G	-	2	0	RHOC	113045832	0.998000	0.40836	1.000000	0.80357	0.865000	0.49528	0.626000	0.24492	0.196000	0.20367	-1.254000	0.01491	GGG	.		0.572	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	NM_175744	
IVL	3713	broad.mit.edu	37	1	152882868	152882868	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:152882868C>G	ENST00000368764.3	+	2	659	c.595C>G	c.(595-597)Cag>Gag	p.Q199E	IVL_ENST00000392667.2_Missense_Mutation_p.Q53E			P07476	INVO_HUMAN	involucrin	199	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cccagagcagcaggaggggca	0.692																																					p.Q199E													.	IVL-93	0			c.C595G						.						1.0	2.0	2.0					1																	152882868		780	1755	2535	SO:0001583	missense	3713	exon2			GAGCAGCAGGAGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.595C>G	1.37:g.152882868C>G	ENSP00000357753:p.Gln199Glu	121	2		100	8	NM_005547	0	0	0	0	0	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	0.071	-1.202827	0.01581	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.12255	3.0;2.7	3.41	2.47	0.30058	.	.	.	.	.	T	0.10252	0.0251	L	0.59436	1.845	0.09310	N	1	D	0.63046	0.992	P	0.60068	0.868	T	0.06215	-1.0839	9	0.07482	T	0.82	.	10.3906	0.44166	0.0:0.7838:0.2162:0.0	.	199	P07476	INVO_HUMAN	E	199;53	ENSP00000357753:Q199E;ENSP00000376435:Q53E	ENSP00000357753:Q199E	Q	+	1	0	IVL	151149492	0.000000	0.05858	0.015000	0.15790	0.021000	0.10359	0.910000	0.28571	0.766000	0.33244	0.430000	0.28490	CAG	.		0.692	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
CENPF	1063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214815619	214815619	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:214815619A>T	ENST00000366955.3	+	12	4106	c.3938A>T	c.(3937-3939)gAa>gTa	p.E1313V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CTGCAGGCTGAAAAGTATGAA	0.393																																					p.E1313V	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.A3938T						.						76.0	76.0	76.0					1																	214815619		2203	4300	6503	SO:0001583	missense	1063	exon12			AGGCTGAAAAGTA	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3938A>T	1.37:g.214815619A>T	ENSP00000355922:p.Glu1313Val	204	0		169	81	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.694781	0.30052	.	.	ENSG00000117724	ENST00000366955	T	0.28255	1.62	4.77	3.61	0.41365	.	0.207947	0.24020	N	0.042296	T	0.51126	0.1656	.	.	.	0.34578	D	0.714136	D	0.89917	1.0	D	0.71414	0.973	T	0.63980	-0.6514	9	0.87932	D	0	.	9.1524	0.36971	0.9148:0.0:0.0852:0.0	.	1313	P49454	CENPF_HUMAN	V	1313	ENSP00000355922:E1313V	ENSP00000355922:E1313V	E	+	2	0	CENPF	212882242	1.000000	0.71417	0.077000	0.20336	0.052000	0.14988	5.178000	0.65037	0.631000	0.30412	0.418000	0.28097	GAA	.		0.393	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
WAPAL	23063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	88227091	88227091	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr10:88227091A>G	ENST00000298767.5	-	9	2787	c.2315T>C	c.(2314-2316)aTc>aCc	p.I772T	WAPAL_ENST00000372075.1_Missense_Mutation_p.I39T|WAPAL_ENST00000263070.7_Missense_Mutation_p.I39T	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	772	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.I772T(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						GAGCCTTCGGATTTTTTCTTT	0.368																																					p.I772T		.											.	WAPAL-91	1	Substitution - Missense(1)	lung(1)	c.T2315C						.						180.0	167.0	171.0					10																	88227091		2203	4300	6503	SO:0001583	missense	23063	exon9			CTTCGGATTTTTT	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2315T>C	10.37:g.88227091A>G	ENSP00000298767:p.Ile772Thr	151	0		114	59	NM_015045	0	0	4	8	4	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.484052	0.84854	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T	0.48201	0.82	5.99	5.99	0.97316	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.99;0.998;0.996	T	0.69537	-0.5119	10	0.72032	D	0.01	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	766;810;772;809	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	T	857;772;857;39;39	ENSP00000298767:I772T	ENSP00000263070:I39T	I	-	2	0	WAPAL	88217071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.336000	0.96533	2.291000	0.77112	0.533000	0.62120	ATC	.		0.368	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
MUC6	4588	bcgsc.ca	37	11	1016801	1016801	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr11:1016801G>C	ENST00000421673.2	-	31	6050	c.6000C>G	c.(5998-6000)caC>caG	p.H2000Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2000	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGTCTGAGGGTGTGATGGGG	0.542																																					p.H2000Q													.	MUC6-23	0			c.C6000G						.						1371.0	1357.0	1362.0					11																	1016801		2203	4297	6500	SO:0001583	missense	4588	exon31			CTGAGGGTGTGAT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6000C>G	11.37:g.1016801G>C	ENSP00000406861:p.His2000Gln	837	15		754	20	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	6.842	0.524518	0.13066	.	.	ENSG00000184956	ENST00000421673	T	0.17528	2.27	2.76	-5.51	0.02568	.	.	.	.	.	T	0.10337	0.0253	L	0.50333	1.59	0.09310	N	1	B	0.27625	0.183	B	0.21708	0.036	T	0.29610	-1.0006	9	0.27082	T	0.32	.	1.062	0.01603	0.2629:0.2888:0.3017:0.1467	.	2000	Q6W4X9	MUC6_HUMAN	Q	2000	ENSP00000406861:H2000Q	ENSP00000406861:H2000Q	H	-	3	2	MUC6	1006801	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.904000	0.04080	-1.588000	0.01627	0.306000	0.20318	CAC	.		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
LSP1	4046	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	1887915	1887915	+	Intron	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr11:1887915G>T	ENST00000311604.3	+	2	228				LSP1_ENST00000381775.1_Missense_Mutation_p.D71Y|AC051649.12_ENST00000509204.1_RNA|LSP1_ENST00000405957.2_5'Flank	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		TTTCCCAGGGGACGCTGCTGT	0.627																																					p.D71Y		.											.	LSP1-90	0			c.G211T						.																																			SO:0001627	intron_variant	4046	exon2			CCAGGGGACGCTG	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.54-13402G>T	11.37:g.1887915G>T		49	0		52	23	NM_001242932	0	0	0	0	0	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	37	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	g	7.536	0.659599	0.14645	.	.	ENSG00000130592	ENST00000381775	T	0.31247	1.5	1.4	-1.62	0.08372	.	.	.	.	.	T	0.19725	0.0474	.	.	.	0.09310	N	1	B	0.20459	0.045	B	0.12156	0.007	T	0.26710	-1.0095	8	0.87932	D	0	.	5.15	0.15005	0.3119:0.0:0.6881:0.0	.	71	E9PFP3	.	Y	71	ENSP00000371194:D71Y	ENSP00000371194:D71Y	D	+	1	0	LSP1	1844491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.255000	0.08769	-0.268000	0.09312	-0.602000	0.04101	GAC	.		0.627	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62301415	62301415	+	Silent	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr11:62301415C>T	ENST00000378024.4	-	5	748	c.474G>A	c.(472-474)acG>acA	p.T158T	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	158					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAGTGTAGGCCGTGACCCTTC	0.532																																					p.T158T		.											.	AHNAK-109	0			c.G474A						.						136.0	119.0	124.0					11																	62301415		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			GTAGGCCGTGACC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.474G>A	11.37:g.62301415C>T		48	0		32	19	NM_001620	0	0	12	23	11	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																			.		0.532	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
CAPN5	726	broad.mit.edu	37	11	76796027	76796027	+	Missense_Mutation	SNP	T	T	C	rs201256547		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr11:76796027T>C	ENST00000278559.3	+	2	284	c.95T>C	c.(94-96)tTc>tCc	p.F32S	CAPN5_ENST00000456580.2_Missense_Mutation_p.F32S|CAPN5_ENST00000531028.1_Missense_Mutation_p.F32S|CAPN5_ENST00000529629.1_Missense_Mutation_p.F32S	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	32	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GACCCCCTCTTCCCCGCCACT	0.637																																					p.F32S													.	CAPN5-90	0			c.T95C						.						32.0	36.0	35.0					11																	76796027		2200	4292	6492	SO:0001583	missense	726	exon2			CCCTCTTCCCCGC		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.95T>C	11.37:g.76796027T>C	ENSP00000278559:p.Phe32Ser	63	17		62	22	NM_004055	0	0	4	4	0	O00263	Missense_Mutation	SNP	ENST00000278559.3	37	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566902	0.65651	.	.	ENSG00000149260	ENST00000278559;ENST00000527066;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	D;D;D;T	0.92348	-3.02;-3.02;-3.02;0.52	5.18	5.18	0.71444	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	H	0.98866	4.355	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.98681	1.0692	10	0.87932	D	0	.	12.99	0.58614	0.0:0.0:0.0:1.0	.	70;32;72;32	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	S	32;32;72;32;32;32	ENSP00000278559:F32S;ENSP00000435894:F32S;ENSP00000432332:F32S;ENSP00000409996:F32S	ENSP00000278559:F32S	F	+	2	0	CAPN5	76473675	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	5.419000	0.66435	1.956000	0.56807	0.533000	0.62120	TTC	.		0.637	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
PIWIL4	143689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	94341805	94341805	+	Silent	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr11:94341805C>T	ENST00000299001.6	+	15	2107	c.1896C>T	c.(1894-1896)gaC>gaT	p.D632D	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	632	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCAGCAAGGACGTGATGGTTG	0.393																																					p.D632D		.											.	PIWIL4-91	0			c.C1896T						.						269.0	236.0	247.0					11																	94341805		2201	4298	6499	SO:0001819	synonymous_variant	143689	exon15			CAAGGACGTGATG	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1896C>T	11.37:g.94341805C>T		191	0		162	64	NM_152431	0	0	4	5	1	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Silent	SNP	ENST00000299001.6	37	CCDS31656.1																																																																																			.		0.393	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
FAM60A	58516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	31448170	31448170	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:31448170G>A	ENST00000337682.4	-	3	594	c.226C>T	c.(226-228)Cat>Tat	p.H76Y	FAM60A_ENST00000542983.1_5'UTR|FAM60A_ENST00000395766.1_5'UTR|FAM60A_ENST00000539409.1_Intron|FAM60A_ENST00000454658.2_Missense_Mutation_p.H76Y	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	76					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					GGACTAACATGATTCCAGTTT	0.373																																					p.H76Y		.											.	FAM60A-90	0			c.C226T						.						82.0	74.0	77.0					12																	31448170		2203	4300	6503	SO:0001583	missense	58516	exon4			TAACATGATTCCA	AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.226C>T	12.37:g.31448170G>A	ENSP00000337477:p.His76Tyr	440	0		439	248	NM_021238	0	0	0	0	0	D3DUV8|Q9BSZ8	Missense_Mutation	SNP	ENST00000337682.4	37	CCDS8723.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261331	0.80246	.	.	ENSG00000139146	ENST00000337682;ENST00000454658;ENST00000398170;ENST00000539004;ENST00000543615	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.80586	0.4651	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.989;0.999	D;D	0.76575	0.969;0.988	D	0.84590	0.0666	10	0.87932	D	0	-1.1171	17.1323	0.86729	0.0:0.0:1.0:0.0	.	76;117	Q9NP50;B7Z287	FA60A_HUMAN;.	Y	76;76;117;76;76	ENSP00000337477:H76Y;ENSP00000393279:H76Y;ENSP00000443881:H76Y;ENSP00000437363:H76Y	ENSP00000337477:H76Y	H	-	1	0	FAM60A	31339437	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.457000	0.97630	2.343000	0.79666	0.561000	0.74099	CAT	.		0.373	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400347.1	NM_021238	
FAM186A	121006	broad.mit.edu	37	12	50746116	50746116	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:50746116G>A	ENST00000327337.5	-	4	4498	c.4499C>T	c.(4498-4500)gCc>gTc	p.A1500V	FAM186A_ENST00000543111.1_Missense_Mutation_p.A1500V|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1500								p.A1500V(3)									CAGGGCCTGGGCCTGCTGAGG	0.662																																					p.A1500V	NSCLC(138;1796 1887 12511 19463 37884)												.	FAM186A-68	3	Substitution - Missense(3)	endometrium(3)	c.C4499T						.						3.0	3.0	3.0					12																	50746116		439	1017	1456	SO:0001583	missense	121006	exon4			GCCTGGGCCTGCT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4499C>T	12.37:g.50746116G>A	ENSP00000329995:p.Ala1500Val	135	0		181	7	NM_001145475	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	13.81	2.347937	0.41599	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.05025	3.51;3.51	4.45	2.54	0.30619	.	.	.	.	.	T	0.06735	0.0172	N	0.19112	0.55	0.09310	N	1	P;D	0.57571	0.756;0.98	P;P	0.51806	0.461;0.68	T	0.38607	-0.9653	9	0.25751	T	0.34	.	7.0527	0.25081	0.0955:0.0:0.7331:0.1714	.	1500;1500	F5GYN0;A6NE01	.;F186A_HUMAN	V	1500	ENSP00000441337:A1500V;ENSP00000329995:A1500V	ENSP00000329995:A1500V	A	-	2	0	FAM186A	49032383	0.000000	0.05858	0.012000	0.15200	0.003000	0.03518	-0.288000	0.08377	0.401000	0.25424	0.498000	0.49722	GCC	.		0.662	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A													.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	66	2		94	6	NM_001256282	0	1	1881	1882	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
METAP2	10988	broad.mit.edu	37	12	95867964	95867964	+	Silent	SNP	T	T	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:95867964T>G	ENST00000323666.5	+	1	238	c.9T>G	c.(7-9)ggT>ggG	p.G3G	METAP2_ENST00000551840.1_Silent_p.G3G|METAP2_ENST00000550777.1_Silent_p.G3G|METAP2_ENST00000546753.1_Silent_p.G3G|METAP2_ENST00000261220.9_Silent_p.G3G	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						ACATGGCGGGTGTGGAGGAGG	0.652																																					p.G3G													.	METAP2-90	0			c.T9G						.						34.0	42.0	39.0					12																	95867964		2203	4297	6500	SO:0001819	synonymous_variant	10988	exon1			GGCGGGTGTGGAG	U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.9T>G	12.37:g.95867964T>G		111	27		157	41	NM_006838	0	0	20	23	3		Silent	SNP	ENST00000323666.5	37	CCDS9052.1																																																																																			.		0.652	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408296.1	NM_006838	
KCTD10	83892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	109889450	109889450	+	Silent	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:109889450G>T	ENST00000228495.6	-	7	1173	c.892C>A	c.(892-894)Cgg>Agg	p.R298R	KCTD10_ENST00000540411.1_Silent_p.R272R|KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000540089.1_Silent_p.R117R|KCTD10_ENST00000424763.2_Silent_p.R117R	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	298					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						TGGATCCTCCGCACGCGCTCG	0.721																																					p.R298R		.											.	KCTD10-90	0			c.C892A						.						53.0	49.0	50.0					12																	109889450		2203	4300	6503	SO:0001819	synonymous_variant	83892	exon7			TCCTCCGCACGCG	BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.892C>A	12.37:g.109889450G>T		41	0		55	4	NM_031954	0	0	28	28	0	Q53HN2|Q59FV1|Q6PL47|Q96SU0	Silent	SNP	ENST00000228495.6	37	CCDS9128.1	.	.	.	.	.	.	.	.	.	.	G	9.426	1.084203	0.20309	.	.	ENSG00000110906	ENST00000538161	.	.	.	4.97	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.5015	11.8876	0.52610	0.0:0.0:0.6832:0.3168	.	.	.	.	X	263	.	.	C	-	3	2	KCTD10	108373833	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.414000	0.66405	1.407000	0.46875	0.655000	0.94253	TGC	.		0.721	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403099.1	NM_031954	
ELL3	80237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44067740	44067740	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr15:44067740C>T	ENST00000319359.3	-	5	1193	c.552G>A	c.(550-552)atG>atA	p.M184I	RP11-296A16.1_ENST00000417761.2_3'UTR|ELL3_ENST00000497465.1_5'Flank|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	184					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		CCCACTGTGCCATGTGCTCCC	0.498											OREG0023092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M184I		.											.	ELL3-91	0			c.G552A						.						154.0	133.0	140.0					15																	44067740		2198	4298	6496	SO:0001583	missense	80237	exon5			CTGTGCCATGTGC	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.552G>A	15.37:g.44067740C>T	ENSP00000320346:p.Met184Ile	91	0	921	60	8	NM_025165	0	0	9	9	0	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	ENST00000319359.3	37	CCDS10102.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299310	0.40694	.	.	ENSG00000128886	ENST00000319359	T	0.29397	1.57	5.75	2.65	0.31530	.	0.896720	0.09670	N	0.771265	T	0.23492	0.0568	L	0.47716	1.5	0.28997	N	0.887675	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.30707	-0.9969	10	0.19147	T	0.46	-31.8363	4.8606	0.13581	0.1517:0.6198:0.1467:0.0818	.	184;184;138	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	I	184	ENSP00000320346:M184I	ENSP00000320346:M184I	M	-	3	0	ELL3	41855032	0.017000	0.18338	0.948000	0.38648	0.979000	0.70002	-0.179000	0.09768	0.734000	0.32515	0.555000	0.69702	ATG	.		0.498	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133236.2	NM_025165	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77450971	77450971	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr15:77450971C>A	ENST00000560626.2	-	5	3680	c.3205G>T	c.(3205-3207)Gat>Tat	p.D1069Y	PEAK1_ENST00000312493.4_Missense_Mutation_p.D1069Y			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1069					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CCCCTGCCATCTTGCTTCCCA	0.473																																					p.D1069Y		.											.	.	0			c.G3205T						.						127.0	119.0	122.0					15																	77450971		1933	4139	6072	SO:0001583	missense	0	exon6			TGCCATCTTGCTT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.3205G>T	15.37:g.77450971C>A	ENSP00000452796:p.Asp1069Tyr	79	0		59	25	NM_024776	0	0	0	0	0	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826500	0.50739	.	.	ENSG00000173517	ENST00000312493	T	0.69685	-0.42	5.4	4.49	0.54785	.	0.667769	0.14142	N	0.338611	T	0.52092	0.1713	N	0.14661	0.345	0.28725	N	0.902826	P	0.44090	0.826	B	0.41723	0.365	T	0.50717	-0.8795	10	0.59425	D	0.04	-3.0393	12.2917	0.54823	0.0:0.9219:0.0:0.0781	.	1069	Q9H792	PEAK1_HUMAN	Y	1069	ENSP00000309230:D1069Y	ENSP00000309230:D1069Y	D	-	1	0	AC087465.1	75238026	1.000000	0.71417	0.993000	0.49108	0.748000	0.42578	4.715000	0.61909	1.275000	0.44379	0.563000	0.77884	GAT	.		0.473	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3860637	3860637	+	Silent	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr16:3860637G>A	ENST00000262367.5	-	3	1751	c.942C>T	c.(940-942)atC>atT	p.I314I	CREBBP_ENST00000382070.3_Silent_p.I314I	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	314	Interaction with SRCAP.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AAGTATTCTTGATATCTGTAG	0.517			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.I314I		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.C942T						.						212.0	196.0	201.0					16																	3860637		2197	4300	6497	SO:0001819	synonymous_variant	1387	exon3			ATTCTTGATATCT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.942C>T	16.37:g.3860637G>A		93	0		108	36	NM_001079846	0	0	5	5	0	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			.		0.517	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
ABCC1	4363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	16180696	16180696	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr16:16180696G>A	ENST00000399410.3	+	18	2483	c.2308G>A	c.(2308-2310)Ggg>Agg	p.G770R	ABCC1_ENST00000346370.5_Intron|ABCC1_ENST00000351154.5_Missense_Mutation_p.G711R|ABCC1_ENST00000345148.5_Missense_Mutation_p.G770R|ABCC1_ENST00000399408.2_Missense_Mutation_p.G770R|ABCC1_ENST00000349029.5_Intron	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	770	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GAACCTGTCTGGGGGCCAGAA	0.587																																					p.G770R		.											.	ABCC1-94	0			c.G2308A						.						60.0	71.0	68.0					16																	16180696		2181	4293	6474	SO:0001583	missense	4363	exon18			CTGTCTGGGGGCC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2308G>A	16.37:g.16180696G>A	ENSP00000382342:p.Gly770Arg	47	0		35	5	NM_004996	0	0	5	8	3	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	33	5.195409	0.94960	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000351154;ENST00000345148;ENST00000536381	D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64	5.38	5.38	0.77491	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	H	0.99182	4.46	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.993;0.978;1.0;1.0	D	0.99712	1.1007	10	0.87932	D	0	-31.1556	18.1249	0.89583	0.0:0.0:1.0:0.0	.	770;711;770;770	P33527-4;P33527-2;P33527;P33527-9	.;.;MRP1_HUMAN;.	R	770;770;711;770;444	ENSP00000382342:G770R;ENSP00000382340:G770R;ENSP00000263017:G711R;ENSP00000263014:G770R	ENSP00000263014:G770R	G	+	1	0	ABCC1	16088197	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	9.697000	0.98697	2.520000	0.84964	0.563000	0.77884	GGG	.		0.587	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24788620	24788620	+	Missense_Mutation	SNP	C	C	G	rs201630200		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr16:24788620C>G	ENST00000395799.3	+	5	659	c.530C>G	c.(529-531)gCt>gGt	p.A177G	TNRC6A_ENST00000315183.7_Missense_Mutation_p.A177G	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	177	Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GAAAGCAGTGCTTTAACAAAT	0.433																																					p.A177G		.											.	TNRC6A-92	0			c.C530G						.						137.0	141.0	140.0					16																	24788620		2064	4235	6299	SO:0001583	missense	27327	exon5			GCAGTGCTTTAAC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.530C>G	16.37:g.24788620C>G	ENSP00000379144:p.Ala177Gly	57	0		59	24	NM_014494	0	0	3	8	5	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446741	0.43429	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12774	2.65;2.65	5.72	4.72	0.59763	.	0.361735	0.29783	N	0.011217	T	0.11110	0.0271	N	0.19112	0.55	0.80722	D	1	B	0.20261	0.043	B	0.19946	0.027	T	0.17228	-1.0376	10	0.26408	T	0.33	-7.991	18.3586	0.90367	0.0:0.8717:0.1283:0.0	.	177	Q8NDV7	TNR6A_HUMAN	G	177	ENSP00000326900:A177G;ENSP00000379144:A177G	ENSP00000326900:A177G	A	+	2	0	TNRC6A	24696121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.054000	0.49908	2.687000	0.91594	0.591000	0.81541	GCT	.		0.433	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
COG4	25839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	70548271	70548271	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr16:70548271A>T	ENST00000323786.5	-	4	532	c.511T>A	c.(511-513)Tcg>Acg	p.S171T	COG4_ENST00000393612.4_Missense_Mutation_p.S167T|COG4_ENST00000564653.1_Missense_Mutation_p.S171T	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	167					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				tcaatgaccgACTTGTCCAGG	0.468																																					p.S171T		.											.	COG4-90	0			c.T511A						.						89.0	75.0	80.0					16																	70548271		2198	4300	6498	SO:0001583	missense	25839	exon4			TGACCGACTTGTC	AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.511T>A	16.37:g.70548271A>T	ENSP00000315775:p.Ser171Thr	94	0		44	14	NM_015386	0	0	12	24	12	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	ENST00000323786.5	37	CCDS10892.2	.	.	.	.	.	.	.	.	.	.	A	22.6	4.316795	0.81469	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000393612;ENST00000534772	T;T;T	0.46819	0.86;0.86;1.12	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	L	0.41961	1.31	0.80722	D	1	B;B	0.24368	0.057;0.102	B;B	0.20955	0.032;0.018	T	0.20706	-1.0267	10	0.25751	T	0.34	-5.8107	15.6224	0.76816	1.0:0.0:0.0:0.0	.	166;167	Q6PIW8;Q9H9E3	.;COG4_HUMAN	T	171;167;167;94	ENSP00000315775:S171T;ENSP00000377236:S167T;ENSP00000461912:S94T	ENSP00000315775:S171T	S	-	1	0	COG4	69105772	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.758000	0.91663	2.093000	0.63338	0.459000	0.35465	TCG	.		0.468	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250326.3		
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26943696	26943696	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr17:26943696G>C	ENST00000528896.2	-	35	6171	c.6097C>G	c.(6097-6099)Cga>Gga	p.R2033G	KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1890G|SPAG5-AS1_ENST00000414744.1_RNA|SGK494_ENST00000469832.3_5'Flank|KIAA0100_ENST00000579924.2_5'UTR|SPAG5-AS1_ENST00000424210.1_RNA|RP11-192H23.4_ENST00000577790.1_5'Flank|RP11-192H23.4_ENST00000534850.1_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1890G|SPAG5-AS1_ENST00000554154.1_RNA|SGK494_ENST00000301037.5_5'Flank	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	2033						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCCACACTTCGGCCAGGAAAG	0.448																																					p.R2033G		.											.	KIAA0100-93	0			c.C6097G						.						118.0	121.0	120.0					17																	26943696		2203	4300	6503	SO:0001583	missense	9703	exon35			CACTTCGGCCAGG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.6097C>G	17.37:g.26943696G>C	ENSP00000436773:p.Arg2033Gly	117	0		140	85	NM_014680	0	0	29	69	40	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483328	0.63962	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.46819	0.86;0.86	5.87	5.87	0.94306	FMP27,  C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67205	-0.5729	10	0.39692	T	0.17	.	20.1947	0.98239	0.0:0.0:1.0:0.0	.	2033	Q14667	K0100_HUMAN	G	2033;2003;2033;1890	ENSP00000436773:R2033G;ENSP00000446443:R1890G	ENSP00000005905:R2033G	R	-	1	2	KIAA0100	23967823	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.682000	0.54656	2.780000	0.95670	0.561000	0.74099	CGA	.		0.448	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
HOXB4	3214	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	46654346	46654346	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr17:46654346G>T	ENST00000332503.5	-	2	2285	c.494C>A	c.(493-495)tCt>tAt	p.S165Y	HOXB3_ENST00000490677.1_5'Flank|HOXB3_ENST00000472863.1_Intron|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000311626.4_5'Flank|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000485909.2_5'Flank	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	165					anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						GGCGGTCCGAGAGCGCTTGGG	0.592																																					p.S165Y		.											.	HOXB4-515	0			c.C494A						.						53.0	58.0	56.0					17																	46654346		2203	4300	6503	SO:0001583	missense	3214	exon2			GTCCGAGAGCGCT		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.494C>A	17.37:g.46654346G>T	ENSP00000328928:p.Ser165Tyr	44	0		101	57	NM_024015	0	0	5	16	11	Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	CCDS11529.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923509	0.92319	.	.	ENSG00000182742	ENST00000332503	D	0.96365	-3.99	5.27	5.27	0.74061	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96836	0.8967	L	0.33710	1.025	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97955	1.0334	10	0.87932	D	0	.	18.4966	0.90867	0.0:0.0:1.0:0.0	.	165	P17483	HXB4_HUMAN	Y	165	ENSP00000328928:S165Y	ENSP00000328928:S165Y	S	-	2	0	HOXB4	44009345	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.842000	0.99487	2.456000	0.83038	0.561000	0.74099	TCT	.		0.592	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2		
NOG	9241	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	54672182	54672182	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr17:54672182C>G	ENST00000332822.4	+	1	1123	c.598C>G	c.(598-600)Ctc>Gtc	p.L200V		NM_005450.4	NP_005441.1	Q13253	NOGG_HUMAN	noggin	200					axial mesoderm development (GO:0048318)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal system development (GO:0048706)|endoderm formation (GO:0001706)|epithelial to mesenchymal transition (GO:0001837)|face morphogenesis (GO:0060325)|fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060825)|in utero embryonic development (GO:0001701)|limb development (GO:0060173)|lung morphogenesis (GO:0060425)|mesoderm formation (GO:0001707)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine activity (GO:0060302)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glomerulus development (GO:0090193)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostatic bud formation (GO:0060513)|regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000313)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|somite development (GO:0061053)|spinal cord development (GO:0021510)|ureteric bud formation (GO:0060676)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)			ovary(1)	1	Breast(9;5.24e-08)					GTCCGTGCACCTCACGGTGCT	0.657																																					p.L200V													.	NOG-90	0			c.C598G						.						27.0	27.0	27.0					17																	54672182		2203	4298	6501	SO:0001583	missense	9241	exon1			GTGCACCTCACGG	U31202	CCDS11589.1	17q22	2006-04-25	2003-03-12		ENSG00000183691	ENSG00000183691			7866	protein-coding gene	gene with protein product		602991	"""synostoses (multiple) syndrome 1"", ""symphalangism 1 (proximal)"""	SYNS1, SYM1		7666191, 10080184, 11545688	Standard	NM_005450		Approved		uc002iup.2	Q13253	OTTHUMG00000151770	ENST00000332822.4:c.598C>G	17.37:g.54672182C>G	ENSP00000328181:p.Leu200Val	129	1		177	105	NM_005450	0	0	0	1	1		Missense_Mutation	SNP	ENST00000332822.4	37	CCDS11589.1	.	.	.	.	.	.	.	.	.	.	C	7.750	0.703154	0.15172	.	.	ENSG00000183691	ENST00000332822	D	0.98207	-4.79	4.85	4.85	0.62838	.	0.163070	0.39146	N	0.001455	D	0.96904	0.8989	L	0.39898	1.24	0.51012	D	0.999903	D	0.56035	0.974	P	0.59703	0.862	D	0.94063	0.7328	10	0.08179	T	0.78	-8.1502	8.5633	0.33525	0.0:0.8257:0.0:0.1743	.	200	Q13253	NOGG_HUMAN	V	200	ENSP00000328181:L200V	ENSP00000328181:L200V	L	+	1	0	NOG	52027181	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.537000	0.23144	2.532000	0.85374	0.561000	0.74099	CTC	.		0.657	NOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323857.1	NM_005450	
KIAA0195	9772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73487468	73487468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr17:73487468G>T	ENST00000314256.7	+	13	1712	c.1318G>T	c.(1318-1320)Gag>Tag	p.E440*	KIAA0195_ENST00000375248.5_Nonsense_Mutation_p.E450*|KIAA0195_ENST00000579208.1_Nonsense_Mutation_p.E91*	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	440						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGGAAGGTGGAGCCCCCTCA	0.602																																					p.E440X		.											.	KIAA0195-91	0			c.G1318T						.						102.0	89.0	93.0					17																	73487468		2203	4300	6503	SO:0001587	stop_gained	9772	exon13			AAGGTGGAGCCCC		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1318G>T	17.37:g.73487468G>T	ENSP00000313885:p.Glu440*	61	0		74	22	NM_014738	0	0	25	27	2	O75536|Q86XF1	Nonsense_Mutation	SNP	ENST00000314256.7	37	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	G	31	5.089916	0.94149	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	.	.	.	5.84	4.86	0.63082	.	0.100124	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-25.239	16.9369	0.86205	0.0:0.1279:0.8721:0.0	.	.	.	.	X	440;450	.	ENSP00000313885:E440X	E	+	1	0	KIAA0195	70999063	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.741000	0.98843	1.465000	0.48006	0.591000	0.81541	GAG	.		0.602	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	
SS18	6760	ucsc.edu	37	18	23658090	23658090	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr18:23658090G>T	ENST00000415083.2	-	3	236	c.181C>A	c.(181-183)Ctt>Att	p.L61I	SS18_ENST00000545952.1_Missense_Mutation_p.L9I|SS18_ENST00000542743.1_Missense_Mutation_p.L9I|SS18_ENST00000542420.2_Missense_Mutation_p.L38I|SS18_ENST00000539849.1_Intron|SS18_ENST00000585241.1_5'UTR|SS18_ENST00000269137.7_Missense_Mutation_p.L61I	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	61	Transcriptional activation.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)		SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					ATTGTAGCAAGGTATACCAAG	0.303			T	"""SSX1,  SSX2"""	synovial sarcoma																																p.L61I				Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	.	SS18-1968	0			c.C181A						.						139.0	132.0	134.0					18																	23658090		2203	4298	6501	SO:0001583	missense	6760	exon3			TAGCAAGGTATAC	X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.181C>A	18.37:g.23658090G>T	ENSP00000414516:p.Leu61Ile	65	0		42	4	NM_001007559	0	0	15	15	0	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Missense_Mutation	SNP	ENST00000415083.2	37	CCDS32807.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.197652	0.38806	.	.	ENSG00000141380	ENST00000415083;ENST00000269138;ENST00000269137;ENST00000542420;ENST00000542743;ENST00000545952	T;T;T;T	0.76060	-0.99;-0.89;0.36;0.36	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.88175	0.6366	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.91635	0.987;0.992;0.999	D	0.89906	0.4048	10	0.87932	D	0	-10.1651	12.1087	0.53827	0.0791:0.0:0.9209:0.0	.	9;61;61	B4E2J6;Q4VAX0;Q15532	.;.;SSXT_HUMAN	I	64;61;61;38;9;9	ENSP00000269137:L61I;ENSP00000438066:L38I;ENSP00000444551:L9I;ENSP00000443097:L9I	ENSP00000269137:L61I	L	-	1	0	SS18	21912088	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.519000	0.53458	2.716000	0.92895	0.655000	0.94253	CTT	.		0.303	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446226.1		
ACER1	125981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6307219	6307219	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:6307219G>T	ENST00000301452.4	-	5	648	c.571C>A	c.(571-573)Cgt>Agt	p.R191S		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	191					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						CAAAGCAGACGGTCACTGATC	0.542																																					p.R191S		.											.	ACER1-90	0			c.C571A						.						89.0	86.0	87.0					19																	6307219		2203	4300	6503	SO:0001583	missense	125981	exon5			GCAGACGGTCACT	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.571C>A	19.37:g.6307219G>T	ENSP00000301452:p.Arg191Ser	49	0		34	9	NM_133492	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301452.4	37	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037897	0.75617	.	.	ENSG00000167769	ENST00000301452	T	0.47177	0.85	5.58	3.34	0.38264	.	0.000000	0.85682	D	0.000000	T	0.68668	0.3026	M	0.87900	2.915	0.80722	D	1	D	0.71674	0.998	D	0.63703	0.917	T	0.75932	-0.3143	10	0.87932	D	0	-21.1368	12.8258	0.57718	0.0:0.0:0.7048:0.2952	.	191	Q8TDN7	ACER1_HUMAN	S	191	ENSP00000301452:R191S	ENSP00000301452:R191S	R	-	1	0	ACER1	6258219	1.000000	0.71417	0.923000	0.36655	0.707000	0.40811	3.467000	0.53078	1.347000	0.45714	0.561000	0.74099	CGT	.		0.542	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1	NM_133492	
CAPN12	147968	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39226808	39226808	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:39226808C>T	ENST00000328867.4	-	12	1833	c.1525G>A	c.(1525-1527)Gcc>Acc	p.A509T	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Missense_Mutation_p.A360T	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	509	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TCGTCGCCGGCGTGGGCGGTG	0.731																																					p.A509T		.											.	CAPN12-91	0			c.G1525A						.						5.0	7.0	6.0					19																	39226808		1560	2860	4420	SO:0001583	missense	147968	exon12			CGCCGGCGTGGGC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1525G>A	19.37:g.39226808C>T	ENSP00000331636:p.Ala509Thr	20	0		17	8	NM_144691	0	0	5	7	2		Missense_Mutation	SNP	ENST00000328867.4	37	CCDS12519.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434611	0.43224	.	.	ENSG00000182472	ENST00000328867	D	0.87256	-2.23	3.72	2.48	0.30137	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.544531	0.18591	N	0.136731	T	0.80909	0.4714	L	0.55990	1.75	0.22266	N	0.999247	B	0.19331	0.035	B	0.12156	0.007	T	0.72204	-0.4361	10	0.87932	D	0	.	3.9299	0.09279	0.0:0.5899:0.2287:0.1814	.	509	Q6ZSI9	CAN12_HUMAN	T	509	ENSP00000331636:A509T	ENSP00000331636:A509T	A	-	1	0	CAPN12	43918648	0.987000	0.35691	0.077000	0.20336	0.396000	0.30629	2.272000	0.43373	0.658000	0.30925	0.484000	0.47621	GCC	.		0.731	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42795850	42795850	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:42795850C>T	ENST00000575354.2	+	11	2879	c.2839C>T	c.(2839-2841)Ccg>Tcg	p.P947S	CIC_ENST00000572681.2_Missense_Mutation_p.P1856S|CIC_ENST00000160740.3_Missense_Mutation_p.P947S	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	947	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				ACTGGTGAGCCCGCCCTTCTC	0.662			"""Mis, F, S"""		oligodendroglioma																																p.P947S		.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC-591	0			c.C2839T						.						46.0	52.0	50.0					19																	42795850		2048	4111	6159	SO:0001583	missense	23152	exon11			GTGAGCCCGCCCT	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2839C>T	19.37:g.42795850C>T	ENSP00000458663:p.Pro947Ser	69	0		88	32	NM_015125	0	0	21	39	18	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	C	9.524	1.109082	0.20714	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.32	3.28	0.37604	.	.	.	.	.	T	0.44138	0.1279	L	0.29908	0.895	0.35299	D	0.782869	B	0.13145	0.007	B	0.12156	0.007	T	0.52200	-0.8607	8	0.87932	D	0	-7.0964	9.1066	0.36701	0.0:0.8892:0.0:0.1108	.	947	Q96RK0	CIC_HUMAN	S	947	.	ENSP00000160740:P947S	P	+	1	0	CIC	47487690	1.000000	0.71417	0.980000	0.43619	0.928000	0.56348	3.631000	0.54280	1.014000	0.39417	0.462000	0.41574	CCG	.		0.662	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
TMEM145	284339	broad.mit.edu	37	19	42819592	42819592	+	Splice_Site	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:42819592G>T	ENST00000301204.3	+	8	687	c.646G>T	c.(646-648)Gtc>Ttc	p.V216F	TMEM145_ENST00000598766.1_Splice_Site_p.V240F	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	216					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				Aggagtagagggtgaggttcc	0.537																																					p.V216F													.	TMEM145-90	0			c.G646T						.						96.0	90.0	92.0					19																	42819592		2203	4300	6503	SO:0001630	splice_region_variant	284339	exon8			GTAGAGGGTGAGG	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.646+1G>T	19.37:g.42819592G>T		72	0		57	3	NM_173633	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301204.3	37	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997506	0.54147	.	.	ENSG00000167619	ENST00000301204	T	0.41758	0.99	3.93	3.93	0.45458	Rhodopsin-like GPCR transmembrane domain (1);	0.000000	0.64402	D	0.000009	T	0.44030	0.1274	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	D	0.67382	0.951	T	0.33904	-0.9850	10	0.05436	T	0.98	-29.9471	11.8194	0.52230	0.0:0.0:1.0:0.0	.	216	Q8NBT3	TM145_HUMAN	F	216	ENSP00000301204:V216F	ENSP00000301204:V216F	V	+	1	0	TMEM145	47511432	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.047000	0.76599	1.926000	0.55796	0.455000	0.32223	GTC	.		0.537	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633	Missense_Mutation
ZNF814	730051	bcgsc.ca	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																					p.Y324H													.	.	0			c.T970C						.						15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	730051	exon3			ATTCATAAGGTCT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His	103	0		78	6	NM_001144989	0	0	1	1	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT	.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
SLC3A1	6519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44539791	44539791	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr2:44539791A>G	ENST00000260649.6	+	8	1475	c.1399A>G	c.(1399-1401)Atg>Gtg	p.M467V	SLC3A1_ENST00000409380.1_Missense_Mutation_p.M189V|SLC3A1_ENST00000409740.3_Missense_Mutation_p.M98V|SLC3A1_ENST00000409387.1_Missense_Mutation_p.M467V|SLC3A1_ENST00000409741.1_Missense_Mutation_p.M467V|SLC3A1_ENST00000409229.3_Missense_Mutation_p.M467V|SLC3A1_ENST00000409294.1_Missense_Mutation_p.M87V	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	467			M -> K (in CSNU). {ECO:0000269|PubMed:8054986}.|M -> T (in CSNU; loss of 80% of amino acid transport activity). {ECO:0000269|PubMed:11748844, ECO:0000269|PubMed:12234283, ECO:0000269|PubMed:8054986, ECO:0000269|PubMed:9186880}.		amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	CGTGATGAACATGCTTCTTTT	0.408																																					p.M467V		.											.	SLC3A1-90	0			c.A1399G						.						141.0	128.0	132.0					2																	44539791		2203	4300	6503	SO:0001583	missense	6519	exon8			ATGAACATGCTTC		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1399A>G	2.37:g.44539791A>G	ENSP00000260649:p.Met467Val	147	0		121	45	NM_000341	1	0	213	422	208	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	ENST00000260649.6	37	CCDS1819.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.955494	0.53293	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000409741;ENST00000409229;ENST00000541289;ENST00000409380;ENST00000409294;ENST00000409740	D;D;D;D;D;D;D	0.99454	-5.92;-5.92;-5.92;-5.92;-5.92;-5.92;-5.92	5.82	4.64	0.57946	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.036710	0.85682	D	0.000000	D	0.98710	0.9567	L	0.52364	1.645	0.58432	D	0.999999	B;B;P;P	0.44776	0.387;0.374;0.843;0.716	B;B;P;P	0.48815	0.194;0.194;0.591;0.511	D	0.97965	1.0340	10	0.51188	T	0.08	-23.3976	13.0393	0.58889	0.8655:0.1345:0.0:0.0	.	467;467;467;467	Q07837;B8ZZK1;Q4J6B5;Q4J6B6	SLC31_HUMAN;.;.;.	V	467;467;403;467;467;467;189;87;98	ENSP00000260649:M467V;ENSP00000387308:M467V;ENSP00000386954:M467V;ENSP00000386620:M467V;ENSP00000386709:M189V;ENSP00000386852:M87V;ENSP00000386677:M98V	ENSP00000260649:M467V	M	+	1	0	SLC3A1	44393295	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	5.273000	0.65564	0.987000	0.38709	0.477000	0.44152	ATG	.		0.408	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341	
TM9SF4	9777	broad.mit.edu	37	20	30729306	30729306	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr20:30729306T>G	ENST00000398022.2	+	4	471	c.236T>G	c.(235-237)gTg>gGg	p.V79G	TM9SF4_ENST00000217315.5_Missense_Mutation_p.V62G	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	79						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GCAGGAGAGGTGCTGAGAGGG	0.547																																					p.V79G													.	TM9SF4-514	0			c.T236G						.						65.0	65.0	65.0					20																	30729306		2203	4300	6503	SO:0001583	missense	9777	exon4			GAGAGGTGCTGAG	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.236T>G	20.37:g.30729306T>G	ENSP00000381104:p.Val79Gly	51	14		81	27	NM_014742	0	0	0	0	0	B0QYT7|Q9NUA3	Missense_Mutation	SNP	ENST00000398022.2	37	CCDS13196.2	.	.	.	.	.	.	.	.	.	.	.	26.8	4.776936	0.90195	.	.	ENSG00000101337	ENST00000398022;ENST00000217315	T;T	0.57107	0.42;0.42	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86868	0.2034	10	0.87932	D	0	-17.8441	15.8887	0.79273	0.0:0.0:0.0:1.0	.	79	Q92544	TM9S4_HUMAN	G	79;62	ENSP00000381104:V79G;ENSP00000217315:V62G	ENSP00000217315:V62G	V	+	2	0	TM9SF4	30192967	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.490000	0.81461	2.154000	0.67381	0.460000	0.39030	GTG	.		0.547	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
ARFGEF2	10564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47587774	47587774	+	Silent	SNP	C	C	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr20:47587774C>G	ENST00000371917.4	+	10	1308	c.1308C>G	c.(1306-1308)ctC>ctG	p.L436L		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	436					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGCAATATCTCTGTGTGGCCT	0.458																																					p.L436L	Esophageal Squamous(176;1738 1974 26285 33069 35354)	.											.	ARFGEF2-358	0			c.C1308G						.						213.0	185.0	195.0					20																	47587774		2203	4300	6503	SO:0001819	synonymous_variant	10564	exon10			ATATCTCTGTGTG	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1308C>G	20.37:g.47587774C>G		98	0		115	47	NM_006420	0	0	2	3	1	Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	37	CCDS13411.1																																																																																			.		0.458	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22710734	22710734	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr21:22710734A>C	ENST00000400546.1	+	8	1173	c.924A>C	c.(922-924)aaA>aaC	p.K308N	NCAM2_ENST00000284894.7_Missense_Mutation_p.K166N|NCAM2_ENST00000535285.1_Missense_Mutation_p.K333N	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	308	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TACAGCTTAAAAATGAAACTA	0.388																																					p.K308N		.											.	NCAM2-94	0			c.A924C						.						59.0	58.0	59.0					21																	22710734		1859	4085	5944	SO:0001583	missense	4685	exon8			GCTTAAAAATGAA		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.924A>C	21.37:g.22710734A>C	ENSP00000383392:p.Lys308Asn	188	0		148	61	NM_004540	0	0	0	0	0	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.936147	0.52972	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.69685	-0.42;-0.42;-0.42	5.8	3.37	0.38596	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.276736	0.45867	D	0.000323	T	0.67382	0.2887	L	0.39245	1.2	0.53688	D	0.999977	D;P;P	0.55800	0.973;0.776;0.618	P;P;B	0.56474	0.799;0.558;0.374	T	0.64761	-0.6331	10	0.49607	T	0.09	-16.2371	9.6438	0.39855	0.8549:0.0:0.1451:0.0	.	333;166;308	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	N	308;166;333	ENSP00000383392:K308N;ENSP00000284894:K166N;ENSP00000441887:K333N	ENSP00000284894:K166N	K	+	3	2	NCAM2	21632605	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	2.518000	0.45537	0.426000	0.26116	0.482000	0.46254	AAA	.		0.388	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
DCBLD2	131566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	98600601	98600601	+	Silent	SNP	A	A	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr3:98600601A>G	ENST00000326840.6	-	2	578	c.216T>C	c.(214-216)tgT>tgC	p.C72C	DCBLD2_ENST00000326857.9_Silent_p.C72C|DCBLD2_ENST00000469648.1_Intron	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	72	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CAGTGTGTCCACATCCATCAC	0.363																																					p.C72C		.											.	DCBLD2-92	0			c.T216C						.						127.0	119.0	121.0					3																	98600601		1874	4109	5983	SO:0001819	synonymous_variant	131566	exon2			GTGTCCACATCCA		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.216T>C	3.37:g.98600601A>G		186	0		144	51	NM_080927	0	0	0	0	0	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	ENST00000326840.6	37	CCDS46878.1																																																																																			.		0.363	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927	
EXOSC9	5393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	122722615	122722615	+	Silent	SNP	C	C	T	rs150604288		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr4:122722615C>T	ENST00000243498.5	+	1	144	c.36C>T	c.(34-36)cgC>cgT	p.R12R	EXOSC9_ENST00000379663.3_Silent_p.R12R|EXOSC9_ENST00000512454.1_5'Flank|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	12	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						GCGAACGCCGCTTCCTACTCC	0.582																																					p.R12R		.											.	EXOSC9-90	0			c.C36T						.						84.0	82.0	83.0					4																	122722615		2203	4300	6503	SO:0001819	synonymous_variant	5393	exon1			ACGCCGCTTCCTA	M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.36C>T	4.37:g.122722615C>T		117	0		112	51	NM_001034194	0	0	6	11	5	Q12883|Q4W5P5|Q86Y41|Q86Y48	Silent	SNP	ENST00000243498.5	37	CCDS3722.2																																																																																			C|1.000;G|0.000		0.582	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	73207182	73207182	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr5:73207182A>T	ENST00000426542.2	+	34	4750	c.4730A>T	c.(4729-4731)aAc>aTc	p.N1577I	ARHGEF28_ENST00000287898.5_Missense_Mutation_p.N1533I|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.N1577I|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.N1577I|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.N1577I|ARHGEF28_ENST00000512883.1_Missense_Mutation_p.N497I|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.N1577I|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.N1264I			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1577	Interaction with microtubules. {ECO:0000250}.|Mediates cytoplasmic retention and interaction with MAPK8IP1. {ECO:0000250}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										ATGTCATTTAACACTTTCAAC	0.363																																					p.N1577I		.											.	.	0			c.A4730T						.						76.0	70.0	72.0					5																	73207182		1930	4126	6056	SO:0001583	missense	64283	exon35			CATTTAACACTTT		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.4730A>T	5.37:g.73207182A>T	ENSP00000412175:p.Asn1577Ile	166	0		132	45	NM_001080479	0	0	12	26	14	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.793921	0.50102	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T;T	0.36157	2.92;2.93;2.88;2.62;2.93;2.88;2.72;1.27	5.3	5.3	0.74995	.	0.000000	0.35349	U	0.003279	T	0.53481	0.1799	M	0.69823	2.125	0.32983	D	0.52386	P;P;P;D;P	0.62365	0.692;0.916;0.951;0.991;0.95	B;P;P;D;P	0.64042	0.232;0.604;0.626;0.921;0.65	T	0.68356	-0.5430	10	0.87932	D	0	.	8.6768	0.34185	0.9063:0.0:0.0937:0.0	.	1264;1577;1577;497;1577	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	I	1577;1577;1577;1533;1577;1577;1264;497	ENSP00000296794:N1577I;ENSP00000441913:N1577I;ENSP00000441436:N1577I;ENSP00000287898:N1533I;ENSP00000411459:N1577I;ENSP00000412175:N1577I;ENSP00000296799:N1264I;ENSP00000421081:N497I	ENSP00000287898:N1533I	N	+	2	0	RP11-428C6.1	73242938	0.998000	0.40836	0.986000	0.45419	0.532000	0.34746	3.430000	0.52807	2.006000	0.58801	0.443000	0.29094	AAC	.		0.363	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179201053	179201053	+	Silent	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr5:179201053G>A	ENST00000292599.3	+	5	2489	c.2226G>A	c.(2224-2226)gtG>gtA	p.V742V	MAML1_ENST00000503050.1_Intron	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCGGGGTGTGGCTCAGTTCC	0.592																																					p.V742V		.											.	MAML1-848	0			c.G2226A						.						54.0	55.0	55.0					5																	179201053		2203	4300	6503	SO:0001819	synonymous_variant	9794	exon5			GGGTGTGGCTCAG	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.2226G>A	5.37:g.179201053G>A		50	0		43	17	NM_014757	0	0	1	5	4		Silent	SNP	ENST00000292599.3	37	CCDS34315.1																																																																																			.		0.592	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	7584156	7584156	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr6:7584156G>C	ENST00000379802.3	+	24	7002	c.6661G>C	c.(6661-6663)Gag>Cag	p.E2221Q	DSP_ENST00000418664.2_Missense_Mutation_p.E1622Q	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2221	Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GACCGTCACTGAGCTAGTAGA	0.458																																					p.E2221Q		.											.	DSP-518	0			c.G6661C						.						119.0	109.0	112.0					6																	7584156		2203	4300	6503	SO:0001583	missense	1832	exon24			GTCACTGAGCTAG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6661G>C	6.37:g.7584156G>C	ENSP00000369129:p.Glu2221Gln	69	0		54	19	NM_004415	0	0	20	46	26	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015584	0.54468	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.70399	-0.48;-0.48	5.62	5.62	0.85841	.	0.098059	0.45361	D	0.000376	T	0.74114	0.3674	L	0.48877	1.53	0.36056	D	0.841104	P;D	0.76494	0.526;0.999	B;P	0.60886	0.141;0.88	T	0.72440	-0.4293	10	0.41790	T	0.15	.	20.0281	0.97530	0.0:0.0:1.0:0.0	.	1669;2221	Q4LE79;P15924	.;DESP_HUMAN	Q	2221;1622	ENSP00000369129:E2221Q;ENSP00000396591:E1622Q	ENSP00000369129:E2221Q	E	+	1	0	DSP	7529155	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	6.483000	0.73617	2.818000	0.97014	0.655000	0.94253	GAG	.		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
ZP3	7784	ucsc.edu	37	7	76069823	76069823	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr7:76069823T>A	ENST00000394857.3	+	7	1013	c.955T>A	c.(955-957)Tgt>Agt	p.C319S	ZP3_ENST00000336517.4_Missense_Mutation_p.C268S|ZP3_ENST00000416245.1_Missense_Mutation_p.C143S|ZP3_ENST00000467555.1_3'UTR	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	319					binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						GGCTGACATCTGTCAATGCTG	0.512																																					p.C319S													.	ZP3-90	0			c.T955A						.						91.0	97.0	95.0					7																	76069823		2203	4300	6503	SO:0001583	missense	7784	exon7			GACATCTGTCAAT	M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.955T>A	7.37:g.76069823T>A	ENSP00000378326:p.Cys319Ser	218	16		347	39	NM_001110354	0	0	3	3	0	Q06633|Q29RW0	Missense_Mutation	SNP	ENST00000394857.3	37	CCDS47618.1	.	.	.	.	.	.	.	.	.	.	t	15.09	2.731094	0.48939	.	.	ENSG00000188372	ENST00000336517;ENST00000394857;ENST00000544121;ENST00000416245	T;T;T	0.78924	-0.62;-0.63;-1.22	4.96	4.96	0.65561	.	0.000000	0.85682	U	0.000000	D	0.88403	0.6427	M	0.86864	2.845	0.50467	D	0.999878	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89966	0.4090	10	0.87932	D	0	-14.8704	11.3228	0.49433	0.0:0.0:0.0:1.0	.	268;319	P21754-3;P21754	.;ZP3_HUMAN	S	268;319;319;143	ENSP00000337310:C268S;ENSP00000378326:C319S;ENSP00000411955:C143S	ENSP00000337310:C268S	C	+	1	0	ZP3	75907759	1.000000	0.71417	0.978000	0.43139	0.083000	0.17756	5.311000	0.65786	2.011000	0.59026	0.459000	0.35465	TGT	.		0.512	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1		
ZAN	7455	broad.mit.edu	37	7	100350474	100350474	+	RNA	SNP	T	T	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr7:100350474T>C	ENST00000348028.3	+	0	2911				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S916P(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCACCATCTCCACGGAAAA	0.502																																					.													.	ZAN-142	2	Substitution - Missense(2)	kidney(2)	.						.						331.0	380.0	365.0					7																	100350474		1868	4101	5969			7455	.			ACCATCTCCACGG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350474T>C		341	23		558	41	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	3.601	-0.081651	0.07141	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.63255	-0.03;-0.03;-0.03	3.77	-0.348	0.12613	.	.	.	.	.	T	0.22282	0.0537	N	0.00368	-1.59	0.09310	N	0.999999	B;B	0.10296	0.003;0.0	B;B	0.14023	0.01;0.0	T	0.23655	-1.0182	9	0.30854	T	0.27	.	4.5056	0.11885	0.0:0.4441:0.1597:0.3962	.	916;916	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	916	ENSP00000445943:S916P;ENSP00000445091:S916P;ENSP00000444427:S916P	ENSP00000423579:S916P	S	+	1	0	ZAN	100188410	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.053000	0.00045	-0.221000	0.09973	-0.220000	0.12472	TCC	.		0.502	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
RBM33	155435	broad.mit.edu	37	7	155532557	155532557	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr7:155532557A>C	ENST00000401878.3	+	12	2084	c.1886A>C	c.(1885-1887)cAc>cCc	p.H629P		NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	629	His-rich.|Pro-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ccaccacagcacccgccgcag	0.706																																					p.H629P													.	RBM33-23	0			c.A1886C						.						12.0	12.0	12.0					7																	155532557		1884	3539	5423	SO:0001583	missense	155435	exon12			CACAGCACCCGCC	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.1886A>C	7.37:g.155532557A>C	ENSP00000384160:p.His629Pro	26	5		58	16	NM_053043	0	0	0	0	0	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	37	CCDS5941.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.292|7.292	0.611250|0.611250	0.14066|0.14066	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000401878|ENST00000392761	T|.	0.45276|.	0.9|.	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	0.000000|.	0.64402|.	D|.	0.000010|.	T|T	0.33469|0.33469	0.0864|0.0864	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B|.	0.09022|.	0.002;0.002|.	B;B|.	0.11329|.	0.006;0.006|.	T|T	0.14952|0.14952	-1.0454|-1.0454	9|5	.|.	.|.	.|.	.|.	9.2613|9.2613	0.37614|0.37614	0.8184:0.1816:0.0:0.0|0.8184:0.1816:0.0:0.0	.|.	346;629|.	B4DVQ2;Q96EV2|.	.;RBM33_HUMAN|.	P|P	629|401	ENSP00000384160:H629P|.	.|.	H|T	+|+	2|1	0|0	RBM33|RBM33	155225318|155225318	1.000000|1.000000	0.71417|0.71417	0.131000|0.131000	0.22000|0.22000	0.206000|0.206000	0.24218|0.24218	3.795000|3.795000	0.55499|0.55499	1.697000|1.697000	0.51169|0.51169	0.383000|0.383000	0.25322|0.25322	CAC|ACC	.		0.706	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
NAT1	9	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	18080420	18080420	+	Silent	SNP	T	T	C			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr8:18080420T>C	ENST00000517492.1	+	3	1502	c.864T>C	c.(862-864)ttT>ttC	p.F288F	NAT1_ENST00000520546.1_Silent_p.F288F|NAT1_ENST00000307719.4_Silent_p.F288F|NAT1_ENST00000541942.1_Silent_p.F288F|NAT1_ENST00000539092.1_Silent_p.F288F|NAT1_ENST00000518029.1_Silent_p.F288F|NAT1_ENST00000535084.1_Silent_p.F288F|NAT1_ENST00000545197.1_Silent_p.F350F			Q8IZM9	S38A6_HUMAN	N-acetyltransferase 1 (arylamine N-acetyltransferase)	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(2)|urinary_tract(1)	9				Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)		ATAGATTTTTTACTATTTAGA	0.343																																					p.F350F		.											.	NAT1-90	0			c.T1050C						.						28.0	30.0	29.0					8																	18080420		2185	4285	6470	SO:0001819	synonymous_variant	9	exon4			ATTTTTTACTATT	BC047666	CCDS6007.1, CCDS55205.1	8p22	2012-01-18			ENSG00000171428	ENSG00000171428	2.3.1.5		7645	protein-coding gene	gene with protein product		108345		AAC1		7773298	Standard	NM_001160174		Approved		uc003wyt.3	P18440	OTTHUMG00000097001	ENST00000517492.1:c.864T>C	8.37:g.18080420T>C		278	1		210	83	NM_001160176	0	0	4	6	2	C9JWA6|Q86SY5	Silent	SNP	ENST00000517492.1	37	CCDS6007.1																																																																																			.		0.343	NAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374828.1	NM_000662	
RNF139	11236	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	125487509	125487509	+	Silent	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr8:125487509C>T	ENST00000303545.3	+	1	531	c.159C>T	c.(157-159)ctC>ctT	p.L53L	RNF139-AS1_ENST00000499418.2_lincRNA	NM_007218.3	NP_009149.2			ring finger protein 139											breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(1)	20	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GCATCGTGCTCCAGATCTTCC	0.647																																					p.L53L													.	RNF139-226	0			c.C159T						.						80.0	83.0	82.0					8																	125487509		2203	4300	6503	SO:0001819	synonymous_variant	11236	exon1			CGTGCTCCAGATC	AF064801	CCDS6350.1	8q24	2013-01-09			ENSG00000170881	ENSG00000170881		"""RING-type (C3HC4) zinc fingers"""	17023	protein-coding gene	gene with protein product		603046				9689122	Standard	NM_007218		Approved	TRC8, RCA1, HRCA1	uc003yrc.3	Q8WU17	OTTHUMG00000165072	ENST00000303545.3:c.159C>T	8.37:g.125487509C>T		75	1		56	23	NM_007218	0	0	13	19	6		Silent	SNP	ENST00000303545.3	37	CCDS6350.1																																																																																			.		0.647	RNF139-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381692.1	NM_007218	
ELAVL2	1993	broad.mit.edu	37	9	23762097	23762097	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr9:23762097G>T	ENST00000397312.2	-	2	410	c.136C>A	c.(136-138)Ctt>Att	p.L46I	ELAVL2_ENST00000462649.1_5'Flank|ELAVL2_ENST00000223951.6_Missense_Mutation_p.L46I|ELAVL2_ENST00000380117.1_Missense_Mutation_p.L46I|ELAVL2_ENST00000380110.4_Missense_Mutation_p.L75I|ELAVL2_ENST00000544538.1_Missense_Mutation_p.L46I	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	46	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TTCTGAGGAAGGTAGTTGACT	0.428																																					p.L46I													.	ELAVL2-516	0			c.C136A						.						295.0	267.0	277.0					9																	23762097		2203	4300	6503	SO:0001583	missense	1993	exon2			GAGGAAGGTAGTT	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.136C>A	9.37:g.23762097G>T	ENSP00000380479:p.Leu46Ile	166	0		134	4	NM_001171195	0	0	0	0	0	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	37	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332086	0.81801	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	T;D;D;D;T	0.85861	2.3;-2.04;-2.04;-2.04;2.3	5.92	5.92	0.95590	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.89884	0.6844	L	0.37466	1.105	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.99;0.997	D	0.90202	0.4258	10	0.87932	D	0	.	20.33	0.98713	0.0:0.0:1.0:0.0	.	46;46	Q12926;Q12926-2	ELAV2_HUMAN;.	I	46;46;46;46;46;74;46	ENSP00000223951:L46I;ENSP00000380479:L46I;ENSP00000440998:L46I;ENSP00000369460:L46I;ENSP00000412602:L46I	ENSP00000223951:L46I	L	-	1	0	ELAVL2	23752097	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.813000	0.69201	2.810000	0.96702	0.585000	0.79938	CTT	.		0.428	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432	
CLTA	1211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	36209297	36209297	+	Silent	SNP	C	C	T			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr9:36209297C>T	ENST00000242285.6	+	5	639	c.519C>T	c.(517-519)ttC>ttT	p.F173F	CLTA_ENST00000540080.1_Intron|CLTA_ENST00000538225.1_Intron|CLTA_ENST00000466396.1_Silent_p.F121F|CLTA_ENST00000396603.2_Silent_p.F173F|CLTA_ENST00000433436.2_Silent_p.F173F|CLTA_ENST00000345519.5_Intron|CLTA_ENST00000470744.1_Intron			P09496	CLCA_HUMAN	clathrin, light chain A	173					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			AACAACCCTTCGCTGACGTGA	0.403																																					p.F173F		.											.	CLTA-90	0			c.C519T						.						191.0	165.0	174.0					9																	36209297		2203	4300	6503	SO:0001819	synonymous_variant	1211	exon5			ACCCTTCGCTGAC		CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.519C>T	9.37:g.36209297C>T		128	0		89	38	NM_001076677	0	0	0	0	0	A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Silent	SNP	ENST00000242285.6	37	CCDS6601.1																																																																																			.		0.403	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096	
PRUNE2	158471	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	79318374	79318374	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr9:79318374G>A	ENST00000376718.3	-	9	8278	c.8155C>T	c.(8155-8157)Cat>Tat	p.H2719Y	PRUNE2_ENST00000428286.1_Missense_Mutation_p.H2360Y	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2719					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCATTGTCATGGGTGACAGCC	0.527																																					p.H2719Y		.											.	PRUNE2-157	0			c.C8155T						.						102.0	83.0	89.0					9																	79318374		1568	3582	5150	SO:0001583	missense	158471	exon9			TGTCATGGGTGAC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8155C>T	9.37:g.79318374G>A	ENSP00000365908:p.His2719Tyr	63	0		51	32	NM_015225	0	0	0	12	12	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.75|17.75	3.465272|3.465272	0.63513|0.63513	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.49720|.	0.77;0.78|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.102782|.	0.43747|.	D|.	0.000523|.	T|T	0.71187|0.71187	0.3310|0.3310	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	P;P|.	0.51653|.	0.898;0.947|.	B;B|.	0.43867|.	0.434;0.335|.	T|T	0.68957|0.68957	-0.5272|-0.5272	10|5	0.72032|.	D|.	0.01|.	-6.6465|-6.6465	14.0742|14.0742	0.64880|0.64880	0.0:0.1938:0.8062:0.0|0.0:0.1938:0.8062:0.0	.|.	2719;2719|.	Q8WUY3-3;Q8WUY3|.	.;PRUN2_HUMAN|.	Y|L	2719;2360;2718|2040	ENSP00000365908:H2719Y;ENSP00000397425:H2360Y|.	ENSP00000365908:H2719Y|.	H|P	-|-	1|2	0|0	PRUNE2|PRUNE2	78508194|78508194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.640000|0.640000	0.38277|0.38277	4.226000|4.226000	0.58606|0.58606	2.814000|2.814000	0.96858|0.96858	0.586000|0.586000	0.80456|0.80456	CAT|CCA	.		0.527	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
RBM3	5935	broad.mit.edu	37	X	48434952	48434952	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chrX:48434952T>G	ENST00000376759.3	+	5	436	c.373T>G	c.(373-375)Tat>Gat	p.Y125D	AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000466764.1_3'UTR|RBM3_ENST00000376755.1_Missense_Mutation_p.Y125D|RBM3_ENST00000430348.2_Silent_p.G97G|RBM3_ENST00000354480.2_Silent_p.G97G	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	125	Gly-rich.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						ACCTGGAGGGTATGGATATGG	0.498																																					p.Y125D													.	RBM3-131	0			c.T373G						.						85.0	72.0	77.0					X																	48434952		2198	4293	6491	SO:0001583	missense	5935	exon5			GGAGGGTATGGAT	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.373T>G	X.37:g.48434952T>G	ENSP00000365950:p.Tyr125Asp	64	12		46	15	NM_006743	3	0	306	310	1		Missense_Mutation	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	T	13.35	2.209999	0.39003	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	T;T	0.20598	2.06;2.06	3.86	3.86	0.44501	.	.	.	.	.	T	0.38957	0.1060	M	0.75615	2.305	0.80722	D	1	D	0.58970	0.984	P	0.62435	0.902	T	0.14117	-1.0484	9	0.30078	T	0.28	-5.6672	10.0649	0.42297	0.0:0.0:0.0:1.0	.	125	P98179	RBM3_HUMAN	D	125	ENSP00000365950:Y125D;ENSP00000365946:Y125D	ENSP00000365946:Y125D	Y	+	1	0	RBM3	48319896	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	2.002000	0.40835	1.735000	0.51646	0.486000	0.48141	TAT	.		0.498	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	
PAQR7	164091	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	26189753	26189755	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:26189753_26189755delTTG	ENST00000374296.3	-	2	1242_1244	c.576_578delCAA	c.(574-579)aacaag>aag	p.N192del	RP1-125I3.2_ENST00000455431.1_RNA	NM_178422.5	NP_848509.1	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	192					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			breast(3)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGATGTACTTGTTATAGCAGG	0.581																																					p.192_193del	Esophageal Squamous(111;1206 1556 18433 19151 38418)	.											.	PAQR7-71	0			c.576_578del						.																																			SO:0001651	inframe_deletion	164091	exon2			.		CCDS267.1	1p35.3	2012-08-10			ENSG00000182749	ENSG00000182749			23146	protein-coding gene	gene with protein product	"""membrane progestin receptor alpha"""	607779					Standard	NM_178422		Approved	mSR, MPRA	uc001bkx.3	Q86WK9	OTTHUMG00000007373	ENST00000374296.3:c.576_578delCAA	1.37:g.26189753_26189755delTTG	ENSP00000363414:p.Asn192del	105	0		105	44	NM_178422	0	0	0	0	0	A2A2D3|Q5XKF9|Q86VE4	In_Frame_Del	DEL	ENST00000374296.3	37	CCDS267.1																																																																																			.		0.581	PAQR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019312.1	NM_178422	
AHDC1	27245	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27876672	27876673	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr1:27876672_27876673delGT	ENST00000247087.5	-	5	2550_2551	c.1954_1955delAC	c.(1954-1956)accfs	p.T652fs	AHDC1_ENST00000374011.2_Frame_Shift_Del_p.T652fs			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	652							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GATGCTCTGGGTGTCGGGGGCC	0.703																																					p.652_652del		.											.	AHDC1-90	0			c.1954_1955del						.																																			SO:0001589	frameshift_variant	27245	exon6			.	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1954_1955delAC	1.37:g.27876674_27876675delGT	ENSP00000247087:p.Thr652fs	53	0		41	16	NM_001029882	0	0	0	0	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Frame_Shift_Del	DEL	ENST00000247087.5	37	CCDS30652.1																																																																																			.		0.703	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
PRB1	5542	broad.mit.edu	37	12	11506653	11506653	+	Intron	DEL	T	T	-			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:11506653delT	ENST00000500254.2	-	3	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GACCTTGAGGTCTGTTGCCTC	0.602																																					.													.	PRB1-90	0			.						.						17.0	14.0	15.0					12																	11506653		1290	2283	3573	SO:0001627	intron_variant	5542	.			TTGAGGTCTGTTG		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.313+70A>-	12.37:g.11506653delT		63	0		94	7	.	0	0	0	0	0	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Frame_Shift_Del	DEL	ENST00000500254.2	37	CCDS8642.1																																																																																			.		0.602	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
ZNF529	57711	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	37038841	37038841	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr19:37038841delT	ENST00000591340.1	-	5	777	c.619delA	c.(619-621)accfs	p.T207fs	ZNF529_ENST00000334116.7_Frame_Shift_Del_p.T102fs	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					ATCCCAAAGGTTTTCCAACAT	0.313																																					p.T207fs		.											.	ZNF529-67	0			c.619delA						.						77.0	71.0	73.0					19																	37038841		1844	4087	5931	SO:0001589	frameshift_variant	57711	exon6			.	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.619delA	19.37:g.37038841delT	ENSP00000465578:p.Thr207fs	123	0		47	15	NM_001145649	0	0	0	0	0	K7EKE1|Q9H731|Q9HCF7	Frame_Shift_Del	DEL	ENST00000591340.1	37	CCDS54256.1																																																																																			.		0.313	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151874152	151874158	+	Frame_Shift_Del	DEL	TTTTTGG	TTTTTGG	-	rs79763944|rs78116609		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	TTTTTGG	TTTTTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr7:151874152_151874158delTTTTTGG	ENST00000262189.6	-	38	8598_8604	c.8380_8386delCCAAAAA	c.(8380-8388)ccaaaaaaafs	p.PKK2794fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.PKK2794fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2794					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGTTCCTTTTTTTTTGGTTCAACAGAT	0.357																																					p.2794_2796del		.											.	MLL3-1398	0			c.8380_8386del						.																																			SO:0001589	frameshift_variant	58508	exon38			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8380_8386delCCAAAAA	7.37:g.151874152_151874158delTTTTTGG	ENSP00000262189:p.Pro2794fs	69	0		95	30	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.357	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PRB1	5542	broad.mit.edu	37	12	11506632	11506633	+	Intron	INS	-	-	GGA			TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:11506632_11506633insGGA	ENST00000500254.2	-	3	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTGGCTTTCCTGGAGGTGGGGG	0.604																																					.													.	PRB1-90	0			.						.																																			SO:0001627	intron_variant	5542	.			CTTTCCTGGAGGT		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.313+90->TCC	12.37:g.11506633_11506635dupGGA		46	0		79	8	.	0	0	0	0	0	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	In_Frame_Ins	INS	ENST00000500254.2	37	CCDS8642.1																																																																																			.		0.604	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
PRB1	5542	broad.mit.edu	37	12	11506655	11506656	+	Intron	INS	-	-	G	rs371206768		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr12:11506655_11506656insG	ENST00000500254.2	-	3	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTTGAGGTCTGTTGCCTCCTT	0.604																																					.													.	PRB1-90	0			.						.																																			SO:0001627	intron_variant	5542	.			GAGGTCTGTTGCC		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.313+67->C	12.37:g.11506656_11506656dupG		63	0		94	7	.	0	0	0	0	0	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Frame_Shift_Ins	INS	ENST00000500254.2	37	CCDS8642.1																																																																																			.		0.604	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
AP1S1	1174	broad.mit.edu	37	7	100802404	100802405	+	Frame_Shift_Ins	INS	-	-	G	rs571529719		TCGA-G7-A4TM-01A-11D-A31X-10	TCGA-G7-A4TM-10B-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d7e8ac41-c79b-4372-92d4-4df7a9fdcdb7	e79e18b2-3037-4c27-bbeb-21d6df3720fb	g.chr7:100802404_100802405insG	ENST00000337619.5	+	4	474_475	c.356_357insG	c.(355-360)atggggfs	p.MG119fs	MIR4653_ENST00000585107.1_RNA	NM_001283.3	NP_001274.1	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1 subunit	119					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor-mediated endocytosis (GO:0006898)|regulation of defense response to virus by virus (GO:0050690)|response to virus (GO:0009615)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)	8	Lung NSC(181;0.168)|all_lung(186;0.215)					GAGTTTTTGATGGGGGGGGATG	0.564																																					p.M119fs													.	AP1S1-226	0			c.356_357insG						.																																			SO:0001589	frameshift_variant	1174	exon4			TTTTGATGGGGGG	AB015319	CCDS47669.1	7q22.1	2014-02-04			ENSG00000106367	ENSG00000106367			559	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, small 1 (19kD)"", ""clathrin coat assembly protein AP19"", ""sigma1A subunit of AP-1 clathrin adaptor complex"", ""AP-1 complex subunit sigma-1A"", ""sigma1A-adaptin"", ""golgi adaptor HA1/AP1 adaptin sigma-1A subunit"", ""clathrin assembly protein complex 1 sigma-1A small chain"", ""HA1 19 kDa subunit"""	603531	"""erythrokeratodermia variabilis 3 (Kamouraska type)"""	CLAPS1, EKV3		9653655, 9733768, 19057675	Standard	NM_001283		Approved	AP19, SIGMA1A, WUGSC:H_DJ0747G18.2	uc003uxv.4	P61966	OTTHUMG00000157103	ENST00000337619.5:c.364dupG	7.37:g.100802412_100802412dupG	ENSP00000336666:p.Met119fs	48	0		110	7	NM_001283	0	0	0	0	0	B2R5D8|P82267|Q00382|Q53YA7|Q9BTN4|Q9UDW9	Frame_Shift_Ins	INS	ENST00000337619.5	37	CCDS47669.1																																																																																			.		0.564	AP1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347439.1	NM_001283	
