#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2160390	2160390	+	Missense_Mutation	SNP	C	C	G	rs28384811	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:2160390C>G	ENST00000378536.4	+	1	257	c.185C>G	c.(184-186)gCg>gGg	p.A62G		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	62					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		gcggtgccggcgccggTGCCC	0.776													C|||	229	0.0457268	0.0234	0.0576	5008	,	,		4535	0.0079		0.0706	False		,,,				2504	0.0808				p.A62G	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C185G						.						1.0	1.0	1.0					1																	2160390		788	1840	2628	SO:0001583	missense	6497	exon1			TGCCGGCGCCGGT	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.185C>G	1.37:g.2160390C>G	ENSP00000367797:p.Ala62Gly	1	1		2	2	NM_003036	0	0	0	1	1	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	102	0.046703296703296704	20	0.04065040650406504	28	0.07734806629834254	3	0.005244755244755245	51	0.06728232189973615	C	9.688	1.151208	0.21371	.	.	ENSG00000157933	ENST00000378536	D	0.95821	-3.82	2.3	2.3	0.28687	.	.	.	.	.	T	0.47857	0.1468	N	0.08118	0	0.45733	P	0.001363000000000003	D	0.57899	0.981	P	0.58520	0.84	T	0.76271	-0.3020	8	0.20519	T	0.43	-11.9718	7.7374	0.28823	0.0:1.0:0.0:0.0	rs28384811	62	P12755	SKI_HUMAN	G	62	ENSP00000367797:A62G	ENSP00000367797:A62G	A	+	2	0	SKI	2150250	0.994000	0.37717	0.998000	0.56505	0.971000	0.66376	0.878000	0.28126	1.104000	0.41587	0.185000	0.17295	GCG	C|0.953;G|0.047		0.776	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
FUCA1	2517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24192102	24192102	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:24192102T>C	ENST00000374479.3	-	2	410	c.403A>G	c.(403-405)Acg>Gcg	p.T135A		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	135					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGCTTTGTCGTCAAAACTACA	0.488																																					p.T135A		.											.	FUCA1-153	0			c.A403G						.						107.0	101.0	103.0					1																	24192102		2203	4300	6503	SO:0001583	missense	2517	exon2			TTGTCGTCAAAAC	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.403A>G	1.37:g.24192102T>C	ENSP00000363603:p.Thr135Ala	129	1		153	34	NM_000147	0	0	0	0	0	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.276474	0.80580	.	.	ENSG00000179163	ENST00000374479	T	0.62105	0.05	5.38	5.38	0.77491	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88451	0.6440	H	0.99404	4.55	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.93482	0.6828	10	0.87932	D	0	-11.1115	15.685	0.77402	0.0:0.0:0.0:1.0	.	135	P04066	FUCO_HUMAN	A	135	ENSP00000363603:T135A	ENSP00000363603:T135A	T	-	1	0	FUCA1	24064689	1.000000	0.71417	0.944000	0.38274	0.576000	0.36127	7.551000	0.82182	2.163000	0.67991	0.459000	0.35465	ACG	.		0.488	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
CATSPER4	378807	ucsc.edu	37	1	26528995	26528995	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:26528995T>C	ENST00000456354.2	+	10	1448	c.1381T>C	c.(1381-1383)Tca>Cca	p.S461P		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	461					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TGACTCTAGCTCACAAATACT	0.552																																					p.S461P													.	CATSPER4-91	0			c.T1381C						.						40.0	39.0	39.0					1																	26528995		2203	4300	6503	SO:0001583	missense	378807	exon10			TCTAGCTCACAAA	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.1381T>C	1.37:g.26528995T>C	ENSP00000390423:p.Ser461Pro	21	0		31	4	NM_198137	0	0	0	0	0	A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	CCDS30645.1	.	.	.	.	.	.	.	.	.	.	T	2.653	-0.281491	0.05642	.	.	ENSG00000188782	ENST00000456354	D	0.97529	-4.42	4.42	-2.63	0.06133	.	2.363080	0.02142	N	0.057251	D	0.91005	0.7171	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	D	0.84668	0.0710	10	0.44086	T	0.13	0.0864	5.949	0.19235	0.3484:0.4045:0.0:0.2471	.	461	Q7RTX7	CTSR4_HUMAN	P	461	ENSP00000390423:S461P	ENSP00000390423:S461P	S	+	1	0	CATSPER4	26401582	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.066000	0.14489	-0.456000	0.07043	-0.509000	0.04479	TCA	.		0.552	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137	
PABPC4	8761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40029530	40029530	+	Silent	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:40029530C>T	ENST00000372857.3	-	11	2262	c.1470G>A	c.(1468-1470)ctG>ctA	p.L490L	PABPC4_ENST00000372858.3_Silent_p.L506L|PABPC4_ENST00000372862.3_Intron|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372856.3_Intron	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	490					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCTGTCAGTCAGCCCTTGCT	0.557																																					p.L506L		.											.	PABPC4-68	0			c.G1518A						.						60.0	61.0	61.0					1																	40029530		2203	4300	6503	SO:0001819	synonymous_variant	8761	exon11			GTCAGTCAGCCCT	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1470G>A	1.37:g.40029530C>T		97	0		116	51	NM_001135653	0	0	85	140	55	B1ANQ8|Q4VC03|Q6P0N3	Silent	SNP	ENST00000372857.3	37	CCDS438.1																																																																																			.		0.557	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
BEST4	266675	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	45250593	45250593	+	Missense_Mutation	SNP	A	A	G	rs377207881		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:45250593A>G	ENST00000372207.3	-	7	976	c.977T>C	c.(976-978)aTa>aCa	p.I326T		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	326						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					GTTGCGGTCTATGAGCTGATT	0.562																																					p.I326T		.											.	BEST4-91	0			c.T977C						.						76.0	81.0	79.0					1																	45250593		2203	4300	6503	SO:0001583	missense	266675	exon7			CGGTCTATGAGCT	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.977T>C	1.37:g.45250593A>G	ENSP00000361281:p.Ile326Thr	117	0		135	11	NM_153274	0	0	1	1	0	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072846	0.76415	.	.	ENSG00000142959	ENST00000372207	D	0.99270	-5.66	5.19	4.07	0.47477	.	0.051148	0.85682	D	0.000000	D	0.99518	0.9828	H	0.96269	3.795	0.51767	D	0.999939	D	0.71674	0.998	D	0.74348	0.983	D	0.98708	1.0703	10	0.87932	D	0	-16.684	9.7184	0.40289	0.9183:0.0:0.0816:0.0	.	326	Q8NFU0	BEST4_HUMAN	T	326	ENSP00000361281:I326T	ENSP00000361281:I326T	I	-	2	0	BEST4	45023180	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.946000	0.70234	0.998000	0.38996	0.533000	0.62120	ATA	.		0.562	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
STXBP3	6814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109302625	109302625	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:109302625T>G	ENST00000370008.3	+	6	406	c.356T>G	c.(355-357)tTt>tGt	p.F119C		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	119	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GATAATCTCTTTAACAAAATT	0.289																																					p.F119C		.											.	STXBP3-93	0			c.T356G						.						92.0	106.0	101.0					1																	109302625		2203	4288	6491	SO:0001583	missense	6814	exon6			ATCTCTTTAACAA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.356T>G	1.37:g.109302625T>G	ENSP00000359025:p.Phe119Cys	172	0		216	94	NM_007269	0	0	18	34	16	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.861971	0.71949	.	.	ENSG00000116266	ENST00000370008	T	0.77098	-1.07	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.87083	0.6089	M	0.84846	2.72	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.89069	0.3468	10	0.62326	D	0.03	-18.7523	15.3518	0.74396	0.0:0.0:0.0:1.0	.	119	O00186	STXB3_HUMAN	C	119	ENSP00000359025:F119C	ENSP00000359025:F119C	F	+	2	0	STXBP3	109104148	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.164000	0.71885	2.110000	0.64415	0.477000	0.44152	TTT	.		0.289	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
CHD1L	9557	hgsc.bcm.edu	37	1	146727559	146727559	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:146727559C>G	ENST00000369258.4	+	4	459	c.439C>G	c.(439-441)Cat>Gat	p.H147D	CHD1L_ENST00000361293.5_Intron|CHD1L_ENST00000369259.3_Intron|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000431239.1_Missense_Mutation_p.H147D	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	147	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					GTCACGTTTTCATGTGCTACT	0.433																																					p.H147D		.											.	CHD1L-231	0			c.C439G						.						79.0	67.0	71.0					1																	146727559		2203	4300	6503	SO:0001583	missense	9557	exon4			CGTTTTCATGTGC	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.439C>G	1.37:g.146727559C>G	ENSP00000358262:p.His147Asp	34	0		36	2	NM_004284	0	0	9	9	0	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	CCDS927.1	.	.	.	.	.	.	.	.	.	.	C	1.555	-0.538188	0.04082	.	.	ENSG00000131778	ENST00000431239;ENST00000369258;ENST00000436230;ENST00000254086	D;D	0.91686	-2.89;-2.89	5.66	5.66	0.87406	DEAD-like helicase (2);SNF2-related (1);	0.198583	0.53938	D	0.000060	D	0.82912	0.5140	N	0.02368	-0.58	0.80722	D	1	D;B	0.89917	1.0;0.007	D;B	0.83275	0.996;0.038	T	0.81709	-0.0809	10	0.02654	T	1	.	15.6157	0.76767	0.0:1.0:0.0:0.0	.	147;147	Q86WJ1-2;Q86WJ1	.;CHD1L_HUMAN	D	147;147;47;108	ENSP00000389031:H147D;ENSP00000358262:H147D	ENSP00000254086:H108D	H	+	1	0	CHD1L	145194183	1.000000	0.71417	1.000000	0.80357	0.290000	0.27261	2.913000	0.48790	2.832000	0.97577	0.655000	0.94253	CAT	.		0.433	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
ZNF687	57592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151259373	151259373	+	Silent	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:151259373C>G	ENST00000368879.2	+	2	704	c.606C>G	c.(604-606)gcC>gcG	p.A202A		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	202	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGAGCTGGCCCAGGAGAATG	0.652																																					p.A202A		.											.	ZNF687-92	0			c.C606G						.						44.0	49.0	47.0					1																	151259373		2203	4300	6503	SO:0001819	synonymous_variant	57592	exon2			GCTGGCCCAGGAG		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.606C>G	1.37:g.151259373C>G		115	0		122	59	NM_020832	1	0	14	28	13	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	37																																																																																				.		0.652	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
SPRR1A	6698	hgsc.bcm.edu;broad.mit.edu	37	1	152957850	152957850	+	Silent	SNP	C	C	T	rs267598046		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:152957850C>T	ENST00000368762.1	+	1	144	c.144C>T	c.(142-144)ccC>ccT	p.P48P	SPRR1A_ENST00000307122.2_Silent_p.P48P			P35321	SPR1A_HUMAN	small proline-rich protein 1A	48	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(2)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)	7	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCTGAGCCCTGCCACCCCA	0.642																																					p.P48P		.											.	SPRR1A-68	0			c.C144T						.						120.0	120.0	120.0					1																	152957850		2203	4300	6503	SO:0001819	synonymous_variant	6698	exon2			TGAGCCCTGCCAC	L05187	CCDS1032.1	1q21-q22	2008-02-05			ENSG00000169474	ENSG00000169474			11259	protein-coding gene	gene with protein product		182265				8325635	Standard	NM_005987		Approved		uc001faw.3	P35321	OTTHUMG00000014404	ENST00000368762.1:c.144C>T	1.37:g.152957850C>T		212	0		254	17	NM_005987	0	0	0	0	0	B1AN47|D3DV31|Q2M303|Q9UDG4	Silent	SNP	ENST00000368762.1	37	CCDS1032.1																																																																																			.		0.642	SPRR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040062.1	NM_005987	
SPRR1B	6699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153004965	153004965	+	Silent	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:153004965C>T	ENST00000307098.4	+	2	209	c.144C>T	c.(142-144)ccC>ccT	p.P48P	SPRR1B_ENST00000392661.3_Silent_p.P48P	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	48	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.C41_P64delCHPKVPEPCHPKVPEPCQPKVPEP(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCTGAGCCCTGCCACCCCA	0.627																																					p.P48P		.											.	SPRR1B-69	1	Deletion - In frame(1)	ovary(1)	c.C144T						.						123.0	123.0	123.0					1																	153004965		2203	4300	6503	SO:0001819	synonymous_variant	6699	exon2			TGAGCCCTGCCAC	M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.144C>T	1.37:g.153004965C>T		274	0		264	105	NM_003125	0	0	0	0	0	B2R5H7|P22529|P22530|Q5T524	Silent	SNP	ENST00000307098.4	37	CCDS30863.1																																																																																			.		0.627	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038906.1	NM_003125	
DCAF8	50717	hgsc.bcm.edu	37	1	160209974	160209974	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:160209974T>G	ENST00000368073.3	-	4	670	c.236A>C	c.(235-237)gAc>gCc	p.D79A	DCAF8_ENST00000556710.1_Missense_Mutation_p.D233A|DCAF8_ENST00000368074.1_Missense_Mutation_p.D79A|DCAF8_ENST00000475733.1_Missense_Mutation_p.D79A|DCAF8_ENST00000610139.1_Missense_Mutation_p.D79A|DCAF8_ENST00000608310.1_Missense_Mutation_p.D233A|DCAF8_ENST00000326837.2_Missense_Mutation_p.D79A			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	79					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						CTCCATGCTGTCAGAGTCCTT	0.512																																					p.D79A		.											.	DCAF8-92	0			c.A236C						.						126.0	90.0	102.0					1																	160209974		2203	4300	6503	SO:0001583	missense	50717	exon4			ATGCTGTCAGAGT	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.236A>C	1.37:g.160209974T>G	ENSP00000357052:p.Asp79Ala	31	0		34	2	NM_015726	0	0	65	65	0	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	37	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094041	0.76870	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000447377;ENST00000440682;ENST00000407642;ENST00000556710;ENST00000485079	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.23;-0.23	5.03	5.03	0.67393	.	0.000000	0.64402	U	0.000002	T	0.51975	0.1706	L	0.40543	1.245	0.58432	D	0.999997	P;P;B	0.49253	0.884;0.921;0.329	B;P;B	0.47206	0.382;0.541;0.077	T	0.54827	-0.8235	10	0.37606	T	0.19	-12.1696	13.7732	0.63038	0.0:0.0:0.0:1.0	.	233;79;79	G3V3G9;Q5TAQ9-2;Q5TAQ9	.;.;DCAF8_HUMAN	A	79;79;79;233;79;79;79;233;291	ENSP00000357052:D79A;ENSP00000318227:D79A;ENSP00000357053:D79A;ENSP00000451989:D233A;ENSP00000451235:D233A	ENSP00000318227:D79A	D	-	2	0	RP11-574F21.3;DCAF8	158476598	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.172000	0.65003	1.889000	0.54706	0.528000	0.53228	GAC	.		0.512	DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077402.2	NM_015726	
CUTC	51076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101507060	101507060	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:101507060A>C	ENST00000370476.5	+	6	615	c.486A>C	c.(484-486)ttA>ttC	p.L162F		NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	162					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		AGACCCTCTTAACCTTGGGAT	0.438																																					p.L162F		.											.	CUTC-153	0			c.A486C						.						178.0	165.0	170.0					10																	101507060		2203	4300	6503	SO:0001583	missense	51076	exon6			CCTCTTAACCTTG	AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.486A>C	10.37:g.101507060A>C	ENSP00000359507:p.Leu162Phe	122	0		179	42	NM_015960	0	0	26	32	6	Q5TCZ8|Q9Y321	Missense_Mutation	SNP	ENST00000370476.5	37	CCDS7483.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863855	0.51482	.	.	ENSG00000119929	ENST00000370476;ENST00000370472	.	.	.	5.75	1.83	0.25207	Copper homeostasis CutC domain (2);	0.362596	0.26478	N	0.024153	T	0.47097	0.1427	M	0.66439	2.03	0.40178	D	0.977255	P;B	0.35844	0.524;0.358	B;B	0.40940	0.241;0.344	T	0.52003	-0.8633	9	0.87932	D	0	-2.0266	1.2816	0.02042	0.5158:0.1141:0.1618:0.2083	.	162;162	B4DYM2;Q9NTM9	.;CUTC_HUMAN	F	162;99	.	ENSP00000359503:L99F	L	+	3	2	CUTC	101497050	0.287000	0.24315	0.936000	0.37596	0.989000	0.77384	-0.314000	0.08092	0.960000	0.38005	0.460000	0.39030	TTA	.		0.438	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049811.1	NM_015960	
MCMBP	79892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	121598084	121598084	+	Silent	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:121598084A>G	ENST00000360003.3	-	12	1546	c.1377T>C	c.(1375-1377)gaT>gaC	p.D459D	MCMBP_ENST00000466047.1_5'UTR|MCMBP_ENST00000369077.3_Silent_p.D457D	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	459					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						GGAGAGTCTCATCGATTACAA	0.483																																					p.D459D		.											.	MCMBP-93	0			c.T1377C						.						75.0	73.0	74.0					10																	121598084		2203	4300	6503	SO:0001819	synonymous_variant	79892	exon12			AGTCTCATCGATT	BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.1377T>C	10.37:g.121598084A>G		60	0		80	29	NM_024834	0	0	37	59	22	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Silent	SNP	ENST00000360003.3	37	CCDS7617.1																																																																																			.		0.483	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
RPS3	6188	hgsc.bcm.edu	37	11	75115876	75115876	+	Silent	SNP	G	G	T	rs139803355		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:75115876G>T	ENST00000531188.1	+	6	761	c.699G>T	c.(697-699)ccG>ccT	p.P233P	RPS3_ENST00000527446.1_Silent_p.P233P|SNORD15B_ENST00000384714.1_RNA|RPS3_ENST00000526608.1_Silent_p.P221P|RPS3_ENST00000534440.1_Silent_p.P148P|RPS3_ENST00000278572.6_Silent_p.P249P|RPS3_ENST00000524851.1_Silent_p.P233P	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	233				P -> L (in Ref. 1; CAA39248). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGCCAGAGCCGCCTGCCATGC	0.567																																					p.P249P		.											.	RPS3-90	0			c.G747T						.						21.0	25.0	23.0					11																	75115876		2192	4288	6480	SO:0001819	synonymous_variant	6188	exon6			AGAGCCGCCTGCC		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.699G>T	11.37:g.75115876G>T		72	0		88	5	NM_001260506	1	26	1125	1152	0	B2R7N5|J3KN86|Q498B5|Q8NI95	Silent	SNP	ENST00000531188.1	37	CCDS8236.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.22|10.22	1.291451|1.291451	0.23564|0.23564	.|.	.|.	ENSG00000149273|ENSG00000149273	ENST00000530689|ENST00000525933	.|.	.|.	.|.	5.13|5.13	-2.74|-2.74	0.05932|0.05932	.|.	.|.	.|.	.|.	.|.	T|T	0.48077|0.48077	0.1480|0.1480	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.41288|0.41288	-0.9517|-0.9517	5|4	0.62326|.	D|.	0.03|.	-6.6103|-6.6103	5.3946|5.3946	0.16263|0.16263	0.495:0.2834:0.2217:0.0|0.495:0.2834:0.2217:0.0	.|.	.|.	.|.	.|.	S|L	135|161	.|.	ENSP00000433354:A135S|.	A|R	+|+	1|2	0|0	RPS3|RPS3	74793524|74793524	0.056000|0.056000	0.20664|0.20664	0.978000|0.978000	0.43139|0.43139	0.410000|0.410000	0.31052|0.31052	-0.618000|-0.618000	0.05578|0.05578	-0.319000|-0.319000	0.08652|0.08652	-0.181000|-0.181000	0.13052|0.13052	GCC|CGC	G|0.999;A|0.001		0.567	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
ENDOD1	23052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	94862157	94862157	+	Missense_Mutation	SNP	C	C	G	rs61734147	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:94862157C>G	ENST00000278505.4	+	2	1035	c.917C>G	c.(916-918)tCt>tGt	p.S306C		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	306						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S306C(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				AGTCCCCTTTCTAGCACCAGG	0.448																																					p.S306C		.											.	ENDOD1-68	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C917G						.						85.0	82.0	83.0					11																	94862157		1855	4087	5942	SO:0001583	missense	23052	exon2			CCCTTTCTAGCAC	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.917C>G	11.37:g.94862157C>G	ENSP00000278505:p.Ser306Cys	121	0		116	47	NM_015036	0	0	32	62	30	A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	37	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450542	0.43531	.	.	ENSG00000149218	ENST00000278505	T	0.35973	1.28	5.79	5.79	0.91817	.	0.494397	0.18919	N	0.127530	T	0.44767	0.1309	M	0.62723	1.935	0.28948	N	0.890571	P	0.45283	0.855	B	0.44163	0.443	T	0.50171	-0.8859	10	0.87932	D	0	-0.6278	17.5334	0.87820	0.0:1.0:0.0:0.0	.	306	O94919	ENDD1_HUMAN	C	306	ENSP00000278505:S306C	ENSP00000278505:S306C	S	+	2	0	ENDOD1	94501805	0.020000	0.18652	0.551000	0.28230	0.151000	0.21798	2.730000	0.47335	2.742000	0.94016	0.455000	0.32223	TCT	C|0.998;T|0.002		0.448	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
UBE4A	9354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118243839	118243839	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:118243839G>A	ENST00000431736.2	+	7	853	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K	UBE4A_ENST00000252108.3_Missense_Mutation_p.E254K					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AGAGGTCATTGAAGCCTTGAT	0.368																																					p.E261K		.											.	UBE4A-229	0			c.G781A						.						117.0	113.0	115.0					11																	118243839		2200	4296	6496	SO:0001583	missense	9354	exon7			GTCATTGAAGCCT	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.781G>A	11.37:g.118243839G>A	ENSP00000387362:p.Glu261Lys	94	0		89	42	NM_004788	0	0	10	13	3		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	g	14.87	2.663910	0.47572	.	.	ENSG00000110344	ENST00000252108;ENST00000431736	T;T	0.46063	0.88;0.88	6.04	1.95	0.26073	.	0.407974	0.28815	N	0.014059	T	0.23766	0.0575	N	0.24115	0.695	0.80722	D	1	B;B	0.19200	0.02;0.034	B;B	0.21708	0.016;0.036	T	0.05903	-1.0857	10	0.08837	T	0.75	-0.6425	8.9731	0.35919	0.1267:0.245:0.6283:0.0	.	254;261	Q14139;Q14139-2	UBE4A_HUMAN;.	K	254;261	ENSP00000252108:E254K;ENSP00000387362:E261K	ENSP00000252108:E254K	E	+	1	0	UBE4A	117749049	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.805000	0.55575	0.437000	0.26423	-0.213000	0.12676	GAA	.		0.368	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
MCAM	4162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119183001	119183001	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:119183001A>C	ENST00000264036.4	-	8	1013	c.999T>G	c.(997-999)agT>agG	p.S333R	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.S282R	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	333					anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCTGTGGTTCACTCAGCAGCG	0.622																																					p.S333R		.											.	MCAM-137	0			c.T999G						.						96.0	92.0	94.0					11																	119183001		2199	4295	6494	SO:0001583	missense	4162	exon8			TGGTTCACTCAGC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.999T>G	11.37:g.119183001A>C	ENSP00000264036:p.Ser333Arg	110	0		107	38	NM_006500	1	0	119	234	114	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	A	10.61	1.399560	0.25291	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.06849	3.25;3.25	5.53	-3.57	0.04612	Immunoglobulin-like fold (1);	.	.	.	.	T	0.03739	0.0106	N	0.19112	0.55	0.09310	N	1	B	0.19331	0.035	B	0.15484	0.013	T	0.45614	-0.9249	9	0.18276	T	0.48	-16.5141	2.4635	0.04547	0.3729:0.2069:0.3187:0.1015	.	333	P43121	MUC18_HUMAN	R	333;282	ENSP00000264036:S333R;ENSP00000376561:S282R	ENSP00000264036:S333R	S	-	3	2	MCAM	118688211	0.000000	0.05858	0.024000	0.17045	0.080000	0.17528	-0.422000	0.07043	-0.700000	0.05070	-0.411000	0.06167	AGT	.		0.622	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
APOLD1	81575	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	12940182	12940182	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:12940182C>T	ENST00000326765.6	+	2	506	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	APOLD1_ENST00000356591.4_Missense_Mutation_p.R115W	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	146					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		CTGCAACTCCCGGGAGCTGCG	0.682																																					p.R146W		.											.	APOLD1-91	0			c.C436T						.						27.0	31.0	30.0					12																	12940182		2203	4300	6503	SO:0001583	missense	81575	exon2			AACTCCCGGGAGC	AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.436C>T	12.37:g.12940182C>T	ENSP00000324277:p.Arg146Trp	65	0		93	23	NM_001130415	0	0	3	3	0	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	37	CCDS44833.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040822	0.75732	.	.	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.03386	3.95;3.95	4.91	4.01	0.46588	.	0.395551	0.24623	U	0.036942	T	0.09730	0.0239	L	0.43152	1.355	0.31300	N	0.688457	D;D	0.76494	0.999;0.999	D;D	0.65987	0.94;0.94	T	0.02758	-1.1114	10	0.44086	T	0.13	-18.6983	9.3604	0.38192	0.2848:0.5756:0.1396:0.0	.	115;146	A0AVN6;Q96LR9	.;APLD1_HUMAN	W	146;115	ENSP00000324277:R146W;ENSP00000348998:R115W	ENSP00000324277:R146W	R	+	1	2	APOLD1	12831449	0.938000	0.31826	1.000000	0.80357	0.994000	0.84299	0.853000	0.27777	1.179000	0.42884	0.478000	0.44815	CGG	.		0.682	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
ANP32D	23519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48866497	48866497	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:48866497C>A	ENST00000266594.1	+	1	50	c.50C>A	c.(49-51)tCc>tAc	p.S17Y		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	17						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						AGGACGCCCTCCGATGTGAAA	0.448																																					p.S17Y		.											.	ANP32D-227	0			c.C50A						.						115.0	117.0	117.0					12																	48866497		2203	4300	6503	SO:0001583	missense	23519	exon1			CGCCCTCCGATGT	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.50C>A	12.37:g.48866497C>A	ENSP00000266594:p.Ser17Tyr	167	0		258	135	NM_012404	0	0	0	0	0	Q6NTC4	Missense_Mutation	SNP	ENST00000266594.1	37	CCDS31788.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.624087	0.46840	.	.	ENSG00000139223	ENST00000266594	T	0.00468	7.22	1.48	0.203	0.15195	.	0.288521	0.34986	N	0.003527	T	0.00552	0.0018	M	0.86343	2.81	0.38870	D	0.95666	P	0.47106	0.89	B	0.41088	0.347	T	0.68458	-0.5403	10	0.72032	D	0.01	.	4.9765	0.14144	0.0:0.6111:0.3889:0.0	.	17	O95626	AN32D_HUMAN	Y	17	ENSP00000266594:S17Y	ENSP00000266594:S17Y	S	+	2	0	ANP32D	47152764	0.897000	0.30589	0.027000	0.17364	0.572000	0.35998	-0.183000	0.09712	0.856000	0.35383	0.289000	0.19496	TCC	.		0.448	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
KRT77	374454	hgsc.bcm.edu	37	12	53086342	53086342	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:53086342G>C	ENST00000341809.3	-	7	1318	c.1290C>G	c.(1288-1290)gaC>gaG	p.D430E	KRT77_ENST00000537195.1_Missense_Mutation_p.D197E|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	430	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q429fs*17(1)		NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CCTCCTCCAGGTCCTGCAGCT	0.612																																					p.D430E		.											.	KRT77-187	1	Deletion - Frameshift(1)	ovary(1)	c.C1290G						.						44.0	41.0	42.0					12																	53086342		2203	4276	6479	SO:0001583	missense	374454	exon7			CTCCAGGTCCTGC	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1290C>G	12.37:g.53086342G>C	ENSP00000342710:p.Asp430Glu	39	0		46	3	NM_175078	0	0	0	0	0	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	37	CCDS8837.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.132215	0.00338	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	T;D	0.87887	-0.76;-2.31	4.29	0.889	0.19212	Filament (1);	.	.	.	.	T	0.63212	0.2492	N	0.03209	-0.39	0.09310	N	0.999999	B	0.27264	0.173	B	0.26614	0.071	T	0.57653	-0.7774	9	0.02654	T	1	.	3.5163	0.07726	0.0919:0.2007:0.4813:0.2261	.	430	Q7Z794	K2C1B_HUMAN	E	430;197	ENSP00000342710:D430E;ENSP00000440803:D197E	ENSP00000342710:D430E	D	-	3	2	KRT77	51372609	0.000000	0.05858	0.002000	0.10522	0.087000	0.18053	-0.966000	0.03825	0.368000	0.24481	-0.487000	0.04747	GAC	.		0.612	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
KRT4	3851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53205646	53205646	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:53205646C>G	ENST00000551956.1	-	2	1070	c.578G>C	c.(577-579)aGt>aCt	p.S193T	KRT4_ENST00000458244.2_Missense_Mutation_p.S173T|KRT4_ENST00000293774.4_Missense_Mutation_p.S267T			P19013	K2C4_HUMAN	keratin 4	207	Linker 1.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCTCAGGACACTGAGGTAGGT	0.537																																					p.S193T	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.G578C						.						114.0	119.0	117.0					12																	53205646		2030	4201	6231	SO:0001583	missense	3851	exon2			AGGACACTGAGGT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.578G>C	12.37:g.53205646C>G	ENSP00000448220:p.Ser193Thr	71	0		124	44	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	37	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	4.151	0.026479	0.08054	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	T;T;T	0.76316	-1.01;-1.01;-1.01	4.54	-1.88	0.07713	Filament (1);	0.363501	0.23947	N	0.042986	T	0.65291	0.2677	L	0.61218	1.895	0.19945	N	0.999941	B	0.21452	0.056	B	0.25614	0.062	T	0.51818	-0.8657	10	0.34782	T	0.22	.	0.9077	0.01288	0.2253:0.3089:0.1121:0.3537	.	207	P19013	K2C4_HUMAN	T	193;267;173	ENSP00000448220:S193T;ENSP00000293774:S267T;ENSP00000387904:S173T	ENSP00000293774:S267T	S	-	2	0	KRT4	51491913	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-1.038000	0.03553	-0.350000	0.08262	-0.137000	0.14449	AGT	.		0.537	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	85449852	85449852	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:85449852G>T	ENST00000393217.2	+	8	1342	c.1281G>T	c.(1279-1281)gtG>gtT	p.V427V		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	427										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAAATCTAGTGGATGAAAATT	0.294																																					p.V427V		.											.	LRRIQ1-95	0			c.G1281T						.						83.0	95.0	91.0					12																	85449852		2200	4297	6497	SO:0001819	synonymous_variant	84125	exon8			TCTAGTGGATGAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1281G>T	12.37:g.85449852G>T		160	0		279	34	NM_001079910	0	0	1	1	0	Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	37	CCDS41816.1																																																																																			.		0.294	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
SYCP3	50511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	102125409	102125409	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:102125409T>C	ENST00000392927.3	-	7	620	c.489A>G	c.(487-489)caA>caG	p.Q163Q	SYCP3_ENST00000392924.1_Silent_p.Q163Q|SYCP3_ENST00000266743.2_Silent_p.Q163Q	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	163	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						CAATTCTAGATTGTTGAAGAA	0.264																																					p.Q163Q		.											.	SYCP3-90	0			c.A489G						.						61.0	59.0	60.0					12																	102125409		2202	4281	6483	SO:0001819	synonymous_variant	50511	exon7			TCTAGATTGTTGA	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.489A>G	12.37:g.102125409T>C		29	0		41	24	NM_001177949	0	0	0	0	0		Silent	SNP	ENST00000392927.3	37	CCDS9087.1																																																																																			.		0.264	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
TRIAP1	51499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120884511	120884511	+	5'Flank	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:120884511C>T	ENST00000546954.1	-	0	0				TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Missense_Mutation_p.A76V|GATC_ENST00000551765.1_Missense_Mutation_p.L45F	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGTCTAGCGCTTGTGGACTT	0.682																																					p.L45F		.											.	GATC-22	0			c.C133T						.						29.0	33.0	32.0					12																	120884511		2202	4295	6497	SO:0001631	upstream_gene_variant	283459	exon2			CTAGCGCTTGTGG		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884511C>T	Exception_encountered	58	0		121	34	NM_176818	0	0	27	42	15	B2R4Z7|Q5RKS5|Q6LCA7	Missense_Mutation	SNP	ENST00000546954.1	37	CCDS9198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.450683|4.450683	0.84101|0.84101	.|.	.|.	ENSG00000111780|ENSG00000257218	ENST00000551806|ENST00000551765	.|T	.|0.55413	.|0.52	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.46483|0.46483	0.1395|0.1395	L|L	0.55213|0.55213	1.73|1.73	0.58432|0.58432	D|D	0.999996|0.999996	.|P	.|0.35456	.|0.502	.|B	.|0.31337	.|0.128	T|T	0.53272|0.53272	-0.8462|-0.8462	6|10	0.72032|0.87932	D|D	0.01|0	-15.3352|-15.3352	12.1028|12.1028	0.53794|0.53794	0.0:0.9221:0.0:0.0779|0.0:0.9221:0.0:0.0779	.|.	.|45	.|O43716	.|GATC_HUMAN	V|F	76|45	.|ENSP00000446872:L45F	ENSP00000450281:A76V|ENSP00000448397:L45F	A|L	+|+	2|1	0|0	GATC|AL021546.1	119368894|119368894	0.992000|0.992000	0.36948|0.36948	0.685000|0.685000	0.30070|0.30070	0.991000|0.991000	0.79684|0.79684	2.195000|2.195000	0.42677|0.42677	2.646000|2.646000	0.89796|0.89796	0.644000|0.644000	0.83932|0.83932	GCT|CTT	.		0.682	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108980.3	NM_016399	
GPR133	283383	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	131590407	131590407	+	Silent	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:131590407C>A	ENST00000261654.5	+	17	2443	c.1884C>A	c.(1882-1884)ggC>ggA	p.G628G	GPR133_ENST00000376682.4_Silent_p.G314G|GPR133_ENST00000543617.1_Silent_p.G147G|GPR133_ENST00000535015.1_Silent_p.G660G	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	628					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCGAGCCGGGCACGGTGAGTG	0.612																																					p.G628G		.											.	GPR133-191	0			c.C1884A						.						112.0	74.0	87.0					12																	131590407		2203	4300	6503	SO:0001819	synonymous_variant	283383	exon17			GCCGGGCACGGTG	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1884C>A	12.37:g.131590407C>A		20	0		33	17	NM_198827	0	0	0	0	0	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	37	CCDS9272.1																																																																																			.		0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
MNAT1	4331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	61434959	61434959	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr14:61434959T>C	ENST00000261245.4	+	8	923	c.822T>C	c.(820-822)caT>caC	p.H274H	RP11-193F5.1_ENST00000553946.1_RNA|MNAT1_ENST00000539616.2_Silent_p.H232H	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	274					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		ATTTAAACCATGTCAGAGCTG	0.388								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.H274H		.											.	MNAT1-523	0			c.T822C						.						128.0	116.0	120.0					14																	61434959		2203	4300	6503	SO:0001819	synonymous_variant	4331	exon8			AAACCATGTCAGA	X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.822T>C	14.37:g.61434959T>C		110	0		102	33	NM_002431	0	0	0	0	0	G3V1U8|Q15817|Q6ICQ7	Silent	SNP	ENST00000261245.4	37	CCDS9750.1																																																																																			.		0.388	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431	
MARK3	4140	hgsc.bcm.edu	37	14	103894758	103894758	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr14:103894758A>G	ENST00000429436.2	+	3	788	c.278A>G	c.(277-279)aAt>aGt	p.N93S	MARK3_ENST00000335102.5_Missense_Mutation_p.N93S|MARK3_ENST00000561071.1_3'UTR|MARK3_ENST00000216288.7_Missense_Mutation_p.N93S|MARK3_ENST00000416682.2_Missense_Mutation_p.N93S|MARK3_ENST00000553942.1_Missense_Mutation_p.N93S|MARK3_ENST00000440884.3_Missense_Mutation_p.N93S|MARK3_ENST00000303622.9_Missense_Mutation_p.N93S	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			ACTCAGTTGAATCCAACAAGT	0.284																																					p.N93S		.											.	MARK3-360	0			c.A278G						.						21.0	19.0	20.0					14																	103894758		1762	4021	5783	SO:0001583	missense	4140	exon3			AGTTGAATCCAAC	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.278A>G	14.37:g.103894758A>G	ENSP00000411397:p.Asn93Ser	3	0		12	8	NM_001128921	0	0	15	30	15	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	ENST00000429436.2	37	CCDS45165.1	.	.	.	.	.	.	.	.	.	.	A	8.139	0.784865	0.16189	.	.	ENSG00000075413	ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942	T;T;T;T;T;T;T	0.64618	-0.11;3.26;-0.11;-0.11;-0.11;-0.11;-0.11	5.27	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.093621	0.64402	D	0.000001	T	0.40694	0.1127	N	0.10685	0.025	0.54753	D	0.99998	B;P;B;B;B;B	0.36183	0.164;0.542;0.026;0.04;0.366;0.021	B;B;B;B;B;B	0.34180	0.127;0.177;0.038;0.043;0.136;0.009	T	0.40683	-0.9550	10	0.54805	T	0.06	.	11.4976	0.50417	0.8493:0.1507:0.0:0.0	.	93;93;93;93;93;93	P27448-2;P27448-6;P27448;Q86TT8;P27448-4;P27448-3	.;.;MARK3_HUMAN;.;.;.	S	93	ENSP00000335347:N93S;ENSP00000402104:N93S;ENSP00000408092:N93S;ENSP00000411397:N93S;ENSP00000303698:N93S;ENSP00000216288:N93S;ENSP00000450772:N93S	ENSP00000216288:N93S	N	+	2	0	MARK3	102964511	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	6.709000	0.74665	0.836000	0.34901	-0.313000	0.08912	AAT	.		0.284	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
PKD1	5310	ucsc.edu	37	16	2153595	2153595	+	Silent	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr16:2153595G>A	ENST00000262304.4	-	23	8671	c.8463C>T	c.(8461-8463)gaC>gaT	p.D2821D	PKD1_ENST00000423118.1_Silent_p.D2821D|PKD1_ENST00000561991.1_5'UTR	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2821	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCTGCACCACGTCACTGAGGT	0.622																																					p.D2821D													.	PKD1-91	0			c.C8463T						.						40.0	44.0	43.0					16																	2153595		2190	4282	6472	SO:0001819	synonymous_variant	5310	exon23			CACCACGTCACTG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8463C>T	16.37:g.2153595G>A		146	1		248	3	NM_000296	0	0	54	67	13	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.622	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
TERF2	7014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69402345	69402345	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr16:69402345C>G	ENST00000254942.3	-	6	897	c.881G>C	c.(880-882)aGt>aCt	p.S294T	TERF2_ENST00000603068.1_Missense_Mutation_p.S252T|TERF2_ENST00000569611.2_5'Flank	NM_005652.3	NP_005643.2	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2	294					age-dependent telomere shortening (GO:0001309)|cell cycle (GO:0007049)|cellular senescence (GO:0090398)|in utero embryonic development (GO:0001701)|negative regulation of telomere maintenance (GO:0032205)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|positive regulation of telomere maintenance (GO:0032206)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)|telomeric loop formation (GO:0031627)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded telomeric DNA binding (GO:0003691)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			NS(2)|breast(1)|large_intestine(3)|lung(1)	7		Ovarian(137;0.101)				CTTCCCTGTACTTGAGGCAGC	0.478																																					p.S294T	Ovarian(13;63 524 30420 31710 34037)	.											.	TERF2-227	0			c.G881C						.						133.0	121.0	125.0					16																	69402345		2198	4300	6498	SO:0001583	missense	7014	exon6			CCTGTACTTGAGG		CCDS10879.1, CCDS10879.2	16q22.1	2008-02-05			ENSG00000132604	ENSG00000132604			11729	protein-coding gene	gene with protein product		602027		TRBF2		9326950, 10226653	Standard	NM_005652		Approved	TRF2	uc002exd.4	Q15554	OTTHUMG00000137566	ENST00000254942.3:c.881G>C	16.37:g.69402345C>G	ENSP00000254942:p.Ser294Thr	67	0		160	61	NM_005652	0	1	12	31	18		Missense_Mutation	SNP	ENST00000254942.3	37		.	.	.	.	.	.	.	.	.	.	C	4.457	0.084724	0.08583	.	.	ENSG00000132604	ENST00000254942	.	.	.	4.95	0.394	0.16299	.	0.964177	0.08668	N	0.911414	T	0.36826	0.0981	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.31024	-0.9958	9	0.15066	T	0.55	0.7302	9.5105	0.39074	0.0:0.5756:0.3285:0.0959	.	252	Q15554	TERF2_HUMAN	T	252	.	ENSP00000254942:S252T	S	-	2	0	TERF2	67959846	.	.	0.002000	0.10522	0.255000	0.26057	.	.	0.218000	0.20820	0.555000	0.69702	AGT	.		0.478	TERF2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000268944.2		
GINS2	51659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	85715212	85715212	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr16:85715212T>C	ENST00000253462.3	-	3	381	c.281A>G	c.(280-282)gAa>gGa	p.E94G		NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	94					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(2)|lung(2)	6						CTTCGTAAGTTCCATGTAGTA	0.448																																					p.E94G		.											.	GINS2-90	0			c.A281G						.						183.0	164.0	170.0					16																	85715212		2198	4300	6498	SO:0001583	missense	51659	exon3			GTAAGTTCCATGT	BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.281A>G	16.37:g.85715212T>C	ENSP00000253462:p.Glu94Gly	50	0		130	66	NM_016095	1	0	18	30	11	D3DUM5|Q6IAG9	Missense_Mutation	SNP	ENST00000253462.3	37	CCDS10953.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.643560	0.87859	.	.	ENSG00000131153	ENST00000253462	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.81259	0.4785	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84916	0.0851	9	0.72032	D	0.01	-30.9692	14.3362	0.66592	0.0:0.0:0.0:1.0	.	94;94	Q53G08;Q9Y248	.;PSF2_HUMAN	G	94	.	ENSP00000253462:E94G	E	-	2	0	GINS2	84272713	1.000000	0.71417	0.970000	0.41538	0.939000	0.58152	7.531000	0.81973	1.874000	0.54306	0.459000	0.35465	GAA	.		0.448	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269098.1	NM_016095	
YBX2	51087	hgsc.bcm.edu	37	17	7197633	7197633	+	Missense_Mutation	SNP	A	A	G	rs8069533	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr17:7197633A>G	ENST00000007699.5	-	1	250	c.187T>C	c.(187-189)Tcc>Ccc	p.S63P	YBX2_ENST00000570627.1_Intron	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	63	Gly-rich.		S -> P (in dbSNP:rs8069533).		mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						GGGGTGCGGGAGCCCGGCGCC	0.816													G|||	1889	0.377196	0.3079	0.4769	5008	,	,		5716	0.245		0.5447	False		,,,				2504	0.364				p.S63P		.											.	YBX2-90	0			c.T187C	GRCh37	CM085124	YBX2	M	rs8069533	.						1.0	1.0	1.0					17																	7197633		363	837	1200	SO:0001583	missense	51087	exon1			TGCGGGAGCCCGG	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.187T>C	17.37:g.7197633A>G	ENSP00000007699:p.Ser63Pro	1	1		4	2	NM_015982	0	0	0	0	0	D3DTP1|Q8N4P0	Missense_Mutation	SNP	ENST00000007699.5	37	CCDS11098.1	910	0.4166666666666667	158	0.32113821138211385	182	0.5027624309392266	158	0.2762237762237762	412	0.5435356200527705	G	2.549	-0.304467	0.05495	.	.	ENSG00000006047	ENST00000007699	T	0.22945	1.93	4.06	0.88	0.19161	.	0.434820	0.17110	N	0.186656	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43909	-0.9362	9	0.11182	T	0.66	0.3984	6.9711	0.24648	0.4087:0.0:0.5913:0.0	rs8069533	63	Q9Y2T7	YBOX2_HUMAN	P	63	ENSP00000007699:S63P	ENSP00000007699:S63P	S	-	1	0	YBX2	7138357	.	.	0.863000	0.33907	0.401000	0.30781	.	.	-0.213000	0.10094	-0.665000	0.03846	TCC	A|0.584;G|0.416		0.816	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440172.2	NM_015982	
COX10	1352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	14005508	14005508	+	Silent	SNP	T	T	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr17:14005508T>A	ENST00000261643.3	+	4	650	c.573T>A	c.(571-573)ctT>ctA	p.L191L	COX10_ENST00000536205.1_Intron|COX10_ENST00000537334.1_5'UTR	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	191					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GTTTCCTGCTTACTTCTGTTG	0.473																																					p.L191L		.											.	COX10-226	0			c.T573A						.						174.0	152.0	160.0					17																	14005508		2203	4300	6503	SO:0001819	synonymous_variant	1352	exon4			CCTGCTTACTTCT	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.573T>A	17.37:g.14005508T>A		164	0		300	190	NM_001303	0	0	3	9	6	B2R6U5|B4DJ50|O15334|Q969F7	Silent	SNP	ENST00000261643.3	37	CCDS11166.1																																																																																			.		0.473	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
AATK	9625	hgsc.bcm.edu	37	17	79096100	79096100	+	Missense_Mutation	SNP	C	C	G	rs62073020	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr17:79096100C>G	ENST00000326724.4	-	11	1660	c.1636G>C	c.(1636-1638)Gac>Cac	p.D546H	AATK_ENST00000572339.1_5'Flank|AATK_ENST00000417379.1_Missense_Mutation_p.D443H|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	546					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCGGCGCAGTCAGGGTCGTGG	0.746													C|||	10	0.00199681	0.0	0.0014	5008	,	,		8349	0.0		0.004	False		,,,				2504	0.0051				p.D546H		.											.	AATK-933	0			c.G1636C						.	C	HIS/ASP,HIS/ASP	3,2899		0,3,1448	2.0	3.0	2.0		1636,1327	4.0	0.5	17	dbSNP_129	2	5,5973		0,5,2984	no	missense,missense	AATK	NM_001080395.2,NM_004920.2	81,81	0,8,4432	GG,GC,CC		0.0836,0.1034,0.0901	probably-damaging,probably-damaging	546/1375,443/1272	79096100	8,8872	1451	2989	4440	SO:0001583	missense	9625	exon11			CGCAGTCAGGGTC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1636G>C	17.37:g.79096100C>G	ENSP00000324196:p.Asp546His	3	1		3	3	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104323	0.56291	0.001034	8.36E-4	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.79653	-1.27;-1.29	3.96	3.96	0.45880	.	0.218250	0.36893	N	0.002349	D	0.85881	0.5800	L	0.52573	1.65	0.40902	D	0.984165	D	0.89917	1.0	D	0.72625	0.978	D	0.87951	0.2723	10	0.87932	D	0	.	13.7929	0.63152	0.0:1.0:0.0:0.0	rs62073020	546	Q6ZMQ8	LMTK1_HUMAN	H	546;510	ENSP00000324196:D546H;ENSP00000363924:D510H	ENSP00000324196:D546H	D	-	1	0	AATK	76710695	1.000000	0.71417	0.461000	0.27105	0.273000	0.26683	4.564000	0.60830	1.742000	0.51746	0.561000	0.74099	GAC	.		0.746	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
TXNL1	9352	bcgsc.ca	37	18	54293655	54293655	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr18:54293655G>C	ENST00000217515.6	-	2	336	c.132C>G	c.(130-132)ttC>ttG	p.F44L	TXNL1_ENST00000590954.1_Missense_Mutation_p.F44L|TXNL1_ENST00000540155.1_5'UTR	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	44	Thioredoxin.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TCATAGAACTGAATGCTGGGG	0.343																																					p.F44L													.	TXNL1-90	0			c.C132G						.						118.0	124.0	122.0					18																	54293655		2203	4300	6503	SO:0001583	missense	9352	exon2			AGAACTGAATGCT	AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.132C>G	18.37:g.54293655G>C	ENSP00000217515:p.Phe44Leu	123	0		166	5	NM_004786	0	0	60	62	2		Missense_Mutation	SNP	ENST00000217515.6	37	CCDS11961.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600187	0.87055	.	.	ENSG00000091164	ENST00000217515	T	0.16743	2.32	5.56	3.76	0.43208	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.20780	0.0500	L	0.47190	1.495	0.80722	D	1	P;P	0.50443	0.935;0.905	P;P	0.47981	0.548;0.563	T	0.01448	-1.1352	10	0.42905	T	0.14	.	12.0451	0.53475	0.1438:0.0:0.8562:0.0	.	44;44	B2R960;O43396	.;TXNL1_HUMAN	L	44	ENSP00000217515:F44L	ENSP00000217515:F44L	F	-	3	2	TXNL1	52444653	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.041000	0.49807	1.360000	0.45960	0.655000	0.94253	TTC	.		0.343	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2		
SMARCA4	6597	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11144469	11144469	+	Silent	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:11144469C>A	ENST00000429416.3	+	28	4082	c.3801C>A	c.(3799-3801)ggC>ggA	p.G1267G	SMARCA4_ENST00000590574.1_Intron|SMARCA4_ENST00000344626.4_Silent_p.G1267G|SMARCA4_ENST00000444061.3_Intron|SMARCA4_ENST00000450717.3_Intron|SMARCA4_ENST00000538456.3_Intron|SMARCA4_ENST00000541122.2_Intron|SMARCA4_ENST00000589677.1_Intron|SMARCA4_ENST00000413806.3_Intron|SMARCA4_ENST00000358026.2_Silent_p.G1267G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1267					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				cgggcagcggcagtgccagct	0.577			"""F, N, Mis"""		NSCLC																																p.G1267G				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.C3801A						.						24.0	28.0	27.0					19																	11144469		2201	4297	6498	SO:0001819	synonymous_variant	6597	exon27			CAGCGGCAGTGCC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3801C>A	19.37:g.11144469C>A		46	0		69	9	NM_003072	0	0	13	17	4	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	ENST00000429416.3	37	CCDS12253.1																																																																																			.		0.577	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
FAM187B	148109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35718874	35718874	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:35718874C>T	ENST00000324675.3	-	1	758	c.710G>A	c.(709-711)gGa>gAa	p.G237E		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	237						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						GTACATGGATCCTAAGGGACA	0.507																																					p.G237E		.											.	FAM187B-92	0			c.G710A						.						67.0	57.0	60.0					19																	35718874		2203	4300	6503	SO:0001583	missense	148109	exon1			ATGGATCCTAAGG	AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.710G>A	19.37:g.35718874C>T	ENSP00000323355:p.Gly237Glu	26	0		37	13	NM_152481	0	0	0	0	0	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	CCDS12448.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687642	0.29962	.	.	ENSG00000177558	ENST00000324675	T	0.39592	1.07	4.91	1.25	0.21368	.	0.519698	0.15947	N	0.236896	T	0.50274	0.1606	L	0.57536	1.79	0.09310	N	1	D	0.57899	0.981	P	0.53401	0.725	T	0.49041	-0.8980	10	0.72032	D	0.01	-2.2526	13.4884	0.61379	0.0:0.4094:0.5906:0.0	.	237	Q17R55	F187B_HUMAN	E	237	ENSP00000323355:G237E	ENSP00000323355:G237E	G	-	2	0	FAM187B	40410714	0.319000	0.24607	0.289000	0.24876	0.145000	0.21501	0.869000	0.27996	0.564000	0.29238	-0.175000	0.13238	GGA	.		0.507	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481	
FCGBP	8857	broad.mit.edu	37	19	40367841	40367841	+	Silent	SNP	T	T	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:40367841T>G	ENST00000221347.6	-	29	13126	c.13119A>C	c.(13117-13119)gcA>gcC	p.A4373A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4373	TIL 10.					extracellular vesicular exosome (GO:0070062)		p.A4373A(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCGTAAGGGGTGCAGGGGACG	0.627																																					p.A4373A													.	FCGBP-98	2	Substitution - coding silent(2)	lung(1)|kidney(1)	c.A13119C						.						17.0	32.0	27.0					19																	40367841		2132	4018	6150	SO:0001819	synonymous_variant	8857	exon29			AAGGGGTGCAGGG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13119A>C	19.37:g.40367841T>G		48	7		56	17	NM_003890	0	0	108	115	7	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF780B	163131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40540794	40540794	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:40540794G>C	ENST00000434248.1	-	5	2037	c.1972C>G	c.(1972-1974)Caa>Gaa	p.Q658E	ZNF780B_ENST00000221355.6_Missense_Mutation_p.Q510E	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	658					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTCTGATGTTGAACAAGGTTT	0.388																																					p.Q658E		.											.	ZNF780B-47	0			c.C1972G						.						167.0	180.0	176.0					19																	40540794		2201	4300	6501	SO:0001583	missense	163131	exon5			GATGTTGAACAAG	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1972C>G	19.37:g.40540794G>C	ENSP00000391641:p.Gln658Glu	263	2		310	113	NM_001005851	0	0	5	6	1	B9EH00	Missense_Mutation	SNP	ENST00000434248.1	37	CCDS46077.1	.	.	.	.	.	.	.	.	.	.	g	0.438	-0.899982	0.02472	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.15139	2.45;2.45	2.56	-0.573	0.11742	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05273	0.0140	N	0.04669	-0.19	0.09310	N	1	B	0.30709	0.291	B	0.29663	0.105	T	0.37056	-0.9722	9	0.02654	T	1	.	5.8975	0.18947	0.0:0.4996:0.321:0.1794	.	658	Q9Y6R6	Z780B_HUMAN	E	658;510	ENSP00000391641:Q658E;ENSP00000221355:Q510E	ENSP00000221355:Q510E	Q	-	1	0	ZNF780B	45232634	0.000000	0.05858	0.312000	0.25196	0.637000	0.38172	-0.905000	0.04075	0.184000	0.20083	0.462000	0.41574	CAA	.		0.388	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851	
ATP1A3	478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42492245	42492245	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:42492245G>A	ENST00000302102.5	-	4	350	c.200C>T	c.(199-201)cCt>cTt	p.P67L	ATP1A3_ENST00000543770.1_Missense_Mutation_p.P78L|ATP1A3_ENST00000545399.1_Missense_Mutation_p.P80L|ATP1A3_ENST00000468774.2_5'UTR|ATP1A3_ENST00000602133.1_Missense_Mutation_p.P37L	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	67					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GAGTGCGTTAGGCCCATCCCG	0.637																																					p.P80L		.											.	ATP1A3-92	0			c.C239T						.						103.0	107.0	106.0					19																	42492245		2203	4300	6503	SO:0001583	missense	478	exon4			GCGTTAGGCCCAT		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.200C>T	19.37:g.42492245G>A	ENSP00000302397:p.Pro67Leu	118	0		133	16	NM_001256214	0	0	0	0	0	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095660	0.56075	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770;ENST00000448429	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	4.09	4.09	0.47781	ATPase, P-type cation-transporter, N-terminal (2);	0.185108	0.46758	D	0.000274	D	0.89065	0.6609	M	0.80616	2.505	0.80722	D	1	B;D;D;D	0.76494	0.383;0.998;0.999;0.997	B;D;D;D	0.75484	0.126;0.965;0.986;0.979	D	0.90107	0.4189	10	0.54805	T	0.06	.	14.1703	0.65506	0.0:0.0:1.0:0.0	.	80;78;67;67	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	L	67;67;80;37;78;80	ENSP00000302397:P67L;ENSP00000411503:P67L;ENSP00000444688:P80L;ENSP00000437577:P78L	ENSP00000302397:P67L	P	-	2	0	ATP1A3	47184085	1.000000	0.71417	0.945000	0.38365	0.021000	0.10359	9.808000	0.99193	2.010000	0.58986	0.491000	0.48974	CCT	.		0.637	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ZNF836	162962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52660096	52660096	+	Silent	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:52660096G>A	ENST00000322146.8	-	5	1361	c.840C>T	c.(838-840)ggC>ggT	p.G280G	ZNF836_ENST00000597252.1_Silent_p.G280G|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGAAGATCTTGCCACATACAC	0.413																																					p.G280G		.											.	ZNF836-46	0			c.C840T						.						85.0	90.0	88.0					19																	52660096		2176	4286	6462	SO:0001819	synonymous_variant	162962	exon5			GATCTTGCCACAT	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.840C>T	19.37:g.52660096G>A		69	0		114	46	NM_001102657	0	0	4	4	0		Silent	SNP	ENST00000322146.8	37	CCDS46162.1																																																																																			.		0.413	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
ZNF264	9422	bcgsc.ca	37	19	57724137	57724137	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:57724137C>G	ENST00000263095.6	+	4	2086	c.1672C>G	c.(1672-1674)Caa>Gaa	p.Q558E	ZNF264_ENST00000536056.1_Missense_Mutation_p.Q558E	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	558					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CACTCAGCATCAAAGGATGCA	0.453																																					p.Q558E													.	ZNF264-92	0			c.C1672G						.						100.0	97.0	98.0					19																	57724137		2203	4300	6503	SO:0001583	missense	9422	exon4			CAGCATCAAAGGA	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1672C>G	19.37:g.57724137C>G	ENSP00000263095:p.Gln558Glu	88	0		108	5	NM_003417	0	0	1	1	0	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241123	0.22711	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.07327	3.2;3.2	2.35	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06234	0.0161	L	0.28014	0.82	0.21553	N	0.999646	B	0.27853	0.191	B	0.18263	0.021	T	0.27226	-1.0080	9	0.59425	D	0.04	.	8.9199	0.35605	0.0:0.7681:0.2319:0.0	.	558	O43296	ZN264_HUMAN	E	558	ENSP00000263095:Q558E;ENSP00000440376:Q558E	ENSP00000263095:Q558E	Q	+	1	0	ZNF264	62415949	0.000000	0.05858	0.624000	0.29186	0.955000	0.61496	0.743000	0.26231	1.644000	0.50603	0.491000	0.48974	CAA	.		0.453	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
IFT172	26160	hgsc.bcm.edu	37	2	27704121	27704121	+	Silent	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:27704121A>G	ENST00000260570.3	-	8	680	c.577T>C	c.(577-579)Ttg>Ctg	p.L193L	IFT172_ENST00000359466.6_Silent_p.L193L|IFT172_ENST00000416524.2_Silent_p.L172L	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	193					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TGGTTAACCAACTTCCCCTAA	0.493																																					p.L193L		.											.	IFT172-154	0			c.T577C						.						43.0	40.0	41.0					2																	27704121		2203	4300	6503	SO:0001819	synonymous_variant	26160	exon8			TAACCAACTTCCC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.577T>C	2.37:g.27704121A>G		22	0		29	2	NM_015662	0	0	0	0	0	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	CCDS1755.1																																																																																			.		0.493	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
LTBP1	4052	hgsc.bcm.edu;bcgsc.ca	37	2	33412006	33412006	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:33412006C>A	ENST00000404816.2	+	6	1638	c.1285C>A	c.(1285-1287)Ctt>Att	p.L429I	LTBP1_ENST00000402934.1_Missense_Mutation_p.L103I|LTBP1_ENST00000354476.3_Missense_Mutation_p.L429I|LTBP1_ENST00000407925.1_Missense_Mutation_p.L103I|LTBP1_ENST00000390003.4_Missense_Mutation_p.L103I|LTBP1_ENST00000418533.2_Missense_Mutation_p.L103I|LTBP1_ENST00000404525.1_Missense_Mutation_p.L103I			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	429	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CACAGGAAAACTTTGTCAGAT	0.478																																					p.L429I		.											.	LTBP1-230	0			c.C1285A						.						116.0	108.0	110.0					2																	33412006		2203	4300	6503	SO:0001583	missense	4052	exon6			GGAAAACTTTGTC		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1285C>A	2.37:g.33412006C>A	ENSP00000386043:p.Leu429Ile	68	0		57	20	NM_206943	0	0	0	0	0	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962600	0.53400	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95	5.3	5.3	0.74995	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.87849	0.6281	L	0.32530	0.975	0.80722	D	1	B;B;B;B;B;B	0.25441	0.077;0.028;0.016;0.033;0.096;0.126	B;B;B;B;B;B	0.28709	0.043;0.016;0.017;0.027;0.05;0.093	D	0.85678	0.1299	9	0.66056	D	0.02	.	12.3249	0.55005	0.0:0.9228:0.0:0.0772	.	429;103;103;103;103;429	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	I	429;429;118;103;103;103;103;103	ENSP00000386043:L429I;ENSP00000346467:L429I;ENSP00000374653:L103I;ENSP00000393057:L103I;ENSP00000384373:L103I;ENSP00000385359:L103I;ENSP00000384091:L103I	ENSP00000346467:L429I	L	+	1	0	LTBP1	33265510	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.239000	0.58694	2.468000	0.83385	0.655000	0.94253	CTT	.		0.478	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
GGCX	2677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	85777685	85777685	+	Missense_Mutation	SNP	G	G	T	rs372492949		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:85777685G>T	ENST00000233838.4	-	14	2157	c.2077C>A	c.(2077-2079)Cgc>Agc	p.R693S	GGCX_ENST00000473665.1_5'Flank|GGCX_ENST00000430215.3_Missense_Mutation_p.R636S	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	693					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	TACCTGCGGCGAAAGACATAG	0.468																																					p.R693S		.											.	GGCX-91	0			c.C2077A						.						53.0	56.0	55.0					2																	85777685		2203	4300	6503	SO:0001583	missense	2677	exon14			TGCGGCGAAAGAC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.2077C>A	2.37:g.85777685G>T	ENSP00000233838:p.Arg693Ser	85	0		92	42	NM_000821	0	0	0	0	0	B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	ENST00000233838.4	37	CCDS1978.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395574	0.83011	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	T;T	0.28895	1.59;1.59	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.56673	0.2001	M	0.72118	2.19	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	T	0.55302	-0.8162	10	0.54805	T	0.06	-15.286	17.5141	0.87768	0.0:0.0:1.0:0.0	.	636;509;693	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	S	693;636	ENSP00000233838:R693S;ENSP00000408045:R636S	ENSP00000233838:R693S	R	-	1	0	GGCX	85631196	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.029000	0.57253	2.730000	0.93505	0.655000	0.94253	CGC	.		0.468	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252490.3	NM_000821	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152507333	152507333	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:152507333C>T	ENST00000172853.10	-	53	7129	c.6982G>A	c.(6982-6984)Gac>Aac	p.D2328N	NEB_ENST00000427231.2_Missense_Mutation_p.D2328N|NEB_ENST00000397345.3_Missense_Mutation_p.D2328N|NEB_ENST00000604864.1_Missense_Mutation_p.D2328N|NEB_ENST00000409198.1_Missense_Mutation_p.D2328N|NEB_ENST00000603639.1_Missense_Mutation_p.D2328N			P20929	NEBU_HUMAN	nebulin	2328					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTTTTGGGTCATCTTGCAGA	0.413																																					p.D2328N		.											.	NEB-145	0			c.G6982A						.						187.0	191.0	190.0					2																	152507333		1983	4164	6147	SO:0001583	missense	4703	exon53			TTGGGTCATCTTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6982G>A	2.37:g.152507333C>T	ENSP00000172853:p.Asp2328Asn	231	0		287	142	NM_004543	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	34	5.297627	0.95574	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.75903	0.3913	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77461	-0.2579	10	0.34782	T	0.22	.	19.3325	0.94297	0.0:1.0:0.0:0.0	.	2328	P20929	NEBU_HUMAN	N	2328	ENSP00000386259:D2328N;ENSP00000380505:D2328N;ENSP00000416578:D2328N;ENSP00000172853:D2328N	ENSP00000172853:D2328N	D	-	1	0	NEB	152215579	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.770000	0.85390	2.583000	0.87209	0.650000	0.86243	GAC	.		0.413	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
RAPGEF4	11069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	173832042	173832042	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:173832042G>A	ENST00000397081.3	+	10	1017	c.874G>A	c.(874-876)Gat>Aat	p.D292N	RAPGEF4_ENST00000535187.1_Missense_Mutation_p.D72N|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.D148N|RAPGEF4_ENST00000538974.1_Missense_Mutation_p.D121N|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.D291N|RAPGEF4_ENST00000540783.1_Missense_Mutation_p.D139N|RAPGEF4_ENST00000473043.1_3'UTR|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.D292N|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.D139N	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	292					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ATTTCTGGATGATGAGCACGA	0.527																																					p.D292N		.											.	RAPGEF4-274	0			c.G874A						.						51.0	53.0	52.0					2																	173832042		2072	4228	6300	SO:0001583	missense	11069	exon10			CTGGATGATGAGC	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.874G>A	2.37:g.173832042G>A	ENSP00000380271:p.Asp292Asn	23	0		33	18	NM_007023	0	0	0	0	0	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	ENST00000397081.3	37	CCDS42775.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453522	0.96223	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000539767;ENST00000535187	T;T;T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5	5.31	5.31	0.75309	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	M	0.74258	2.255	0.80722	D	1	D;D;D;D;D	0.89917	0.993;1.0;0.996;0.992;1.0	P;D;D;P;D	0.87578	0.897;0.998;0.948;0.889;0.996	T	0.28681	-1.0036	10	0.72032	D	0.01	.	18.9765	0.92738	0.0:0.0:1.0:0.0	.	119;121;148;292;292	B7Z805;B7Z2R0;Q8WZA2-3;Q8WZA2;E9PB94	.;.;.;RPGF4_HUMAN;.	N	291;292;292;148;121;139;139;119;72	ENSP00000264111:D291N;ENSP00000380271:D292N;ENSP00000387104:D292N;ENSP00000380276:D148N;ENSP00000440135:D121N;ENSP00000440250:D139N;ENSP00000437384:D139N;ENSP00000438011:D72N	ENSP00000264111:D291N	D	+	1	0	RAPGEF4	173540288	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	9.822000	0.99363	2.478000	0.83669	0.561000	0.74099	GAT	.		0.527	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218712984	218712984	+	Silent	SNP	G	G	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:218712984G>C	ENST00000171887.4	-	17	2333	c.1881C>G	c.(1879-1881)ccC>ccG	p.P627P	TNS1_ENST00000430930.1_Silent_p.P627P|TNS1_ENST00000419504.1_Silent_p.P627P|TNS1_ENST00000480665.1_5'Flank	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	627					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGGGCAGCTGGGGTTCAGCTT	0.652																																					p.P627P		.											.	TNS1-156	0			c.C1881G						.						45.0	38.0	40.0					2																	218712984		2203	4299	6502	SO:0001819	synonymous_variant	7145	exon17			CAGCTGGGGTTCA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1881C>G	2.37:g.218712984G>C		59	0		79	37	NM_022648	0	0	20	31	11	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																			.		0.652	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
MYEOV2	150678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241073371	241073371	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:241073371C>G	ENST00000607357.1	-	2	133	c.115G>C	c.(115-117)Gtt>Ctt	p.V39L	MYEOV2_ENST00000489698.1_5'UTR|MYEOV2_ENST00000307266.3_Missense_Mutation_p.V70L	NM_001163424.1	NP_001156896.1	Q8WXC6	MYOV2_HUMAN	myeloma overexpressed 2	39								p.V70F(1)		breast(1)|lung(5)|pancreas(1)	7		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		TCTGCATGAACGGCCTTTTCA	0.483																																					p.V70L		.											.	MYEOV2-68	1	Substitution - Missense(1)	lung(1)	c.G208C						.						127.0	130.0	129.0					2																	241073371		2203	4300	6503	SO:0001583	missense	150678	exon2			CATGAACGGCCTT	AF453951	CCDS2532.1, CCDS63183.1	2q37.3	2008-02-05			ENSG00000172428	ENSG00000172428			21314	protein-coding gene	gene with protein product							Standard	NM_138336		Approved		uc002vyu.1	Q8WXC6	OTTHUMG00000133352	ENST00000607357.1:c.115G>C	2.37:g.241073371C>G	ENSP00000475979:p.Val39Leu	132	0		168	65	NM_138336	0	0	79	142	63	Q8N110	Missense_Mutation	SNP	ENST00000607357.1	37		.	.	.	.	.	.	.	.	.	.	C	21.1	4.096434	0.76870	.	.	ENSG00000172428	ENST00000307266;ENST00000403160	.	.	.	4.55	3.67	0.42095	.	0.000000	0.64402	U	0.000001	T	0.74137	0.3677	.	.	.	0.58432	D	0.999999	B;D	0.57899	0.04;0.981	B;P	0.62382	0.041;0.901	T	0.76203	-0.3045	8	0.72032	D	0.01	-4.0557	10.5952	0.45333	0.0:0.9036:0.0:0.0963	.	39;70	Q8WXC6;Q8WXC6-1	MYOV2_HUMAN;.	L	70;60	.	ENSP00000304147:V70L	V	-	1	0	MYEOV2	240722044	1.000000	0.71417	0.472000	0.27241	0.971000	0.66376	6.092000	0.71414	1.042000	0.40150	0.650000	0.86243	GTT	.		0.483	MYEOV2-005	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470698.1	NM_138336	
FRG1B	284802	bcgsc.ca	37	20	29628229	29628229	+	Silent	SNP	G	G	T	rs373737774		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr20:29628229G>T	ENST00000278882.3	+	6	611	c.231G>T	c.(229-231)ggG>ggT	p.G77G	FRG1B_ENST00000439954.2_Silent_p.G82G|FRG1B_ENST00000358464.4_Silent_p.G77G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	77										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTT	0.353																																					.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.231G>T	20.37:g.29628229G>T		301	5		519	29	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SCARF2	91179	broad.mit.edu	37	22	20791897	20791897	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr22:20791897G>T	ENST00000266214.5	-	1	249	c.145C>A	c.(145-147)Cgc>Agc	p.R49S	SCARF2_ENST00000405555.3_Missense_Mutation_p.R49S	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	49					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TTGCGGCCGCGAGGGTTCAGT	0.741																																					p.R49S													.	SCARF2-341	0			c.C145A						.						5.0	7.0	7.0					22																	20791897		2125	4206	6331	SO:0001583	missense	91179	exon1			GGCCGCGAGGGTT	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.145C>A	22.37:g.20791897G>T	ENSP00000266214:p.Arg49Ser	17	0		16	7	NM_182895	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Missense_Mutation	SNP	ENST00000266214.5	37	CCDS13779.1	.	.	.	.	.	.	.	.	.	.	G	1.646	-0.515131	0.04200	.	.	ENSG00000244486	ENST00000405555;ENST00000341328;ENST00000266214	T;T	0.19105	2.23;2.17	2.65	1.57	0.23409	.	0.223960	0.29451	U	0.012102	T	0.06371	0.0164	N	0.02225	-0.63	0.54753	D	0.999987	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.28332	-1.0047	10	0.10111	T	0.7	-16.2973	7.303	0.26432	0.0:0.2762:0.7238:0.0	.	49;49	E5RFB8;Q96GP6	.;SREC2_HUMAN	S	49	ENSP00000385589:R49S;ENSP00000266214:R49S	ENSP00000266214:R49S	R	-	1	0	SCARF2	19121897	0.998000	0.40836	0.988000	0.46212	0.206000	0.24218	2.710000	0.47169	0.438000	0.26450	-0.547000	0.04224	CGC	.		0.741	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
TTLL3	26140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9877081	9877081	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:9877081G>A	ENST00000547186.1	+	13	2443	c.2227G>A	c.(2227-2229)Gtg>Atg	p.V743M	TTLL3_ENST00000426895.4_Missense_Mutation_p.V886M|TTLL3_ENST00000383827.1_3'UTR|ARPC4-TTLL3_ENST00000397256.1_3'UTR|TTLL3_ENST00000397241.1_3'UTR|TTLL3_ENST00000455274.1_Intron	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	743					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					AAAGAAACAAGTGAAGTATTT	0.567																																					p.V886M		.											.	TTLL3-585	0			c.G2656A						.						122.0	128.0	126.0					3																	9877081		1906	4123	6029	SO:0001583	missense	26140	exon13			AAACAAGTGAAGT		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.2227G>A	3.37:g.9877081G>A	ENSP00000446659:p.Val743Met	160	0		311	108	NM_001025930	0	0	2	2	0	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	37		.	.	.	.	.	.	.	.	.	.	G	9.673	1.147353	0.21288	.	.	ENSG00000214021	ENST00000426895;ENST00000547186	T;T	0.06294	3.32;3.44	3.94	-1.13	0.09775	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.42275	-0.9461	9	0.87932	D	0	.	3.4181	0.07382	0.437:0.0:0.3814:0.1815	.	743	Q9Y4R7	TTLL3_HUMAN	M	886;743	ENSP00000392549:V886M;ENSP00000446659:V743M	ENSP00000392549:V886M	V	+	1	0	TTLL3	9852081	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.357000	0.07651	-0.239000	0.09710	-0.314000	0.08810	GTG	.		0.567	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52526307	52526307	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:52526307C>A	ENST00000479054.1	+	22	4396	c.4324C>A	c.(4324-4326)Ctc>Atc	p.L1442I	NISCH_ENST00000345716.4_Missense_Mutation_p.L1442I			Q9Y2I1	NISCH_HUMAN	nischarin	1442					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	AGGTCATGACCTCATGGGCAG	0.657																																					p.L1442I		.											.	NISCH-93	0			c.C4324A						.						154.0	153.0	153.0					3																	52526307		2203	4300	6503	SO:0001583	missense	11188	exon21			CATGACCTCATGG	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.4324C>A	3.37:g.52526307C>A	ENSP00000418232:p.Leu1442Ile	309	0		441	133	NM_007184	0	0	32	48	16	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107084	0.77096	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.13089	2.62;2.62	5.37	4.3	0.51218	.	0.078630	0.51477	D	0.000098	T	0.18800	0.0451	L	0.27053	0.805	0.37589	D	0.920105	D	0.67145	0.996	P	0.58210	0.835	T	0.02307	-1.1179	10	0.72032	D	0.01	-30.3479	11.4769	0.50304	0.0:0.8448:0.0:0.1552	.	1442	Q9Y2I1	NISCH_HUMAN	I	1442;1442;366;786	ENSP00000418232:L1442I;ENSP00000339958:L1442I	ENSP00000339958:L1442I	L	+	1	0	NISCH	52501347	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.763000	0.47605	2.535000	0.85469	0.561000	0.74099	CTC	.		0.657	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
KIAA2018	205717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113376680	113376680	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:113376680G>T	ENST00000478658.1	-	5	3866	c.3849C>A	c.(3847-3849)ggC>ggA	p.G1283G	KIAA2018_ENST00000316407.4_Silent_p.G1283G|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1283						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GAGGTTGACTGCCATAGGAGC	0.468																																					p.G1283G		.											.	KIAA2018-93	0			c.C3849A						.						109.0	105.0	106.0					3																	113376680		1947	4151	6098	SO:0001819	synonymous_variant	205717	exon7			TTGACTGCCATAG	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3849C>A	3.37:g.113376680G>T		165	0		222	140	NM_001009899	0	0	0	2	2	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123254840	123254840	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:123254840A>G	ENST00000264501.4	+	68	11895	c.11522A>G	c.(11521-11523)aAg>aGg	p.K3841R	KIAA1109_ENST00000388738.3_Missense_Mutation_p.K3841R			Q2LD37	K1109_HUMAN	KIAA1109	3841	Poly-Lys.				regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAAAAGAAGAAGTTTCAAACT	0.348																																					p.K3841R		.											.	KIAA1109-80	0			c.A11522G						.						80.0	72.0	74.0					4																	123254840		1827	4081	5908	SO:0001583	missense	84162	exon66			AGAAGAAGTTTCA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11522A>G	4.37:g.123254840A>G	ENSP00000264501:p.Lys3841Arg	37	0		46	23	NM_015312	0	0	5	16	11	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.9|24.9	4.586223|4.586223	0.86851|0.86851	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707|ENST00000306802	T;T;T|.	0.35421|.	2.32;2.32;1.31|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72120|0.72120	0.3421|0.3421	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.974;0.997|.	D;D|.	0.73380|.	0.969;0.98|.	T|T	0.70941|0.70941	-0.4735|-0.4735	10|5	0.45353|.	T|.	0.12|.	.|.	16.1413|16.1413	0.81528|0.81528	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3840;3841|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	R|G	3841;3841;545|252	ENSP00000264501:K3841R;ENSP00000373390:K3841R;ENSP00000410874:K545R|.	ENSP00000264501:K3841R|.	K|S	+|+	2|1	0|0	KIAA1109|KIAA1109	123474290|123474290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.910000|8.910000	0.92685|0.92685	2.270000|2.270000	0.75569|0.75569	0.482000|0.482000	0.46254|0.46254	AAG|AGT	.		0.348	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
NUDT6	11162	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123843660	123843660	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:123843660G>A	ENST00000304430.5	-	1	101	c.68C>T	c.(67-69)tCg>tTg	p.S23L	SPATA5_ENST00000274008.4_5'Flank|NUDT6_ENST00000339154.2_Intron	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	23						mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						GTAACCCGCCGAAGGCCCGGG	0.677																																					p.S23L													.	NUDT6-90	0			c.C68T						.						14.0	18.0	17.0					4																	123843660		1877	4043	5920	SO:0001583	missense	11162	exon1			CCCGCCGAAGGCC	AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.68C>T	4.37:g.123843660G>A	ENSP00000306070:p.Ser23Leu	32	0		39	5	NM_007083	0	0	5	6	1	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	ENST00000304430.5	37	CCDS43268.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823757	0.32237	.	.	ENSG00000170917	ENST00000304430	T	0.22945	1.93	3.97	-7.94	0.01152	.	2.861800	0.01561	N	0.020112	T	0.08044	0.0201	N	0.02539	-0.55	0.09310	N	0.999995	B	0.06786	0.001	B	0.04013	0.001	T	0.22103	-1.0226	10	0.09843	T	0.71	3.0083	6.3736	0.21495	0.2466:0.543:0.1195:0.091	.	23	P53370	NUDT6_HUMAN	L	23	ENSP00000306070:S23L	ENSP00000306070:S23L	S	-	2	0	NUDT6	124063110	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.472000	0.02341	-2.060000	0.00893	0.462000	0.41574	TCG	.		0.677	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095331.3	NM_007083	
CBR4	84869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	169931208	169931208	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:169931208G>T	ENST00000306193.3	-	1	201	c.33C>A	c.(31-33)tcC>tcA	p.S11S	CBR4_ENST00000504480.1_Silent_p.S11S|RP11-483A20.3_ENST00000506933.1_RNA	NM_032783.4	NP_116172.2	Q8N4T8	CBR4_HUMAN	carbonyl reductase 4	11					daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|fatty acid biosynthetic process (GO:0006633)|protein homotetramerization (GO:0051289)	mitochondrial matrix (GO:0005759)	NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|NADPH binding (GO:0070402)|NADPH dehydrogenase (quinone) activity (GO:0008753)|quinone binding (GO:0048038)			kidney(1)|large_intestine(2)|lung(2)	5		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		CAATGCCTCGGGAGCCTCCAA	0.602											OREG0016397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S11S		.											.	CBR4-90	0			c.C33A						.						50.0	54.0	52.0					4																	169931208		2203	4300	6503	SO:0001819	synonymous_variant	84869	exon1			GCCTCGGGAGCCT	BC021973	CCDS3812.1	4q32.3	2013-10-11			ENSG00000145439	ENSG00000145439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	25891	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 45C, member 1"""					19027726	Standard	NM_032783		Approved	FLJ14431, SDR45C1	uc003iry.3	Q8N4T8	OTTHUMG00000161025	ENST00000306193.3:c.33C>A	4.37:g.169931208G>T		49	0	1881	44	22	NM_032783	0	0	20	35	15	Q8WTW8|Q96K93	Silent	SNP	ENST00000306193.3	37	CCDS3812.1																																																																																			.		0.602	CBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363441.2	NM_032783	
FAT1	2195	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	187540602	187540602	+	Missense_Mutation	SNP	C	C	T	rs201352448		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:187540602C>T	ENST00000441802.2	-	10	7347	c.7138G>A	c.(7138-7140)Gtt>Att	p.V2380I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2380	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGGTCGGTAACGTCCACCGTG	0.502										HNSCC(5;0.00058)																											p.V2380I	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.G7138A						.						67.0	68.0	67.0					4																	187540602		2106	4223	6329	SO:0001583	missense	2195	exon10			CGGTAACGTCCAC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7138G>A	4.37:g.187540602C>T	ENSP00000406229:p.Val2380Ile	52	0		67	35	NM_005245	0	0	36	79	43		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092207	0.36952	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.61510	0.1	5.14	4.3	0.51218	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.121633	0.56097	N	0.000035	T	0.38799	0.1054	N	0.26130	0.795	0.58432	D	0.999996	B	0.30851	0.297	B	0.25614	0.062	T	0.20306	-1.0279	10	0.22109	T	0.4	.	9.4366	0.38643	0.0:0.8376:0.0:0.1624	.	2380	Q14517	FAT1_HUMAN	I	2380;2382	ENSP00000406229:V2380I	ENSP00000260147:V2382I	V	-	1	0	FAT1	187777596	0.992000	0.36948	0.999000	0.59377	0.398000	0.30690	1.481000	0.35476	1.527000	0.49086	0.650000	0.86243	GTT	C|0.999;T|0.001		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	73136427	73136427	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr5:73136427T>C	ENST00000426542.2	+	10	1289	c.1269T>C	c.(1267-1269)agT>agC	p.S423S	ARHGEF28_ENST00000513841.1_3'UTR|ARHGEF28_ENST00000545377.1_Silent_p.S423S|ARHGEF28_ENST00000513042.2_Silent_p.S423S|ARHGEF28_ENST00000296799.4_Silent_p.S110S|ARHGEF28_ENST00000296794.6_Silent_p.S423S|ARHGEF28_ENST00000287898.5_Silent_p.S423S|ARHGEF28_ENST00000437974.1_Silent_p.S423S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	423					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										CAGAAACCAGTCCCAGTGTGT	0.493																																					p.S423S		.											.	.	0			c.T1269C						.						69.0	68.0	68.0					5																	73136427		2002	4162	6164	SO:0001819	synonymous_variant	64283	exon11			AACCAGTCCCAGT		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1269T>C	5.37:g.73136427T>C		54	0		57	27	NM_001080479	0	0	3	6	3	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	CCDS54870.1																																																																																			.		0.493	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
CDKL3	51265	hgsc.bcm.edu	37	5	133695635	133695635	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr5:133695635A>C	ENST00000265334.4	-	3	431	c.313T>G	c.(313-315)Tac>Gac	p.Y105D	CDKL3_ENST00000609654.1_Intron|CDKL3_ENST00000521118.1_Missense_Mutation_p.Y105D|CDKL3_ENST00000609383.1_Intron|CDKL3_ENST00000522501.1_Intron|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000523832.1_Missense_Mutation_p.Y105D|CDKL3_ENST00000435211.1_Missense_Mutation_p.Y105D|CDKL3_ENST00000435240.2_Intron|CDKL3_ENST00000523054.1_5'UTR|CDKL3_ENST00000521755.1_Intron|CDKL3_ENST00000536186.1_Intron	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3	105	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGAAGAGGTATTTTCTAAGT	0.328																																					p.Y105D		.											.	CDKL3-389	0			c.T313G						.						99.0	90.0	93.0					5																	133695635		1826	4085	5911	SO:0001583	missense	51265	exon3			AGAGGTATTTTCT	AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.313T>G	5.37:g.133695635A>C	ENSP00000265334:p.Tyr105Asp	6	0		17	8	NM_001113575	0	0	0	0	0	D3DQA0|D3DQA1|Q9P114	Missense_Mutation	SNP	ENST00000265334.4	37	CCDS47264.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106870	0.77096	.	.	ENSG00000006837	ENST00000265334;ENST00000521118;ENST00000523832;ENST00000435211	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.33	5.33	0.75918	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000039	T	0.82171	0.4979	M	0.81614	2.55	0.45733	D	0.998634	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.84940	0.0865	10	0.87932	D	0	-6.1958	14.5773	0.68258	1.0:0.0:0.0:0.0	.	105;105	E7ET86;Q8IVW4	.;CDKL3_HUMAN	D	105	ENSP00000265334:Y105D;ENSP00000428689:Y105D;ENSP00000430496:Y105D;ENSP00000395559:Y105D	ENSP00000265334:Y105D	Y	-	1	0	CDKL3	133723534	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.231000	0.72307	2.141000	0.66446	0.482000	0.46254	TAC	.		0.328	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377697.1	NM_001113575	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38704982	38704982	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr6:38704982A>T	ENST00000359357.3	+	4	505	c.251A>T	c.(250-252)gAa>gTa	p.E84V	DNAH8_ENST00000449981.2_Missense_Mutation_p.E301V|DNAH8_ENST00000441566.1_Missense_Mutation_p.E84V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	84					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGAGAATCTGAAAAACATATT	0.313																																					p.E301V		.											.	DNAH8-615	0			c.A902T						.						74.0	77.0	76.0					6																	38704982		2203	4300	6503	SO:0001583	missense	1769	exon6			AATCTGAAAAACA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.251A>T	6.37:g.38704982A>T	ENSP00000352312:p.Glu84Val	70	0		108	50	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	6.965	0.548009	0.13312	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.23950	1.91;1.9;1.88	5.2	5.2	0.72013	.	0.348200	0.29980	N	0.010705	T	0.08268	0.0206	L	0.41236	1.265	0.32224	N	0.57484	B	0.02656	0.0	B	0.04013	0.001	T	0.17868	-1.0355	10	0.14252	T	0.57	.	11.237	0.48946	0.8476:0.1523:0.0:0.0	.	84	Q96JB1	DYH8_HUMAN	V	289;289;84;84	ENSP00000333363:E289V;ENSP00000352312:E84V;ENSP00000402294:E84V	ENSP00000333363:E289V	E	+	2	0	DNAH8	38812960	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.440000	0.44855	2.073000	0.62155	0.482000	0.46254	GAA	.		0.313	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DFNA5	1687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	24745817	24745817	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:24745817A>T	ENST00000342947.3	-	8	1594	c.1169T>A	c.(1168-1170)gTc>gAc	p.V390D	DFNA5_ENST00000419307.1_Missense_Mutation_p.V226D|DFNA5_ENST00000545231.1_Missense_Mutation_p.V226D|DFNA5_ENST00000409970.1_Missense_Mutation_p.V226D|DFNA5_ENST00000409775.3_Missense_Mutation_p.V390D	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	390					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GAGGGCACTGACCAAGAAGTA	0.537																																					p.V390D	GBM(78;184 1250 20134 20900 23600)	.											.	DFNA5-91	0			c.T1169A						.						75.0	76.0	76.0					7																	24745817		2203	4300	6503	SO:0001583	missense	1687	exon8			GCACTGACCAAGA	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1169T>A	7.37:g.24745817A>T	ENSP00000339587:p.Val390Asp	100	0		164	95	NM_001127453	0	0	0	0	0	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.752032	0.49362	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775;ENST00000430096	T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7	5.0	5.0	0.66597	.	0.415630	0.25613	N	0.029475	T	0.44074	0.1276	M	0.68317	2.08	0.80722	D	1	D	0.60575	0.988	P	0.59357	0.856	T	0.43048	-0.9415	10	0.87932	D	0	-18.5588	12.3301	0.55035	1.0:0.0:0.0:0.0	.	390	O60443	DFNA5_HUMAN	D	390;226;226;226;390;10	ENSP00000339587:V390D;ENSP00000401332:V226D;ENSP00000442661:V226D;ENSP00000387119:V226D;ENSP00000386670:V390D;ENSP00000395540:V10D	ENSP00000339587:V390D	V	-	2	0	DFNA5	24712342	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	5.025000	0.64097	2.091000	0.63221	0.460000	0.39030	GTC	.		0.537	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	8235103	8235103	+	Silent	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:8235103A>T	ENST00000520004.1	-	3	1080	c.816T>A	c.(814-816)acT>acA	p.T272T	SGK223_ENST00000330777.4_Silent_p.T272T			Q86YV5	SG223_HUMAN		272							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGGAACCTGCAGTCTGGGAGG	0.677																																					p.T272T	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.T816A						.						22.0	27.0	25.0					8																	8235103		1995	4154	6149	SO:0001819	synonymous_variant	0	exon2			ACCTGCAGTCTGG																												ENST00000520004.1:c.816T>A	8.37:g.8235103A>T		32	0		34	22	NM_001080826	0	0	12	18	6	Q8N3N5	Silent	SNP	ENST00000520004.1	37	CCDS43706.1																																																																																			.		0.677	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
GPR124	25960	hgsc.bcm.edu	37	8	37699293	37699293	+	Missense_Mutation	SNP	T	T	C	rs111828443	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:37699293T>C	ENST00000412232.2	+	19	3450	c.3437T>C	c.(3436-3438)gTg>gCg	p.V1146A	GPR124_ENST00000315215.7_Missense_Mutation_p.V929A	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1146					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CAGAGTCAGGTGTGCGAggcg	0.746													T|||	6	0.00119808	0.0	0.0014	5008	,	,		8221	0.0		0.005	False		,,,				2504	0.0				p.V1146A		.											.	GPR124-157	0			c.T3437C						.	T	ALA/VAL	2,2230		0,2,1114	1.0	2.0	2.0		3437	-8.5	0.0	8	dbSNP_132	2	31,5047		0,31,2508	no	missense	GPR124	NM_032777.9	64	0,33,3622	CC,CT,TT		0.6105,0.0896,0.4514	benign	1146/1339	37699293	33,7277	1116	2539	3655	SO:0001583	missense	25960	exon19			GTCAGGTGTGCGA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3437T>C	8.37:g.37699293T>C	ENSP00000406367:p.Val1146Ala	3	1		4	2	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	T	0.107	-1.144334	0.01728	8.96E-4	0.006105	ENSG00000020181	ENST00000315215;ENST00000412232	T;T	0.59224	0.28;0.4	4.26	-8.52	0.00920	.	0.697471	0.13568	N	0.378295	T	0.20700	0.0498	N	0.16790	0.44	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13388	-1.0511	10	0.13108	T	0.6	-1.0774	6.7924	0.23707	0.089:0.5225:0.2609:0.1276	.	929;1146	Q96PE1-2;Q96PE1	.;GP124_HUMAN	A	929;1146	ENSP00000323508:V929A;ENSP00000406367:V1146A	ENSP00000323508:V929A	V	+	2	0	GPR124	37818451	0.000000	0.05858	0.016000	0.15963	0.559000	0.35586	-1.039000	0.03550	-2.808000	0.00349	-0.425000	0.05940	GTG	T|0.500;C|0.500		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
NPBWR1	2831	ucsc.edu	37	8	53852861	53852861	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:53852861G>A	ENST00000331251.3	+	1	1871	c.394G>A	c.(394-396)Gcc>Acc	p.A132T		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	132					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				CGTCATGAGCGCCGACCGCTA	0.677																																					p.A132T													.	NPBWR1-155	0			c.G394A						.						31.0	31.0	31.0					8																	53852861		2199	4292	6491	SO:0001583	missense	2831	exon1			ATGAGCGCCGACC	BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.394G>A	8.37:g.53852861G>A	ENSP00000330284:p.Ala132Thr	39	0		37	4	NM_005285	0	0	0	0	0	Q6NTC7	Missense_Mutation	SNP	ENST00000331251.3	37	CCDS6151.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474654	0.84640	.	.	ENSG00000183729	ENST00000331251	T	0.37235	1.21	5.06	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.391699	0.20883	N	0.083979	T	0.27731	0.0682	L	0.35593	1.075	0.32441	N	0.546692	P	0.49358	0.923	B	0.43680	0.427	T	0.38972	-0.9636	10	0.87932	D	0	.	6.9066	0.24313	0.2626:0.0:0.7374:0.0	.	132	P48145	NPBW1_HUMAN	T	132	ENSP00000330284:A132T	ENSP00000330284:A132T	A	+	1	0	NPBWR1	54015414	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.744000	0.55112	2.623000	0.88846	0.655000	0.94253	GCC	.		0.677	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1	NM_005285	
NIPAL2	79815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	99215364	99215364	+	Silent	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:99215364A>T	ENST00000341166.3	-	8	1107	c.852T>A	c.(850-852)atT>atA	p.I284I	NIPAL2_ENST00000520545.1_5'UTR|NIPAL2_ENST00000430223.2_Silent_p.I284I	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	284						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						TTGTAAAGAAAATATGATTAA	0.408																																					p.I284I		.											.	NIPAL2-90	0			c.T852A						.						185.0	162.0	170.0					8																	99215364		2203	4300	6503	SO:0001819	synonymous_variant	79815	exon8			AAAGAAAATATGA	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.852T>A	8.37:g.99215364A>T		99	0		122	58	NM_024759	0	0	1	2	1	A2RTY8	Silent	SNP	ENST00000341166.3	37	CCDS6278.1																																																																																			.		0.408	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	
JRK	8629	hgsc.bcm.edu	37	8	143745894	143745894	+	RNA	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:143745894C>G	ENST00000507178.2	-	0	1916							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				CGCCTCCTCACCTGCTGCTGG	0.692																																					p.V528L		.											.	.	0			c.G1582C						.						19.0	24.0	23.0					8																	143745894		2165	4270	6435			8629	exon3			TCCTCACCTGCTG	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143745894C>G		16	0		27	2	NM_003724	0	0	2	2	0	O75565	Missense_Mutation	SNP	ENST00000507178.2	37																																																																																				.		0.692	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
C9orf91	203197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117400851	117400851	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr9:117400851T>C	ENST00000288502.4	+	8	1131	c.694T>C	c.(694-696)Ttg>Ctg	p.L232L	C9orf91_ENST00000374049.4_Silent_p.L233L			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	232						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						ATTGAGCCAGTTGTGTGTTGT	0.562																																					p.L232L		.											.	C9orf91-91	0			c.T694C						.						149.0	136.0	140.0					9																	117400851		2203	4300	6503	SO:0001819	synonymous_variant	203197	exon8			AGCCAGTTGTGTG	BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.694T>C	9.37:g.117400851T>C		168	0		175	76	NM_153045	0	0	5	10	5	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Silent	SNP	ENST00000288502.4	37	CCDS6808.1																																																																																			.		0.562	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053780.1	NM_153045	
JADE3	9767	hgsc.bcm.edu	37	X	46918438	46918438	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:46918438A>G	ENST00000218343.4	+	11	2729	c.2431A>G	c.(2431-2433)Agc>Ggc	p.S811G	PHF16_ENST00000397189.1_Missense_Mutation_p.S811G	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						CCATGGTAAAAGCAAGACACA	0.458																																					p.S811G		.											.	PHF16-130	0			c.A2431G						.						40.0	34.0	36.0					X																	46918438		2203	4293	6496	SO:0001583	missense	9767	exon11			GGTAAAAGCAAGA																												ENST00000218343.4:c.2431A>G	X.37:g.46918438A>G	ENSP00000218343:p.Ser811Gly	32	0		52	3	NM_001077445	0	0	14	14	0		Missense_Mutation	SNP	ENST00000218343.4	37	CCDS14271.1	.	.	.	.	.	.	.	.	.	.	A	5.227	0.227339	0.09916	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.50813	0.73;0.73	5.18	2.75	0.32379	.	1.092960	0.06637	N	0.760394	T	0.22975	0.0555	N	0.04508	-0.205	0.22081	N	0.999376	B	0.02656	0.0	B	0.01281	0.0	T	0.26815	-1.0092	10	0.11794	T	0.64	.	5.0228	0.14370	0.6887:0.153:0.1583:0.0	.	811	Q92613	JADE3_HUMAN	G	811	ENSP00000380373:S811G;ENSP00000218343:S811G	ENSP00000218343:S811G	S	+	1	0	PHF16	46803382	1.000000	0.71417	0.859000	0.33776	0.840000	0.47671	1.976000	0.40579	0.274000	0.22072	0.481000	0.45027	AGC	.		0.458	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
HUWE1	10075	ucsc.edu	37	X	53607789	53607789	+	Splice_Site	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:53607789A>G	ENST00000342160.3	-	42	6174		c.e42+1		HUWE1_ENST00000262854.6_Splice_Site			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase						base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AGCGAAACTTACCAGTTCCTG	0.498																																					.													.	HUWE1-280	0			c.5716+2T>C						.						55.0	41.0	46.0					X																	53607789		2203	4300	6503	SO:0001630	splice_region_variant	10075	exon44			AAACTTACCAGTT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5716+1T>C	X.37:g.53607789A>G		28	0		40	4	NM_031407	0	0	0	0	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Splice_Site	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.418952	0.83559	.	.	ENSG00000086758	ENST00000342160;ENST00000427052;ENST00000262854	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0818	0.64929	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HUWE1	53624514	1.000000	0.71417	0.971000	0.41717	0.927000	0.56198	8.857000	0.92250	1.971000	0.57363	0.486000	0.48141	.	.		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	Intron
ZMYM3	9203	hgsc.bcm.edu	37	X	70468027	70468027	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:70468027T>C	ENST00000353904.2	-	11	2147	c.1960A>G	c.(1960-1962)Agc>Ggc	p.S654G	ZMYM3_ENST00000314425.5_Missense_Mutation_p.S654G|ZMYM3_ENST00000373998.1_Missense_Mutation_p.S654G|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.S656G|ZMYM3_ENST00000373984.3_Missense_Mutation_p.S656G	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	654					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CTGCAGAAGCTTTTCTCCACT	0.562																																					p.S654G		.											.	ZMYM3-131	0			c.A1960G						.						70.0	48.0	55.0					X																	70468027		2203	4299	6502	SO:0001583	missense	9203	exon11			AGAAGCTTTTCTC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1960A>G	X.37:g.70468027T>C	ENSP00000343909:p.Ser654Gly	17	0		18	2	NM_005096	0	0	16	16	0	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	t	3.943	-0.013893	0.07681	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.46063	1.48;0.88;1.48;1.48;1.48	4.37	4.37	0.52481	TRASH (1);Zinc finger, MYM-type (1);	0.073908	0.64402	D	0.000019	T	0.31358	0.0794	N	0.24115	0.695	0.26074	N	0.981187	B;B	0.22800	0.061;0.075	B;B	0.27380	0.047;0.079	T	0.25984	-1.0116	10	0.44086	T	0.13	-1.9223	12.9702	0.58508	0.0:0.0:0.0:1.0	.	654;654	Q14202-2;Q14202	.;ZMYM3_HUMAN	G	654;654;654;656;656	ENSP00000322845:S654G;ENSP00000363110:S654G;ENSP00000343909:S654G;ENSP00000363096:S656G;ENSP00000363100:S656G	ENSP00000322845:S654G	S	-	1	0	ZMYM3	70384752	1.000000	0.71417	0.998000	0.56505	0.226000	0.24999	3.014000	0.49590	1.629000	0.50426	0.350000	0.21858	AGC	.		0.562	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
PHKA1	5255	hgsc.bcm.edu;ucsc.edu	37	X	71822085	71822085	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:71822085T>C	ENST00000373542.4	-	27	3115	c.2956A>G	c.(2956-2958)Atc>Gtc	p.I986V	PHKA1_ENST00000541944.1_Missense_Mutation_p.I927V|PHKA1_ENST00000373539.3_Missense_Mutation_p.I986V|PHKA1_ENST00000373545.3_Missense_Mutation_p.I927V|PHKA1_ENST00000339490.3_Missense_Mutation_p.I986V	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	986					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					ATCTCGTGGATAGAAATAGCA	0.403																																					p.I986V		.											.	PHKA1-134	0			c.A2956G						.						120.0	96.0	104.0					X																	71822085		2203	4300	6503	SO:0001583	missense	5255	exon27			CGTGGATAGAAAT		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2956A>G	X.37:g.71822085T>C	ENSP00000362643:p.Ile986Val	21	0		39	4	NM_002637	0	0	5	5	0	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.931761	0.52866	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91295	-2.77;-2.79;-2.82;-2.78;-2.76	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.89884	0.6844	M	0.73372	2.23	0.52099	D	0.999948	B;B;B	0.19200	0.025;0.016;0.034	B;B;B	0.27608	0.038;0.073;0.081	D	0.86249	0.1648	10	0.34782	T	0.22	-12.1844	12.9234	0.58245	0.0:0.0:0.0:1.0	.	927;986;986	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	V	927;986;927;986;986	ENSP00000362646:I927V;ENSP00000362643:I986V;ENSP00000441251:I927V;ENSP00000342469:I986V;ENSP00000362640:I986V	ENSP00000342469:I986V	I	-	1	0	PHKA1	71738810	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.818000	0.69236	1.960000	0.56953	0.417000	0.27973	ATC	.		0.403	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
CCDC160	347475	hgsc.bcm.edu	37	X	133379028	133379028	+	Silent	SNP	T	T	C	rs367640741		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:133379028T>C	ENST00000517294.1	+	3	581	c.198T>C	c.(196-198)taT>taC	p.Y66Y	CCDC160_ENST00000370809.4_Silent_p.Y66Y			A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	66										endometrium(1)|kidney(2)|large_intestine(10)|lung(2)|prostate(1)|skin(1)	17						GGAAAAAATATATTTTCCAAC	0.303													T|||	1	0.000264901	0.0	0.0	3775	,	,		12364	0.0		0.001	False		,,,				2504	0.0				p.Y66Y		.											.	CCDC160-40	0			c.T198C						.	T		0,2994		0,0,0,1219,556	16.0	14.0	15.0		198	1.2	0.0	X		15	2,6295		0,0,2,2278,1739	no	coding-synonymous	CCDC160	NM_001101357.1		0,0,2,3497,2295	CC,CT,C,TT,T		0.0318,0.0,0.0215		66/326	133379028	2,9289	1775	4019	5794	SO:0001819	synonymous_variant	347475	exon2			AAAATATATTTTC	BC017958	CCDS48171.1	Xq26.2	2010-02-17			ENSG00000203952	ENSG00000203952			37286	protein-coding gene	gene with protein product							Standard	NM_001101357		Approved		uc011mvj.2	A6NGH7	OTTHUMG00000164183	ENST00000517294.1:c.198T>C	X.37:g.133379028T>C		1	1		5	4	NM_001101357	0	0	0	2	2		Silent	SNP	ENST00000517294.1	37	CCDS48171.1																																																																																			.		0.303	CCDC160-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377679.1	NM_001101357	
C1orf54	79630	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	150248209	150248212	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	GTGA	GTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:150248209_150248212delGTGA	ENST00000369102.1	+	5	959		c.e5+1		C1orf54_ENST00000369099.3_Splice_Site|C1orf54_ENST00000369098.3_Splice_Site			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54							extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGACAGGCTGGTGAGTGAACTCTA	0.407																																					.		.											.	C1orf54-90	0			.						.																																			SO:0001630	splice_region_variant	79630	.			.	BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.189+1GTGA>-	1.37:g.150248213_150248216delGTGA		48	0		75	17	.	0	0	0	0	0	Q9H5P3	Splice_Site	DEL	ENST00000369102.1	37	CCDS948.1																																																																																			.		0.407	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	Intron
LIPA	3988	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	90974746	90974746	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:90974746delG	ENST00000336233.5	-	10	1361	c.1039delC	c.(1039-1041)cttfs	p.L347fs	LIPA_ENST00000456827.1_Frame_Shift_Del_p.L347fs|LIPA_ENST00000371837.1_Frame_Shift_Del_p.L291fs			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	347					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		ACATCTGCAAGCCAGTCGTGA	0.493																																					p.L347fs		.											.	LIPA-90	0			c.1039delC						.						93.0	84.0	87.0					10																	90974746		2203	4300	6503	SO:0001589	frameshift_variant	3988	exon10			.	M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.1039delC	10.37:g.90974746delG	ENSP00000337354:p.Leu347fs	131	0		156	63	NM_000235	0	0	0	0	0	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Frame_Shift_Del	DEL	ENST00000336233.5	37	CCDS7401.1																																																																																			.		0.493	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049308.1	NM_000235	
LTBP1	4052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	33412000	33412000	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:33412000delG	ENST00000404816.2	+	6	1632	c.1279delG	c.(1279-1281)ggafs	p.G427fs	LTBP1_ENST00000402934.1_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000354476.3_Frame_Shift_Del_p.G427fs|LTBP1_ENST00000407925.1_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000390003.4_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000418533.2_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000404525.1_Frame_Shift_Del_p.G101fs			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	427	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAATTTCACAGGAAAACTTTG	0.473																																					p.G427fs		.											.	LTBP1-230	0			c.1279delG						.						115.0	107.0	110.0					2																	33412000		2203	4300	6503	SO:0001589	frameshift_variant	4052	exon6			.		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1279delG	2.37:g.33412000delG	ENSP00000386043:p.Gly427fs	64	0		57	20	NM_206943	0	0	0	0	0	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Frame_Shift_Del	DEL	ENST00000404816.2	37	CCDS33177.2																																																																																			.		0.473	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
BCLAF1	9774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	136582550	136582550	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr6:136582550delT	ENST00000531224.1	-	12	2862	c.2610delA	c.(2608-2610)caafs	p.Q870fs	BCLAF1_ENST00000392348.2_Frame_Shift_Del_p.Q819fs|BCLAF1_ENST00000530767.1_Frame_Shift_Del_p.Q697fs|BCLAF1_ENST00000031135.9_Frame_Shift_Del_p.Q88fs|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527536.1_Frame_Shift_Del_p.Q821fs|BCLAF1_ENST00000353331.4_Frame_Shift_Del_p.Q819fs|BCLAF1_ENST00000527759.1_Frame_Shift_Del_p.Q868fs	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	870					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTCTGCCACGTTGAAAAGTAC	0.418																																					p.Q870fs	Colon(142;1534 1789 5427 7063 28491)	.											.	BCLAF1-228	0			c.2610delA						.						218.0	218.0	218.0					6																	136582550		2203	4300	6503	SO:0001589	frameshift_variant	9774	exon12			.	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2610delA	6.37:g.136582550delT	ENSP00000435210:p.Gln870fs	379	0		614	103	NM_014739	0	0	0	0	0	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Frame_Shift_Del	DEL	ENST00000531224.1	37	CCDS5177.1																																																																																			.		0.418	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
CSPP1	79848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	68070755	68070755	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:68070755delG	ENST00000262210.5	+	18	2331	c.2300delG	c.(2299-2301)cggfs	p.R767fs	CSPP1_ENST00000412460.1_Frame_Shift_Del_p.R422fs|CSPP1_ENST00000521168.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	802					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GAAGAAAGACGGCTTGCAGAA	0.388																																					p.R767fs		.											.	CSPP1-138	0			c.2300delG						.						68.0	67.0	67.0					8																	68070755		1860	4092	5952	SO:0001589	frameshift_variant	79848	exon18			.	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2300delG	8.37:g.68070755delG	ENSP00000262210:p.Arg767fs	49	0		47	13	NM_024790	0	0	0	0	0	A6ND63|Q70F00|Q8TBC1	Frame_Shift_Del	DEL	ENST00000262210.5	37	CCDS43744.1																																																																																			.		0.388	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
REPIN1	29803	hgsc.bcm.edu;broad.mit.edu	37	7	150068863	150068864	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:150068863_150068864insA	ENST00000425389.2	+	1	611_612	c.533_534insA	c.(532-537)atatgcfs	p.C179fs	REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000482680.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000444957.1_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000397281.2_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000540729.1_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000489432.2_Frame_Shift_Ins_p.C236fs	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	179					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CGGCCCTTCATATGCGGCAACT	0.658																																					p.I235fs		.											.	REPIN1-69	0			c.704_705insA						.																																			SO:0001589	frameshift_variant	29803	exon3			.	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.534dupA	7.37:g.150068864_150068864dupA	ENSP00000388287:p.Cys179fs	38	0		41	10	NM_001099695	0	0	0	0	0	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Frame_Shift_Ins	INS	ENST00000425389.2	37	CCDS43677.1																																																																																			.		0.658	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
