#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AIDA	64853	hgsc.bcm.edu	37	1	222843559	222843559	+	Missense_Mutation	SNP	T	T	A	rs200516684		TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr1:222843559T>A	ENST00000340020.6	-	9	946	c.740A>T	c.(739-741)aAg>aTg	p.K247M	AIDA_ENST00000541237.1_Missense_Mutation_p.K223M|AIDA_ENST00000355727.2_Missense_Mutation_p.K165M|AIDA_ENST00000474863.1_5'UTR	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	247					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TTTTTTAGGCTTGTAGTGTTT	0.353																																																	0													60.0	57.0	58.0					1																	222843559		2203	4300	6503	SO:0001583	missense	64853			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.740A>T	1.37:g.222843559T>A	ENSP00000339161:p.Lys247Met		A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	ENST00000340020.6	37	CCDS1533.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.370995	0.61624	.	.	ENSG00000186063	ENST00000340020;ENST00000355727;ENST00000541237	.	.	.	5.9	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.62134	0.2403	M	0.76574	2.34	0.80722	D	1	B;B	0.18863	0.025;0.031	B;B	0.13407	0.008;0.009	T	0.65022	-0.6269	9	0.87932	D	0	.	12.5154	0.56030	0.1246:0.0:0.0:0.8754	.	223;247	F5H715;Q96BJ3	.;AIDA_HUMAN	M	247;165;223	.	ENSP00000339161:K247M	K	-	2	0	AIDA	220910182	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.001000	0.63946	2.250000	0.74265	0.533000	0.62120	AAG		0.353	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091818.1		NM_022831	
ANKRD44	91526	hgsc.bcm.edu;ucsc.edu	37	2	197954719	197954719	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr2:197954719C>T	ENST00000328737.2	-	11	1139	c.1063G>A	c.(1063-1065)Gcc>Acc	p.A355T	ANKRD44_ENST00000409153.1_Missense_Mutation_p.A380T|ANKRD44_ENST00000282272.8_Missense_Mutation_p.A372T|ANKRD44_ENST00000477852.1_5'Flank|ANKRD44_ENST00000337207.5_Missense_Mutation_p.A355T|ANKRD44_ENST00000450567.1_Missense_Mutation_p.A355T|ANKRD44_ENST00000539527.1_Missense_Mutation_p.A308T			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	380										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCATTTAGGGCAGCTAAATGT	0.433																																																	0													127.0	113.0	118.0					2																	197954719		2203	4300	6503	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1063G>A	2.37:g.197954719C>T	ENSP00000331516:p.Ala355Thr		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37		.	.	.	.	.	.	.	.	.	.	C	35	5.562244	0.96527	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886;ENST00000409153;ENST00000539527	T;T;T;T;T;T;T;T	0.71817	-0.37;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.81475	0.4830	L	0.55103	1.725	0.80722	D	1	P;D;D	0.76494	0.844;0.999;0.999	P;D;D	0.85130	0.58;0.995;0.997	T	0.78086	-0.2341	10	0.33141	T	0.24	.	19.1499	0.93483	0.0:1.0:0.0:0.0	.	308;380;380	F5H682;Q8N8A2-3;Q8N8A2-2	.;.;.	T	177;372;355;355;355;78;380;308	ENSP00000403415:A177T;ENSP00000282272:A372T;ENSP00000331516:A355T;ENSP00000402420:A355T;ENSP00000338794:A355T;ENSP00000416319:A78T;ENSP00000387141:A380T;ENSP00000437825:A308T	ENSP00000282272:A372T	A	-	1	0	ANKRD44	197662964	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	7.648000	0.83479	2.761000	0.94854	0.650000	0.86243	GCC		0.433	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1		NM_153697	
ASPH	444	hgsc.bcm.edu;ucsc.edu	37	8	62577970	62577970	+	Intron	SNP	T	T	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr8:62577970T>A	ENST00000379454.4	-	4	510				ASPH_ENST00000445642.3_Intron|ASPH_ENST00000518068.1_Intron|ASPH_ENST00000541428.1_Intron|ASPH_ENST00000517847.2_Intron|ASPH_ENST00000517856.1_Intron|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000517903.1_Intron|ASPH_ENST00000389204.4_Missense_Mutation_p.E173V|ASPH_ENST00000522603.1_Missense_Mutation_p.E158V|ASPH_ENST00000356457.5_Intron	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	agcacttttttctaggtccac	0.383																																																	0													176.0	149.0	158.0					8																	62577970		2203	4300	6503	SO:0001627	intron_variant	444			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.323-11751A>T	8.37:g.62577970T>A			A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	T	7.253	0.603690	0.14002	.	.	ENSG00000198363	ENST00000389204;ENST00000522603	T;T	0.68181	-0.31;-0.31	4.53	3.35	0.38373	.	.	.	.	.	T	0.57198	0.2037	.	.	.	0.23751	N	0.996949	B;B	0.29716	0.255;0.255	B;B	0.38056	0.264;0.179	T	0.48948	-0.8989	8	0.28530	T	0.3	.	8.3973	0.32564	0.0:0.0933:0.0:0.9067	.	158;173	Q12797-4;Q12797-3	.;.	V	173;158	ENSP00000373856:E173V;ENSP00000436188:E158V	ENSP00000373856:E173V	E	-	2	0	ASPH	62740524	0.075000	0.21258	0.005000	0.12908	0.157000	0.22087	1.863000	0.39459	0.839000	0.34971	0.533000	0.62120	GAA		0.383	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3		NM_004318	
ATP13A2	23400	hgsc.bcm.edu	37	1	17318322	17318322	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr1:17318322C>T	ENST00000326735.8	-	20	2191	c.2158G>A	c.(2158-2160)Ggg>Agg	p.G720R	ATP13A2_ENST00000452699.1_Missense_Mutation_p.G715R|ATP13A2_ENST00000341676.5_Missense_Mutation_p.G715R|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	720					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		ACCAGCAGCCCCAGGAGGCTC	0.627																																																	0													71.0	68.0	69.0					1																	17318322		2203	4300	6503	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2158G>A	1.37:g.17318322C>T	ENSP00000327214:p.Gly720Arg		O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715340	0.89112	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552	D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06	4.7	4.7	0.59300	ATPase, cation-transporting, domain N (1);HAD-like domain (2);	0.095435	0.64402	D	0.000001	D	0.94823	0.8328	H	0.96048	3.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.96402	0.9297	10	0.87932	D	0	-28.4809	16.3304	0.83010	0.0:1.0:0.0:0.0	.	715;715;720	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	R	720;715;715;190	ENSP00000327214:G720R;ENSP00000341115:G715R;ENSP00000413307:G715R;ENSP00000421126:G190R	ENSP00000327214:G720R	G	-	1	0	ATP13A2	17190909	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.265000	0.78442	2.429000	0.82318	0.491000	0.48974	GGG		0.627	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1		NM_022089	
BRD4	23476	hgsc.bcm.edu;ucsc.edu	37	19	15366320	15366320	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr19:15366320T>C	ENST00000263377.2	-	10	2056	c.1835A>G	c.(1834-1836)tAt>tGt	p.Y612C	BRD4_ENST00000371835.4_Missense_Mutation_p.Y612C|BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Missense_Mutation_p.Y612C	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	612	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CTTCTCCTCATAGGACATAGG	0.602			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													126.0	111.0	116.0					19																	15366320		2203	4300	6503	SO:0001583	missense	23476			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1835A>G	19.37:g.15366320T>C	ENSP00000263377:p.Tyr612Cys		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114625	0.77210	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.27720	1.65;1.65;1.65	5.08	5.08	0.68730	.	0.000000	0.56097	D	0.000040	T	0.64271	0.2583	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.996;0.995	T	0.74206	-0.3740	10	0.87932	D	0	-11.3676	13.8415	0.63441	0.0:0.0:0.0:1.0	.	612;612;612	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	C	612	ENSP00000263377:Y612C;ENSP00000360901:Y612C;ENSP00000353112:Y612C	ENSP00000263377:Y612C	Y	-	2	0	BRD4	15227320	1.000000	0.71417	0.166000	0.22797	0.994000	0.84299	8.040000	0.89188	1.920000	0.55613	0.482000	0.46254	TAT		0.602	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3		NM_058243	
CACNA1D	776	hgsc.bcm.edu;ucsc.edu	37	3	53845146	53845146	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr3:53845146A>G	ENST00000350061.5	+	48	6710	c.6199A>G	c.(6199-6201)Ata>Gta	p.I2067V	CACNA1D_ENST00000288139.4_Missense_Mutation_p.I2087V|CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000422281.2_Missense_Mutation_p.I2043V	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2067					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACAGGTCCTGATATCCGAAGG	0.498																																																	0													84.0	84.0	84.0					3																	53845146		2203	4300	6503	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6199A>G	3.37:g.53845146A>G	ENSP00000288133:p.Ile2067Val		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704688	0.68615	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.39	5.39	0.77823	.	0.135539	0.46442	D	0.000282	T	0.76535	0.4001	L	0.47078	1.49	0.80722	D	1	D;P;D;D	0.69078	0.995;0.882;0.979;0.997	D;B;P;D	0.77557	0.977;0.387;0.714;0.99	T	0.76176	-0.3055	10	0.42905	T	0.14	.	15.7136	0.77649	1.0:0.0:0.0:0.0	.	2043;1760;2067;2087	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	V	2067;2087;2043;1760	ENSP00000288133:I2067V;ENSP00000288139:I2087V;ENSP00000409174:I2043V;ENSP00000418014:I1760V	ENSP00000288139:I2087V	I	+	1	0	CACNA1D	53820186	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	9.265000	0.95647	2.188000	0.69820	0.533000	0.62120	ATA		0.498	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1		NM_000720	
C3orf30	152405	hgsc.bcm.edu	37	3	118865300	118865300	+	Silent	SNP	C	C	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr3:118865300C>A	ENST00000295622.1	+	1	304	c.264C>A	c.(262-264)ggC>ggA	p.G88G	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	88										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		GTCAGGCTGGCCGCAGAGCAT	0.502																																																	0													55.0	47.0	50.0					3																	118865300		2203	4300	6503	SO:0001819	synonymous_variant	152405			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.264C>A	3.37:g.118865300C>A			A1L4B7	Silent	SNP	ENST00000295622.1	37	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	C	2.904	-0.226751	0.06022	.	.	ENSG00000163424	ENST00000460150	.	.	.	2.98	-1.52	0.08637	.	.	.	.	.	T	0.18215	0.0437	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23261	-1.0193	4	.	.	.	.	0.6098	0.00759	0.179:0.2402:0.1772:0.4037	.	.	.	.	T	52	.	.	P	+	1	0	C3orf30	120347990	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.855000	0.01663	-0.365000	0.08076	0.563000	0.77884	CCG		0.502	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1		NM_152539	
CCDC88B	283234	hgsc.bcm.edu;ucsc.edu	37	11	64121227	64121227	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr11:64121227G>A	ENST00000356786.5	+	23	3918	c.3874G>A	c.(3874-3876)Gtg>Atg	p.V1292M	CCDC88B_ENST00000359902.2_Missense_Mutation_p.V444M|CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_Silent_p.S10S	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1292						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GCAGAAGCTCGTGGAGAAGAT	0.632																																																	0													165.0	158.0	160.0					11																	64121227		2201	4297	6498	SO:0001583	missense	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3874G>A	11.37:g.64121227G>A	ENSP00000349238:p.Val1292Met		A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	g	18.11	3.549701	0.65311	.	.	ENSG00000168071	ENST00000377638;ENST00000356786;ENST00000359902	T;T	0.58940	0.3;0.3	3.11	3.11	0.35812	.	.	.	.	.	T	0.64583	0.2611	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.934;0.994;0.995	T	0.66296	-0.5959	9	0.72032	D	0.01	.	9.8582	0.41098	0.0:0.0:1.0:0.0	.	1292;1174;428;1292	B2RTU8;A6NC98-4;A6NC98-5;A6NC98	.;.;.;CC88B_HUMAN	M	1174;1292;444	ENSP00000349238:V1292M;ENSP00000352974:V444M	ENSP00000349238:V1292M	V	+	1	0	CCDC88B	63877803	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.733000	0.55029	1.735000	0.51646	0.462000	0.41574	GTG		0.632	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1		NM_032251	
COL15A1	1306	hgsc.bcm.edu	37	9	101748184	101748184	+	Silent	SNP	C	C	A	rs7045978	byFrequency	TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr9:101748184C>A	ENST00000375001.3	+	3	861	c.438C>A	c.(436-438)tcC>tcA	p.S146S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	146	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CCCATGTGTCCCAAGAGGCTG	0.607																																																	0													107.0	100.0	102.0					9																	101748184		2203	4300	6503	SO:0001819	synonymous_variant	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.438C>A	9.37:g.101748184C>A			Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1																																																																																				0.607	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3		NM_001855	
CPAMD8	27151	hgsc.bcm.edu	37	19	17086920	17086920	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr19:17086920C>G	ENST00000443236.1	-	16	1972	c.1941G>C	c.(1939-1941)gaG>gaC	p.E647D	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	600						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGTCGACAACCTCCCCAGGTT	0.557																																																	0													42.0	46.0	45.0					19																	17086920		2054	4203	6257	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1941G>C	19.37:g.17086920C>G	ENSP00000402505:p.Glu647Asp		Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.004|0.004	-2.380909|-2.380909	0.00205|0.00205	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	2.89|2.89	-0.328|-0.328	0.12690|0.12690	Alpha-2-macroglobulin, N-terminal 2 (1);|.	0.076489|.	0.50627|.	D|.	0.000114|.	T|T	0.18173|0.18173	0.0436|0.0436	N|N	0.04260|0.04260	-0.245|-0.245	0.36521|0.36521	D|D	0.87016|0.87016	B|.	0.06786|.	0.001|.	B|.	0.10450|.	0.005|.	T|T	0.14896|0.14896	-1.0456|-1.0456	9|5	0.11485|.	T|.	0.65|.	.|.	1.0546|1.0546	0.01587|0.01587	0.419:0.2177:0.2295:0.1338|0.419:0.2177:0.2295:0.1338	.|.	600|.	Q8IZJ3|.	CPMD8_HUMAN|.	D|T	647|658	.|.	ENSP00000291440:E647D|.	E|R	-|-	3|2	2|0	CPAMD8|CPAMD8	16947920|16947920	0.137000|0.137000	0.22531|0.22531	0.179000|0.179000	0.23059|0.23059	0.011000|0.011000	0.07611|0.07611	0.281000|0.281000	0.18810|0.18810	0.308000|0.308000	0.22923|0.22923	0.561000|0.561000	0.74099|0.74099	GAG|AGG		0.557	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		NM_015692	
CPSF2	53981	hgsc.bcm.edu;ucsc.edu	37	14	92604675	92604675	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr14:92604675A>T	ENST00000298875.4	+	7	930	c.645A>T	c.(643-645)agA>agT	p.R215S		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	215					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		GAAAACAGAGAGATGAGCAGC	0.343																																					Ovarian(78;28 1788 18702 44111)												0													114.0	113.0	114.0					14																	92604675		2203	4300	6503	SO:0001583	missense	53981			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.645A>T	14.37:g.92604675A>T	ENSP00000298875:p.Arg215Ser		B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	37	CCDS9902.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.869126	0.72065	.	.	ENSG00000165934	ENST00000298875	T	0.55052	0.54	5.74	3.01	0.34805	Beta-lactamase-like (1);	0.000000	0.85682	D	0.000000	T	0.74450	0.3718	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.76509	-0.2933	10	0.87932	D	0	.	7.8164	0.29263	0.6918:0.0:0.3082:0.0	.	215	Q9P2I0	CPSF2_HUMAN	S	215	ENSP00000298875:R215S	ENSP00000298875:R215S	R	+	3	2	CPSF2	91674428	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.172000	0.31908	0.963000	0.38082	0.533000	0.62120	AGA		0.343	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1			
PIEZO1	9780	hgsc.bcm.edu	37	16	88781504	88781504	+	IGR	SNP	C	C	A	rs368079417		TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr16:88781504C>A	ENST00000301015.9	-	0	8072				CTU2_ENST00000378384.3_Missense_Mutation_p.R403S|CTU2_ENST00000312060.5_Intron|CTU2_ENST00000453996.2_Missense_Mutation_p.R490S|CTU2_ENST00000567949.1_Missense_Mutation_p.R561S|MIR4722_ENST00000578292.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GGCCCAGCTCCGCACACAGAG	0.682																																																	0													34.0	38.0	37.0					16																	88781504		2185	4288	6473	SO:0001628	intergenic_variant	348180			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		16.37:g.88781504C>A			A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365740	0.61513	.	.	ENSG00000174177	ENST00000378384;ENST00000453996	T;T	0.52754	0.65;0.65	5.19	2.96	0.34315	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	L	0.36672	1.1	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.57849	-0.7740	10	0.87932	D	0	.	10.2433	0.43326	0.1771:0.7409:0.0:0.082	.	403;490	Q2VPK5-3;Q2VPK5	.;CTU2_HUMAN	S	403;490	ENSP00000367635:R403S;ENSP00000388320:R490S	ENSP00000367635:R403S	R	+	1	0	CTU2	87309005	0.027000	0.19231	1.000000	0.80357	0.642000	0.38348	0.147000	0.16202	1.326000	0.45319	0.561000	0.74099	CGC		0.682	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4		NM_014745	
DCHS1	8642	hgsc.bcm.edu	37	11	6646503	6646503	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr11:6646503C>A	ENST00000299441.3	-	19	7483	c.7072G>T	c.(7072-7074)Ggc>Tgc	p.G2358C	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2358	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGGCACGGCCCTCATGAGGC	0.592																																																	0													85.0	79.0	81.0					11																	6646503		2201	4296	6497	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.7072G>T	11.37:g.6646503C>A	ENSP00000299441:p.Gly2358Cys		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654756	0.47467	.	.	ENSG00000166341	ENST00000299441	T	0.54866	0.55	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	0.000000	0.43747	D	0.000533	T	0.67590	0.2909	M	0.79475	2.455	0.34854	D	0.741943	D	0.76494	0.999	D	0.68192	0.956	T	0.77021	-0.2742	10	0.66056	D	0.02	.	6.99	0.24750	0.0:0.7326:0.1768:0.0906	.	2358	Q96JQ0	PCD16_HUMAN	C	2358	ENSP00000299441:G2358C	ENSP00000299441:G2358C	G	-	1	0	DCHS1	6603079	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	4.861000	0.62969	2.563000	0.86464	0.655000	0.94253	GGC		0.592	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1		NM_003737	
FAM179B	23116	hgsc.bcm.edu	37	14	45514044	45514044	+	Silent	SNP	A	A	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr14:45514044A>G	ENST00000361577.3	+	13	4339	c.4125A>G	c.(4123-4125)gcA>gcG	p.A1375A	KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Silent_p.A1375A	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1375										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGCACGTGCAGTTGTTTCTC	0.343																																																	0													79.0	76.0	77.0					14																	45514044		2202	4300	6502	SO:0001819	synonymous_variant	23116			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4125A>G	14.37:g.45514044A>G			Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1																																																																																				0.343	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1		XM_113781	
FAM83G	644815	hgsc.bcm.edu;ucsc.edu	37	17	18882881	18882881	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr17:18882881C>T	ENST00000388995.6	-	4	1019	c.796G>A	c.(796-798)Gct>Act	p.A266T	FAM83G_ENST00000585154.2_Missense_Mutation_p.A266T|FAM83G_ENST00000345041.4_Missense_Mutation_p.A266T|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395643.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	266					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CCGCACACAGCCCGGTCTCCA	0.587																																																	0													50.0	61.0	58.0					17																	18882881		2023	4176	6199	SO:0001583	missense	644815			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.796G>A	17.37:g.18882881C>T	ENSP00000373647:p.Ala266Thr		Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	37	CCDS42276.1	.	.	.	.	.	.	.	.	.	.	C	35	5.534371	0.96460	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.12465	2.68;2.68	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.21381	-1.0247	10	0.72032	D	0.01	-28.7186	19.48	0.95005	0.0:1.0:0.0:0.0	.	266	A6ND36	FA83G_HUMAN	T	266	ENSP00000373647:A266T;ENSP00000343279:A266T	ENSP00000343279:A266T	A	-	1	0	FAM83G	18823606	1.000000	0.71417	0.987000	0.45799	0.854000	0.48673	6.037000	0.70956	2.606000	0.88127	0.655000	0.94253	GCT		0.587	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4			
FGD1	2245	hgsc.bcm.edu;ucsc.edu	37	X	54475346	54475346	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chrX:54475346G>A	ENST00000375135.3	-	16	3062	c.2329C>T	c.(2329-2331)Cgc>Tgc	p.R777C		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	777					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGGTTGGAGCGGTTGTTGTCA	0.622																																																	0													61.0	44.0	50.0					X																	54475346		2203	4300	6503	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2329C>T	X.37:g.54475346G>A	ENSP00000364277:p.Arg777Cys		Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555216	0.86231	.	.	ENSG00000102302	ENST00000375135	T	0.12984	2.63	5.45	5.45	0.79879	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.56097	D	0.000039	T	0.43612	0.1255	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.49579	-0.8925	10	0.87932	D	0	-12.7389	17.0402	0.86487	0.0:0.0:1.0:0.0	.	777	P98174	FGD1_HUMAN	C	777	ENSP00000364277:R777C	ENSP00000364277:R777C	R	-	1	0	FGD1	54492071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.468000	0.66743	2.287000	0.76781	0.513000	0.50165	CGC		0.622	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1		NM_004463	
HLA-DQB1	3119	hgsc.bcm.edu	37	6	32632777	32632777	+	Silent	SNP	C	C	T	rs1049068	byFrequency	TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr6:32632777C>T	ENST00000399084.1	-	3	355	c.177G>A	c.(175-177)gtG>gtA	p.V59V	HLA-DQB1_ENST00000399079.3_Silent_p.V59V|HLA-DQB1_ENST00000374943.4_Silent_p.V59V|HLA-DQB1_ENST00000399082.3_Intron|HLA-DQB1_ENST00000434651.2_Silent_p.V59V|XXbac-BPG254F23.6_ENST00000443574.1_RNA			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	59	Beta-1.		V -> L (in allele DQB1*03:18; dbSNP:rs41563539).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	TGTATCTGGTCACAAGACGCA	0.622									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				C|||	474	0.0946486	0.1044	0.0908	5008	,	,		7780	0.0427		0.1233	False		,,,				2504	0.1084				Esophageal Squamous(151;720 1825 15000 40336 43415)												0								C		473,3789		100,273,1758	30.0	32.0	32.0		177	3.0	0.1	6	dbSNP_86	32	1130,7308		260,610,3349	no	coding-synonymous	HLA-DQB1	NM_002123.4		360,883,5107	TT,TC,CC		13.3918,11.0981,12.622		59/262	32632777	1603,11097	2131	4219	6350	SO:0001819	synonymous_variant	3119	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.177G>A	6.37:g.32632777C>T			A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Silent	SNP	ENST00000399084.1	37	CCDS43451.1																																																																																				0.622	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1		NM_002123	
HLX	3142	hgsc.bcm.edu;ucsc.edu	37	1	221055659	221055659	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr1:221055659T>C	ENST00000366903.6	+	3	2427	c.926T>C	c.(925-927)cTg>cCg	p.L309P	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_Missense_Mutation_p.L95P	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	309					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CGAAAGCAGCTGGCGGCGATG	0.627																																																	0													49.0	43.0	45.0					1																	221055659		2203	4300	6503	SO:0001583	missense	3142			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.926T>C	1.37:g.221055659T>C	ENSP00000355870:p.Leu309Pro		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	T	31	5.089072	0.94100	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;D	0.98792	-5.05;-5.14;-5.05	5.9	5.9	0.94986	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.160366	0.28865	N	0.013899	D	0.99548	0.9838	H	0.98951	4.38	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.97823	1.0258	10	0.87932	D	0	-20.4509	16.3816	0.83467	0.0:0.0:0.0:1.0	.	309	Q14774	HLX_HUMAN	P	309;42;95	ENSP00000355870:L309P;ENSP00000408248:L42P;ENSP00000449882:L95P	ENSP00000355870:L309P	L	+	2	0	HLX	219122282	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.038000	0.88943	2.276000	0.75962	0.454000	0.30748	CTG		0.627	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3		NM_021958	
HNRNPLL	92906	hgsc.bcm.edu;ucsc.edu	37	2	38800465	38800465	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr2:38800465T>C	ENST00000449105.3	-	8	1318	c.979A>G	c.(979-981)Atg>Gtg	p.M327V	HNRNPLL_ENST00000409636.1_Missense_Mutation_p.M322V|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.M293V|HNRNPLL_ENST00000378915.3_Missense_Mutation_p.M293V|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.M327V			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	327					mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CCTCCATGCATGTAAGAGGAA	0.413																																																	0													111.0	107.0	109.0					2																	38800465		2203	4300	6503	SO:0001583	missense	92906			BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.979A>G	2.37:g.38800465T>C	ENSP00000390625:p.Met327Val		Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	37		.	.	.	.	.	.	.	.	.	.	T	10.58	1.388806	0.25118	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328	.	.	.	5.42	5.42	0.78866	.	0.114714	0.64402	D	0.000007	T	0.42743	0.1216	N	0.22421	0.69	0.80722	D	1	B;B;B	0.21381	0.055;0.055;0.027	B;B;B	0.18263	0.021;0.021;0.004	T	0.31916	-0.9926	9	0.12766	T	0.61	1.2017	15.7498	0.77976	0.0:0.0:0.0:1.0	.	322;327;327	C9J9G0;D6W592;Q8WVV9	.;.;HNRLL_HUMAN	V	327;322;293;293	.	ENSP00000368195:M293V	M	-	1	0	HNRPLL	38653969	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.806000	0.27126	2.172000	0.68678	0.482000	0.46254	ATG		0.413	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2		NM_138394	
LARS2	23395	hgsc.bcm.edu	37	3	45583404	45583404	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr3:45583404C>A	ENST00000415258.1	+	20	2629	c.2488C>A	c.(2488-2490)Ccg>Acg	p.P830T	LARS2_ENST00000414984.1_Missense_Mutation_p.P787T|LARS2_ENST00000265537.3_Missense_Mutation_p.P830T			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	830					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	TGCTGTGGACCCGGAGTTCCT	0.637																																																	0													70.0	62.0	64.0					3																	45583404		2203	4300	6503	SO:0001583	missense	23395			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.2488C>A	3.37:g.45583404C>A	ENSP00000408576:p.Pro830Thr			Missense_Mutation	SNP	ENST00000415258.1	37	CCDS2728.1	.	.	.	.	.	.	.	.	.	.	C	9.770	1.172358	0.21704	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	T;T;T	0.31247	1.5;1.5;1.5	5.67	3.79	0.43588	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.241644	0.42294	N	0.000729	T	0.29321	0.0730	M	0.62266	1.93	0.46981	D	0.999275	B;B	0.16166	0.016;0.016	B;B	0.15484	0.013;0.013	T	0.08806	-1.0704	10	0.62326	D	0.03	-17.9133	7.6703	0.28455	0.2921:0.6327:0.0:0.0752	.	787;830	E9PHM2;Q15031	.;SYLM_HUMAN	T	830;830;787	ENSP00000265537:P830T;ENSP00000408576:P830T;ENSP00000412893:P787T	ENSP00000265537:P830T	P	+	1	0	LARS2	45558408	1.000000	0.71417	0.986000	0.45419	0.204000	0.24138	2.503000	0.45407	0.671000	0.31185	0.557000	0.71058	CCG		0.637	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345001.1		NM_015340	
EIF2D	1939	hgsc.bcm.edu	37	1	206776435	206776435	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr1:206776435C>T	ENST00000271764.2	-	6	862	c.654G>A	c.(652-654)atG>atA	p.M218I	EIF2D_ENST00000367114.3_Intron	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	218					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						CCTCCAGGGTCATGTGCCTCA	0.582																																																	0													194.0	172.0	180.0					1																	206776435		2203	4300	6503	SO:0001583	missense	100529141			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.654G>A	1.37:g.206776435C>T	ENSP00000271764:p.Met218Ile		Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	C	8.144	0.785964	0.16189	.	.	ENSG00000143486	ENST00000271764;ENST00000367111;ENST00000437518	T;T	0.39997	1.05;1.05	5.89	2.72	0.32119	.	0.555420	0.19749	N	0.106946	T	0.24624	0.0597	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.16070	-1.0415	10	0.36615	T	0.2	-17.2481	10.3042	0.43670	0.1316:0.5835:0.2849:0.0	.	218	P41214	EIF2D_HUMAN	I	218;190;190	ENSP00000271764:M218I;ENSP00000394685:M190I	ENSP00000271764:M218I	M	-	3	0	EIF2D	204843058	0.226000	0.23696	0.009000	0.14445	0.386000	0.30323	0.587000	0.23909	0.786000	0.33708	0.655000	0.94253	ATG		0.582	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1		NM_006893	
MICAL3	57553	hgsc.bcm.edu;ucsc.edu	37	22	18382260	18382260	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr22:18382260A>C	ENST00000441493.2	-	7	1254	c.902T>G	c.(901-903)aTg>aGg	p.M301R	MICAL3_ENST00000400561.2_Missense_Mutation_p.M301R|MICAL3_ENST00000444520.1_Missense_Mutation_p.M301R|MICAL3_ENST00000383094.3_Missense_Mutation_p.M301R|MICAL3_ENST00000207726.7_Missense_Mutation_p.M301R|MICAL3_ENST00000414725.2_Missense_Mutation_p.M301R|MICAL3_ENST00000429452.1_Missense_Mutation_p.M301R|MICAL3_ENST00000585038.1_Missense_Mutation_p.M301R	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	301	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTTGGCTGTCATAACGAAATA	0.408																																																	0													170.0	137.0	147.0					22																	18382260		1568	3582	5150	SO:0001583	missense	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.902T>G	22.37:g.18382260A>C	ENSP00000416015:p.Met301Arg		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.710578	0.89112	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.06687	3.27;3.27;3.27;3.27;3.27;3.27;3.27	5.73	5.73	0.89815	.	0.032147	0.85682	D	0.000000	T	0.40595	0.1123	M	0.93420	3.415	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.992;0.996;1.0;1.0;0.996	T	0.54741	-0.8248	10	0.87932	D	0	.	16.0337	0.80603	1.0:0.0:0.0:0.0	.	301;301;301;301;301	B4DJ91;B2RXJ5;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	R	301	ENSP00000416015:M301R;ENSP00000414846:M301R;ENSP00000383406:M301R;ENSP00000410315:M301R;ENSP00000391827:M301R;ENSP00000372574:M301R;ENSP00000207726:M301R	ENSP00000207726:M301R	M	-	2	0	XXbac-B461K10.4;MICAL3	16762260	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.310000	0.96267	2.189000	0.69895	0.528000	0.53228	ATG		0.408	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			
MORC2	22880	hgsc.bcm.edu	37	22	31328970	31328970	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr22:31328970C>A	ENST00000397641.3	-	22	2836	c.2428G>T	c.(2428-2430)Ggc>Tgc	p.G810C	MORC2-AS1_ENST00000441558.1_RNA|MORC2_ENST00000215862.4_Missense_Mutation_p.G748C			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	810						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						GTGACACGGCCCGTGTACCAC	0.562																																																	0													280.0	251.0	260.0					22																	31328970		2203	4300	6503	SO:0001583	missense	22880			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2428G>T	22.37:g.31328970C>A	ENSP00000380763:p.Gly810Cys		B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	C	35	5.481527	0.96307	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.40225	1.07;1.04	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.66307	0.2776	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66248	-0.5971	10	0.87932	D	0	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	810	Q9Y6X9	MORC2_HUMAN	C	810;748	ENSP00000380763:G810C;ENSP00000215862:G748C	ENSP00000215862:G748C	G	-	1	0	MORC2	29658970	1.000000	0.71417	0.984000	0.44739	0.988000	0.76386	7.487000	0.81328	2.825000	0.97269	0.655000	0.94253	GGC		0.562	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2		NM_014941	
NUP153	9972	hgsc.bcm.edu	37	6	17637570	17637570	+	Silent	SNP	A	A	G	rs370382318		TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr6:17637570A>G	ENST00000262077.2	-	16	2277	c.2278T>C	c.(2278-2280)Ttg>Ctg	p.L760L	NUP153_ENST00000537253.1_Silent_p.L791L	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	760					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ACCACTGTCAATGTAAGGGCT	0.433																																																	0													155.0	150.0	152.0					6																	17637570		2203	4300	6503	SO:0001819	synonymous_variant	9972			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2278T>C	6.37:g.17637570A>G			B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Silent	SNP	ENST00000262077.2	37	CCDS4541.1																																																																																				0.433	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1			
PAK6	56924	hgsc.bcm.edu;ucsc.edu	37	15	40564426	40564426	+	Splice_Site	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr15:40564426C>T	ENST00000542403.2	+	4	971	c.860C>T	c.(859-861)cCc>cTc	p.P287L	PAK6_ENST00000260404.4_Splice_Site_p.P287L|PAK6_ENST00000441369.1_Splice_Site_p.P287L|PAK6_ENST00000560346.1_Splice_Site_p.P287L|PAK6_ENST00000453867.1_Splice_Site_p.P287L|PAK6_ENST00000455577.2_Splice_Site_p.P287L|RP11-133K1.2_ENST00000558658.1_3'UTR	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	287	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		TCCCTGCAGCCCAACTCCTCT	0.647																																																	0													79.0	93.0	88.0					15																	40564426		2203	4300	6503	SO:0001630	splice_region_variant	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.859-1C>T	15.37:g.40564426C>T			A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793235	0.50102	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.75704	-0.88;-0.88;-0.96;-0.88;-0.88	5.02	2.06	0.26882	.	0.764422	0.12595	N	0.455216	T	0.62171	0.2406	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.12156	0.003;0.007	T	0.54289	-0.8316	10	0.62326	D	0.03	.	9.2675	0.37650	0.0:0.7726:0.0:0.2274	.	287;287	Q9NQU5;G5E9R2	PAK6_HUMAN;.	L	287	ENSP00000406873:P287L;ENSP00000401153:P287L;ENSP00000409465:P287L;ENSP00000260404:P287L;ENSP00000439597:P287L	ENSP00000260404:P287L	P	+	2	0	PAK6	38351718	0.965000	0.33210	0.985000	0.45067	0.934000	0.57294	1.971000	0.40530	0.232000	0.21100	0.555000	0.69702	CCC		0.647	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			Missense_Mutation
PLEKHH1	57475	hgsc.bcm.edu;ucsc.edu	37	14	68040063	68040063	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr14:68040063T>G	ENST00000329153.5	+	12	1931	c.1799T>G	c.(1798-1800)tTt>tGt	p.F600C		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	600	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AGGCGCTGGTTTGTCCTGAGA	0.547																																																	0													73.0	78.0	76.0					14																	68040063		2077	4235	6312	SO:0001583	missense	57475			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1799T>G	14.37:g.68040063T>G	ENSP00000330278:p.Phe600Cys		A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.821944	0.90873	.	.	ENSG00000054690	ENST00000329153	T	0.07688	3.17	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.051844	0.85682	D	0.000000	T	0.32704	0.0838	M	0.85710	2.77	0.80722	D	1	D;D	0.62365	0.991;0.971	D;D	0.68943	0.961;0.928	T	0.14420	-1.0473	10	0.87932	D	0	.	15.5421	0.76062	0.0:0.0:0.0:1.0	.	115;600	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	C	600	ENSP00000330278:F600C	ENSP00000330278:F600C	F	+	2	0	PLEKHH1	67109816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.254000	0.74563	0.460000	0.39030	TTT		0.547	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3		XM_031054	
PPP6R1	22870	hgsc.bcm.edu	37	19	55751267	55751267	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr19:55751267T>A	ENST00000412770.2	-	13	2056	c.1490A>T	c.(1489-1491)gAg>gTg	p.E497V	PPP6R1_ENST00000587283.1_Missense_Mutation_p.E497V	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	497					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CTCCTGCTGCTCGCTGGGCAG	0.642																																																	0													40.0	46.0	44.0					19																	55751267		2014	4167	6181	SO:0001583	missense	22870			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1490A>T	19.37:g.55751267T>A	ENSP00000414202:p.Glu497Val		Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	T	18.59	3.655952	0.67586	.	.	ENSG00000105063	ENST00000412770	T	0.49720	0.77	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000012	T	0.51193	0.1660	L	0.33339	1.005	0.46564	D	0.999106	P	0.46064	0.872	P	0.54664	0.758	T	0.50206	-0.8855	10	0.45353	T	0.12	-20.4323	13.9603	0.64175	0.0:0.0:0.0:1.0	.	497	Q9UPN7	PP6R1_HUMAN	V	497	ENSP00000414202:E497V	ENSP00000414202:E497V	E	-	2	0	PPP6R1	60443079	1.000000	0.71417	0.968000	0.41197	0.168000	0.22595	7.272000	0.78516	2.195000	0.70347	0.455000	0.32223	GAG		0.642	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1		NM_014931	
PRDM5	11107	hgsc.bcm.edu;ucsc.edu	37	4	121631520	121631520	+	Silent	SNP	G	G	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr4:121631520G>T	ENST00000264808.3	-	15	1912	c.1672C>A	c.(1672-1674)Cga>Aga	p.R558R	PRDM5_ENST00000506065.1_5'UTR|PRDM5_ENST00000515109.1_Missense_Mutation_p.A498E|PRDM5_ENST00000428209.2_Silent_p.R527R	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	558					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCCAGGCCTCGCTTCTGGCTG	0.473																																																	0													163.0	116.0	132.0					4																	121631520		2203	4300	6503	SO:0001819	synonymous_variant	11107			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1672C>A	4.37:g.121631520G>T			Q0VAI9|Q0VAJ0|Q6NXQ7	Silent	SNP	ENST00000264808.3	37	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561626	0.45590	.	.	ENSG00000138738	ENST00000515109	T	0.09350	2.99	5.45	5.45	0.79879	.	.	.	.	.	T	0.06280	0.0162	.	.	.	0.80722	D	1	B	0.31625	0.332	B	0.34652	0.187	T	0.13791	-1.0496	8	0.02654	T	1	-8.5661	13.393	0.60834	0.0:0.0:0.8424:0.1575	.	498	Q0VAI9	.	E	498	ENSP00000422309:A498E	ENSP00000422309:A498E	A	-	2	0	PRDM5	121850970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.784000	0.47774	2.710000	0.92621	0.555000	0.69702	GCG		0.473	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2			
PRSS16	10279	hgsc.bcm.edu	37	6	27216901	27216901	+	Silent	SNP	A	A	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr6:27216901A>C	ENST00000230582.3	+	4	375	c.360A>C	c.(358-360)ccA>ccC	p.P120P	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	120					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCTTGGCCCCAGCCTGGGGCG	0.587																																					NSCLC(178;1118 2105 17078 23587 44429)												0													54.0	59.0	58.0					6																	27216901		2203	4300	6503	SO:0001819	synonymous_variant	10279			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.360A>C	6.37:g.27216901A>C			O75416	Silent	SNP	ENST00000230582.3	37	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	A	5.587	0.293155	0.10567	.	.	ENSG00000112812	ENST00000485993;ENST00000475106	.	.	.	4.04	-3.83	0.04269	.	.	.	.	.	T	0.29817	0.0745	.	.	.	0.43531	D	0.995812	.	.	.	.	.	.	T	0.38993	-0.9635	4	.	.	.	-20.1907	4.6414	0.12550	0.3051:0.0:0.4276:0.2672	.	.	.	.	R	12	.	.	S	+	1	0	PRSS16	27324880	0.053000	0.20554	0.917000	0.36280	0.060000	0.15804	-0.059000	0.11731	-0.710000	0.05001	0.455000	0.32223	AGC		0.587	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2			
PTCD1	26024	hgsc.bcm.edu	37	7	99022803	99022803	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr7:99022803G>T	ENST00000292478.4	-	6	1602	c.1352C>A	c.(1351-1353)aCa>aAa	p.T451K	PTCD1_ENST00000555673.1_Missense_Mutation_p.T500K|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.T500K	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	451					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGAGACCACTGTAGGGGGAAC	0.662																																																	0													50.0	54.0	52.0					7																	99022803		2203	4300	6503	SO:0001583	missense	26024			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1352C>A	7.37:g.99022803G>T	ENSP00000292478:p.Thr451Lys		Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	G	5.962	0.361560	0.11296	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.63580	-0.05;-0.03;-0.03	5.72	3.74	0.42951	.	0.663220	0.16748	N	0.201163	T	0.48822	0.1521	L	0.34521	1.04	0.09310	N	1	B;B	0.31054	0.306;0.121	B;B	0.24006	0.05;0.023	T	0.35076	-0.9803	10	0.32370	T	0.25	0.1931	13.8419	0.63444	0.0:0.0:0.5533:0.4467	.	500;451	G3V325;O75127	.;PTCD1_HUMAN	K	451;233;500;500	ENSP00000292478:T451K;ENSP00000450995:T500K;ENSP00000400168:T500K	ENSP00000400168:T500K	T	-	2	0	ATP5J2-PTCD1;PTCD1	98860739	0.002000	0.14202	0.370000	0.25965	0.004000	0.04260	0.616000	0.24344	1.405000	0.46838	0.561000	0.74099	ACA		0.662	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1		NM_015545	
RHO	6010	hgsc.bcm.edu	37	3	129249846	129249846	+	Missense_Mutation	SNP	G	G	T	rs556019320		TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr3:129249846G>T	ENST00000296271.3	+	2	583	c.489G>T	c.(487-489)atG>atT	p.M163I		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	163					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	CCTGGGTCATGGCGCTGGCCT	0.632																																					Esophageal Squamous(118;214 1623 30842 43234 46940)												0													124.0	100.0	108.0					3																	129249846		2203	4300	6503	SO:0001583	missense	6010			AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.489G>T	3.37:g.129249846G>T	ENSP00000296271:p.Met163Ile		Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	37	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080758	0.94050	.	.	ENSG00000163914	ENST00000296271	T	0.70282	-0.47	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	M	0.81682	2.555	0.80722	D	1	D	0.56035	0.974	D	0.74023	0.982	D	0.87240	0.2266	10	0.87932	D	0	.	18.8606	0.92270	0.0:0.0:1.0:0.0	.	163	P08100	OPSD_HUMAN	I	163	ENSP00000296271:M163I	ENSP00000296271:M163I	M	+	3	0	RHO	130732536	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.863000	0.99569	2.448000	0.82819	0.462000	0.41574	ATG		0.632	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1		NM_000539	
RPS3	6188	hgsc.bcm.edu	37	11	75113406	75113406	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr11:75113406A>C	ENST00000531188.1	+	4	328	c.266A>C	c.(265-267)gAa>gCa	p.E89A	RPS3_ENST00000534440.1_Missense_Mutation_p.E89A|RPS3_ENST00000524851.1_Missense_Mutation_p.E89A|RPS3_ENST00000526608.1_Intron|RPS3_ENST00000278572.6_Missense_Mutation_p.E105A|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000529285.1_3'UTR|SNORD15B_ENST00000384714.1_RNA|RPS3_ENST00000530164.1_Missense_Mutation_p.E89A|RPS3_ENST00000527446.1_Missense_Mutation_p.E89A	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	89	KH type-2. {ECO:0000255|PROSITE- ProRule:PRU00118}.				cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						CTTTATGCTGAAAAGGTGGCC	0.458																																																	0													111.0	109.0	109.0					11																	75113406		2200	4293	6493	SO:0001583	missense	6188				CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.266A>C	11.37:g.75113406A>C	ENSP00000434643:p.Glu89Ala		B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	ENST00000531188.1	37	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198376	0.79015	.	.	ENSG00000149273	ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000534440;ENST00000527446;ENST00000524851	.	.	.	4.9	4.9	0.64082	K Homology (1);K homology domain-like, alpha/beta (1);K Homology, prokaryotic type (1);K Homology, type 2 (2);	0.000000	0.85682	D	0.000000	D	0.84356	0.5454	M	0.93594	3.435	0.80722	D	1	B	0.28400	0.21	P	0.45913	0.497	D	0.85670	0.1294	9	0.56958	D	0.05	-12.9159	12.5319	0.56120	1.0:0.0:0.0:0.0	.	89	P23396	RS3_HUMAN	A	89;89;89;105;89;89;89	.	ENSP00000278572:E105A	E	+	2	0	RPS3	74791054	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.109000	0.94291	2.077000	0.62373	0.482000	0.46254	GAA		0.458	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2		NM_001005	
RS1	6247	hgsc.bcm.edu	37	X	18660196	18660196	+	Silent	SNP	G	G	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chrX:18660196G>A	ENST00000379984.3	-	6	643	c.603C>T	c.(601-603)ctC>ctT	p.L201L	CDKL5_ENST00000379989.3_Intron|CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	201	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					CCAGCGGGATGAGGCGGATGA	0.627																																																	0													69.0	63.0	65.0					X																	18660196		2203	4300	6503	SO:0001819	synonymous_variant	6247			AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.603C>T	X.37:g.18660196G>A			Q0QD39	Silent	SNP	ENST00000379984.3	37	CCDS14187.1																																																																																				0.627	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055949.1			
NEMF	9147	hgsc.bcm.edu;ucsc.edu	37	14	50312885	50312885	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr14:50312885G>C	ENST00000298310.5	-	4	779	c.330C>G	c.(328-330)taC>taG	p.Y110*	NEMF_ENST00000546046.1_Nonsense_Mutation_p.Y110*|NEMF_ENST00000545773.1_Intron|NEMF_ENST00000556672.1_Nonsense_Mutation_p.Y110*|AL627171.1_ENST00000358799.1_5'Flank			O60524	NEMF_HUMAN	nuclear export mediator factor	110					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TGATTAAATGGTAAGCAGCTT	0.338																																																	0													91.0	86.0	87.0					14																	50312885		2203	4300	6503	SO:0001587	stop_gained	0			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.330C>G	14.37:g.50312885G>C	ENSP00000298310:p.Tyr110*		A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Nonsense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387893	0.61956	.	.	ENSG00000165525	ENST00000298310;ENST00000546046;ENST00000556672	.	.	.	5.29	4.15	0.48705	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.858	8.5809	0.33628	0.7742:0.0:0.2258:0.0	.	.	.	.	X	110	.	ENSP00000298310:Y110X	Y	-	3	2	NEMF	49382635	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.701000	0.54793	0.338000	0.23692	-0.490000	0.04691	TAC		0.338	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1		NM_004713	
SDR9C7	121214	hgsc.bcm.edu	37	12	57323228	57323228	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr12:57323228C>T	ENST00000293502.1	-	3	813	c.670G>A	c.(670-672)Gag>Aag	p.E224K		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	224					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						GGCAGCCTCTCCCAAAGCTTT	0.572																																																	0													106.0	94.0	98.0					12																	57323228		2203	4300	6503	SO:0001583	missense	121214			AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.670G>A	12.37:g.57323228C>T	ENSP00000293502:p.Glu224Lys		B3KVB4	Missense_Mutation	SNP	ENST00000293502.1	37	CCDS8926.1	.	.	.	.	.	.	.	.	.	.	C	9.224	1.034236	0.19590	.	.	ENSG00000170426	ENST00000293502	D	0.89343	-2.5	5.45	2.66	0.31614	NAD(P)-binding domain (1);	1.444650	0.03997	N	0.295833	D	0.84723	0.5535	L	0.41824	1.3	0.23735	N	0.996985	B	0.06786	0.001	B	0.09377	0.004	T	0.65990	-0.6034	10	0.27082	T	0.32	.	8.4767	0.33018	0.0:0.6934:0.0:0.3066	.	224	Q8NEX9	DR9C7_HUMAN	K	224	ENSP00000293502:E224K	ENSP00000293502:E224K	E	-	1	0	SDR9C7	55609495	0.001000	0.12720	0.953000	0.39169	0.574000	0.36063	-0.082000	0.11304	0.383000	0.24910	0.650000	0.86243	GAG		0.572	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411211.1		NM_148897	
SERPINI1	5274	hgsc.bcm.edu;ucsc.edu	37	3	167508176	167508176	+	Silent	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr3:167508176C>T	ENST00000295777.5	+	3	698	c.267C>T	c.(265-267)ttC>ttT	p.F89F	SERPINI1_ENST00000446050.2_Silent_p.F89F	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	89					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						AATTTTCTTTCTTGAAGGAGT	0.368																																																	0													65.0	66.0	66.0					3																	167508176		2203	4300	6503	SO:0001819	synonymous_variant	5274			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.267C>T	3.37:g.167508176C>T			A8K217|D3DNP1|Q6AHZ4	Silent	SNP	ENST00000295777.5	37	CCDS3203.1																																																																																				0.368	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1			
SETD4	54093	hgsc.bcm.edu	37	21	37418057	37418057	+	Silent	SNP	C	C	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr21:37418057C>T	ENST00000399215.1	-	5	1921	c.549G>A	c.(547-549)ctG>ctA	p.L183L	SETD4_ENST00000399205.1_Silent_p.L159L|SETD4_ENST00000481477.1_5'UTR|SETD4_ENST00000399207.1_Silent_p.L183L|SETD4_ENST00000399212.1_Silent_p.L159L|SETD4_ENST00000399201.1_Silent_p.L159L|SETD4_ENST00000332131.4_Silent_p.L183L|SETD4_ENST00000399208.2_Silent_p.L183L			Q9NVD3	SETD4_HUMAN	SET domain containing 4	183	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						CCTCCGCAAACAGAGGCTGCA	0.547																																																	0													67.0	74.0	72.0					21																	37418057		2203	4300	6503	SO:0001819	synonymous_variant	54093			AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.549G>A	21.37:g.37418057C>T			B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Silent	SNP	ENST00000399215.1	37	CCDS13640.1																																																																																				0.547	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1		NM_017438	
SKAP2	8935	hgsc.bcm.edu	37	7	26765559	26765559	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr7:26765559A>C	ENST00000345317.2	-	8	954	c.641T>G	c.(640-642)cTg>cGg	p.L214R	SKAP2_ENST00000489977.1_5'UTR|SKAP2_ENST00000539623.1_Missense_Mutation_p.L42R	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	214	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						TACAAATTTCAGCTGCTGTAC	0.328																																																	0													83.0	80.0	81.0					7																	26765559		2203	4299	6502	SO:0001583	missense	8935				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.641T>G	7.37:g.26765559A>C	ENSP00000005587:p.Leu214Arg		A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.084886	0.55861	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.22336	1.96;1.96	6.03	6.03	0.97812	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.144353	0.50627	D	0.000102	T	0.45915	0.1366	M	0.76433	2.335	0.41034	D	0.985173	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.48410	-0.9038	10	0.87932	D	0	-16.8407	11.6211	0.51119	0.8673:0.0:0.0:0.1327	.	199;214	B7Z5N4;O75563	.;SKAP2_HUMAN	R	214;42;199	ENSP00000005587:L214R;ENSP00000443593:L42R	ENSP00000005587:L214R	L	-	2	0	SKAP2	26732084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.216000	0.72212	2.302000	0.77476	0.533000	0.62120	CTG		0.328	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1			
SLC6A2	6530	hgsc.bcm.edu	37	16	55734212	55734212	+	Silent	SNP	T	T	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr16:55734212T>C	ENST00000379906.2	+	12	2007	c.1752T>C	c.(1750-1752)ctT>ctC	p.L584L	SLC6A2_ENST00000219833.8_Silent_p.L584L|SLC6A2_ENST00000568943.1_Silent_p.L584L|SLC6A2_ENST00000414754.3_Intron|SLC6A2_ENST00000566163.1_Silent_p.L539L|SLC6A2_ENST00000567238.1_Silent_p.L479L|SLC6A2_ENST00000561820.1_Silent_p.L584L	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	584					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGGGCTCTCTTTGGGAGGTGA	0.642																																																	0													50.0	45.0	46.0					16																	55734212		2198	4300	6498	SO:0001819	synonymous_variant	6530				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1752T>C	16.37:g.55734212T>C			B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	CCDS10754.1																																																																																				0.642	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			
TAS2R38	5726	hgsc.bcm.edu	37	7	141672558	141672558	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr7:141672558A>G	ENST00000547270.1	-	1	1015	c.932T>C	c.(931-933)aTt>aCt	p.I311T		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	311					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					CCAGAGCAGAATGGTCATCAC	0.522																																																	0													72.0	63.0	66.0					7																	141672558		2203	4300	6503	SO:0001583	missense	5726			AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.932T>C	7.37:g.141672558A>G	ENSP00000448219:p.Ile311Thr		A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	37	CCDS34765.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.431571	0.43122	.	.	ENSG00000257138	ENST00000547270	T	0.00864	5.6	5.01	3.82	0.43975	.	0.627114	0.14668	N	0.305548	T	0.01558	0.0050	L	0.46157	1.445	0.09310	N	1	P	0.49307	0.922	P	0.46850	0.529	T	0.52411	-0.8579	10	0.45353	T	0.12	.	7.7823	0.29072	0.9051:0.0:0.0949:0.0	.	311	P59533	T2R38_HUMAN	T	311	ENSP00000448219:I311T	ENSP00000331291:I311T	I	-	2	0	TAS2R38	141319027	0.001000	0.12720	0.001000	0.08648	0.025000	0.11179	0.796000	0.26986	1.007000	0.39238	0.533000	0.62120	ATT		0.522	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2		NM_176817	
TIGD2	166815	hgsc.bcm.edu	37	4	90034133	90034133	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr4:90034133G>T	ENST00000317005.2	+	1	166	c.8G>T	c.(7-9)gGg>gTg	p.G3V	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	3	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		AAAATGTTGGGGAAACGTAAG	0.338																																																	0													99.0	104.0	102.0					4																	90034133		2203	4300	6503	SO:0001583	missense	166815			AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.8G>T	4.37:g.90034133G>T	ENSP00000317170:p.Gly3Val			Missense_Mutation	SNP	ENST00000317005.2	37	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	g	12.42	1.933753	0.34096	.	.	ENSG00000180346	ENST00000317005	T	0.23754	1.89	3.01	3.01	0.34805	Homeodomain-like (1);Helix-turn-helix, Psq-like (1);	0.000000	0.41712	U	0.000823	T	0.31513	0.0799	N	0.22421	0.69	0.49687	D	0.99981	D	0.89917	1.0	D	0.74023	0.982	T	0.04078	-1.0979	10	0.45353	T	0.12	.	9.6193	0.39712	0.0:0.0:1.0:0.0	.	3	Q4W5G0	TIGD2_HUMAN	V	3	ENSP00000317170:G3V	ENSP00000317170:G3V	G	+	2	0	TIGD2	90253156	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	2.871000	0.48459	1.708000	0.51301	0.298000	0.19748	GGG		0.338	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2		NM_145715	
TLR8	51311	hgsc.bcm.edu;ucsc.edu	37	X	12937473	12937473	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chrX:12937473G>A	ENST00000218032.6	+	2	401	c.314G>A	c.(313-315)gGa>gAa	p.G105E	TLR8_ENST00000311912.5_Missense_Mutation_p.G123E	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	105					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CACCAGAACGGAAATCCCGGT	0.403																																																	0													129.0	131.0	130.0					X																	12937473		2203	4300	6503	SO:0001583	missense	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.314G>A	X.37:g.12937473G>A	ENSP00000218032:p.Gly105Glu		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	G	0.074	-1.197454	0.01594	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.32515	1.45;1.59	4.77	-0.69	0.11309	.	1.033840	0.07731	N	0.945337	T	0.15522	0.0374	N	0.12961	0.28	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30937	-0.9961	10	0.22706	T	0.39	.	5.4556	0.16588	0.4657:0.0:0.3983:0.136	.	105;123	Q9NR97;D1CS70	TLR8_HUMAN;.	E	105;123	ENSP00000218032:G105E;ENSP00000312082:G123E	ENSP00000218032:G105E	G	+	2	0	TLR8	12847394	0.001000	0.12720	0.003000	0.11579	0.004000	0.04260	0.979000	0.29500	-0.174000	0.10743	-0.407000	0.06327	GGA		0.403	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2		NM_016610	
TMPRSS12	283471	hgsc.bcm.edu;ucsc.edu	37	12	51252806	51252806	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr12:51252806A>G	ENST00000398458.3	+	3	654	c.622A>G	c.(622-624)Ata>Gta	p.I208V	TMPRSS12_ENST00000551456.1_Missense_Mutation_p.I208V	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						AAAGTGTTTTATAAGTGGCTG	0.353																																																	0													45.0	43.0	44.0					12																	51252806		1825	4087	5912	SO:0001583	missense	283471			BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.622A>G	12.37:g.51252806A>G	ENSP00000381476:p.Ile208Val		B9ZVX2	Missense_Mutation	SNP	ENST00000398458.3	37	CCDS44881.1	.	.	.	.	.	.	.	.	.	.	A	7.320	0.616800	0.14129	.	.	ENSG00000186452	ENST00000551456;ENST00000398458	D;D	0.86366	-2.11;-2.11	5.89	2.28	0.28536	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.085474	0.49916	N	0.000130	T	0.71804	0.3383	N	0.04018	-0.295	0.31074	N	0.712653	P;P	0.43477	0.808;0.619	P;B	0.47162	0.54;0.172	T	0.71262	-0.4645	10	0.06099	T	0.92	-22.289	8.6627	0.34101	0.7864:0.0:0.2136:0.0	.	208;208	F8WBX2;Q86WS5	.;TMPSC_HUMAN	V	208	ENSP00000447259:I208V;ENSP00000381476:I208V	ENSP00000381476:I208V	I	+	1	0	TMPRSS12	49539073	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.298000	0.33412	1.011000	0.39340	0.455000	0.32223	ATA		0.353	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1		NM_182559	
UBN1	29855	hgsc.bcm.edu	37	16	4911047	4911047	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr16:4911047T>C	ENST00000396658.4	+	6	1757	c.1054T>C	c.(1054-1056)Tct>Cct	p.S352P	UBN1_ENST00000590769.1_Missense_Mutation_p.S352P|UBN1_ENST00000585857.1_3'UTR|UBN1_ENST00000262376.6_Missense_Mutation_p.S352P|UBN1_ENST00000545171.1_Missense_Mutation_p.S352P	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	352					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						GCAGCCCTCTTCTCTCCCCGA	0.577																																																	0													47.0	49.0	48.0					16																	4911047		2197	4300	6497	SO:0001583	missense	29855			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1054T>C	16.37:g.4911047T>C	ENSP00000379894:p.Ser352Pro		B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.583414	0.46006	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.45668	1.47;0.89;1.47	5.87	2.09	0.27110	.	0.120365	0.56097	D	0.000021	T	0.27900	0.0687	L	0.40543	1.245	0.29734	N	0.837686	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.12192	-1.0557	10	0.37606	T	0.19	-6.8685	4.2918	0.10881	0.1133:0.064:0.2353:0.5873	.	352;352	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	P	352	ENSP00000262376:S352P;ENSP00000442379:S352P;ENSP00000379894:S352P	ENSP00000262376:S352P	S	+	1	0	UBN1	4851048	0.912000	0.30974	0.983000	0.44433	0.989000	0.77384	1.570000	0.36439	0.524000	0.28502	0.533000	0.62120	TCT		0.577	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1		NM_016936	
URGCP	55665	hgsc.bcm.edu	37	7	43918276	43918276	+	Silent	SNP	G	G	C	rs144106376		TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr7:43918276G>C	ENST00000453200.1	-	6	1279	c.786C>G	c.(784-786)gcC>gcG	p.A262A	URGCP_ENST00000402306.3_Silent_p.A253A|URGCP_ENST00000443736.1_Silent_p.A219A|URGCP_ENST00000336086.6_Silent_p.A219A|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000223341.7_Silent_p.A219A|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000447717.3_Silent_p.A219A			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	262					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.A219A(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGAAGGCGAAGGCGGGCGCCC	0.652																																																	1	Substitution - coding silent(1)	skin(1)											37.0	45.0	42.0					7																	43918276		2084	4206	6290	SO:0001819	synonymous_variant	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.786C>G	7.37:g.43918276G>C			E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	ENST00000453200.1	37	CCDS47578.1																																																																																				0.652	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1		NM_001077664	
VCP	7415	hgsc.bcm.edu;ucsc.edu	37	9	35059494	35059494	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chr9:35059494G>A	ENST00000358901.6	-	14	2895	c.2000C>T	c.(1999-2001)gCc>gTc	p.A667V		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	667					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ACCTGCCTTGGCAACTGGGGA	0.542																																																	0													79.0	66.0	70.0					9																	35059494		2203	4300	6503	SO:0001583	missense	7415			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.2000C>T	9.37:g.35059494G>A	ENSP00000351777:p.Ala667Val		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482359	0.84747	.	.	ENSG00000165280	ENST00000358901	D	0.94862	-3.54	6.07	6.07	0.98685	.	0.231439	0.51477	D	0.000082	D	0.94275	0.8161	M	0.67953	2.075	0.80722	D	1	P	0.42456	0.78	B	0.40165	0.321	D	0.94330	0.7561	10	0.87932	D	0	-29.8665	20.6439	0.99570	0.0:0.0:1.0:0.0	.	667	P55072	TERA_HUMAN	V	667	ENSP00000351777:A667V	ENSP00000351777:A667V	A	-	2	0	VCP	35049494	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.140000	0.71738	2.884000	0.98904	0.655000	0.94253	GCC		0.542	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1		NM_007126	
XPNPEP2	7512	hgsc.bcm.edu	37	X	128886126	128886126	+	Splice_Site	SNP	G	G	T			TCGA-BP-4346-01A-01D-1366-10	TCGA-BP-4346-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	20735253-1ba8-41c9-b4ab-682c1af79b9d	69e027cf-071a-4b3e-97de-c450555f38c1	g.chrX:128886126G>T	ENST00000371106.3	+	10	1014	c.822G>T	c.(820-822)agG>agT	p.R274S		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	274						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						CCCCACCCAGGTTGTTTGCAA	0.527																																																	0													90.0	83.0	85.0					X																	128886126		2203	4299	6502	SO:0001630	splice_region_variant	7512			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.822-1G>T	X.37:g.128886126G>T			A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	G	5.605	0.296405	0.10622	.	.	ENSG00000122121	ENST00000371106	T	0.73152	-0.72	5.78	0.523	0.17060	.	0.184777	0.64402	N	0.000012	T	0.53318	0.1789	L	0.46885	1.475	0.80722	D	1	B	0.22909	0.077	B	0.20955	0.032	T	0.26189	-1.0110	9	.	.	.	.	2.2466	0.04033	0.1496:0.1164:0.3733:0.3607	.	274	O43895	XPP2_HUMAN	S	274	ENSP00000360147:R274S	.	R	+	3	2	XPNPEP2	128713807	0.966000	0.33281	0.192000	0.23308	0.288000	0.27193	0.795000	0.26972	-0.046000	0.13446	0.529000	0.55759	AGG		0.527	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1		NM_003399	Missense_Mutation
