#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AAAS	8086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53702266	53702266	+	Silent	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr12:53702266C>A	ENST00000209873.4	-	12	1299	c.1134G>T	c.(1132-1134)gtG>gtT	p.V378V	AAAS_ENST00000549983.1_5'Flank|AAAS_ENST00000394384.3_Silent_p.V345V|AAAS_ENST00000550286.1_Silent_p.V254V	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	378					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)		p.V378V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						ACAGATCTGCCACAATCGTTG	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											287.0	216.0	240.0					12																	53702266		2203	4300	6503	SO:0001819	synonymous_variant	8086			AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.1134G>T	12.37:g.53702266C>A			Q5JB47|Q9NWI6|Q9UG19	Silent	SNP	ENST00000209873.4	37	CCDS8856.1																																																																																				0.527	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405632.1			
ALPK2	115701	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	56205356	56205356	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr18:56205356G>A	ENST00000361673.3	-	5	2276	c.2063C>T	c.(2062-2064)aCa>aTa	p.T688I	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	688						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T688I(1)|p.T54I(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GAAGGAAATTGTTGTGGTCCC	0.498																																																	2	Substitution - Missense(2)	kidney(2)											57.0	49.0	51.0					18																	56205356		2203	4300	6503	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2063C>T	18.37:g.56205356G>A	ENSP00000354991:p.Thr688Ile		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	11.04	1.520964	0.27211	.	.	ENSG00000198796	ENST00000361673	T	0.53640	0.61	5.91	-1.69	0.08186	.	1.013800	0.07893	N	0.971439	T	0.36026	0.0952	L	0.43152	1.355	0.09310	N	1	B;B	0.24721	0.11;0.024	B;B	0.23419	0.046;0.005	T	0.33137	-0.9880	10	0.46703	T	0.11	0.2428	5.7219	0.17992	0.4616:0.0:0.4136:0.1249	.	688;688	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	I	688	ENSP00000354991:T688I	ENSP00000354991:T688I	T	-	2	0	ALPK2	54356336	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.125000	0.10579	-0.365000	0.08076	-0.136000	0.14681	ACA		0.498	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1		NM_052947	
ANKMY2	57037	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	16655424	16655424	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr7:16655424T>C	ENST00000306999.2	-	5	719	c.476A>G	c.(475-477)aAg>aGg	p.K159R		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	159						cilium (GO:0005929)	metal ion binding (GO:0046872)	p.K159R(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GCCTGCCAACTTTGGGGGCAG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											97.0	95.0	96.0					7																	16655424		2203	4300	6503	SO:0001583	missense	57037			AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.476A>G	7.37:g.16655424T>C	ENSP00000303570:p.Lys159Arg		A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	ENST00000306999.2	37	CCDS5361.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667121	0.47677	.	.	ENSG00000106524	ENST00000306999	T	0.72051	-0.62	5.73	5.73	0.89815	.	0.082451	0.85682	D	0.000000	T	0.68742	0.3034	M	0.65975	2.015	0.58432	D	0.999998	B	0.16166	0.016	B	0.14023	0.01	T	0.64183	-0.6467	10	0.20519	T	0.43	-11.3991	16.3349	0.83056	0.0:0.0:0.0:1.0	.	159	Q8IV38	ANKY2_HUMAN	R	159	ENSP00000303570:K159R	ENSP00000303570:K159R	K	-	2	0	ANKMY2	16621949	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.864000	0.69575	2.324000	0.78689	0.533000	0.62120	AAG		0.428	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2		NM_020319	
ASAP2	8853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	9531296	9531296	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:9531296C>T	ENST00000281419.3	+	23	2829	c.2489C>T	c.(2488-2490)cCg>cTg	p.P830L	ASAP2_ENST00000491413.1_Intron|ASAP2_ENST00000315273.4_Intron	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	830	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)	p.P830L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GTCCATCCACCGCTGCCCCCT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											173.0	168.0	170.0					2																	9531296		2203	4300	6503	SO:0001583	missense	8853			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2489C>T	2.37:g.9531296C>T	ENSP00000281419:p.Pro830Leu		D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384893	0.82792	.	.	ENSG00000151693	ENST00000281419	T	0.59224	0.28	4.49	4.49	0.54785	.	0.520793	0.22942	N	0.053775	T	0.68476	0.3005	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66101	-0.6007	10	0.34782	T	0.22	.	17.7309	0.88377	0.0:1.0:0.0:0.0	.	830	O43150	ASAP2_HUMAN	L	830	ENSP00000281419:P830L	ENSP00000281419:P830L	P	+	2	0	ASAP2	9448747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.470000	0.66756	2.504000	0.84457	0.460000	0.39030	CCG		0.562	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1		NM_003887	
ATG7	10533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	11354777	11354777	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr3:11354777G>T	ENST00000354449.3	+	6	436		c.e6-1		ATG7_ENST00000354956.5_Splice_Site|ATG7_ENST00000446450.2_Intron	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						TTTTTTTCTAGGATCTAAAGA	0.368																																																	1	Unknown(1)	kidney(1)											100.0	98.0	98.0					3																	11354777		2203	4300	6503	SO:0001630	splice_region_variant	10533			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.412-1G>T	3.37:g.11354777G>T			B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Splice_Site	SNP	ENST00000354449.3	37	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869986	0.72065	.	.	ENSG00000197548	ENST00000451513;ENST00000354956;ENST00000354449	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.189	0.86874	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATG7	11329777	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.088000	0.89523	2.793000	0.96121	0.563000	0.77884	.		0.368	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3		NM_006395	Intron
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	108199913	108199913	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:108199913A>T	ENST00000452508.2	+	50	7444	c.7255A>T	c.(7255-7257)Aga>Tga	p.R2419*	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Nonsense_Mutation_p.R2419*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2419	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.R2419*(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCTCCTGAAAAGAGCCAAAGA	0.373			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	2	Substitution - Nonsense(2)	kidney(2)											71.0	70.0	70.0					11																	108199913		2201	4298	6499	SO:0001587	stop_gained	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7255A>T	11.37:g.108199913A>T	ENSP00000388058:p.Arg2419*		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	49	15.200593	0.99826	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	.	.	.	5.54	4.39	0.52855	.	0.129398	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5666	0.56314	0.8609:0.1391:0.0:0.0	.	.	.	.	X	2419	.	ENSP00000278616:R2419X	R	+	1	2	ATM	107705123	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.285000	0.72658	0.902000	0.36520	0.528000	0.53228	AGA		0.373	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1		NM_000051	
BMP1	649	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	22034151	22034151	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr8:22034151A>G	ENST00000306385.5	+	4	1209	c.539A>G	c.(538-540)tAt>tGt	p.Y180C	BMP1_ENST00000397816.3_Missense_Mutation_p.Y180C|BMP1_ENST00000306349.8_Missense_Mutation_p.Y180C|BMP1_ENST00000523849.1_3'UTR|BMP1_ENST00000397814.3_Missense_Mutation_p.Y180C|BMP1_ENST00000354870.5_Missense_Mutation_p.Y180C	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	180	Metalloprotease.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.Y180C(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GTGTTCACCTATCGACCTTGC	0.627																																																	2	Substitution - Missense(2)	kidney(2)											153.0	138.0	143.0					8																	22034151		2203	4300	6503	SO:0001583	missense	649				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.539A>G	8.37:g.22034151A>G	ENSP00000305714:p.Tyr180Cys		A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	37	CCDS6026.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263963	0.59431	.	.	ENSG00000168487	ENST00000306385;ENST00000354870;ENST00000397816;ENST00000306349;ENST00000397814	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	4.82	4.82	0.62117	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.000000	0.35096	U	0.003457	T	0.74854	0.3771	M	0.69248	2.105	0.80722	D	1	D;D;D	0.76494	0.99;0.998;0.999	D;D;D	0.71184	0.936;0.965;0.972	T	0.75906	-0.3152	10	0.48119	T	0.1	.	12.3681	0.55240	1.0:0.0:0.0:0.0	.	180;180;180	P13497;P13497-2;P13497-6	BMP1_HUMAN;.;.	C	180	ENSP00000305714:Y180C;ENSP00000346941:Y180C;ENSP00000380917:Y180C;ENSP00000306121:Y180C;ENSP00000380915:Y180C	ENSP00000306121:Y180C	Y	+	2	0	BMP1	22090096	1.000000	0.71417	0.996000	0.52242	0.642000	0.38348	5.924000	0.70054	2.035000	0.60131	0.260000	0.18958	TAT		0.627	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2		NM_006132	
BRWD3	254065	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	79991541	79991541	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chrX:79991541C>G	ENST00000373275.4	-	9	1076	c.860G>C	c.(859-861)gGt>gCt	p.G287A		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	287					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.G287A(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TCCATCAGCACCAGTAGAAGT	0.294																																																	1	Substitution - Missense(1)	kidney(1)											74.0	67.0	69.0					X																	79991541		2203	4298	6501	SO:0001583	missense	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.860G>C	X.37:g.79991541C>G	ENSP00000362372:p.Gly287Ala		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395770	0.83011	.	.	ENSG00000165288	ENST00000373275	T	0.62788	-0.0	4.31	4.31	0.51392	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66096	0.2755	N	0.20483	0.58	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.65829	-0.6073	9	.	.	.	-14.8049	16.4124	0.83723	0.0:1.0:0.0:0.0	.	287	Q6RI45	BRWD3_HUMAN	A	287	ENSP00000362372:G287A	.	G	-	2	0	BRWD3	79878197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.521000	0.81832	2.131000	0.65755	0.544000	0.68410	GGT		0.294	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1		NM_153252	
C8orf34	116328	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	69621309	69621309	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr8:69621309C>G	ENST00000539993.1	+	9	1613	c.1064C>G	c.(1063-1065)tCa>tGa	p.S355*	C8orf34_ENST00000337103.4_Nonsense_Mutation_p.S330*|C8orf34_ENST00000518698.1_Nonsense_Mutation_p.S441*|C8orf34_ENST00000325233.3_Nonsense_Mutation_p.S99*			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	355								p.S355*(1)|p.S330*(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			ATCCCAGATTCATTCGGTAAG	0.343																																																	2	Substitution - Nonsense(2)	kidney(2)											69.0	66.0	67.0					8																	69621309		2203	4300	6503	SO:0001587	stop_gained	116328			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.1064C>G	8.37:g.69621309C>G	ENSP00000438159:p.Ser355*		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Nonsense_Mutation	SNP	ENST00000539993.1	37		.	.	.	.	.	.	.	.	.	.	C	40	8.269689	0.98735	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	.	.	.	5.2	4.32	0.51571	.	0.538688	0.18375	N	0.143154	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5789	10.297	0.43629	0.0:0.9074:0.0:0.0926	.	.	.	.	X	441;355;330;99	.	.	S	+	2	0	C8orf34	69783863	1.000000	0.71417	1.000000	0.80357	0.422000	0.31414	2.083000	0.41615	1.315000	0.45114	0.655000	0.94253	TCA		0.343	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_052958	
C9orf84	158401	broad.mit.edu;hgsc.bcm.edu	37	9	114484858	114484858	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:114484858C>A	ENST00000318737.4	-	13	1898	c.1770G>T	c.(1768-1770)caG>caT	p.Q590H	C9orf84_ENST00000394779.3_Missense_Mutation_p.Q551H|C9orf84_ENST00000394777.4_Missense_Mutation_p.Q551H|C9orf84_ENST00000374287.3_Missense_Mutation_p.Q590H	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	590								p.Q551H(1)|p.Q590H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						ATGCTTGGCACTGGCTATCTG	0.388																																																	2	Substitution - Missense(2)	kidney(2)											84.0	82.0	83.0					9																	114484858		2203	4300	6503	SO:0001583	missense	158401			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.1770G>T	9.37:g.114484858C>A	ENSP00000322108:p.Gln590His		A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515589	0.64634	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.14516	3.19;2.5;3.2;3.2	6.17	0.0372	0.14195	.	0.000000	0.56097	D	0.000037	T	0.22781	0.0550	L	0.34521	1.04	0.33351	D	0.571087	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.16453	-1.0402	10	0.72032	D	0.01	-7.472	11.6732	0.51415	0.0:0.5087:0.0:0.4913	.	551;590;551	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	H	551;551;204;590;590	ENSP00000378259:Q551H;ENSP00000378257:Q551H;ENSP00000363405:Q590H;ENSP00000322108:Q590H	ENSP00000322108:Q590H	Q	-	3	2	C9orf84	113524679	0.183000	0.23186	0.996000	0.52242	0.977000	0.68977	-0.939000	0.03933	-0.019000	0.14055	0.655000	0.94253	CAG		0.388	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2		NM_173521	
CCDC82	79780	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	96098194	96098194	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:96098194A>G	ENST00000278520.5	-	7	1758	c.1330T>C	c.(1330-1332)Tat>Cat	p.Y444H	CCDC82_ENST00000423339.2_Missense_Mutation_p.Y444H|CCDC82_ENST00000542662.1_Missense_Mutation_p.Y444H			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	444								p.Y444H(1)|p.Y444D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		CTGGTGTTATACAACTCTCCT	0.328																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)											99.0	98.0	98.0					11																	96098194		2201	4298	6499	SO:0001583	missense	79780			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.1330T>C	11.37:g.96098194A>G	ENSP00000278520:p.Tyr444His		B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	ENST00000278520.5	37	CCDS8307.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.978155	0.74360	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339	T;T;T	0.73258	-0.73;-0.73;-0.73	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000002	D	0.82300	0.5007	M	0.66939	2.045	0.47621	D	0.999474	D	0.89917	1.0	D	0.97110	1.0	D	0.84451	0.0588	10	0.87932	D	0	-17.4396	14.3662	0.66807	1.0:0.0:0.0:0.0	.	444	Q8N4S0	CCD82_HUMAN	H	444	ENSP00000278520:Y444H;ENSP00000444010:Y444H;ENSP00000397156:Y444H	ENSP00000278520:Y444H	Y	-	1	0	CCDC82	95737842	0.999000	0.42202	0.270000	0.24601	0.997000	0.91878	5.842000	0.69417	2.095000	0.63458	0.482000	0.46254	TAT		0.328	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2		NM_024725	
CDC45	8318	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	19467681	19467681	+	Splice_Site	SNP	A	A	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr22:19467681A>T	ENST00000407835.1	+	3	308	c.52A>T	c.(52-54)Agg>Tgg	p.R18W	CDC45_ENST00000404724.3_Splice_Site_p.R18W|UFD1L_ENST00000263202.10_5'Flank|CDC45_ENST00000263201.1_Splice_Site_p.R18W|UFD1L_ENST00000484101.1_5'Flank|UFD1L_ENST00000360834.4_5'Flank|CDC45_ENST00000483431.1_3'UTR|CDC45_ENST00000437685.2_Splice_Site_p.R18W|UFD1L_ENST00000399523.1_5'Flank			O75419	CDC45_HUMAN	cell division cycle 45	18					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R18W(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						TCCCCGATAGAGGGTCCTTCT	0.682																																																	1	Substitution - Missense(1)	kidney(1)											92.0	75.0	81.0					22																	19467681		2203	4300	6503	SO:0001630	splice_region_variant	8318			AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.52-1A>T	22.37:g.19467681A>T			B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	37	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559865	0.86335	.	.	ENSG00000093009	ENST00000407835;ENST00000438587;ENST00000455750;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86	6.04	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.53546	0.1803	M	0.85041	2.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.60172	-0.7315	10	0.87932	D	0	-31.6736	11.9369	0.52878	0.7687:0.2313:0.0:0.0	.	18;13;18;18;18	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	W	18;6;18;18;18;18	ENSP00000385240:R18W;ENSP00000397434:R6W;ENSP00000413138:R18W;ENSP00000405726:R18W;ENSP00000263201:R18W;ENSP00000384978:R18W	ENSP00000263201:R18W	R	+	1	2	CDC45	17847681	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	1.522000	0.35921	2.317000	0.78254	0.460000	0.39030	AGG		0.682	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1		NM_003504	Missense_Mutation
CDK15	65061	broad.mit.edu;hgsc.bcm.edu	37	2	202700487	202700487	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:202700487G>T	ENST00000374598.4	+	8	851		c.e8+1		CDK15_ENST00000260967.2_Splice_Site|CDK15_ENST00000450471.2_Splice_Site|CDK15_ENST00000410091.3_Splice_Site|CDK15_ENST00000434439.1_Splice_Site|CDK15_ENST00000488419.1_Splice_Site			Q96Q40	CDK15_HUMAN	cyclin-dependent kinase 15								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.?(1)		breast(3)|endometrium(2)|kidney(5)|large_intestine(1)|lung(14)|ovary(1)	26					Adenosine triphosphate(DB00171)	TGGACATATGGTAAGAGTGGT	0.443																																																	1	Unknown(1)	kidney(1)											69.0	68.0	69.0					2																	202700487		2203	4300	6503	SO:0001630	splice_region_variant	65061			AB053308	CCDS2350.1, CCDS58746.1, CCDS58747.1	2q33.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000138395	ENSG00000138395		"""Cyclin-dependent kinases"""	14434	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7"", ""PFTAIRE protein kinase 2"""	ALS2CR7, PFTK2		11586298, 16236519, 19884882	Standard	NM_139158		Approved	PFTAIRE2	uc002uyt.3	Q96Q40	OTTHUMG00000132838	ENST00000374598.4:c.851+1G>T	2.37:g.202700487G>T			A8K8R9|B8ZZX0|C9J1N8|C9K003|F8W6H8|Q4ZG86|Q53TV1|Q6ZMR9|Q8IUP1	Splice_Site	SNP	ENST00000374598.4	37		.	.	.	.	.	.	.	.	.	.	G	28.6	4.934154	0.92458	.	.	ENSG00000138395	ENST00000410091;ENST00000260967;ENST00000450471;ENST00000434439;ENST00000374598	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.02	0.97489	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDK15	202408732	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.653000	0.98506	2.809000	0.96659	0.557000	0.71058	.		0.443	CDK15-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000336053.2			Intron
CDK3	1018	broad.mit.edu;hgsc.bcm.edu	37	17	73998205	73998205	+	Silent	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr17:73998205C>A	ENST00000425876.2	+	3	385	c.297C>A	c.(295-297)ctC>ctA	p.L99L	TEN1-CDK3_ENST00000567351.1_RNA|CDK3_ENST00000448471.1_Silent_p.L99L			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	99	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.L99L(1)		central_nervous_system(1)	1						GCTCAGAGCTCCCCCTGCACC	0.597																																																	1	Substitution - coding silent(1)	kidney(1)											91.0	79.0	83.0					17																	73998205		2203	4300	6503	SO:0001819	synonymous_variant	1018			X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506		"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828				1639063	Standard	NM_001258		Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.297C>A	17.37:g.73998205C>A				Silent	SNP	ENST00000425876.2	37	CCDS11736.1																																																																																				0.597	CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337389.2		NM_001258	
CENPF	1063	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	214818891	214818891	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr1:214818891C>G	ENST00000366955.3	+	13	6146	c.5978C>G	c.(5977-5979)tCt>tGt	p.S1993C		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2089					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.S1993C(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGCTTGAGTCTCATCAAAGT	0.443																																					Colon(80;575 1284 11000 14801 43496)												1	Substitution - Missense(1)	kidney(1)											74.0	77.0	76.0					1																	214818891		2203	4300	6503	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5978C>G	1.37:g.214818891C>G	ENSP00000355922:p.Ser1993Cys		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	7.316	0.615893	0.14129	.	.	ENSG00000117724	ENST00000366955	T	0.48201	0.82	5.23	2.31	0.28768	.	0.685575	0.12094	N	0.500170	T	0.45875	0.1364	M	0.65975	2.015	0.09310	N	1	D	0.57571	0.98	P	0.46975	0.533	T	0.38607	-0.9653	10	0.48119	T	0.1	.	2.7827	0.05365	0.1282:0.5404:0.1244:0.207	.	2089	P49454	CENPF_HUMAN	C	1993	ENSP00000355922:S1993C	ENSP00000355922:S1993C	S	+	2	0	CENPF	212885514	0.792000	0.28813	0.007000	0.13788	0.014000	0.08584	0.332000	0.19751	0.209000	0.20645	0.609000	0.83330	TCT		0.443	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1		NM_016343	
CSRP3	8048	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	19213960	19213960	+	Silent	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:19213960G>A	ENST00000533783.1	-	3	276	c.36C>T	c.(34-36)gcC>gcT	p.A12A	CSRP3_ENST00000265968.3_Silent_p.A12A	NM_003476.4	NP_003467.1	P50461	CSRP3_HUMAN	cysteine and glycine-rich protein 3 (cardiac LIM protein)	12	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue development (GO:0048738)|cardiac myofibril assembly (GO:0055003)|cellular calcium ion homeostasis (GO:0006874)|detection of muscle stretch (GO:0035995)|protein localization to organelle (GO:0033365)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)	actinin binding (GO:0042805)|structural constituent of muscle (GO:0008307)|telethonin binding (GO:0031433)|zinc ion binding (GO:0008270)	p.A12A(1)		kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	10						TCTTTTCACAGGCTCCACATT	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											150.0	115.0	127.0					11																	19213960		2199	4293	6492	SO:0001819	synonymous_variant	8048			U20324	CCDS7848.1	11p15.1	2014-09-17				ENSG00000129170			2472	protein-coding gene	gene with protein product		600824				7490106	Standard	NM_003476		Approved	CLP, MLP, CMD1M	uc001mpk.3	P50461		ENST00000533783.1:c.36C>T	11.37:g.19213960G>A			Q9P131	Silent	SNP	ENST00000533783.1	37	CCDS7848.1																																																																																				0.498	CSRP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394484.1		NM_003476	
CSRP3	8048	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	19213973	19213973	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:19213973G>T	ENST00000533783.1	-	3	263	c.23C>A	c.(22-24)gCa>gAa	p.A8E	CSRP3_ENST00000265968.3_Missense_Mutation_p.A8E	NM_003476.4	NP_003467.1	P50461	CSRP3_HUMAN	cysteine and glycine-rich protein 3 (cardiac LIM protein)	8					cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue development (GO:0048738)|cardiac myofibril assembly (GO:0055003)|cellular calcium ion homeostasis (GO:0006874)|detection of muscle stretch (GO:0035995)|protein localization to organelle (GO:0033365)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)	actinin binding (GO:0042805)|structural constituent of muscle (GO:0008307)|telethonin binding (GO:0031433)|zinc ion binding (GO:0008270)	p.A8E(1)		kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	10						TCCACATTTTGCGCCTCCGCC	0.493																																																	1	Substitution - Missense(1)	kidney(1)											135.0	104.0	115.0					11																	19213973		2199	4293	6492	SO:0001583	missense	8048			U20324	CCDS7848.1	11p15.1	2014-09-17				ENSG00000129170			2472	protein-coding gene	gene with protein product		600824				7490106	Standard	NM_003476		Approved	CLP, MLP, CMD1M	uc001mpk.3	P50461		ENST00000533783.1:c.23C>A	11.37:g.19213973G>T	ENSP00000431813:p.Ala8Glu		Q9P131	Missense_Mutation	SNP	ENST00000533783.1	37	CCDS7848.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294498	0.23564	.	.	ENSG00000129170	ENST00000265968;ENST00000533783	T;T	0.63417	-0.04;-0.04	6.02	6.02	0.97574	Zinc finger, LIM-type (2);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	N	0.02876	-0.465	0.80722	D	1	B	0.26512	0.151	B	0.28991	0.097	T	0.44682	-0.9312	10	0.02654	T	1	-7.4989	20.1323	0.98003	0.0:0.0:1.0:0.0	.	8	P50461	CSRP3_HUMAN	E	8	ENSP00000265968:A8E;ENSP00000431813:A8E	ENSP00000265968:A8E	A	-	2	0	CSRP3	19170549	1.000000	0.71417	0.937000	0.37676	0.432000	0.31715	9.751000	0.98889	2.857000	0.98124	0.650000	0.86243	GCA		0.493	CSRP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394484.1		NM_003476	
DAK	26007	hgsc.bcm.edu;ucsc.edu	37	11	61105442	61105442	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:61105442delT	ENST00000394900.3	+	3	262	c.33delT	c.(31-33)gctfs	p.A11fs	DAK_ENST00000530057.1_3'UTR	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	11	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						ACTCGGTGGCTGGCTGTGCTG	0.622																																																	0													95.0	75.0	82.0					11																	61105442		2203	4299	6502	SO:0001589	frameshift_variant	26007				CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.33delT	11.37:g.61105442delT	ENSP00000378360:p.Ala11fs		Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Frame_Shift_Del	DEL	ENST00000394900.3	37	CCDS8003.1																																																																																				0.622	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4		NM_015533	
DBN1	1627	broad.mit.edu;hgsc.bcm.edu	37	5	176894482	176894482	+	Splice_Site	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr5:176894482C>G	ENST00000309007.5	-	5	696	c.477G>C	c.(475-477)gtG>gtC	p.V159V	DBN1_ENST00000393565.1_Splice_Site_p.V159V|DBN1_ENST00000292385.5_Splice_Site_p.V161V	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	159					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.V159V(1)|p.V161V(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACACACTAACCACGGGCTCTG	0.672																																																	2	Substitution - coding silent(2)	kidney(2)											22.0	23.0	22.0					5																	176894482		2199	4296	6495	SO:0001630	splice_region_variant	1627				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.477+1G>C	5.37:g.176894482C>G			A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	ENST00000309007.5	37	CCDS4420.1																																																																																				0.672	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2		NM_080881	Silent
DDX31	64794	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	135470291	135470291	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:135470291C>G	ENST00000372159.3	-	20	2669	c.2518G>C	c.(2518-2520)Ggt>Cgt	p.G840R	DDX31_ENST00000372153.1_Missense_Mutation_p.G767R|DDX31_ENST00000438527.3_Missense_Mutation_p.G711R	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	840						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.G840R(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		CGCTGTACACCTTTTTGGGTT	0.552																																																	1	Substitution - Missense(1)	kidney(1)											114.0	127.0	123.0					9																	135470291		2203	4300	6503	SO:0001583	missense	64794			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.2518G>C	9.37:g.135470291C>G	ENSP00000361232:p.Gly840Arg		Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	37	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536088	0.27475	.	.	ENSG00000125485	ENST00000372159;ENST00000372153;ENST00000438527	T;T;T	0.04809	4.08;3.55;4.21	3.59	1.72	0.24424	.	.	.	.	.	T	0.04452	0.0122	N	0.22421	0.69	0.09310	N	1	P;P	0.38195	0.527;0.622	B;B	0.41332	0.354;0.193	T	0.41822	-0.9487	9	0.52906	T	0.07	.	6.4692	0.21999	0.0:0.7635:0.0:0.2365	.	767;840	Q9H8H2-2;Q9H8H2	.;DDX31_HUMAN	R	840;767;711	ENSP00000361232:G840R;ENSP00000361226:G767R;ENSP00000387730:G711R	ENSP00000361226:G767R	G	-	1	0	DDX31	134460112	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	-0.455000	0.06762	0.226000	0.20979	0.462000	0.41574	GGT		0.552	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1		NM_138620	
DNAH8	1769	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	38952015	38952015	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:38952015G>A	ENST00000359357.3	+	85	12588	c.12334G>A	c.(12334-12336)Gga>Aga	p.G4112R	DNAH8_ENST00000441566.1_Missense_Mutation_p.G4076R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4112					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G4112R(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTACATGATCGGAGAAGTACA	0.348																																																	2	Substitution - Missense(2)	kidney(2)											138.0	133.0	134.0					6																	38952015		2203	4300	6503	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12334G>A	6.37:g.38952015G>A	ENSP00000352312:p.Gly4112Arg		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	30	5.057867	0.93846	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.14516	2.5;2.5;2.5	6.02	6.02	0.97574	Dynein heavy chain (1);	0.062472	0.64402	D	0.000007	T	0.57154	0.2034	H	0.99545	4.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.76683	-0.2869	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	4076;4112	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	R	4317;4112;4076	ENSP00000333363:G4317R;ENSP00000352312:G4112R;ENSP00000402294:G4076R	ENSP00000333363:G4317R	G	+	1	0	DNAH8	39059993	1.000000	0.71417	0.993000	0.49108	0.843000	0.47879	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	GGA		0.348	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1		NM_001206927	
EGLN2	112398	hgsc.bcm.edu;ucsc.edu	37	19	41306619	41306619	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:41306619T>C	ENST00000593726.1	+	1	1170	c.142T>C	c.(142-144)Tac>Cac	p.Y48H	EGLN2_ENST00000303961.4_Missense_Mutation_p.Y48H|RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000594140.1_5'Flank|CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000406058.2_Missense_Mutation_p.Y48H			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	48					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GCTCCCCTCCTACCACTGTCC	0.652																																																	0													50.0	45.0	47.0					19																	41306619		2203	4300	6503	SO:0001583	missense	112398			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.142T>C	19.37:g.41306619T>C	ENSP00000469686:p.Tyr48His		A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.056184	0.36277	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.23754	1.89;1.89	4.15	4.15	0.48705	.	0.532983	0.17951	N	0.156514	T	0.12817	0.0311	N	0.14661	0.345	0.25525	N	0.987334	B	0.02656	0.0	B	0.04013	0.001	T	0.17107	-1.0380	10	0.21540	T	0.41	-4.0076	6.3593	0.21419	0.0:0.1098:0.0:0.8902	.	48	Q96KS0	EGLN2_HUMAN	H	48	ENSP00000307080:Y48H;ENSP00000385253:Y48H	ENSP00000307080:Y48H	Y	+	1	0	EGLN2	45998459	0.687000	0.27671	0.933000	0.37362	0.984000	0.73092	1.589000	0.36644	1.874000	0.54306	0.402000	0.26972	TAC		0.652	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1			
EMILIN1	11117	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27306232	27306232	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:27306232G>C	ENST00000380320.4	+	4	2292	c.1793G>C	c.(1792-1794)gGt>gCt	p.G598A		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	598					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.G598A(1)		breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCGGGATGGTGTGGAGCGC	0.706																																																	1	Substitution - Missense(1)	kidney(1)											33.0	39.0	37.0					2																	27306232		2182	4282	6464	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1793G>C	2.37:g.27306232G>C	ENSP00000369677:p.Gly598Ala		A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	37	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871452	0.51695	.	.	ENSG00000138080	ENST00000380320	T	0.62364	0.03	4.73	4.73	0.59995	.	0.086450	0.46758	D	0.000264	T	0.52092	0.1713	N	0.14661	0.345	0.34953	D	0.751391	D	0.55172	0.97	P	0.51833	0.681	T	0.57004	-0.7885	10	0.18710	T	0.47	-12.5524	13.0709	0.59061	0.0:0.0:1.0:0.0	.	598	Q9Y6C2	EMIL1_HUMAN	A	598	ENSP00000369677:G598A	ENSP00000369677:G598A	G	+	2	0	EMILIN1	27159736	0.967000	0.33354	0.996000	0.52242	0.998000	0.95712	2.322000	0.43814	2.456000	0.83038	0.561000	0.74099	GGT		0.706	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1		NM_007046	
EXTL3	2137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	28574199	28574199	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr8:28574199G>A	ENST00000220562.4	+	3	1525	c.623G>A	c.(622-624)aGc>aAc	p.S208N	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	208					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.S208N(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GTCTTTGGCAGCTACCTGGAT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											101.0	102.0	102.0					8																	28574199		2203	4300	6503	SO:0001583	missense	2137			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.623G>A	8.37:g.28574199G>A	ENSP00000220562:p.Ser208Asn		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	G	2.860	-0.236273	0.05944	.	.	ENSG00000012232	ENST00000220562	D	0.97791	-4.54	4.89	1.84	0.25277	.	0.566023	0.21370	N	0.075653	D	0.90442	0.7007	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.81185	-0.1048	9	.	.	.	-4.829	4.7746	0.13173	0.3494:0.1472:0.5034:0.0	.	208	O43909	EXTL3_HUMAN	N	208	ENSP00000220562:S208N	.	S	+	2	0	EXTL3	28630118	0.934000	0.31675	0.997000	0.53966	0.991000	0.79684	1.053000	0.30442	0.063000	0.16370	0.485000	0.47835	AGC		0.512	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3		NM_001440	
FBXW9	84261	broad.mit.edu;hgsc.bcm.edu	37	19	12807200	12807200	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:12807200G>A	ENST00000380339.3	-	1	232	c.196C>T	c.(196-198)Cgg>Tgg	p.R66W	FBXW9_ENST00000544494.1_5'UTR|FBXW9_ENST00000587955.1_Missense_Mutation_p.R66W|FBXW9_ENST00000393261.3_Missense_Mutation_p.R66W			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	66					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)			p.R66W(1)		cervix(1)|lung(4)|ovary(1)|prostate(1)	7						GACGCGGCCCGAGGCTCCGAA	0.697																																																	1	Substitution - Missense(1)	kidney(1)											13.0	17.0	16.0					19																	12807200		1875	4083	5958	SO:0001583	missense	84261			BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.196C>T	19.37:g.12807200G>A	ENSP00000369696:p.Arg66Trp		B3KVP7|Q9BT89	Missense_Mutation	SNP	ENST00000380339.3	37		.	.	.	.	.	.	.	.	.	.	G	14.89	2.670423	0.47677	.	.	ENSG00000132004	ENST00000393261;ENST00000380339	T;T	0.44881	1.9;0.91	4.68	1.18	0.20946	.	0.908365	0.09091	N	0.849833	T	0.22475	0.0542	N	0.12182	0.205	0.21105	N	0.999783	B;B	0.17465	0.022;0.004	B;B	0.14578	0.011;0.004	T	0.21518	-1.0243	10	0.35671	T	0.21	-12.1666	4.9979	0.14249	0.1879:0.0:0.6422:0.1698	.	66;66	Q5XUX1-2;Q5XUX1-3	.;.	W	66	ENSP00000376945:R66W;ENSP00000369696:R66W	ENSP00000369696:R66W	R	-	1	2	FBXW9	12668200	0.000000	0.05858	0.087000	0.20705	0.122000	0.20287	0.347000	0.20014	0.359000	0.24239	0.462000	0.41574	CGG		0.697	FBXW9-201	KNOWN	basic	protein_coding	protein_coding			NM_032301	
FERMT2	10979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	53385908	53385908	+	Silent	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr14:53385908A>G	ENST00000395631.2	-	3	540	c.324T>C	c.(322-324)taT>taC	p.Y108Y	FERMT2_ENST00000553373.1_Silent_p.Y108Y|FERMT2_ENST00000399304.3_Silent_p.Y108Y|FERMT2_ENST00000341590.3_Silent_p.Y108Y|FERMT2_ENST00000343279.4_Silent_p.Y108Y			Q96AC1	FERM2_HUMAN	fermitin family member 2	108					cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.Y108Y(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TCACCTTCACATACTTCATGT	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											120.0	114.0	116.0					14																	53385908		2203	4300	6503	SO:0001819	synonymous_variant	10979			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.324T>C	14.37:g.53385908A>G			B5TJY2|Q14840|Q86TY7	Silent	SNP	ENST00000395631.2	37	CCDS9713.1																																																																																				0.393	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2		NM_006832	
FGF14	2259	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	103053874	103053874	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr13:103053874T>A	ENST00000376131.4	-	1	250	c.155A>T	c.(154-156)cAt>cTt	p.H52L	RP11-811P12.3_ENST00000418923.2_RNA	NM_175929.2	NP_787125.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	0					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.H52L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGCAGCATATGCGTTCCTTT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											122.0	106.0	112.0					13																	103053874		2203	4300	6503	SO:0001583	missense	2259				CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376131.4:c.155A>T	13.37:g.103053874T>A	ENSP00000365301:p.His52Leu		Q86YN7|Q96QX6	Missense_Mutation	SNP	ENST00000376131.4	37	CCDS9500.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.710882	0.48517	.	.	ENSG00000102466	ENST00000376131	T	0.79033	-1.23	4.73	4.73	0.59995	.	1.733080	0.02968	N	0.144013	T	0.62454	0.2429	.	.	.	0.80722	D	1	P	0.42584	0.784	B	0.36885	0.235	T	0.57814	-0.7746	9	0.02654	T	1	.	14.3812	0.66911	0.0:0.0:0.0:1.0	.	52	Q92915-2	.	L	52	ENSP00000365301:H52L	ENSP00000365301:H52L	H	-	2	0	FGF14	101851875	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.462000	0.80851	1.984000	0.57885	0.533000	0.62120	CAT		0.408	FGF14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045680.5			
FZD10	11211	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	130648324	130648324	+	Silent	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr12:130648324C>T	ENST00000229030.4	+	1	1321	c.837C>T	c.(835-837)atC>atT	p.I279I	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.P247S			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	279					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.I279I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GCTACCTCATCCGCCTCTTCG	0.657																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	90.0	89.0					12																	130648324		2203	4300	6503	SO:0001819	synonymous_variant	11211			AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.837C>T	12.37:g.130648324C>T				Silent	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	C	9.389	1.074964	0.20227	.	.	ENSG00000111432	ENST00000539839	.	.	.	4.96	3.08	0.35506	.	.	.	.	.	T	0.62332	0.2419	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61123	-0.7126	5	0.87932	D	0	.	6.2443	0.20807	0.1493:0.6962:0.0:0.1545	.	.	.	.	S	247	.	ENSP00000438460:P247S	P	+	1	0	FZD10	129214277	0.997000	0.39634	0.991000	0.47740	0.991000	0.79684	0.472000	0.22116	0.459000	0.27016	0.561000	0.74099	CCG		0.657	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
GPR45	11250	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	105859391	105859391	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:105859391C>A	ENST00000258456.1	+	1	1192	c.1076C>A	c.(1075-1077)cCa>cAa	p.P359Q		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P359Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						AGAATCCAGCCAAGCACAGTC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											72.0	74.0	73.0					2																	105859391		2203	4300	6503	SO:0001583	missense	11250			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.1076C>A	2.37:g.105859391C>A	ENSP00000258456:p.Pro359Gln		Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.140564	0.77775	.	.	ENSG00000135973	ENST00000258456	T	0.72282	-0.64	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.81460	0.4827	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83019	-0.0168	10	0.87932	D	0	-16.6649	17.2936	0.87163	0.0:1.0:0.0:0.0	.	359	Q9Y5Y3	GPR45_HUMAN	Q	359	ENSP00000258456:P359Q	ENSP00000258456:P359Q	P	+	2	0	GPR45	105225823	1.000000	0.71417	0.969000	0.41365	0.990000	0.78478	7.239000	0.78182	2.696000	0.92011	0.456000	0.33151	CCA		0.567	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1		NM_007227	
GTSE1	51512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	46708174	46708174	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr22:46708174G>T	ENST00000454366.1	+	5	1111	c.899G>T	c.(898-900)gGc>gTc	p.G300V		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	281					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)		p.G281V(1)|p.G300V(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TTGGGCCAGGGCAAGCGGGCG	0.592																																					GBM(153;542 1915 12487 29016 50495)												2	Substitution - Missense(2)	kidney(2)											36.0	38.0	38.0					22																	46708174		2203	4300	6503	SO:0001583	missense	51512			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.899G>T	22.37:g.46708174G>T	ENSP00000415430:p.Gly300Val		B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	37	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	G	11.92	1.783180	0.31593	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.08458	3.09	5.03	2.75	0.32379	.	0.406223	0.28908	N	0.013751	T	0.13030	0.0316	L	0.46157	1.445	0.80722	D	1	D	0.60160	0.987	P	0.53518	0.728	T	0.04870	-1.0921	10	0.35671	T	0.21	-19.2069	9.8305	0.40939	0.0:0.0:0.6272:0.3728	.	281	Q9NYZ3	GTSE1_HUMAN	V	300;260	ENSP00000415430:G300V	ENSP00000354634:G260V	G	+	2	0	GTSE1	45086838	0.999000	0.42202	0.972000	0.41901	0.074000	0.17049	1.484000	0.35508	1.410000	0.46936	0.650000	0.86243	GGC		0.592	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2		NM_016426	
HAUS8	93323	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17169444	17169444	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:17169444T>G	ENST00000253669.5	-	8	750	c.560A>C	c.(559-561)aAg>aCg	p.K187T	HAUS8_ENST00000593360.1_Missense_Mutation_p.K126T|HAUS8_ENST00000448593.2_Missense_Mutation_p.K186T			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	187					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.K187T(1)|p.K187fs*9(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						TTTCTGTAGCTTCTCCTTCTC	0.453																																																	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|kidney(1)											70.0	64.0	66.0					19																	17169444		2203	4300	6503	SO:0001583	missense	93323			BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.560A>C	19.37:g.17169444T>G	ENSP00000253669:p.Lys187Thr		B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Missense_Mutation	SNP	ENST00000253669.5	37	CCDS32948.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677431	0.47886	.	.	ENSG00000131351	ENST00000253669;ENST00000448593	T;T	0.76448	-1.02;-1.02	4.55	-3.13	0.05266	.	0.908188	0.09402	N	0.807097	T	0.67599	0.2910	L	0.54323	1.7	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.13407	0.009;0.009;0.009	T	0.57934	-0.7725	10	0.66056	D	0.02	-8.9424	5.029	0.14400	0.0:0.3612:0.2926:0.3462	.	126;186;187	Q9BT25-2;C9JBZ4;Q9BT25	.;.;HAUS8_HUMAN	T	187;186	ENSP00000253669:K187T;ENSP00000395298:K186T	ENSP00000253669:K187T	K	-	2	0	HAUS8	17030444	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.581000	0.02119	-0.501000	0.06605	0.459000	0.35465	AAG		0.453	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463015.1		NM_001011699	
HECTD3	79654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	45473182	45473182	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr1:45473182C>A	ENST00000372172.4	-	10	1477	c.1406G>T	c.(1405-1407)aGc>aTc	p.S469I	HECTD3_ENST00000372168.3_Missense_Mutation_p.S79I|HECTD3_ENST00000486132.1_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	469					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S79I(1)|p.S185I(1)|p.S469I(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					TGGCATGAAGCTGGGCTTGCT	0.607																																																	3	Substitution - Missense(3)	kidney(3)											82.0	87.0	85.0					1																	45473182		2136	4233	6369	SO:0001583	missense	79654			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.1406G>T	1.37:g.45473182C>A	ENSP00000361245:p.Ser469Ile		B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	37	CCDS41318.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.533237	0.64972	.	.	ENSG00000126107	ENST00000372172;ENST00000372168	T;T	0.60548	0.18;0.42	5.19	5.19	0.71726	.	0.147828	0.64402	D	0.000012	T	0.37376	0.1001	N	0.19112	0.55	0.39948	D	0.974503	P;P	0.39964	0.697;0.603	B;B	0.39258	0.276;0.295	T	0.21314	-1.0249	10	0.22706	T	0.39	.	6.2149	0.20649	0.0:0.785:0.0:0.215	.	469;79	Q5T447;Q5T447-2	HECD3_HUMAN;.	I	469;79	ENSP00000361245:S469I;ENSP00000361241:S79I	ENSP00000361241:S79I	S	-	2	0	HECTD3	45245769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.412000	0.59787	2.686000	0.91538	0.655000	0.94253	AGC		0.607	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1		NM_024602	
HERPUD2	64224	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	35673462	35673462	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr7:35673462C>T	ENST00000396081.1	-	8	1864		c.e8-1		HERPUD2_ENST00000311350.3_Splice_Site|HERPUD2_ENST00000426180.1_5'Flank	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2						response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.?(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TAAGACGCTCCTTTCAAGCAA	0.403																																																	1	Unknown(1)	kidney(1)											166.0	155.0	159.0					7																	35673462		2203	4300	6503	SO:0001630	splice_region_variant	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.1060-1G>A	7.37:g.35673462C>T			A4D1Y8|Q9H6F9	Splice_Site	SNP	ENST00000396081.1	37	CCDS5446.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534458	0.85812	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7161	0.96121	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HERPUD2	35639987	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.625000	0.83145	2.656000	0.90262	0.551000	0.68910	.		0.403	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1		NM_022373	Intron
IGSF10	285313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	151154637	151154637	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr3:151154637G>A	ENST00000282466.3	-	6	7711	c.7712C>T	c.(7711-7713)tCa>tTa	p.S2571L	MED12L_ENST00000474524.1_3'UTR|IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2571	Ig-like C2-type 12.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.S2571L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACTTGCCGTTGAGAGAAGGGA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											87.0	79.0	81.0					3																	151154637		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7712C>T	3.37:g.151154637G>A	ENSP00000282466:p.Ser2571Leu		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231120	0.39399	.	.	ENSG00000152580	ENST00000282466	T	0.69926	-0.44	4.95	4.95	0.65309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38720	N	0.001599	T	0.72277	0.3440	L	0.28740	0.885	0.51233	D	0.999916	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.956	T	0.71981	-0.4428	10	0.40728	T	0.16	.	14.987	0.71356	0.0:0.0:0.857:0.143	.	2571;598	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	L	2571	ENSP00000282466:S2571L	ENSP00000282466:S2571L	S	-	2	0	IGSF10	152637327	1.000000	0.71417	0.102000	0.21198	0.004000	0.04260	7.315000	0.78998	2.442000	0.82660	0.655000	0.94253	TCA		0.507	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		NM_178822	
INHBA	3624	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	41729694	41729694	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr7:41729694C>A	ENST00000242208.4	-	3	1081	c.835G>T	c.(835-837)Gca>Tca	p.A279S	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.A279S	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	279					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.A279S(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						tctgctcctgccccaccttca	0.607										TSP Lung(11;0.080)																																							1	Substitution - Missense(1)	kidney(1)											59.0	57.0	57.0					7																	41729694		2203	4300	6503	SO:0001583	missense	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.835G>T	7.37:g.41729694C>A	ENSP00000242208:p.Ala279Ser		Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	3.398	-0.122907	0.06795	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.77489	-1.1;-1.1	5.67	2.74	0.32292	Transforming growth factor-beta, N-terminal (1);	1.526900	0.03612	N	0.234970	T	0.50803	0.1637	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46610	-0.9179	10	0.22109	T	0.4	.	1.7663	0.03002	0.152:0.4424:0.2277:0.1779	.	279	P08476	INHBA_HUMAN	S	279	ENSP00000242208:A279S;ENSP00000397197:A279S	ENSP00000242208:A279S	A	-	1	0	INHBA	41696219	0.000000	0.05858	0.001000	0.08648	0.396000	0.30629	0.107000	0.15375	0.632000	0.30432	0.585000	0.79938	GCA		0.607	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			
IRS4	8471	hgsc.bcm.edu;ucsc.edu	37	X	107976255	107976258	+	Frame_Shift_Del	DEL	CTGT	CTGT	-			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	CTGT	CTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chrX:107976255_107976258delCTGT	ENST00000372129.2	-	1	3393_3396	c.3317_3320delACAG	c.(3316-3321)gacagcfs	p.DS1106fs	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1106	Ala-rich.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TCTCTCGAGGCTGTCTGTTGGAAA	0.593																																																	0																																										SO:0001589	frameshift_variant	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3317_3320delACAG	X.37:g.107976259_107976262delCTGT	ENSP00000361202:p.Asp1106fs			Frame_Shift_Del	DEL	ENST00000372129.2	37	CCDS14544.1																																																																																				0.593	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604	
UVSSA	57654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	1348531	1348531	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr4:1348531A>C	ENST00000389851.4	+	6	1390	c.943A>C	c.(943-945)Aag>Cag	p.K315Q	UVSSA_ENST00000507531.1_Missense_Mutation_p.K315Q|UVSSA_ENST00000511216.1_Missense_Mutation_p.K315Q|AC078852.1_ENST00000504748.1_RNA	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	315					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)	p.K315Q(1)									AGAGGGCCTGAAGGTGCAGGA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											74.0	64.0	68.0					4																	1348531		2201	4297	6498	SO:0001583	missense	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.943A>C	4.37:g.1348531A>C	ENSP00000374501:p.Lys315Gln		A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	37	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	A	8.128	0.782408	0.16189	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.32023	1.47;1.47;1.47	4.83	1.2	0.21068	.	0.378458	0.31233	N	0.008011	T	0.23289	0.0563	L	0.39245	1.2	0.80722	D	1	B	0.27380	0.177	B	0.20384	0.029	T	0.04915	-1.0918	10	0.31617	T	0.26	.	13.7747	0.63046	0.5409:0.4591:0.0:0.0	.	315	Q2YD98	K1530_HUMAN	Q	315	ENSP00000425130:K315Q;ENSP00000374501:K315Q;ENSP00000421741:K315Q	ENSP00000374501:K315Q	K	+	1	0	KIAA1530	1338531	0.998000	0.40836	0.315000	0.25238	0.261000	0.26267	1.613000	0.36900	0.025000	0.15241	0.379000	0.24179	AAG		0.622	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1		NM_020894	
LRRN4CL	221091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62455461	62455461	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr11:62455461C>G	ENST00000317449.4	-	2	997	c.520G>C	c.(520-522)Ggg>Cgg	p.G174R		NM_203422.2	NP_981967.1	Q8ND94	LRN4L_HUMAN	LRRN4 C-terminal like	174	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)		p.G174R(1)		cervix(1)|kidney(1)	2						ATGTCGGCCCCCTCGAGGCCC	0.721																																																	1	Substitution - Missense(1)	kidney(1)											14.0	17.0	16.0					11																	62455461		2173	4260	6433	SO:0001583	missense	221091			AK291334	CCDS8030.1	11q12.3	2013-02-11				ENSG00000177363		"""Fibronectin type III domain containing"""	33724	protein-coding gene	gene with protein product							Standard	NM_203422		Approved		uc001nun.3	Q8ND94		ENST00000317449.4:c.520G>C	11.37:g.62455461C>G	ENSP00000325808:p.Gly174Arg		A8K5L9	Missense_Mutation	SNP	ENST00000317449.4	37	CCDS8030.1	.	.	.	.	.	.	.	.	.	.	C	9.195	1.027089	0.19512	.	.	ENSG00000177363	ENST00000317449	.	.	.	4.8	-2.54	0.06307	Fibronectin, type III (1);	1.624630	0.04488	U	0.378986	T	0.27559	0.0677	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26189	-1.0110	9	0.48119	T	0.1	-0.0429	5.9635	0.19313	0.0:0.2932:0.4377:0.2691	.	174	Q8ND94	LRN4L_HUMAN	R	174	.	ENSP00000325808:G174R	G	-	1	0	LRRN4CL	62212037	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.126000	0.15769	-0.463000	0.06973	-0.150000	0.13652	GGG		0.721	LRRN4CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395168.1		NM_203422	
OSBPL6	114880	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179203777	179203777	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:179203777A>G	ENST00000190611.4	+	10	1226	c.850A>G	c.(850-852)Ata>Gta	p.I284V	OSBPL6_ENST00000357080.4_Missense_Mutation_p.I284V|OSBPL6_ENST00000315022.2_Missense_Mutation_p.I263V|OSBPL6_ENST00000409045.3_Missense_Mutation_p.I284V|OSBPL6_ENST00000409631.1_Missense_Mutation_p.I284V|OSBPL6_ENST00000392505.2_Missense_Mutation_p.I284V|OSBPL6_ENST00000359685.3_Missense_Mutation_p.I284V	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	284					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.I284V(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AAATTTGGAAATACTTCAGAG	0.353																																																	2	Substitution - Missense(2)	kidney(2)											78.0	77.0	77.0					2																	179203777		2203	4300	6503	SO:0001583	missense	114880			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.850A>G	2.37:g.179203777A>G	ENSP00000190611:p.Ile284Val		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	A	6.102	0.387113	0.11581	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000361154;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.10960	2.85;2.86;2.82;2.83;2.82;2.86;2.83	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.05364	0.0142	N	0.10733	0.035	0.53688	D	0.999971	B;P;B;B;B;B	0.35242	0.001;0.492;0.015;0.343;0.198;0.383	B;B;B;B;B;B	0.32583	0.007;0.148;0.025;0.148;0.047;0.106	T	0.51317	-0.8721	10	0.15499	T	0.54	-15.0261	11.3163	0.49394	0.8643:0.0:0.0:0.1357	.	284;263;284;284;284;284	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	V	284;284;69;284;284;284;284;263	ENSP00000376293:I284V;ENSP00000352713:I284V;ENSP00000349591:I284V;ENSP00000387248:I284V;ENSP00000190611:I284V;ENSP00000386885:I284V;ENSP00000318723:I263V	ENSP00000190611:I284V	I	+	1	0	OSBPL6	178912023	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.982000	0.76173	2.224000	0.72417	0.528000	0.53228	ATA		0.353	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2		NM_032523	
PCSK6	5046	broad.mit.edu;ucsc.edu	37	15	101971643	101971643	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr15:101971643C>A	ENST00000348070.1	-	5	535	c.536G>T	c.(535-537)tGc>tTc	p.C179F	PCSK6_ENST00000331826.7_Missense_Mutation_p.C14F|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Missense_Mutation_p.C179F|PCSK6_ENST00000344273.2_Missense_Mutation_p.C179F|PCSK6_ENST00000398181.2_Missense_Mutation_p.C179F	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	180					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.C179F(3)|p.C14F(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTCCGACCGGCAGCGACTGTT	0.532																																																	4	Substitution - Missense(4)	kidney(4)											63.0	64.0	63.0					15																	101971643		2081	4215	6296	SO:0001583	missense	5046				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.536G>T	15.37:g.101971643C>A	ENSP00000305056:p.Cys179Phe		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37		.	.	.	.	.	.	.	.	.	.	C	26.4	4.735630	0.89482	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	T;T;T;T;T	0.80480	0.98;0.98;0.98;0.98;-1.38	5.67	5.67	0.87782	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.000000	0.85682	D	0.000000	D	0.90393	0.6993	M	0.80847	2.515	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.998;0.999;0.984;0.991;0.984;0.984;1.0;0.998;0.999	D;D;P;P;P;P;D;D;D	0.85130	0.991;0.994;0.809;0.906;0.809;0.809;0.997;0.976;0.961	D	0.90523	0.4490	10	0.56958	D	0.05	-43.0865	18.7651	0.91869	0.0:1.0:0.0:0.0	.	180;85;179;180;179;179;180;180;179	P29122;Q59H04;E7EUC8;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	F	179;179;84;179;179;14	ENSP00000305056:C179F;ENSP00000351193:C179F;ENSP00000344410:C179F;ENSP00000381243:C179F;ENSP00000332052:C14F	ENSP00000332052:C14F	C	-	2	0	PCSK6	99789166	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.612000	0.67681	2.692000	0.91855	0.655000	0.94253	TGC		0.532	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_002570	
PILRB	29990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	99956460	99956460	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr7:99956460G>A	ENST00000452089.1	+	7	1271	c.212G>A	c.(211-213)tGg>tAg	p.W71*	PILRB_ENST00000444073.1_Nonsense_Mutation_p.W71*|PILRB_ENST00000609309.1_Nonsense_Mutation_p.W71*|PILRB_ENST00000610247.1_Nonsense_Mutation_p.W71*|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000448382.1_Intron			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	71	Ig-like V-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)		p.W71*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGAATATCCTGGAGACGGGGC	0.537																																																	1	Substitution - Nonsense(1)	kidney(1)											86.0	87.0	87.0					7																	99956460		2203	4300	6503	SO:0001587	stop_gained	29990			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.212G>A	7.37:g.99956460G>A	ENSP00000391748:p.Trp71*		Q69YF9|Q9HBS0	Nonsense_Mutation	SNP	ENST00000452089.1	37	CCDS43622.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563423	0.65651	.	.	ENSG00000121716	ENST00000310771;ENST00000420688;ENST00000452089;ENST00000457519;ENST00000443526;ENST00000419749;ENST00000422808;ENST00000444073;ENST00000413850;ENST00000438231	.	.	.	2.48	1.53	0.23141	.	0.182579	0.27266	N	0.020149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7437	0.23451	0.0:0.0:0.7195:0.2805	.	.	.	.	X	71;71;71;71;71;71;71;71;176;71	.	.	W	+	2	0	PILRB	99794396	0.985000	0.35326	0.254000	0.24359	0.163000	0.22366	0.860000	0.27871	0.280000	0.22209	0.536000	0.68110	TGG		0.537	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339923.2		NM_178238	
PITPNM3	83394	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	6386893	6386893	+	Silent	SNP	G	G	A	rs374847640		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr17:6386893G>A	ENST00000262483.8	-	6	618	c.531C>T	c.(529-531)ctC>ctT	p.L177L	PITPNM3_ENST00000421306.3_Silent_p.L141L	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	177					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.L177L(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CGAACTTGATGAGGATGTGGC	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											149.0	101.0	117.0					17																	6386893		2203	4300	6503	SO:0001819	synonymous_variant	83394			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.531C>T	17.37:g.6386893G>A			A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	CCDS11076.1																																																																																				0.592	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2		NM_031220	
RAB23	51715	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	57075110	57075110	+	Silent	SNP	T	T	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:57075110T>A	ENST00000317483.3	-	2	688	c.69A>T	c.(67-69)tcA>tcT	p.S23S	RAB23_ENST00000468148.1_Silent_p.S23S	NM_016277.3	NP_057361.3	Q9ULC3	RAB23_HUMAN	RAB23, member RAS oncogene family	23					autophagic vacuole assembly (GO:0000045)|cellular defense response (GO:0006968)|cilium assembly (GO:0042384)|craniofacial suture morphogenesis (GO:0097094)|embryonic digit morphogenesis (GO:0042733)|GTP catabolic process (GO:0006184)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription factor import into nucleus (GO:0042992)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|small GTPase mediated signal transduction (GO:0007264)|spinal cord dorsal/ventral patterning (GO:0021513)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S23S(1)		kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	8	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAATCATACTTGATTTTCCAA	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											233.0	212.0	219.0					6																	57075110		2203	4300	6503	SO:0001819	synonymous_variant	51715			AB034244	CCDS4962.1	6p12.1	2008-05-15			ENSG00000112210	ENSG00000112210		"""RAB, member RAS oncogene"""	14263	protein-coding gene	gene with protein product		606144					Standard	NM_016277		Approved		uc003pdt.3	Q9ULC3	OTTHUMG00000014918	ENST00000317483.3:c.69A>T	6.37:g.57075110T>A			B2R9I5|Q68DJ6|Q8NI06|Q9P023	Silent	SNP	ENST00000317483.3	37	CCDS4962.1																																																																																				0.393	RAB23-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041042.1			
RAPGEF3	10411	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	48143587	48143587	+	Silent	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr12:48143587C>T	ENST00000449771.2	-	9	919	c.831G>A	c.(829-831)ggG>ggA	p.G277G	RAPGEF3_ENST00000548919.1_Silent_p.G235G|RAPGEF3_ENST00000389212.3_Silent_p.G277G|RAPGEF3_ENST00000405493.2_Silent_p.G235G|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000395358.3_Silent_p.G277G|RAPGEF3_ENST00000549151.1_Silent_p.G235G|RAPGEF3_ENST00000171000.4_Silent_p.G235G			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	277					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)	p.G235G(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		TGCCCTTGTCCCCCTGGCTGA	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											162.0	143.0	150.0					12																	48143587		2203	4300	6503	SO:0001819	synonymous_variant	10411			AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.831G>A	12.37:g.48143587C>T			A8K2G5|E7EQC8|O95634|Q8WVN0	Silent	SNP	ENST00000449771.2	37	CCDS41775.1																																																																																				0.602	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1		NM_006105	
RHEB	6009	broad.mit.edu;hgsc.bcm.edu	37	7	151181869	151181869	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr7:151181869A>T	ENST00000262187.5	-	3	558	c.146T>A	c.(145-147)gTa>gAa	p.V49E	RHEB_ENST00000496004.1_5'UTR|RHEB_ENST00000472642.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	49					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.V49E(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		TTGTCCATTTACTGTGATCAA	0.358																																					Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)												1	Substitution - Missense(1)	kidney(1)											94.0	87.0	90.0					7																	151181869		2203	4300	6503	SO:0001583	missense	6009			D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.146T>A	7.37:g.151181869A>T	ENSP00000262187:p.Val49Glu		B3KWN6|D3DX13|Q53Y56|Q99444	Missense_Mutation	SNP	ENST00000262187.5	37	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.577598	0.86645	.	.	ENSG00000106615	ENST00000262187	T	0.79352	-1.26	5.34	5.34	0.76211	Small GTP-binding protein domain (1);	0.138039	0.49305	D	0.000157	D	0.87811	0.6271	M	0.82323	2.585	0.80722	D	1	D	0.63880	0.993	D	0.69307	0.963	D	0.89552	0.3800	10	0.87932	D	0	.	13.2534	0.60064	1.0:0.0:0.0:0.0	.	49	Q15382	RHEB_HUMAN	E	49	ENSP00000262187:V49E	ENSP00000262187:V49E	V	-	2	0	RHEB	150812802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.229000	0.89791	2.025000	0.59659	0.477000	0.44152	GTA		0.358	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348468.2		NM_005614	
RYR1	6261	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	39008078	39008078	+	Silent	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:39008078G>T	ENST00000359596.3	+	66	9765	c.9765G>T	c.(9763-9765)ggG>ggT	p.G3255G	RYR1_ENST00000360985.3_Silent_p.G3255G|RYR1_ENST00000355481.4_Silent_p.G3255G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3255					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.G3255G(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACATTGGGGGGCTGGCCGAGT	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	44.0	45.0					19																	39008078		2203	4300	6503	SO:0001819	synonymous_variant	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9765G>T	19.37:g.39008078G>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				0.662	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			
SACS	26278	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	23904812	23904812	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr13:23904812C>A	ENST00000382292.3	-	9	13476	c.13203G>T	c.(13201-13203)tgG>tgT	p.W4401C	SACS_ENST00000402364.1_Missense_Mutation_p.W3651C|SACS_ENST00000382298.3_Missense_Mutation_p.W4401C			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4401					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.W4254C(1)|p.W4401C(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTTCTTGATTCCATGAAGTAT	0.423																																																	2	Substitution - Missense(2)	kidney(2)											75.0	78.0	77.0					13																	23904812		2203	4300	6503	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13203G>T	13.37:g.23904812C>A	ENSP00000371729:p.Trp4401Cys		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989638	0.74589	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.89875	-2.43;-2.58;-2.43	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.93759	0.8005	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93812	0.7111	10	0.87932	D	0	.	19.9341	0.97130	0.0:1.0:0.0:0.0	.	4401	Q9NZJ4	SACS_HUMAN	C	4401;3651;4401	ENSP00000371729:W4401C;ENSP00000385844:W3651C;ENSP00000371735:W4401C	ENSP00000371729:W4401C	W	-	3	0	SACS	22802812	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.818000	0.86416	2.711000	0.92665	0.563000	0.77884	TGG		0.423	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3		NM_014363	
SLC25A25	114789	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	130865982	130865982	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:130865982T>A	ENST00000373064.5	+	5	772	c.509T>A	c.(508-510)cTa>cAa	p.L170Q	SLC25A25_ENST00000373069.5_Missense_Mutation_p.L216Q|SLC25A25_ENST00000433501.1_Missense_Mutation_p.L67Q|SLC25A25_ENST00000373068.2_Missense_Mutation_p.L204Q|SLC25A25_ENST00000432073.2_Missense_Mutation_p.L190Q|SLC25A25_ENST00000373066.5_Missense_Mutation_p.L202Q	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	170					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.L170Q(1)|p.L204Q(1)|p.L190Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						GGTGAGAATCTAACGGTCCCG	0.597																																																	3	Substitution - Missense(3)	kidney(3)											95.0	91.0	93.0					9																	130865982		2203	4300	6503	SO:0001583	missense	114789			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.509T>A	9.37:g.130865982T>A	ENSP00000362155:p.Leu170Gln		Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	ENST00000373064.5	37	CCDS6890.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341149	0.81911	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064;ENST00000433501	T;T;T;D;T;T	0.82526	0.96;0.96;-1.35;-1.62;-1.34;-1.42	5.7	5.7	0.88788	.	0.171234	0.44902	D	0.000413	D	0.90287	0.6962	M	0.76727	2.345	0.80722	D	1	P;D;P;D	0.89917	0.863;0.987;0.866;1.0	P;D;D;D	0.74023	0.708;0.94;0.94;0.982	D	0.90614	0.4554	10	0.51188	T	0.08	-20.623	15.1577	0.72755	0.0:0.0:0.0:1.0	.	170;202;190;204	Q6KCM7;Q6KCM7-5;Q6KCM7-4;Q6KCM7-2	SCMC2_HUMAN;.;.;.	Q	204;216;190;202;170;67	ENSP00000362159:L204Q;ENSP00000362160:L216Q;ENSP00000410053:L190Q;ENSP00000362157:L202Q;ENSP00000362155:L170Q;ENSP00000401672:L67Q	ENSP00000362155:L170Q	L	+	2	0	SLC25A25	129905803	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	8.040000	0.89188	2.172000	0.68678	0.533000	0.62120	CTA		0.597	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054407.1		NM_052901	
SLC35A1	10559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	88210341	88210341	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:88210341A>G	ENST00000369552.4	+	3	337	c.310A>G	c.(310-312)Atg>Gtg	p.M104V	SLC35A1_ENST00000544441.1_Intron|SLC35A1_ENST00000464978.1_3'UTR|SLC35A1_ENST00000369557.5_Missense_Mutation_p.M104V|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000369556.3_Missense_Mutation_p.M104V	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	104					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)	p.M104V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TCAGAACAACATGGCTTTCCT	0.403																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)												1	Substitution - Missense(1)	kidney(1)											112.0	99.0	104.0					6																	88210341		2203	4300	6503	SO:0001583	missense	10559			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.310A>G	6.37:g.88210341A>G	ENSP00000358565:p.Met104Val		Q5W1L8	Missense_Mutation	SNP	ENST00000369552.4	37	CCDS5010.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370208	0.82573	.	.	ENSG00000164414	ENST00000369556;ENST00000369552;ENST00000429605;ENST00000369557;ENST00000369544	T;T;T	0.40225	1.04;1.04;1.04	5.63	5.63	0.86233	.	0.000000	0.85682	U	0.000000	T	0.27313	0.0670	N	0.21240	0.645	0.80722	D	1	P;P	0.45240	0.854;0.594	P;B	0.46144	0.505;0.312	T	0.14062	-1.0486	10	0.72032	D	0.01	-27.8238	16.1359	0.81487	1.0:0.0:0.0:0.0	.	104;104	P78382;Q5W1L8	S35A1_HUMAN;.	V	104;104;104;104;85	ENSP00000358569:M104V;ENSP00000358565:M104V;ENSP00000358570:M104V	ENSP00000358557:M85V	M	+	1	0	SLC35A1	88267060	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.910000	0.92685	2.276000	0.75962	0.454000	0.30748	ATG		0.403	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1			
SON	6651	hgsc.bcm.edu	37	21	34948697	34948697	+	Frame_Shift_Del	DEL	A	A	-	rs199930883|rs34373121		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr21:34948697delA	ENST00000356577.4	+	12	7723	c.7248delA	c.(7246-7248)agafs	p.R2416fs	SON_ENST00000470533.1_Intron|DONSON_ENST00000303113.6_Intron|SON_ENST00000381692.2_Frame_Shift_Del_p.R444fs|SON_ENST00000290239.6_3'UTR|AP000304.1_ENST00000595468.1_5'Flank	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2416	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.			ALTR -> SPYQ (in Ref. 2; AAK07692). {ECO:0000305}.	cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCCTTACCAGACCCAATTGTA	0.363													-|A|-|insertion	5008	1.0	1.0	1.0	5008	,	,		14481	1.0		1.0	False		,,,				2504	1.0																0													9.0	10.0	10.0					21																	34948697		1712	3586	5298	SO:0001589	frameshift_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7248delA	21.37:g.34948697delA	ENSP00000348984:p.Arg2416fs		D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Del	DEL	ENST00000356577.4	37	CCDS13629.1																																																																																				0.363	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2		NM_138927	
SPG7	6687	hgsc.bcm.edu;ucsc.edu	37	16	89616909	89616910	+	Frame_Shift_Ins	INS	-	-	A	rs369227537		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr16:89616909_89616910insA	ENST00000268704.2	+	13	1686_1687	c.1671_1672insA	c.(1672-1674)aaafs	p.K558fs		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	558					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CAGGGACTGCCAAAAAGAGCAA	0.604																																																	0																																										SO:0001589	frameshift_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1676dupA	16.37:g.89616914_89616914dupA	ENSP00000268704:p.Lys558fs		O75756|Q2TB70|Q58F00|Q96IB0	Frame_Shift_Ins	INS	ENST00000268704.2	37	CCDS10977.1																																																																																				0.604	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2		NM_003119	
SPHKAP	80309	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	228882779	228882779	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:228882779C>A	ENST00000392056.3	-	7	2837	c.2791G>T	c.(2791-2793)Gaa>Taa	p.E931*	SPHKAP_ENST00000344657.5_Nonsense_Mutation_p.E931*	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	931	PKA-RII subunit binding domain. {ECO:0000250}.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.E931K(2)|p.E931*(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCTAATTCTTCCGCAAAGTCT	0.473																																																	4	Substitution - Missense(2)|Substitution - Nonsense(2)	kidney(4)											189.0	171.0	177.0					2																	228882779		2203	4300	6503	SO:0001587	stop_gained	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2791G>T	2.37:g.228882779C>A	ENSP00000375909:p.Glu931*		Q68DA3|Q68DR8|Q9C0I5	Nonsense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	38	7.002497	0.97994	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	.	.	.	6.08	6.08	0.98989	.	0.092028	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6516	0.95815	0.0:1.0:0.0:0.0	.	.	.	.	X	931	.	ENSP00000339886:E931X	E	-	1	0	SPHKAP	228591023	1.000000	0.71417	0.980000	0.43619	0.402000	0.30811	7.194000	0.77789	2.894000	0.99253	0.655000	0.94253	GAA		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1		NM_030623	
SSNA1	8636	broad.mit.edu;hgsc.bcm.edu	37	9	140083619	140083619	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:140083619G>A	ENST00000322310.5	+	2	234	c.154G>A	c.(154-156)Gag>Aag	p.E52K	ANAPC2_ENST00000323927.2_5'Flank|SSNA1_ENST00000459860.1_3'UTR	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1	52					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E52K(2)		breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		GCAGCTGACAGAGAAGCTGGC	0.627																																																	2	Substitution - Missense(2)	breast(1)|kidney(1)											41.0	33.0	36.0					9																	140083619		2201	4299	6500	SO:0001583	missense	8636			Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.154G>A	9.37:g.140083619G>A	ENSP00000313752:p.Glu52Lys		Q5VSG0|Q6FG70|Q9BVW8	Missense_Mutation	SNP	ENST00000322310.5	37	CCDS7034.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775002	0.70107	.	.	ENSG00000176101	ENST00000322310	D	0.83755	-1.76	4.07	4.07	0.47477	.	0.124068	0.53938	D	0.000050	T	0.78541	0.4299	M	0.65677	2.01	0.58432	D	0.999991	B	0.34103	0.437	B	0.26770	0.073	T	0.77485	-0.2570	10	0.27785	T	0.31	-27.7985	14.1028	0.65068	0.0:0.0:1.0:0.0	.	52	O43805	SSNA1_HUMAN	K	52	ENSP00000313752:E52K	ENSP00000313752:E52K	E	+	1	0	SSNA1	139203440	1.000000	0.71417	0.904000	0.35570	0.888000	0.51559	7.282000	0.78630	1.972000	0.57404	0.561000	0.74099	GAG		0.627	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055311.1		NM_003731	
SUGP2	10147	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19129981	19129981	+	Missense_Mutation	SNP	C	C	T	rs373174595		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:19129981C>T	ENST00000601879.1	-	4	2084	c.1787G>A	c.(1786-1788)cGt>cAt	p.R596H	SUGP2_ENST00000452918.2_Missense_Mutation_p.R596H|SUGP2_ENST00000600377.1_Missense_Mutation_p.R610H|SUGP2_ENST00000337018.6_Missense_Mutation_p.R596H|SUGP2_ENST00000456085.2_Missense_Mutation_p.R365H			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	596					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R596H(1)		NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TTCGATGACACGTTTCACAAG	0.507																																																	1	Substitution - Missense(1)	kidney(1)						C	HIS/ARG,HIS/ARG	1,4405		0,1,2202	108.0	91.0	96.0		1787,1787	4.5	0.1	19		96	0,8600		0,0,4300	no	missense,missense	SUGP2	NM_001017392.3,NM_014884.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	596/1083,596/1083	19129981	1,13005	2203	4300	6503	SO:0001583	missense	10147			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.1787G>A	19.37:g.19129981C>T	ENSP00000472286:p.Arg596His		C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.798757	0.50208	2.27E-4	0.0	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.59	4.49	0.54785	SWAP/Surp (1);	0.178846	0.39083	N	0.001469	T	0.44787	0.1310	N	0.19112	0.55	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.62491	0.903;0.903;0.862	T	0.30563	-0.9974	10	0.52906	T	0.07	-15.4684	13.0309	0.58840	0.0:0.8382:0.1618:0.0	.	365;596;596	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	H	596;596;596;365	ENSP00000337926:R596H;ENSP00000332373:R596H;ENSP00000389380:R596H;ENSP00000409603:R365H	ENSP00000332373:R596H	R	-	2	0	SUGP2	18990981	0.443000	0.25641	0.122000	0.21767	0.117000	0.20001	1.979000	0.40608	2.639000	0.89480	0.655000	0.94253	CGT		0.507	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1		NM_001017392	
TAF1	6872	broad.mit.edu;hgsc.bcm.edu	37	X	70602417	70602417	+	Silent	SNP	T	T	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chrX:70602417T>C	ENST00000373790.4	+	10	1617	c.1566T>C	c.(1564-1566)tcT>tcC	p.S522S	TAF1_ENST00000423759.1_Silent_p.S543S|TAF1_ENST00000276072.3_Silent_p.S543S|TAF1_ENST00000449580.1_Silent_p.S522S	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	522	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S522S(1)|p.S543S(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AGGCCACCTCTAACTCCCCCT	0.443																																																	2	Substitution - coding silent(2)	kidney(2)											59.0	55.0	56.0					X																	70602417		2203	4300	6503	SO:0001819	synonymous_variant	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1566T>C	X.37:g.70602417T>C			A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	ENST00000373790.4	37	CCDS35325.1																																																																																				0.443	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2		NM_004606	
PSMB8	5696	broad.mit.edu;hgsc.bcm.edu	37	6	32805899	32805899	+	IGR	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:32805899G>A	ENST00000374882.3	-	0	1124				TAP2_ENST00000452392.2_Silent_p.L38L|TAP2_ENST00000374897.2_Silent_p.L38L|TAP2_ENST00000374899.4_Silent_p.L38L	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.L38L(2)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	TCCAGCCATAGTCCTGGCAGC	0.637																																					NSCLC(48;53 1172 10859 13624 22883)												2	Substitution - coding silent(2)	kidney(2)											45.0	50.0	48.0					6																	32805899		1508	2708	4216	SO:0001628	intergenic_variant	6891				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285		6.37:g.32805899G>A			B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Silent	SNP	ENST00000374882.3	37	CCDS4757.1																																																																																				0.637	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076617.3		NM_148919	
TBPL2	387332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	55895569	55895569	+	Silent	SNP	G	G	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr14:55895569G>A	ENST00000247219.5	-	5	982	c.912C>T	c.(910-912)ccC>ccT	p.P304P		NM_199047.2	NP_950248.1			TATA box binding protein like 2									p.P304P(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						CCAGCCTGATGGGAAATCTCA	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											118.0	108.0	111.0					14																	55895569		2203	4300	6503	SO:0001819	synonymous_variant	387332			AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.912C>T	14.37:g.55895569G>A				Silent	SNP	ENST00000247219.5	37	CCDS9724.1																																																																																				0.408	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1		NM_199047	
TDRD6	221400	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	46657639	46657639	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:46657639C>G	ENST00000316081.6	+	1	1774	c.1774C>G	c.(1774-1776)Cag>Gag	p.Q592E	TDRD6_ENST00000544460.1_Missense_Mutation_p.Q592E|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	592	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.Q592E(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TCAGTTTAGGCAGCTACCAAT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											112.0	107.0	109.0					6																	46657639		2203	4300	6503	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1774C>G	6.37:g.46657639C>G	ENSP00000346065:p.Gln592Glu		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.091618	0.00364	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.08807	3.05;3.05	6.02	3.26	0.37387	Tudor subgroup (1);Maternal tudor protein (1);	1.007200	0.07955	N	0.981482	T	0.01254	0.0041	N	0.16098	0.37	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.13407	0.005;0.009	T	0.44892	-0.9298	10	0.06757	T	0.87	-15.0336	9.3675	0.38234	0.3338:0.4181:0.2481:0.0	.	592;592	F5H5M3;O60522	.;TDRD6_HUMAN	E	592	ENSP00000443299:Q592E;ENSP00000346065:Q592E	ENSP00000346065:Q592E	Q	+	1	0	TDRD6	46765598	0.329000	0.24696	0.066000	0.19879	0.238000	0.25445	0.983000	0.29552	0.424000	0.26061	-0.953000	0.02652	CAG		0.448	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1		XM_166443	
THBS4	7060	hgsc.bcm.edu	37	5	79351734	79351734	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr5:79351734C>T	ENST00000350881.2	+	3	609	c.419C>T	c.(418-420)tCc>tTc	p.S140F	THBS4_ENST00000511733.1_Missense_Mutation_p.S49F|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	140	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.S140F(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GGGGCCGGCTCCCTAGAGCTC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											75.0	81.0	79.0					5																	79351734		2203	4300	6503	SO:0001583	missense	7060				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.419C>T	5.37:g.79351734C>T	ENSP00000339730:p.Ser140Phe		B2R909|Q86TG2	Missense_Mutation	SNP	ENST00000350881.2	37	CCDS4049.1	.	.	.	.	.	.	.	.	.	.	C	9.899	1.206285	0.22205	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	T;T	0.02280	4.36;4.36	5.84	5.84	0.93424	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.174186	0.51477	D	0.000083	T	0.03095	0.0091	L	0.28115	0.83	0.35855	D	0.827082	P	0.45283	0.855	P	0.44732	0.459	T	0.63019	-0.6730	9	.	.	.	-21.7724	15.3735	0.74587	0.1401:0.8599:0.0:0.0	.	140	P35443	TSP4_HUMAN	F	140;49	ENSP00000339730:S140F;ENSP00000422298:S49F	.	S	+	2	0	THBS4	79387490	0.982000	0.34865	0.905000	0.35620	0.046000	0.14306	2.370000	0.44240	2.758000	0.94735	0.591000	0.81541	TCC		0.582	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1			
TMEM68	137695	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	56652730	56652730	+	Silent	SNP	T	T	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr8:56652730T>C	ENST00000434581.2	-	8	1135	c.936A>G	c.(934-936)ccA>ccG	p.P312P	TMEM68_ENST00000519784.1_Silent_p.P131P|TMEM68_ENST00000334667.2_Silent_p.P245P|TMEM68_ENST00000523073.1_Intron			Q96MH6	TMM68_HUMAN	transmembrane protein 68	312						integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)	p.P245P(1)		NS(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6			Epithelial(17;0.000361)|all cancers(17;0.00326)			TAATGTTTCCTGGTATTCTTT	0.299																																																	1	Substitution - coding silent(1)	kidney(1)											128.0	121.0	123.0					8																	56652730		2202	4298	6500	SO:0001819	synonymous_variant	137695			AK056932	CCDS6161.1, CCDS75740.1, CCDS75741.1, CCDS75742.1	8q12.1	2011-12-12			ENSG00000167904	ENSG00000167904			26510	protein-coding gene	gene with protein product						12477932	Standard	XM_005251150		Approved	FLJ32370	uc003xsh.1	Q96MH6	OTTHUMG00000164293	ENST00000434581.2:c.936A>G	8.37:g.56652730T>C			Q658X6|Q8WUD2	Silent	SNP	ENST00000434581.2	37																																																																																					0.299	TMEM68-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000378137.1		NM_152417	
TSPYL1	7259	hgsc.bcm.edu;ucsc.edu	37	6	116600703	116600703	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:116600703delC	ENST00000368608.3	-	1	363	c.291delG	c.(289-291)gggfs	p.G97fs	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000452085.3_5'Flank|DSE_ENST00000540275.1_Intron	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	97					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		CCTCTTCCTGCCCGGCTTTGA	0.672																																																	0													27.0	32.0	30.0					6																	116600703		2202	4298	6500	SO:0001589	frameshift_variant	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.291delG	6.37:g.116600703delC	ENSP00000357597:p.Gly97fs		O75885|Q5TFE6	Frame_Shift_Del	DEL	ENST00000368608.3	37	CCDS34518.1																																																																																				0.672	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10191520	10191520	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr3:10191520delG	ENST00000256474.2	+	3	1353	c.513delG	c.(511-513)aagfs	p.K171fs	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Frame_Shift_Del_p.K130fs	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	171					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.K171N(2)|p.V170fs*29(1)|p.P172_E173del(1)|p.K171fs*43(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCCTAGTCAAGCCTGAGAATT	0.522		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	5	Substitution - Missense(2)|Deletion - Frameshift(2)|Deletion - In frame(1)	kidney(5)											93.0	84.0	87.0					3																	10191520		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.513delG	3.37:g.10191520delG	ENSP00000256474:p.Lys171fs		B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.522	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS13D	55187	broad.mit.edu;ucsc.edu	37	1	12321995	12321995	+	Silent	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr1:12321995G>T	ENST00000358136.3	+	13	1582	c.1452G>T	c.(1450-1452)tcG>tcT	p.S484S	VPS13D_ENST00000356315.4_Silent_p.S484S	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.S484S(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGATGCCTCGTGTATGAACA	0.438																																																	1	Substitution - coding silent(1)	kidney(1)											157.0	139.0	145.0					1																	12321995		2203	4300	6503	SO:0001819	synonymous_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.1452G>T	1.37:g.12321995G>T				Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																				0.438	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2		NM_015378	
WNT8A	7478	hgsc.bcm.edu	37	5	137426309	137426309	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr5:137426309C>A	ENST00000398754.1	+	6	608	c.603C>A	c.(601-603)ttC>ttA	p.F201L	WNT8A_ENST00000506684.1_Missense_Mutation_p.F219L	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	201					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGGCTGAATTCCGGGAGATGG	0.537																																																	0													45.0	45.0	45.0					5																	137426309		1937	4145	6082	SO:0001583	missense	7478			AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.603C>A	5.37:g.137426309C>A	ENSP00000381739:p.Phe201Leu		Q96S51	Missense_Mutation	SNP	ENST00000398754.1	37	CCDS43368.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277773	0.80692	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	T;T;T	0.79454	-1.27;-1.27;-1.27	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.87728	0.6250	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.89065	0.3465	10	0.87932	D	0	.	13.6469	0.62288	0.0:0.9233:0.0:0.0767	.	219;219;201	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	L	219;219;201	ENSP00000426653:F219L;ENSP00000424809:F219L;ENSP00000381739:F201L	ENSP00000354726:F201L	F	+	3	2	WNT8A	137454208	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.589000	0.36644	2.537000	0.85549	0.557000	0.71058	TTC		0.537	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1		NM_058244	
ZFPM2	23414	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	106810965	106810965	+	Silent	SNP	T	T	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr8:106810965T>C	ENST00000407775.2	+	7	1003	c.753T>C	c.(751-753)ccT>ccC	p.P251P	RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Silent_p.P119P|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000378472.4_5'UTR|ZFPM2_ENST00000520492.1_Silent_p.P119P	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	251					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P251P(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATATATTCCCTTGCAAGTCCT	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	82.0	84.0					8																	106810965		1972	4178	6150	SO:0001819	synonymous_variant	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.753T>C	8.37:g.106810965T>C			Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	ENST00000407775.2	37	CCDS47908.1																																																																																				0.468	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			
ZNF318	24149	hgsc.bcm.edu;ucsc.edu	37	6	43307260	43307261	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:43307260_43307261insC	ENST00000361428.2	-	10	4552_4553	c.4475_4476insG	c.(4474-4476)ggtfs	p.G1492fs	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1492	Pro-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			AAATGTTAGGACCCACGAAGCC	0.535																																																	0																																										SO:0001589	frameshift_variant	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4476dupG	6.37:g.43307263_43307263dupC	ENSP00000354964:p.Gly1492fs		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Ins	INS	ENST00000361428.2	37	CCDS4895.2																																																																																				0.535	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2		NM_014345	
ZNF808	388558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	53058493	53058493	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr19:53058493G>T	ENST00000359798.4	+	5	2504	c.2324G>T	c.(2323-2325)tGg>tTg	p.W775L		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	775					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W775L(1)		endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TTCCGTCACTGGTCATCCCTT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											196.0	198.0	197.0					19																	53058493		2203	4300	6503	SO:0001583	missense	388558			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2324G>T	19.37:g.53058493G>T	ENSP00000352846:p.Trp775Leu		Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	2.401	-0.337518	0.05278	.	.	ENSG00000198482	ENST00000359798	T	0.20200	2.09	1.74	-3.49	0.04724	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02888	0.0086	N	0.00068	-2.29	0.09310	N	1	B	0.15719	0.014	B	0.12837	0.008	T	0.37337	-0.9710	9	0.23891	T	0.37	.	3.2837	0.06925	0.4761:0.0:0.2044:0.3195	.	775	Q8N4W9	ZN808_HUMAN	L	775	ENSP00000352846:W775L	ENSP00000352846:W775L	W	+	2	0	ZNF808	57750305	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.090000	0.00152	-1.935000	0.01049	-1.337000	0.01257	TGG		0.443	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3		NM_001039886	
C3orf58	205428	broad.mit.edu	37	3	143691275	143691275	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr3:143691275C>A	ENST00000315691.3	+	1	636	c.101C>A	c.(100-102)tCg>tAg	p.S34*	C3orf58_ENST00000441925.2_5'Flank|C3orf58_ENST00000495414.1_5'Flank	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	34					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)		p.S34*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CACTCGCCGTCGCTGCTCGCC	0.692																																																	1	Substitution - Nonsense(1)	kidney(1)											9.0	10.0	10.0					3																	143691275		2180	4273	6453	SO:0001587	stop_gained	205428			AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.101C>A	3.37:g.143691275C>A	ENSP00000320081:p.Ser34*		B2RCF2|B7Z1W3	Nonsense_Mutation	SNP	ENST00000315691.3	37	CCDS3130.1	.	.	.	.	.	.	.	.	.	.	C	42	9.466290	0.99178	.	.	ENSG00000181744	ENST00000315691	.	.	.	3.89	3.89	0.44902	.	0.200072	0.42420	D	0.000703	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-18.5612	16.0803	0.81001	0.0:1.0:0.0:0.0	.	.	.	.	X	34	.	ENSP00000320081:S34X	S	+	2	0	C3orf58	145173965	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.564000	0.60830	2.027000	0.59764	0.561000	0.74099	TCG		0.692	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1		NM_173552	
EEF1A1	1915	broad.mit.edu	37	6	74228230	74228230	+	Silent	SNP	G	G	T	rs200820708		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr6:74228230G>T	ENST00000316292.9	-	5	1867	c.876C>A	c.(874-876)gtC>gtA	p.V292V	EEF1A1_ENST00000309268.6_Silent_p.V292V|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Silent_p.V292V	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	292					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)	p.V292V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GGTGCATTTCGACAGATTTTA	0.488											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					1	Substitution - coding silent(1)	kidney(1)											34.0	33.0	33.0					6																	74228230		2006	4167	6173	SO:0001819	synonymous_variant	1915			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.876C>A	6.37:g.74228230G>T		1151	P04719|P04720|Q6IQ15	Silent	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																				0.488	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2		NM_001402	
FLJ36000	284124	broad.mit.edu	37	17	21904083	21904083	+	lincRNA	SNP	C	C	A			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr17:21904083C>A	ENST00000581223.2	+	0	0					NR_027084.1																						ctgacctctccacggggtcca	0.677																																																	0																																												284124																															17.37:g.21904083C>A				RNA	SNP	ENST00000581223.2	37																																																																																					0.677	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000451067.1			
GRSF1	2926	broad.mit.edu	37	4	71690078	71690078	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr4:71690078C>G	ENST00000254799.6	-	9	1518	c.1401G>C	c.(1399-1401)agG>agC	p.R467S	GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000545193.1_Missense_Mutation_p.R349S|GRSF1_ENST00000502323.1_Missense_Mutation_p.R305S|GRSF1_ENST00000439371.1_Missense_Mutation_p.R305S	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	467	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R467S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GTTCAATATACCTATGATCTG	0.353																																																	1	Substitution - Missense(1)	kidney(1)											73.0	65.0	68.0					4																	71690078		1814	4066	5880	SO:0001583	missense	2926			BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.1401G>C	4.37:g.71690078C>G	ENSP00000254799:p.Arg467Ser		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.21|17.21	3.331130|3.331130	0.60853|0.60853	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000514161|ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193	.|T;T;T;T;T	.|0.11930	.|2.73;2.73;2.73;2.73;2.73	6.05|6.05	0.286|0.286	0.15710|0.15710	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.|0.093461	.|0.64402	.|D	.|0.000001	T|T	0.28632|0.28632	0.0709|0.0709	M|M	0.81239|0.81239	2.535|2.535	0.43574|0.43574	D|D	0.995908|0.995908	.|D;D	.|0.69078	.|0.997;0.988	.|D;D	.|0.79784	.|0.993;0.954	T|T	0.07385|0.07385	-1.0775|-1.0775	5|10	.|0.72032	.|D	.|0.01	-8.2403|-8.2403	1.0969|1.0969	0.01675|0.01675	0.2323:0.2913:0.1034:0.373|0.2323:0.2913:0.1034:0.373	.|.	.|380;467	.|B7Z5F9;Q12849	.|.;GRSF1_HUMAN	A|S	404|467;305;399;440;305;349	.|ENSP00000254799:R467S;ENSP00000389219:R305S;ENSP00000427354:R440S;ENSP00000425430:R305S;ENSP00000443380:R349S	.|ENSP00000254799:R467S	G|R	-|-	2|3	0|2	GRSF1|GRSF1	71908942|71908942	0.970000|0.970000	0.33590|0.33590	0.988000|0.988000	0.46212|0.46212	0.929000|0.929000	0.56500|0.56500	0.027000|0.027000	0.13621|0.13621	-0.273000|-0.273000	0.09246|0.09246	-0.300000|-0.300000	0.09419|0.09419	GGT|AGG		0.353	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1		NM_002092	
CEP170B	283638	broad.mit.edu	37	14	105361169	105361169	+	Silent	SNP	A	A	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr14:105361169A>C	ENST00000414716.3	+	19	4767	c.4539A>C	c.(4537-4539)tcA>tcC	p.S1513S	CEP170B_ENST00000453495.1_Silent_p.S1549S|CEP170B_ENST00000556508.1_Silent_p.S1478S|CEP170B_ENST00000418279.1_Silent_p.S1443S	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1548						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.S1513S(3)|p.S1479S(3)|p.S1478S(1)									GCCCACCCTCACCCGCCTCAG	0.711																																																	7	Substitution - coding silent(7)	prostate(3)|kidney(2)|central_nervous_system(2)											11.0	15.0	14.0					14																	105361169		1915	4097	6012	SO:0001819	synonymous_variant	0			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.4539A>C	14.37:g.105361169A>C			Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	37	CCDS45175.1																																																																																				0.711	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2		NM_001112726	
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S164S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871							Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)											8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1		NM_004529	
CDK2AP2P2	107133486	broad.mit.edu	37	9	66500810	66500810	+	IGR	SNP	G	G	A	rs201331241		TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:66500810G>A								RP11-262H14.1 (31500 upstream) : RP11-262H14.7 (16395 downstream)																							ACCTACGGTCGGTTGTGTGCA	0.637																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.66500810G>A				RNA	SNP		37																																																																																				0	0.637									
PI4KAP1	728233	broad.mit.edu	37	22	20385733	20385733	+	RNA	SNP	A	A	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr22:20385733A>G	ENST00000430523.3	-	0	2078					NR_003563.1		Q8N8J0	PI4P1_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)												TACTTCAAGAACTTGATTGTC	0.537																																																	0																																												728233					22q11.21	2007-08-14	2007-08-14			ENSG00000274602			33576	pseudogene	pseudogene							Standard	NR_003563		Approved		uc010gsg.2	Q8N8J0			22.37:g.20385733A>G				RNA	SNP	ENST00000430523.3	37																																																																																					0.537	PI4KAP1-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319534.5			
RGPD4	285190	broad.mit.edu	37	2	108489172	108489172	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr2:108489172G>C	ENST00000408999.3	+	20	4789	c.4712G>C	c.(4711-4713)gGa>gCa	p.G1571A	RGPD4_ENST00000354986.4_Missense_Mutation_p.G1571A	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1571					protein targeting to Golgi (GO:0000042)			p.G1571A(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TCTTTGTTTGGATTTAGTTTT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											97.0	82.0	87.0					2																	108489172		692	1591	2283	SO:0001583	missense	285190			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4712G>C	2.37:g.108489172G>C	ENSP00000386810:p.Gly1571Ala		B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	8.357	0.832189	0.16820	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.50277	0.75;0.76	2.33	2.33	0.28932	.	.	.	.	.	T	0.56217	0.1970	M	0.66939	2.045	0.29405	N	0.86167	D	0.60160	0.987	P	0.53006	0.715	T	0.56214	-0.8016	9	0.66056	D	0.02	-28.2303	11.5771	0.50869	0.0:0.0:1.0:0.0	.	1571	Q7Z3J3	RGPD4_HUMAN	A	1571	ENSP00000347081:G1571A;ENSP00000386810:G1571A	ENSP00000347081:G1571A	G	+	2	0	RGPD4	107855604	1.000000	0.71417	1.000000	0.80357	0.335000	0.28730	7.559000	0.82265	1.303000	0.44873	0.162000	0.16502	GGA		0.348	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2		XM_496581	
RPS8P10	388076	broad.mit.edu	37	15	22440773	22440773	+	IGR	SNP	C	C	T			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr15:22440773C>T								RP11-2F9.4 (4596 upstream) : IGHV1OR15-1 (7608 downstream)																							CTCATACTTCCGCTTCTTGTG	0.577																																																	0																																										SO:0001628	intergenic_variant	0																															15.37:g.22440773C>T				Missense_Mutation	SNP		37																																																																																				0	0.577									
IFNA22P	3453	broad.mit.edu	37	9	21278188	21278188	+	IGR	SNP	C	C	G			TCGA-CJ-5686-01A-11D-1669-08	TCGA-CJ-5686-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	695e2a72-6b97-4fa1-9f57-d7c6e10438ee	643a505e-ab7b-4885-a5ba-ed890cf80da8	g.chr9:21278188C>G								IFNA14 (38210 upstream) : IFNA5 (26424 downstream)																							AAAGTATTTTCTCACAGCCAG	0.453																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.21278188C>G				RNA	SNP		37																																																																																				0	0.453									
