#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBE4B	10277	broad.mit.edu;bcgsc.ca	37	1	10177626	10177626	+	Silent	SNP	C	C	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:10177626C>A	ENST00000253251.8	+	7	1758	c.919C>A	c.(919-921)Cga>Aga	p.R307R	UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000343090.6_Silent_p.R436R|UBE4B_ENST00000377157.3_Silent_p.R191R					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTGTTTCGACCGAGTTGGAAT	0.393																																					p.R436R													.	UBE4B-229	0			c.C1306A						.						63.0	62.0	62.0					1																	10177626		2203	4300	6503	SO:0001819	synonymous_variant	10277	exon8			TTCGACCGAGTTG	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.919C>A	1.37:g.10177626C>A		72	0		50	5	NM_001105562	0	0	2	2	0		Silent	SNP	ENST00000253251.8	37	CCDS110.1																																																																																			.		0.393	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
VPS13D	55187	bcgsc.ca	37	1	12387776	12387776	+	Missense_Mutation	SNP	A	A	C	rs201321059		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:12387776A>C	ENST00000358136.3	+	36	8192	c.8062A>C	c.(8062-8064)Acc>Ccc	p.T2688P	VPS13D_ENST00000356315.4_Missense_Mutation_p.T2688P	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTTGGCCTCCACCAGCCGAGA	0.488																																					p.T2688P													.	VPS13D-95	0			c.A8062C						.						158.0	160.0	160.0					1																	12387776		2203	4300	6503	SO:0001583	missense	55187	exon36			GCCTCCACCAGCC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8062A>C	1.37:g.12387776A>C	ENSP00000350854:p.Thr2688Pro	220	10		201	36	NM_015378	0	0	3	3	0		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	A	7.855	0.724729	0.15439	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.45276	0.9;0.9	5.51	-1.24	0.09435	.	1.281640	0.04635	N	0.404367	T	0.28167	0.0695	L	0.27053	0.805	0.09310	N	1	B;B;B	0.12013	0.0;0.005;0.003	B;B;B	0.19666	0.0;0.026;0.012	T	0.16424	-1.0403	9	.	.	.	.	5.2921	0.15733	0.3598:0.2951:0.3451:0.0	.	595;2688;2688	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	P	2688	ENSP00000348666:T2688P;ENSP00000350854:T2688P	.	T	+	1	0	VPS13D	12310363	0.000000	0.05858	0.000000	0.03702	0.253000	0.25986	-0.083000	0.11286	-0.389000	0.07786	0.533000	0.62120	ACC	.		0.488	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
ERICH3	127254	bcgsc.ca	37	1	75037375	75037375	+	Missense_Mutation	SNP	A	A	C	rs139917611|rs78115948		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:75037375A>C	ENST00000326665.5	-	14	4237	c.4019T>G	c.(4018-4020)gTg>gGg	p.V1340G	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1340	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TAGAACTTCCACAGCCACAAC	0.547																																					p.V1340G													.	C1orf173-94	0			c.T4019G						.						223.0	211.0	215.0					1																	75037375		2203	4300	6503	SO:0001583	missense	127254	exon14			ACTTCCACAGCCA																												ENST00000326665.5:c.4019T>G	1.37:g.75037375A>C	ENSP00000322609:p.Val1340Gly	163	3		115	18	NM_001002912	0	0	0	0	0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	8.852	0.944804	0.18356	.	.	ENSG00000178965	ENST00000326665	T	0.11169	2.8	3.98	-2.34	0.06704	.	.	.	.	.	T	0.01421	0.0046	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.47761	-0.9092	9	0.22109	T	0.4	1.3381	9.7524	0.40483	0.5201:0.0:0.0:0.4799	.	1340	Q5RHP9	CA173_HUMAN	G	1340	ENSP00000322609:V1340G	ENSP00000322609:V1340G	V	-	2	0	C1orf173	74809963	0.001000	0.12720	0.002000	0.10522	0.040000	0.13550	0.391000	0.20784	-0.236000	0.09753	-0.393000	0.06486	GTG	.		0.547	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
FRRS1	391059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100214268	100214268	+	Silent	SNP	A	A	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:100214268A>G	ENST00000414213.1	-	3	658	c.57T>C	c.(55-57)taT>taC	p.Y19Y	FRRS1_ENST00000287474.5_Silent_p.Y19Y			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	19	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		AATTAGCCACATAACTAATGT	0.378																																					p.Y19Y		.											.	FRRS1-91	0			c.T57C						.						154.0	132.0	139.0					1																	100214268		2203	4300	6503	SO:0001819	synonymous_variant	391059	exon3			AGCCACATAACTA	AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.57T>C	1.37:g.100214268A>G		112	0		107	38	NM_001013660	0	0	0	0	0	A6NLN7	Silent	SNP	ENST00000414213.1	37																																																																																				.		0.378	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013660	
ALX3	257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110604111	110604111	+	Silent	SNP	G	G	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:110604111G>T	ENST00000369792.4	-	3	756	c.669C>A	c.(667-669)ccC>ccA	p.P223P	RP4-773N10.4_ENST00000554749.1_RNA|RP4-773N10.4_ENST00000596959.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	223					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAGCCGTGAAGGGGTTCCGCC	0.622																																					p.P223P		.											.	ALX3-90	0			c.C669A						.						79.0	78.0	78.0					1																	110604111		2203	4300	6503	SO:0001819	synonymous_variant	257	exon3			CGTGAAGGGGTTC	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.669C>A	1.37:g.110604111G>T		106	0		101	34	NM_006492	0	0	7	7	0	O95075|Q5T8M4	Silent	SNP	ENST00000369792.4	37	CCDS819.1																																																																																			.		0.622	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	NM_006492	
FCRL1	115350	bcgsc.ca	37	1	157776893	157776893	+	Splice_Site	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:157776893G>A	ENST00000368176.3	-	2	118	c.51C>T	c.(49-51)gcC>gcT	p.A17A	FCRL1_ENST00000489998.1_5'Flank|FCRL1_ENST00000491942.1_Splice_Site_p.A17A|FCRL1_ENST00000358292.3_Splice_Site_p.A17A	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	17	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCAACTCACCGGCAGGTTCAC	0.483																																					p.A17A	GBM(54;482 1003 11223 30131 35730)												.	FCRL1-153	0			c.C51T						.						73.0	70.0	71.0					1																	157776893		2203	4300	6503	SO:0001630	splice_region_variant	115350	exon2			CTCACCGGCAGGT	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.52+1C>T	1.37:g.157776893G>A		119	0		50	4	NM_001159397	0	0	0	0	0	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	ENST00000368176.3	37	CCDS1170.1																																																																																			.		0.483	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	Silent
DSTYK	25778	hgsc.bcm.edu	37	1	205132867	205132867	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:205132867C>G	ENST00000367162.3	-	4	1571	c.1541G>C	c.(1540-1542)aGt>aCt	p.S514T	DSTYK_ENST00000367160.4_Intron|DSTYK_ENST00000367161.3_Missense_Mutation_p.S514T	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	514					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						GAGATAATTACTGGTGATGTG	0.433																																					p.S514T		.											.	DSTYK-333	0			c.G1541C						.						80.0	72.0	75.0					1																	205132867		2203	4300	6503	SO:0001583	missense	25778	exon4			TAATTACTGGTGA	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1541G>C	1.37:g.205132867C>G	ENSP00000356130:p.Ser514Thr	35	0		31	2	NM_199462	0	0	0	0	0	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Missense_Mutation	SNP	ENST00000367162.3	37	CCDS1451.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245935	0.80024	.	.	ENSG00000133059	ENST00000367161;ENST00000367162	T;T	0.81163	-1.41;-1.46	5.8	5.8	0.92144	.	0.090598	0.85682	D	0.000000	D	0.84047	0.5386	L	0.35723	1.085	0.80722	D	1	D;D	0.63880	0.993;0.977	P;P	0.58454	0.839;0.751	D	0.83764	0.0216	10	0.49607	T	0.09	-13.2589	19.6644	0.95887	0.0:1.0:0.0:0.0	.	514;514	Q6XUX3-2;Q6XUX3	.;DUSTY_HUMAN	T	514	ENSP00000356129:S514T;ENSP00000356130:S514T	ENSP00000356129:S514T	S	-	2	0	DSTYK	203399490	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.108000	0.71522	2.758000	0.94735	0.563000	0.77884	AGT	.		0.433	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
PIP4K2A	5305	bcgsc.ca	37	10	22856802	22856802	+	Missense_Mutation	SNP	C	C	T	rs201266267		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr10:22856802C>T	ENST00000376573.4	-	6	884	c.656G>A	c.(655-657)aGa>aAa	p.R219K	PIP4K2A_ENST00000323883.7_Missense_Mutation_p.R79K|PIP4K2A_ENST00000422321.1_5'UTR|PIP4K2A_ENST00000545335.1_Missense_Mutation_p.R160K	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	219	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						ACTAGCTTCTCTAGCCACTGT	0.453																																					p.R219K													.	PIP4K2A-665	0			c.G656A						.						140.0	123.0	129.0					10																	22856802		2203	4300	6503	SO:0001583	missense	5305	exon6			GCTTCTCTAGCCA	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.656G>A	10.37:g.22856802C>T	ENSP00000365757:p.Arg219Lys	211	1		126	16	NM_005028	0	0	1	1	0	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Missense_Mutation	SNP	ENST00000376573.4	37	CCDS7141.1	.	.	.	.	.	.	.	.	.	.	C	35	5.513277	0.96402	.	.	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335;ENST00000422321;ENST00000376565	T;T;T	0.69306	-0.39;-0.39;-0.39	5.36	5.36	0.76844	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.88130	0.6354	H	0.96301	3.8	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.80764	0.994;0.971	D	0.91774	0.5430	10	0.87932	D	0	-22.5481	19.0839	0.93194	0.0:1.0:0.0:0.0	.	79;219	B4DH09;P48426	.;PI42A_HUMAN	K	219;79;160;171;178	ENSP00000365757:R219K;ENSP00000326294:R79K;ENSP00000442098:R160K	ENSP00000326294:R79K	R	-	2	0	PIP4K2A	22896808	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.252000	0.78309	2.530000	0.85305	0.650000	0.86243	AGA	.		0.453	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028	
SYT15	83849	hgsc.bcm.edu	37	10	46969435	46969435	+	Missense_Mutation	SNP	A	A	G	rs374015418	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr10:46969435A>G	ENST00000374321.4	-	2	92	c.26T>C	c.(25-27)aTt>aCt	p.I9T	RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374325.3_Missense_Mutation_p.I9T|SYT15_ENST00000374323.4_Intron|SYT15_ENST00000503753.1_Missense_Mutation_p.I9T	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GGTGCCCCCAATCACCAGGGC	0.632													A|||	3	0.000599042	0.0	0.0014	5008	,	,		36778	0.001		0.001	False		,,,				2504	0.0				p.I9T	Ovarian(57;1152 1428 19651 37745)	.											.	SYT15-22	0			c.T26C						.	A	THR/ILE,THR/ILE	2,4202		0,2,2100	15.0	20.0	18.0		26,26	1.7	0.1	10		18	0,8484		0,0,4242	no	missense,missense	SYT15	NM_031912.4,NM_181519.2	89,89	0,2,6342	GG,GA,AA		0.0,0.0476,0.0158	possibly-damaging,possibly-damaging	9/422,9/391	46969435	2,12686	2102	4242	6344	SO:0001583	missense	83849	exon2			CCCCCAATCACCA	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.26T>C	10.37:g.46969435A>G	ENSP00000363441:p.Ile9Thr	28	1		17	10	NM_031912	0	0	0	0	0	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	a	11.75	1.731353	0.30684	4.76E-4	0.0	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374321	T;T;T	0.16743	2.32;2.32;2.56	4.04	1.72	0.24424	.	.	.	.	.	T	0.13157	0.0319	L	0.51422	1.61	0.09310	N	1	B;P	0.36535	0.421;0.557	B;B	0.31191	0.041;0.125	T	0.19192	-1.0313	9	0.59425	D	0.04	.	5.2408	0.15471	0.7616:0.0:0.2384:0.0	.	9;9	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	T	9	ENSP00000363445:I9T;ENSP00000427607:I9T;ENSP00000363441:I9T	ENSP00000363441:I9T	I	-	2	0	SYT15	46389441	0.000000	0.05858	0.072000	0.20136	0.932000	0.56968	0.119000	0.15626	0.709000	0.31976	0.383000	0.25322	ATT	.		0.632	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912	
ARHGAP22	58504	bcgsc.ca	37	10	49667744	49667744	+	Silent	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr10:49667744C>T	ENST00000249601.4	-	5	938	c.642G>A	c.(640-642)gaG>gaA	p.E214E	ARHGAP22_ENST00000435790.2_Silent_p.E220E|ARHGAP22_ENST00000374172.1_Silent_p.E105E|ARHGAP22_ENST00000417247.2_Silent_p.E124E|ARHGAP22_ENST00000417912.2_Silent_p.E230E|ARHGAP22_ENST00000374170.1_Silent_p.E124E	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	214	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ACAGTGGCTTCTCCCCACAGT	0.622																																					p.E230E													.	ARHGAP22-228	0			c.G690A						.						197.0	180.0	186.0					10																	49667744		2203	4300	6503	SO:0001819	synonymous_variant	58504	exon5			TGGCTTCTCCCCA	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.642G>A	10.37:g.49667744C>T		280	0		209	25	NM_001256024	0	0	1	1	0	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Silent	SNP	ENST00000249601.4	37	CCDS7227.1																																																																																			.		0.622	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
TMEM26	219623	bcgsc.ca	37	10	63195951	63195951	+	Missense_Mutation	SNP	G	G	A	rs200974700		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr10:63195951G>A	ENST00000399298.3	-	2	615	c.247C>T	c.(247-249)Ctt>Ttt	p.L83F	TMEM26_ENST00000399293.1_Missense_Mutation_p.L83F	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	83						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					TGCAATTCAAGAAGCCATAAT	0.348																																					p.L83F													.	TMEM26-90	0			c.C247T						.						68.0	68.0	68.0					10																	63195951		1829	4079	5908	SO:0001583	missense	219623	exon2			ATTCAAGAAGCCA	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.247C>T	10.37:g.63195951G>A	ENSP00000382237:p.Leu83Phe	72	0		42	10	NM_178505	0	0	0	0	0	Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	37	CCDS41530.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757789	0.69648	.	.	ENSG00000196932	ENST00000399298;ENST00000399293	.	.	.	5.55	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.79070	0.4384	M	0.84511	2.7	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.81534	-0.0889	9	0.87932	D	0	-28.2733	10.5584	0.45131	0.1464:0.0:0.8536:0.0	.	83	Q6ZUK4	TMM26_HUMAN	F	83	.	ENSP00000382232:L83F	L	-	1	0	TMEM26	62865957	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	3.466000	0.53071	2.590000	0.87494	0.655000	0.94253	CTT	.		0.348	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
DNA2	1763	bcgsc.ca	37	10	70196869	70196869	+	Silent	SNP	A	A	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr10:70196869A>C	ENST00000358410.3	-	10	1595	c.1545T>G	c.(1543-1545)ggT>ggG	p.G515G	DNA2_ENST00000399179.2_Silent_p.G515G|DNA2_ENST00000399180.2_Silent_p.G601G	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	515	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TAACTCTGTCACCTGCCATTA	0.353																																					p.G515G													.	.	0			c.T1545G						.						182.0	176.0	178.0					10																	70196869		1887	4114	6001	SO:0001819	synonymous_variant	1763	exon10			TCTGTCACCTGCC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.1545T>G	10.37:g.70196869A>C		251	13		144	32	NM_001080449	0	0	4	4	0	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Silent	SNP	ENST00000358410.3	37																																																																																				.		0.353	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
RIC8A	60626	broad.mit.edu;bcgsc.ca	37	11	208890	208890	+	Silent	SNP	G	G	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:208890G>T	ENST00000526104.1	+	1	1380	c.36G>T	c.(34-36)acG>acT	p.T12T	RIC8A_ENST00000527696.1_5'Flank|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000486280.1_5'Flank|RIC8A_ENST00000325207.5_Silent_p.T12T|BET1L_ENST00000529614.2_5'Flank|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000382762.3_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	12					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCGTGGAGACGGGTGAGGAGG	0.721																																					p.T12T													.	RIC8A-514	0			c.G36T						.						19.0	20.0	19.0					11																	208890		2199	4296	6495	SO:0001819	synonymous_variant	60626	exon1			GGAGACGGGTGAG	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.36G>T	11.37:g.208890G>T		39	0		15	4	NM_021932	0	0	2	3	1	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Silent	SNP	ENST00000526104.1	37																																																																																				.		0.721	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
ANO9	338440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	428825	428825	+	Splice_Site	SNP	T	T	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:428825T>C	ENST00000332826.6	-	12	1001	c.917A>G	c.(916-918)gAg>gGg	p.E306G		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	306					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TGCCATTTCCTCCTGGGGAGA	0.602																																					p.E306G		.											.	ANO9-227	0			c.A917G						.						196.0	142.0	160.0					11																	428825		2199	4296	6495	SO:0001630	splice_region_variant	338440	exon12			ATTTCCTCCTGGG	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.916-1A>G	11.37:g.428825T>C		48	0		23	10	NM_001012302	0	0	0	0	0	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	T	15.26	2.782107	0.49891	.	.	ENSG00000185101	ENST00000332826	T	0.68181	-0.31	3.62	3.62	0.41486	.	7.753800	0.01393	N	0.013339	D	0.87317	0.6147	M	0.90922	3.16	0.51233	D	0.99991	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.925	T	0.73173	-0.4066	10	0.72032	D	0.01	.	12.6745	0.56887	0.0:0.0:0.0:1.0	.	7;306	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	G	306	ENSP00000332788:E306G	ENSP00000332788:E306G	E	-	2	0	ANO9	418825	1.000000	0.71417	0.844000	0.33320	0.027000	0.11550	5.539000	0.67199	1.651000	0.50673	0.379000	0.24179	GAG	.		0.602	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	Missense_Mutation
OR5B3	441608	broad.mit.edu	37	11	58170566	58170566	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:58170566G>A	ENST00000309403.2	-	1	316	c.317C>T	c.(316-318)gCc>gTc	p.A106V		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTCCACAGTGGCAAAAGCTAC	0.453																																					p.A106V													.	OR5B3-68	0			c.C317T						.						131.0	121.0	124.0					11																	58170566		2201	4295	6496	SO:0001583	missense	441608	exon1			ACAGTGGCAAAAG	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.317C>T	11.37:g.58170566G>A	ENSP00000308270:p.Ala106Val	97	0		139	4	NM_001005469	0	0	0	0	0	Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	g	6.305	0.424317	0.11928	.	.	ENSG00000172769	ENST00000309403	T	0.01359	4.98	3.96	2.06	0.26882	GPCR, rhodopsin-like superfamily (1);	0.297208	0.24150	N	0.041083	T	0.01353	0.0044	L	0.37561	1.115	0.19575	N	0.999966	B	0.16802	0.019	B	0.14578	0.011	T	0.48328	-0.9045	10	0.17369	T	0.5	-4.7308	8.991	0.36024	0.1887:0.0:0.8113:0.0	.	106	Q8NH48	OR5B3_HUMAN	V	106	ENSP00000308270:A106V	ENSP00000308270:A106V	A	-	2	0	OR5B3	57927142	0.000000	0.05858	0.966000	0.40874	0.267000	0.26476	-0.182000	0.09726	0.453000	0.26858	-0.237000	0.12165	GCC	.		0.453	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469	
MALAT1	378938	ucsc.edu;bcgsc.ca	37	11	65273039	65273039	+	lincRNA	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:65273039C>T	ENST00000534336.1	+	0	7807					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CATCGCCACCCCGTGCCTTTT	0.532																																					.													.	.	0			.						.						178.0	159.0	165.0					11																	65273039		874	1988	2862			378938	.			GCCACCCCGTGCC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273039C>T		150	0		106	45	.	0	0	59	123	64		RNA	SNP	ENST00000534336.1	37																																																																																				.		0.532	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
LARP4	113251	bcgsc.ca	37	12	50869377	50869377	+	Silent	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr12:50869377G>C	ENST00000398473.2	+	16	2017	c.1905G>C	c.(1903-1905)gtG>gtC	p.V635V	LARP4_ENST00000293618.8_Silent_p.V564V|LARP4_ENST00000518444.1_Silent_p.V634V|LARP4_ENST00000347328.5_Silent_p.V564V|LARP4_ENST00000429001.3_Silent_p.V641V	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	635					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						CAGTTCTTGTGCAGCCACTAC	0.453																																					p.V635V													.	LARP4-91	0			c.G1905C						.						159.0	159.0	159.0					12																	50869377		1838	4094	5932	SO:0001819	synonymous_variant	113251	exon16			TCTTGTGCAGCCA	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1905G>C	12.37:g.50869377G>C		353	0		225	34	NM_052879	0	0	3	3	0	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Silent	SNP	ENST00000398473.2	37	CCDS41782.1																																																																																			.		0.453	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
BEST3	144453	bcgsc.ca	37	12	70049556	70049556	+	Missense_Mutation	SNP	A	A	C	rs75364232		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr12:70049556A>C	ENST00000330891.5	-	10	1364	c.1138T>G	c.(1138-1140)Tgg>Ggg	p.W380G	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000488961.1_Missense_Mutation_p.W167G|BEST3_ENST00000553096.1_Missense_Mutation_p.W274G	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	380					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TCATAATCCCACAGCCACTCC	0.552																																					p.W380G													.	BEST3-248	0			c.T1138G						.						85.0	88.0	87.0					12																	70049556		2071	4216	6287	SO:0001583	missense	144453	exon10			AATCCCACAGCCA	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1138T>G	12.37:g.70049556A>C	ENSP00000332413:p.Trp380Gly	160	0		117	19	NM_032735	0	0	1	1	0	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	A	11.73	1.726777	0.30593	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.97941	-4.31;-4.62;-4.59	5.63	5.63	0.86233	.	0.490168	0.21288	N	0.077038	D	0.96482	0.8852	M	0.72118	2.19	0.80722	D	1	P;D	0.57257	0.629;0.979	B;P	0.46940	0.225;0.532	D	0.94362	0.7588	10	0.16896	T	0.51	-10.6053	9.3652	0.38219	0.9188:0.0:0.0812:0.0	.	380;167	Q8N1M1;B5MDI8	BEST3_HUMAN;.	G	167;380;274	ENSP00000433213:W167G;ENSP00000332413:W380G;ENSP00000449548:W274G	ENSP00000332413:W380G	W	-	1	0	BEST3	68335823	0.999000	0.42202	0.999000	0.59377	0.382000	0.30200	4.037000	0.57311	2.130000	0.65690	0.533000	0.62120	TGG	.		0.552	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	
RPL6	6128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	112843158	112843158	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr12:112843158C>T	ENST00000424576.2	-	7	922	c.737G>A	c.(736-738)cGc>cAc	p.R246H	RPL6_ENST00000202773.9_Missense_Mutation_p.R246H	NM_001024662.1	NP_001019833.1	Q02878	RL6_HUMAN	ribosomal protein L6	246					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(6)|lung(3)	10						ATCAATCTTGCGCTGCTCCGT	0.393																																					p.R246H		.											.	RPL6-153	0			c.G737A						.						23.0	25.0	24.0					12																	112843158		2187	4288	6475	SO:0001583	missense	6128	exon7			ATCTTGCGCTGCT	X69391	CCDS9162.1	12q24.13	2014-06-05				ENSG00000089009		"""L ribosomal proteins"""	10362	protein-coding gene	gene with protein product		603703		TXREB1		8479925, 8457378	Standard	XM_005253920		Approved	TAXREB107, L6	uc001ttv.3	Q02878		ENST00000424576.2:c.737G>A	12.37:g.112843158C>T	ENSP00000403172:p.Arg246His	49	0		59	16	NM_001024662	0	1	995	1890	894	Q2M3Q3|Q8WW97	Missense_Mutation	SNP	ENST00000424576.2	37	CCDS9162.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498413	0.64298	.	.	ENSG00000089009	ENST00000202773;ENST00000424576;ENST00000549923	T;T	0.34072	1.38;1.38	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	M	0.66297	2.02	0.80722	D	1	B	0.30439	0.279	B	0.29524	0.103	T	0.40572	-0.9556	10	0.62326	D	0.03	.	16.8348	0.85954	0.0:1.0:0.0:0.0	.	246	Q02878	RL6_HUMAN	H	246;246;186	ENSP00000202773:R246H;ENSP00000403172:R246H	ENSP00000202773:R246H	R	-	2	0	RPL6	111327541	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.919000	0.75793	2.408000	0.81797	0.591000	0.81541	CGC	.		0.393	RPL6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405422.1		
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L													.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		16	0		12	4	NM_080687	0	0	11	13	2	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
DMXL2	23312	broad.mit.edu;bcgsc.ca	37	15	51783908	51783908	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr15:51783908G>A	ENST00000251076.5	-	20	5107	c.4820C>T	c.(4819-4821)tCt>tTt	p.S1607F	DMXL2_ENST00000543779.2_Missense_Mutation_p.S1607F|DMXL2_ENST00000449909.3_Missense_Mutation_p.S971F|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1607						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTCAGCCTCAGAATGAAAAGC	0.388																																					p.S1607F													.	DMXL2-99	0			c.C4820T						.						88.0	95.0	93.0					15																	51783908		2195	4293	6488	SO:0001583	missense	23312	exon20			GCCTCAGAATGAA	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.4820C>T	15.37:g.51783908G>A	ENSP00000251076:p.Ser1607Phe	144	2		121	49	NM_001174116	0	0	0	0	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841196	0.71488	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.68181	-0.31;-0.31;-0.31	5.29	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.85965	0.5820	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.91635	0.999;0.996;0.998	D	0.89690	0.3897	10	0.87932	D	0	.	13.7623	0.62973	0.074:0.0:0.926:0.0	.	1607;971;1607	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	F	1607;1607;971	ENSP00000251076:S1607F;ENSP00000441858:S1607F;ENSP00000400855:S971F	ENSP00000251076:S1607F	S	-	2	0	DMXL2	49571200	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	9.386000	0.97228	1.363000	0.46019	0.655000	0.94253	TCT	.		0.388	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	93567925	93567925	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr15:93567925G>A	ENST00000394196.4	+	39	6545	c.5477G>A	c.(5476-5478)cGg>cAg	p.R1826Q		NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1826					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TGGAATGTTCGGAAAACATAA	0.428																																					p.R1826Q		.											.	CHD2-229	0			c.G5477A						.						50.0	47.0	48.0					15																	93567925		1887	4107	5994	SO:0001583	missense	1106	exon39			ATGTTCGGAAAAC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.5477G>A	15.37:g.93567925G>A	ENSP00000377747:p.Arg1826Gln	59	0		44	4	NM_001271	0	0	12	12	0	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	36	5.643949	0.96704	.	.	ENSG00000173575	ENST00000394196	D	0.92647	-3.08	5.56	5.56	0.83823	.	.	.	.	.	D	0.93485	0.7921	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.94151	0.7405	9	0.72032	D	0.01	-0.1389	19.8965	0.96963	0.0:0.0:1.0:0.0	.	1826	O14647	CHD2_HUMAN	Q	1826	ENSP00000377747:R1826Q	ENSP00000377747:R1826Q	R	+	2	0	CHD2	91368929	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.932000	0.75869	2.771000	0.95319	0.563000	0.77884	CGG	.		0.428	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
SMG1	23049	hgsc.bcm.edu	37	16	18841542	18841542	+	Splice_Site	SNP	T	T	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:18841542T>C	ENST00000446231.2	-	52	9354	c.8942A>G	c.(8941-8943)aAg>aGg	p.K2981R	SMG1_ENST00000389467.3_Splice_Site_p.K2981R			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2981					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CACATTTACCTTTTCAACTAA	0.368																																					p.K2981R		.											.	SMG1-1160	0			c.A8942G						.						59.0	53.0	55.0					16																	18841542		1857	4104	5961	SO:0001630	splice_region_variant	23049	exon52			TTTACCTTTTCAA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8943+1A>G	16.37:g.18841542T>C		34	0		26	2	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961864	0.53400	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01092	5.35;5.35	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000001	T	0.01421	0.0046	N	0.19112	0.55	0.49582	D	0.999805	P	0.51057	0.941	P	0.46917	0.531	T	0.75983	-0.3125	10	0.09338	T	0.73	.	16.3947	0.83586	0.0:0.0:0.0:1.0	.	2981	Q96Q15	SMG1_HUMAN	R	2981	ENSP00000402515:K2981R;ENSP00000374118:K2981R	ENSP00000374118:K2981R	K	-	2	0	SMG1	18749043	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.809000	0.86057	2.272000	0.75746	0.459000	0.35465	AAG	.		0.368	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	Missense_Mutation
NFATC2IP	84901	hgsc.bcm.edu	37	16	28962357	28962357	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:28962357G>A	ENST00000320805.4	+	1	100	c.25G>A	c.(25-27)Ggc>Agc	p.G9S	NFATC2IP_ENST00000564978.1_Intron|NFATC2IP_ENST00000562977.1_3'UTR	NM_032815.3	NP_116204.3	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	9					cytokine production (GO:0001816)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(2)	11						GGGGAAGCGGGGCCGCTGGTC	0.746																																					p.G9S		.											.	NFATC2IP-91	0			c.G25A						.						8.0	8.0	8.0					16																	28962357		2155	4247	6402	SO:0001583	missense	84901	exon1			AAGCGGGGCCGCT	AK074761	CCDS10645.1	16p11.2	2010-09-13			ENSG00000176953	ENSG00000176953			25906	protein-coding gene	gene with protein product		614525				15698469	Standard	NM_032815		Approved	FLJ14639, NIP45, RAD60, ESC2	uc002dru.3	Q8NCF5	OTTHUMG00000097763	ENST00000320805.4:c.25G>A	16.37:g.28962357G>A	ENSP00000324792:p.Gly9Ser	7	0		12	5	NM_032815	0	0	0	1	1	B7Z4G5|Q66K34|Q6NVK1|Q8NFR2|Q96ST9	Missense_Mutation	SNP	ENST00000320805.4	37	CCDS10645.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066553	0.55539	.	.	ENSG00000176953	ENST00000320805	T	0.20738	2.05	3.93	1.75	0.24633	.	0.242826	0.21545	N	0.072825	T	0.33673	0.0871	M	0.63428	1.95	0.18873	N	0.999987	D;D	0.76494	0.999;0.97	D;P	0.66847	0.947;0.665	T	0.03433	-1.1037	10	0.87932	D	0	-12.4241	4.3333	0.11075	0.1322:0.2392:0.6286:0.0	.	9;9	B7Z8Y9;Q8NCF5	.;NF2IP_HUMAN	S	9	ENSP00000324792:G9S	ENSP00000324792:G9S	G	+	1	0	NFATC2IP	28869858	0.073000	0.21202	0.023000	0.16930	0.020000	0.10135	0.970000	0.29383	1.906000	0.55180	0.557000	0.71058	GGC	.		0.746	NFATC2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214999.2	NM_032815	
PLEKHG4	25894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67315014	67315014	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:67315014G>C	ENST00000360461.5	+	4	3275	c.740G>C	c.(739-741)gGa>gCa	p.G247A	PLEKHG4_ENST00000450733.1_Missense_Mutation_p.G166A|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.G247A|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.G247A	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	247							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CAGGCACTGGGACTGACAGTG	0.552																																					p.G247A		.											.	PLEKHG4-92	0			c.G740C						.						138.0	123.0	128.0					16																	67315014		2198	4300	6498	SO:0001583	missense	25894	exon5			CACTGGGACTGAC	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.740G>C	16.37:g.67315014G>C	ENSP00000353646:p.Gly247Ala	155	0		118	62	NM_001129728	0	0	2	2	0	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	37	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	G	34	5.393426	0.96009	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.71	5.71	0.89125	.	0.000000	0.32802	N	0.005631	T	0.66366	0.2782	M	0.88570	2.965	0.35318	D	0.78447	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.78059	-0.2352	10	0.62326	D	0.03	.	15.3559	0.74425	0.0:0.0:1.0:0.0	.	166;54;247	Q58EX7-2;B4E3H4;Q58EX7	.;.;PKHG4_HUMAN	A	247;247;247;166	ENSP00000353646:G247A;ENSP00000401118:G247A;ENSP00000368649:G247A;ENSP00000398030:G166A	ENSP00000353646:G247A	G	+	2	0	PLEKHG4	65872515	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.887000	0.69751	2.688000	0.91661	0.591000	0.81541	GGA	.		0.552	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
CDH3	1001	bcgsc.ca	37	16	68732251	68732251	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:68732251G>C	ENST00000264012.4	+	16	2982	c.2438G>C	c.(2437-2439)gGc>gCc	p.G813A	CDH3_ENST00000429102.2_3'UTR|CDH3_ENST00000581171.1_Missense_Mutation_p.G758A	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	813					adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		AACGAGTGGGGCAGCCGCTTC	0.632																																					p.G813A													.	CDH3-950	2	Unknown(2)	breast(2)	c.G2438C						.						98.0	99.0	99.0					16																	68732251		2198	4300	6498	SO:0001583	missense	1001	exon16			AGTGGGGCAGCCG	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.2438G>C	16.37:g.68732251G>C	ENSP00000264012:p.Gly813Ala	158	0		114	18	NM_001793	0	0	0	0	0	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915546	0.92178	.	.	ENSG00000062038	ENST00000264012;ENST00000542274	D	0.82803	-1.65	5.51	4.53	0.55603	Cadherin, cytoplasmic domain (1);	0.000000	0.42172	D	0.000760	D	0.93890	0.8045	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95601	0.8663	10	0.87932	D	0	.	14.2135	0.65779	0.0:0.1508:0.8492:0.0	.	813	P22223	CADH3_HUMAN	A	813;758	ENSP00000264012:G813A	ENSP00000264012:G813A	G	+	2	0	CDH3	67289752	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.730000	0.98797	1.418000	0.47098	0.655000	0.94253	GGC	.		0.632	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71789972	71789972	+	Silent	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:71789972C>T	ENST00000299980.4	-	12	1620	c.1179G>A	c.(1177-1179)gaG>gaA	p.E393E	AP1G1_ENST00000393512.3_Silent_p.E396E|AP1G1_ENST00000569748.1_Silent_p.E393E|AP1G1_ENST00000433195.2_Silent_p.E416E|AP1G1_ENST00000423132.2_Silent_p.E396E|SNORD71_ENST00000411292.1_RNA	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	393					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TAAATTCTGGCTCACACGAAT	0.378																																					p.E396E		.											.	AP1G1-92	0			c.G1188A						.						90.0	95.0	93.0					16																	71789972		2198	4300	6498	SO:0001819	synonymous_variant	164	exon13			TTCTGGCTCACAC	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.1179G>A	16.37:g.71789972C>T		153	1		140	59	NM_001030007	0	0	1	1	0	O75709|O75842|Q9UG09|Q9Y3U4	Silent	SNP	ENST00000299980.4	37	CCDS32480.1																																																																																			.		0.378	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
ADAMTS18	170692	broad.mit.edu	37	16	77325309	77325309	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr16:77325309C>A	ENST00000282849.5	-	21	3674	c.3256G>T	c.(3256-3258)Gga>Tga	p.G1086*	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1086	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATCAGCTTTCCCTGGAAGCCC	0.507																																					p.G1086X													.	ADAMTS18-1036	0			c.G3256T						.						225.0	228.0	227.0					16																	77325309		2198	4300	6498	SO:0001587	stop_gained	170692	exon21			GCTTTCCCTGGAA	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3256G>T	16.37:g.77325309C>A	ENSP00000282849:p.Gly1086*	353	0		349	6	NM_199355	0	0	0	0	0	Q6P4R5|Q6ZWJ9	Nonsense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	44	10.858122	0.99479	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.0575	0.93072	0.0:1.0:0.0:0.0	.	.	.	.	X	1086	.	ENSP00000282849:G1086X	G	-	1	0	ADAMTS18	75882810	1.000000	0.71417	0.974000	0.42286	0.806000	0.45545	6.818000	0.75257	2.758000	0.94735	0.563000	0.77884	GGA	.		0.507	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
CCL23	6368	broad.mit.edu	37	17	34340315	34340315	+	Silent	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:34340315G>A	ENST00000591423.1	-	4	349	c.285C>T	c.(283-285)gcC>gcT	p.A95A	RP11-104J23.1_ENST00000590192.1_RNA|RP11-104J23.2_ENST00000590149.1_lincRNA|CCL23_ENST00000293280.2_Silent_p.A112A|RP11-104J23.1_ENST00000588294.1_RNA	NM_145898.1	NP_665905.1	P55773	CCL23_HUMAN	chemokine (C-C motif) ligand 23	95					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|negative regulation of C-C chemokine binding (GO:2001264)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			large_intestine(2)|liver(1)|lung(2)|prostate(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CACTGGGGTTGGCACAGAAAC	0.527																																					p.A112A													.	CCL23-90	0			c.C336T						.						84.0	68.0	74.0					17																	34340315		2203	4300	6503	SO:0001819	synonymous_variant	6368	exon4			GGGGTTGGCACAG	U58913	CCDS11305.1, CCDS59282.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000167236	ENSG00000274736		"""Chemokine ligands"", ""Endogenous ligands"""	10622	protein-coding gene	gene with protein product		602494	"""small inducible cytokine subfamily A (Cys-Cys), member 23"""	SCYA23		9104803, 10409433	Standard	XR_429910		Approved	Ckb-8, MPIF-1, MIP-3, CKb8	uc002hks.1	P55773	OTTHUMG00000188409	ENST00000591423.1:c.285C>T	17.37:g.34340315G>A		28	0		68	3	NM_005064	0	0	0	0	0	B7ZKQ3|O00174|O75950|Q52LD4	Silent	SNP	ENST00000591423.1	37	CCDS59282.1																																																																																			.		0.527	CCL23-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450228.1	NM_005064, NM_145898	
CDK12	51755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37627488	37627488	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:37627488T>A	ENST00000447079.4	+	2	1436	c.1403T>A	c.(1402-1404)cTa>cAa	p.L468Q	CDK12_ENST00000430627.2_Missense_Mutation_p.L468Q	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	468					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GTAACACATCTAAACACAGAG	0.383			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.L468Q		.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12-1055	0			c.T1403A						.						98.0	103.0	101.0					17																	37627488		2203	4300	6503	SO:0001583	missense	51755	exon2			CACATCTAAACAC	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1403T>A	17.37:g.37627488T>A	ENSP00000398880:p.Leu468Gln	159	0		187	50	NM_016507	0	0	2	3	1	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939975	0.34283	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.39787	1.06;1.06	5.76	3.58	0.41010	.	0.608641	0.12825	N	0.436065	T	0.22589	0.0545	N	0.14661	0.345	0.21220	N	0.99976	B;B;B	0.16603	0.01;0.01;0.018	B;B;B	0.25291	0.026;0.026;0.059	T	0.18967	-1.0320	10	0.25106	T	0.35	-0.9823	2.5375	0.04717	0.2138:0.3455:0.0:0.4407	.	467;468;468	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	Q	468	ENSP00000407720:L468Q;ENSP00000398880:L468Q	ENSP00000407720:L468Q	L	+	2	0	CDK12	34881014	0.002000	0.14202	1.000000	0.80357	0.998000	0.95712	0.584000	0.23864	1.076000	0.40961	0.528000	0.53228	CTA	.		0.383	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
CDC27	996	hgsc.bcm.edu	37	17	45214661	45214661	+	Silent	SNP	G	G	A	rs111322439		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:45214661G>A	ENST00000066544.3	-	14	1863	c.1770C>T	c.(1768-1770)ttC>ttT	p.F590F	CDC27_ENST00000527547.1_Silent_p.F589F|CDC27_ENST00000446365.2_Silent_p.F529F|CDC27_ENST00000531206.1_Silent_p.F596F	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	590					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAGCTCTCTGGAAGAATTTAA	0.383																																					p.F596F		.											.	CDC27-291	0			c.C1788T						.						58.0	61.0	60.0					17																	45214661		2203	4300	6503	SO:0001819	synonymous_variant	996	exon14			TCTCTGGAAGAAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1770C>T	17.37:g.45214661G>A		81	1		117	9	NM_001114091	0	0	10	10	0	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																			G|0.500;A|0.500		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57754485	57754485	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:57754485A>G	ENST00000269122.3	+	17	3006	c.2732A>G	c.(2731-2733)aAg>aGg	p.K911R	CLTC_ENST00000579815.1_3'UTR|CLTC_ENST00000393043.1_Missense_Mutation_p.K911R|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	911	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TATTGTGAGAAGAGAGATCCA	0.423			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.K911R		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.A2732G						.						118.0	116.0	116.0					17																	57754485		2203	4300	6503	SO:0001583	missense	1213	exon17			GTGAGAAGAGAGA	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2732A>G	17.37:g.57754485A>G	ENSP00000269122:p.Lys911Arg	82	0		127	82	NM_004859	0	0	0	3	3	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	34	5.330051	0.95733	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.23552	1.9;1.9	5.69	5.69	0.88448	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	M	0.85945	2.785	0.80722	D	1	D;B	0.69078	0.997;0.139	D;B	0.83275	0.996;0.394	T	0.60707	-0.7210	10	0.48119	T	0.1	.	15.9483	0.79809	1.0:0.0:0.0:0.0	.	911;911	Q00610;Q00610-2	CLH1_HUMAN;.	R	911	ENSP00000269122:K911R;ENSP00000376763:K911R	ENSP00000269122:K911R	K	+	2	0	CLTC	55109267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.228000	0.95250	2.168000	0.68352	0.455000	0.32223	AAG	.		0.423	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
MRC2	9902	hgsc.bcm.edu	37	17	60767020	60767020	+	Missense_Mutation	SNP	G	G	C	rs376905774		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:60767020G>C	ENST00000303375.5	+	24	3874	c.3472G>C	c.(3472-3474)Gcc>Ccc	p.A1158P	MRC2_ENST00000446119.2_Intron|MRC2_ENST00000580916.1_Intron	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1158	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GAGCCGCAATGCCAGCCTGGC	0.692																																					p.A1158P		.											.	MRC2-117	0			c.G3472C						.						23.0	20.0	21.0					17																	60767020		2200	4300	6500	SO:0001583	missense	9902	exon24			CGCAATGCCAGCC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3472G>C	17.37:g.60767020G>C	ENSP00000307513:p.Ala1158Pro	16	0		25	2	NM_006039	0	0	0	0	0	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059910	0.55325	.	.	ENSG00000011028	ENST00000303375	T	0.26810	1.71	5.1	-5.13	0.02884	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.438461	0.26116	N	0.026252	T	0.30978	0.0782	M	0.76838	2.35	0.43326	D	0.995354	P	0.43633	0.813	P	0.48627	0.584	T	0.32481	-0.9905	10	0.66056	D	0.02	-8.6135	8.0509	0.30577	0.4748:0.0:0.4249:0.1003	.	1158	Q9UBG0	MRC2_HUMAN	P	1158	ENSP00000307513:A1158P	ENSP00000307513:A1158P	A	+	1	0	MRC2	58120752	0.224000	0.23674	0.025000	0.17156	0.378000	0.30076	0.529000	0.23019	-0.836000	0.04229	-0.254000	0.11334	GCC	.		0.692	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
SLC16A6	9120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	66267173	66267173	+	Silent	SNP	A	A	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr17:66267173A>G	ENST00000327268.4	-	6	1292	c.1128T>C	c.(1126-1128)ttT>ttC	p.F376F	ARSG_ENST00000448504.2_Intron|SLC16A6_ENST00000580666.1_Silent_p.F376F	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	376					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	TAGCAAAAGTAAAGGCAAACA	0.443																																					p.F376F		.											.	SLC16A6-90	0			c.T1128C						.						120.0	112.0	115.0					17																	66267173		2203	4300	6503	SO:0001819	synonymous_variant	9120	exon6			AAAAGTAAAGGCA	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.1128T>C	17.37:g.66267173A>G		94	0		130	85	NM_001174166	0	0	2	2	0	Q6P1X3	Silent	SNP	ENST00000327268.4	37	CCDS11675.1																																																																																			.		0.443	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694	
MIR7-3HG	284424	bcgsc.ca	37	19	4770697	4770697	+	lincRNA	SNP	T	T	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr19:4770697T>G	ENST00000586721.1	+	0	509				MIR7-3_ENST00000384898.1_RNA			Q8N6C7	PGSF1_HUMAN	MIR7-3 host gene (non-protein coding)																		AGAGTGGCTGTGGTCTAGTGC	0.532																																					.													.	.	0			.						.						311.0	298.0	302.0					19																	4770697		1568	3582	5150			407045	.			TGGCTGTGGTCTA	AB058892		19p13.3	2014-03-17	2011-09-01	2011-09-01	ENSG00000176840	ENSG00000176840		"""Long non-coding RNAs"""	30049	non-coding RNA	RNA, long non-coding	"""pituitary gland specific factor 1a"", ""pituitary gland specific factor 1b"""		"""chromosome 19 open reading frame 30"", ""non-protein coding RNA 306"", ""long intergenic non-protein coding RNA 306"""	C19orf30, NCRNA00306, LINC00306		11854097	Standard	NR_027148		Approved	PGSF1, PGSF1a, PGSF1b, Huh7, uc002mbe.2	uc010xii.2	Q8N6C7	OTTHUMG00000150589		19.37:g.4770697T>G		289	1		175	21	.	0	0	2	2	0	D6W630|Q17RJ9|Q8N6C6	RNA	SNP	ENST00000586721.1	37																																																																																				.		0.532	MIR7-3HG-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000459345.1	NR_027148	
ZNF763	284390	hgsc.bcm.edu	37	19	12088187	12088187	+	Splice_Site	SNP	G	G	A	rs374392113		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr19:12088187G>A	ENST00000358987.3	+	3	259	c.132G>A	c.(130-132)ggG>ggA	p.G44G	ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000592625.1_Intron|ZNF763_ENST00000590798.1_Splice_Site_p.G64G|ZNF763_ENST00000545530.1_Intron|ZNF763_ENST00000538752.1_Splice_Site_p.G64G|ZNF763_ENST00000343949.5_Splice_Site_p.G47G			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	44	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						GTATTTTAGGGAAAAAGTGGA	0.353																																					p.G47G		.											.	ZNF763-90	0			c.G141A						.	G		0,4406		0,0,2203	86.0	88.0	88.0		141	-1.6	0.0	19		88	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous-near-splice	ZNF763	NM_001012753.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		47/398	12088187	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	284390	exon3			TTTAGGGAAAAAG	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.131-1G>A	19.37:g.12088187G>A		65	0		83	7	NM_001012753	0	0	2	2	0	B3KRU3|B4DRE7	Silent	SNP	ENST00000358987.3	37																																																																																				.		0.353	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	Silent
ROCK2	9475	broad.mit.edu	37	2	11354553	11354553	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:11354553C>T	ENST00000315872.6	-	17	2421	c.1973G>A	c.(1972-1974)gGc>gAc	p.G658D	ROCK2_ENST00000401753.1_Missense_Mutation_p.G415D	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	658	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TAAGATTTTGCCGTTCTTTAA	0.303																																					p.G658D													.	ROCK2-546	0			c.G1973A						.						113.0	103.0	106.0					2																	11354553		1798	4064	5862	SO:0001583	missense	9475	exon17			ATTTTGCCGTTCT	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1973G>A	2.37:g.11354553C>T	ENSP00000317985:p.Gly658Asp	64	0		78	4	NM_004850	0	0	0	0	0	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	37	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405987	0.42715	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.62232	0.04;1.08	4.97	4.97	0.65823	.	0.278030	0.38778	N	0.001565	T	0.53302	0.1788	L	0.36672	1.1	0.39665	D	0.970667	B	0.34103	0.437	B	0.31495	0.131	T	0.55068	-0.8198	10	0.32370	T	0.25	.	18.2526	0.90009	0.0:1.0:0.0:0.0	.	658	O75116	ROCK2_HUMAN	D	658;415;16	ENSP00000317985:G658D;ENSP00000385509:G415D	ENSP00000317985:G658D	G	-	2	0	ROCK2	11272004	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	3.406000	0.52637	2.297000	0.77311	0.650000	0.86243	GGC	.		0.303	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		
ZNF514	84874	bcgsc.ca	37	2	95818976	95818976	+	Missense_Mutation	SNP	A	A	C	rs79400981		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:95818976A>C	ENST00000295208.2	-	3	485	c.23T>G	c.(22-24)gTg>gGg	p.V8G	ZNF514_ENST00000411425.1_Missense_Mutation_p.V8G	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(6)|urinary_tract(1)	11						GCTGAATTCCACAGCCACATC	0.478																																					p.V8G													.	ZNF514-90	0			c.T23G						.						70.0	69.0	69.0					2																	95818976		2203	4300	6503	SO:0001583	missense	84874	exon3			AATTCCACAGCCA	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.23T>G	2.37:g.95818976A>C	ENSP00000295208:p.Val8Gly	101	0		72	10	NM_032788	0	0	13	13	0	Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.522701	0.44866	.	.	ENSG00000144026	ENST00000295208;ENST00000411425;ENST00000447814	T;T;T	0.04758	3.56;3.56;3.56	2.96	1.69	0.24217	Krueppel-associated box (4);	.	.	.	.	T	0.23766	0.0575	H	0.95402	3.665	0.40694	D	0.982426	D	0.71674	0.998	D	0.63113	0.911	T	0.02512	-1.1148	9	0.87932	D	0	.	7.1256	0.25469	0.77:0.23:0.0:0.0	.	8	Q96K75	ZN514_HUMAN	G	8;8;24	ENSP00000295208:V8G;ENSP00000405509:V8G;ENSP00000399647:V24G	ENSP00000295208:V8G	V	-	2	0	ZNF514	95182703	0.990000	0.36364	0.996000	0.52242	0.594000	0.36715	2.815000	0.48018	0.310000	0.22990	0.533000	0.62120	GTG	.		0.478	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788	
PROM2	150696	bcgsc.ca	37	2	95945594	95945594	+	Splice_Site	SNP	T	T	G	rs199504764		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:95945594T>G	ENST00000317620.9	+	11	1409	c.1276T>G	c.(1276-1278)Tgg>Ggg	p.W426G	PROM2_ENST00000403131.2_Splice_Site_p.W426G|PROM2_ENST00000317668.4_Splice_Site_p.W426G|PROM2_ENST00000542147.1_Splice_Site_p.W426G	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	426					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.W426R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CTGTGGCAGGTGGATCGTGGG	0.627																																					p.W426G													.	PROM2-91	1	Substitution - Missense(1)	large_intestine(1)	c.T1276G						.						115.0	91.0	99.0					2																	95945594		2203	4300	6503	SO:0001630	splice_region_variant	150696	exon11			GGCAGGTGGATCG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1275-1T>G	2.37:g.95945594T>G		146	7		93	24	NM_001165977	0	0	0	0	0	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.356610	0.61293	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.02	5.02	0.67125	.	0.000000	0.64402	D	0.000003	T	0.66327	0.2778	M	0.78801	2.425	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.66056	-0.6018	10	0.33141	T	0.24	-13.0314	11.4157	0.49951	0.0:0.0:0.0:1.0	.	426	Q8N271	PROM2_HUMAN	G	426	ENSP00000385716:W426G;ENSP00000318520:W426G;ENSP00000318270:W426G;ENSP00000442542:W426G	ENSP00000318270:W426G	W	+	1	0	PROM2	95309321	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	5.815000	0.69215	2.019000	0.59389	0.533000	0.62120	TGG	T|0.998;G|0.002		0.627	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	Missense_Mutation
BIN1	274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	127828371	127828371	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:127828371T>C	ENST00000316724.5	-	3	598	c.187A>G	c.(187-189)Aag>Gag	p.K63E	BIN1_ENST00000346226.3_Missense_Mutation_p.K63E|BIN1_ENST00000393040.3_Missense_Mutation_p.K63E|BIN1_ENST00000393041.3_Missense_Mutation_p.K63E|BIN1_ENST00000259238.4_Missense_Mutation_p.K63E|BIN1_ENST00000357970.3_Missense_Mutation_p.K63E|BIN1_ENST00000376113.2_Missense_Mutation_p.K63E|BIN1_ENST00000409400.1_Missense_Mutation_p.K63E|BIN1_ENST00000352848.3_Missense_Mutation_p.K63E|BIN1_ENST00000348750.4_Missense_Mutation_p.K63E|BIN1_ENST00000351659.3_Missense_Mutation_p.K63E	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	63	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Interaction with BIN2.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CGGAGATCCTTCTGCAGCCGG	0.647																																					p.K63E		.											.	BIN1-655	0			c.A187G						.						45.0	44.0	44.0					2																	127828371		2203	4300	6503	SO:0001583	missense	274	exon3			GATCCTTCTGCAG	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.187A>G	2.37:g.127828371T>C	ENSP00000316779:p.Lys63Glu	31	0		56	24	NM_139346	0	0	22	54	32	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.331702	0.81690	.	.	ENSG00000136717	ENST00000376113;ENST00000357970;ENST00000393040;ENST00000348750;ENST00000259238;ENST00000346226;ENST00000393041;ENST00000351659;ENST00000352848;ENST00000316724;ENST00000409400	T;T;T;T;T;T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	4.49	3.3	0.37823	BAR (3);	0.101360	0.64402	D	0.000002	T	0.71558	0.3354	M	0.66939	2.045	0.54753	D	0.999988	P;D;P;P;P;P;P;P;B;P;P;B;P	0.60575	0.947;0.988;0.457;0.942;0.606;0.952;0.938;0.884;0.432;0.837;0.941;0.047;0.929	P;D;B;P;B;P;P;B;B;B;B;B;P	0.65010	0.879;0.931;0.286;0.528;0.286;0.611;0.804;0.346;0.177;0.287;0.357;0.017;0.794	T	0.73697	-0.3901	10	0.87932	D	0	-23.223	8.0196	0.30402	0.0:0.0991:0.0:0.9009	.	63;39;63;63;63;63;63;63;63;63;63;63;63	B7Z2Z2;B7Z6Y2;O00499-4;O00499-7;O00499-6;O00499-2;O00499-3;O00499-8;O00499-11;O00499-5;O00499-10;O00499-9;O00499	.;.;.;.;.;.;.;.;.;.;.;.;BIN1_HUMAN	E	63	ENSP00000365281:K63E;ENSP00000350654:K63E;ENSP00000376760:K63E;ENSP00000259237:K63E;ENSP00000259238:K63E;ENSP00000315411:K63E;ENSP00000376761:K63E;ENSP00000315388:K63E;ENSP00000315284:K63E;ENSP00000316779:K63E;ENSP00000386797:K63E	ENSP00000259238:K63E	K	-	1	0	BIN1	127544841	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.533000	0.60615	1.884000	0.54569	0.459000	0.35465	AAG	.		0.647	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
RAB6C	84084	hgsc.bcm.edu	37	2	130738210	130738210	+	Silent	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:130738210G>A	ENST00000410061.2	+	1	976	c.522G>A	c.(520-522)ttG>ttA	p.L174L	AC079776.7_ENST00000412425.1_RNA	NM_032144.2	NP_115520.2	Q9H0N0	RAB6C_HUMAN	RAB6C, member RAS oncogene family	174	Required for centrosome localization.				cell cycle process (GO:0022402)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of centrosome duplication (GO:0010824)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	5	Colorectal(110;0.1)					CAGCAGCTTTGCCGGGAATGG	0.478																																					p.L174L		.											.	RAB6C-251	0			c.G522A						.						63.0	57.0	59.0					2																	130738210		2201	4279	6480	SO:0001819	synonymous_variant	84084	exon1			AGCTTTGCCGGGA	AF124200	CCDS46408.1	2q21.1	2012-07-02			ENSG00000222014	ENSG00000222014		"""RAB, member RAS oncogene"""	16525	protein-coding gene	gene with protein product		612909				11054569, 17426708	Standard	NM_032144		Approved	WTH3	uc002tpx.1	Q9H0N0	OTTHUMG00000153487	ENST00000410061.2:c.522G>A	2.37:g.130738210G>A		206	0		221	62	NM_032144	0	0	8	8	0	Q53RU3|Q6FIF7|Q9P128	Silent	SNP	ENST00000410061.2	37	CCDS46408.1																																																																																			.		0.478	RAB6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331384.1	NM_032144	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152512859	152512859	+	Silent	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:152512859C>T	ENST00000172853.10	-	49	6450	c.6303G>A	c.(6301-6303)gaG>gaA	p.E2101E	NEB_ENST00000604864.1_Silent_p.E2101E|NEB_ENST00000409198.1_Silent_p.E2101E|NEB_ENST00000427231.2_Silent_p.E2101E|NEB_ENST00000603639.1_Silent_p.E2101E|NEB_ENST00000397345.3_Silent_p.E2101E			P20929	NEBU_HUMAN	nebulin	2101					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTTCTTGTACTCCCGATCAG	0.483																																					p.E2101E		.											.	NEB-145	0			c.G6303A						.						239.0	236.0	237.0					2																	152512859		2046	4199	6245	SO:0001819	synonymous_variant	4703	exon49			CTTGTACTCCCGA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6303G>A	2.37:g.152512859C>T		191	0		155	66	NM_004543	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SCN3A	6328	bcgsc.ca	37	2	166012356	166012356	+	Nonsense_Mutation	SNP	G	G	T	rs202083628		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:166012356G>T	ENST00000360093.3	-	10	1580	c.1089C>A	c.(1087-1089)taC>taA	p.Y363*	SCN3A_ENST00000409101.3_Nonsense_Mutation_p.Y363*|SCN3A_ENST00000283254.7_Nonsense_Mutation_p.Y363*	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	363					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAAAGCTTGTGTAGCCATAGT	0.443																																					p.Y363X													.	SCN3A-141	0			c.C1089A						.						126.0	121.0	123.0					2																	166012356		2203	4300	6503	SO:0001587	stop_gained	6328	exon10			GCTTGTGTAGCCA	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1089C>A	2.37:g.166012356G>T	ENSP00000353206:p.Tyr363*	155	0		85	11	NM_001081676	0	0	1	1	0	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Nonsense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	G	42	9.547340	0.99201	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	.	.	.	5.41	1.6	0.23607	.	0.000000	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0847	0.42410	0.2746:0.0:0.7254:0.0	.	.	.	.	X	363	.	ENSP00000283254:Y363X	Y	-	3	2	SCN3A	165720602	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	2.871000	0.48459	0.020000	0.15106	-0.237000	0.12165	TAC	.		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SCN9A	6335	bcgsc.ca	37	2	167060900	167060900	+	Silent	SNP	C	C	T	rs201748099		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:167060900C>T	ENST00000409435.1	-	24	4472	c.4473G>A	c.(4471-4473)aaG>aaA	p.K1491K	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.K1492K|SCN9A_ENST00000409672.1_Silent_p.K1480K|SCN9A_ENST00000375387.4_Silent_p.K1492K			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1491					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTGTGGCTTCTTGGACCCCA	0.308																																					p.K1480K													.	SCN9A-181	0			c.G4440A						.						76.0	84.0	81.0					2																	167060900		2155	4289	6444	SO:0001819	synonymous_variant	6335	exon25			TGGCTTCTTGGAC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4473G>A	2.37:g.167060900C>T		111	1		61	15	NM_002977	0	0	0	0	0	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	CCDS46441.1																																																																																			.		0.308	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
ABCB11	8647	bcgsc.ca	37	2	169847341	169847341	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:169847341G>C	ENST00000263817.6	-	9	1002	c.878C>G	c.(877-879)gCt>gGt	p.A293G		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	293	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACCACCAAAAGCAGCCACTGT	0.423																																					p.A293G													.	ABCB11-139	0			c.C878G						.						205.0	209.0	207.0					2																	169847341		1903	4125	6028	SO:0001583	missense	8647	exon9			CCAAAAGCAGCCA	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.878C>G	2.37:g.169847341G>C	ENSP00000263817:p.Ala293Gly	411	1		279	26	NM_003742	0	0	0	0	0	Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267379	0.80469	.	.	ENSG00000073734	ENST00000263817	D	0.92048	-2.96	5.53	5.53	0.82687	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94584	0.8255	M	0.87758	2.905	0.80722	D	1	B	0.28350	0.208	B	0.37508	0.252	D	0.93403	0.6762	10	0.66056	D	0.02	-2.4159	19.8195	0.96586	0.0:0.0:1.0:0.0	.	293	O95342	ABCBB_HUMAN	G	293	ENSP00000263817:A293G	ENSP00000263817:A293G	A	-	2	0	ABCB11	169555587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.779000	0.99018	2.756000	0.94617	0.655000	0.94253	GCT	.		0.423	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179433843	179433843	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:179433843G>C	ENST00000591111.1	-	276	72317	c.72093C>G	c.(72091-72093)taC>taG	p.Y24031*	TTN_ENST00000460472.2_Nonsense_Mutation_p.Y16607*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y25672*|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y23104*|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y16799*|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y16732*|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24031	Fibronectin type-III 74. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACTCTAAAGTAATAACTGC	0.418																																					p.Y25672X		.											.	TTN-636	0			c.C77016G						.						171.0	169.0	170.0					2																	179433843		1958	4136	6094	SO:0001587	stop_gained	7273	exon326			TCTAAAGTAATAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72093C>G	2.37:g.179433843G>C	ENSP00000465570:p.Tyr24031*	200	0		231	99	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	63	76.472557	0.99993	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.5208	0.61566	0.071:0.0:0.929:0.0	.	.	.	.	X	23104;16607;16799;16732;16605	.	ENSP00000340554:Y16799X	Y	-	3	2	TTN	179142089	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.714000	0.68422	2.803000	0.96430	0.650000	0.86243	TAC	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL6A3	1293	bcgsc.ca	37	2	238253123	238253123	+	Missense_Mutation	SNP	A	A	C	rs199609978	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:238253123A>C	ENST00000295550.4	-	36	7990	c.7538T>G	c.(7537-7539)gTt>gGt	p.V2513G	COL6A3_ENST00000409809.1_Missense_Mutation_p.V2307G|COL6A3_ENST00000347401.3_Missense_Mutation_p.V2312G|COL6A3_ENST00000472056.1_Missense_Mutation_p.V1906G|COL6A3_ENST00000346358.4_Missense_Mutation_p.V2313G|COL6A3_ENST00000353578.4_Missense_Mutation_p.V2307G	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2513	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCTGAAGAAAACAGCCACTTT	0.522													A|||	144	0.028754	0.0204	0.0562	5008	,	,		21429	0.0357		0.0417	False		,,,				2504	0.0				p.V2513G													.	COL6A3-526	0			c.T7538G						.						154.0	150.0	151.0					2																	238253123		2203	4300	6503	SO:0001583	missense	1293	exon36			AAGAAAACAGCCA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7538T>G	2.37:g.238253123A>C	ENSP00000295550:p.Val2513Gly	205	0		210	29	NM_004369	0	0	4	4	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	A	9.634	1.137131	0.21123	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13;-2.13	4.87	4.87	0.63330	von Willebrand factor, type A (3);	0.614043	0.14162	N	0.337275	D	0.93138	0.7815	M	0.74647	2.275	0.58432	D	0.999998	D;D;D;D	0.89917	0.971;0.971;0.963;1.0	P;P;P;D	0.87578	0.845;0.845;0.76;0.998	D	0.93000	0.6422	10	0.87932	D	0	.	14.8002	0.69909	1.0:0.0:0.0:0.0	.	1906;1906;2307;2513	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	G	2513;2312;2307;1906;2307;2313	ENSP00000295550:V2513G;ENSP00000315609:V2312G;ENSP00000315873:V2307G;ENSP00000418285:V1906G;ENSP00000386844:V2307G;ENSP00000295546:V2313G	ENSP00000295550:V2513G	V	-	2	0	COL6A3	237917862	0.972000	0.33761	0.029000	0.17559	0.409000	0.31022	9.118000	0.94355	1.942000	0.56320	0.533000	0.62120	GTT	.		0.522	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CDS2	8760	bcgsc.ca	37	20	5157344	5157344	+	Nonsense_Mutation	SNP	C	C	A	rs554837402	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr20:5157344C>A	ENST00000460006.1	+	4	649	c.342C>A	c.(340-342)taC>taA	p.Y114*	CDS2_ENST00000379070.3_3'UTR|CDS2_ENST00000535100.1_5'Flank|CDS2_ENST00000379062.4_Intron	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	114					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						CTATTGGCTACAACGTCTACC	0.458													C|||	240	0.0479233	0.034	0.0764	5008	,	,		18742	0.0665		0.0746	False		,,,				2504	0.0				p.Y114X													.	CDS2-226	0			c.C342A						.						222.0	207.0	212.0					20																	5157344		2203	4300	6503	SO:0001587	stop_gained	8760	exon4			TGGCTACAACGTC	AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.342C>A	20.37:g.5157344C>A	ENSP00000419879:p.Tyr114*	303	0		252	21	NM_003818	0	0	4	4	0	B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Nonsense_Mutation	SNP	ENST00000460006.1	37	CCDS13088.1	.	.	.	.	.	.	.	.	.	.	C	39	7.690869	0.98434	.	.	ENSG00000101290	ENST00000460006;ENST00000450570	.	.	.	4.72	1.76	0.24704	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.0661	7.5322	0.27689	0.0:0.6576:0.0:0.3424	.	.	.	.	X	114;59	.	ENSP00000403205:Y59X	Y	+	3	2	CDS2	5105344	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.219000	0.32479	0.712000	0.32039	0.561000	0.74099	TAC	.		0.458	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077858.2		
ZHX3	23051	ucsc.edu	37	20	39832697	39832697	+	Missense_Mutation	SNP	T	T	G	rs200146666		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr20:39832697T>G	ENST00000309060.3	-	4	1275	c.860A>C	c.(859-861)cAc>cCc	p.H287P	ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000540170.1_Missense_Mutation_p.H287P|ZHX3_ENST00000432768.2_Missense_Mutation_p.H287P|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.H287P|ZHX3_ENST00000559234.1_Missense_Mutation_p.H287P|ZHX3_ENST00000544979.2_Missense_Mutation_p.H287P			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	287	Required for homodimerization and interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CAGTGGCTGGTGGACATGGTG	0.582																																					p.H287P													.	ZHX3-93	0			c.A860C						.						77.0	66.0	70.0					20																	39832697		2203	4300	6503	SO:0001583	missense	23051	exon3			GGCTGGTGGACAT	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.860A>C	20.37:g.39832697T>G	ENSP00000312222:p.His287Pro	81	5		116	12	NM_015035	0	0	4	4	0	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.785356	0.31593	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768	T;T;T;T;T	0.29917	1.55;2.97;2.97;2.75;1.55	5.95	5.95	0.96441	.	0.675209	0.16477	N	0.212703	T	0.32526	0.0832	L	0.57536	1.79	0.43947	D	0.996617	B;B;P	0.47106	0.002;0.002;0.89	B;B;B	0.40506	0.003;0.003;0.331	T	0.07214	-1.0784	10	0.31617	T	0.26	-16.5459	14.3566	0.66742	0.0:0.0:0.0:1.0	.	287;287;287	A8K8Q0;Q9H4I2;F5H820	.;ZHX3_HUMAN;.	P	287;287;287;287;65;287	ENSP00000312222:H287P;ENSP00000362360:H287P;ENSP00000442290:H287P;ENSP00000443783:H287P;ENSP00000415498:H287P	ENSP00000312222:H287P	H	-	2	0	ZHX3	39266111	0.999000	0.42202	1.000000	0.80357	0.465000	0.32709	0.856000	0.27818	2.277000	0.76020	0.533000	0.62120	CAC	T|0.999;G|0.001		0.582	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
LSM14B	149986	hgsc.bcm.edu	37	20	60697753	60697753	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr20:60697753G>C	ENST00000279068.6	+	1	191	c.31G>C	c.(31-33)Ggc>Cgc	p.G11R	LSM14B_ENST00000253001.4_Missense_Mutation_p.G11R|LSM14B_ENST00000370915.1_Missense_Mutation_p.G11R	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	11					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CCCGTATCTGGGCAGCAAGAT	0.706																																					p.G11R		.											.	LSM14B-22	0			c.G31C						.						37.0	36.0	36.0					20																	60697753		2202	4300	6502	SO:0001583	missense	149986	exon1			TATCTGGGCAGCA	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.31G>C	20.37:g.60697753G>C	ENSP00000279068:p.Gly11Arg	53	0		38	2	NM_144703	0	0	0	0	0	Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	37	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765540	0.90020	.	.	ENSG00000149657	ENST00000370915;ENST00000279068;ENST00000253001;ENST00000400318;ENST00000279069	T;T;T	0.78126	-0.98;-1.15;-1.01	3.03	3.03	0.35002	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	U	0.000000	D	0.90232	0.6946	H	0.94620	3.56	0.80722	D	1	P;D;D	0.76494	0.946;0.997;0.999	P;D;D	0.80764	0.866;0.939;0.994	D	0.92606	0.6095	10	0.87932	D	0	.	13.1281	0.59366	0.0:0.0:1.0:0.0	.	11;11;11	Q9BX40;Q5TBQ0;Q9BX40-2	LS14B_HUMAN;.;.	R	11	ENSP00000279068:G11R;ENSP00000253001:G11R;ENSP00000383172:G11R	ENSP00000253001:G11R	G	+	1	0	LSM14B	60131148	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.991000	0.88244	1.396000	0.46663	0.305000	0.20034	GGC	.		0.706	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	NM_144703	
ZGPAT	84619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62340218	62340218	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr20:62340218G>A	ENST00000328969.5	+	2	413	c.286G>A	c.(286-288)Gcc>Acc	p.A96T	ZGPAT_ENST00000355969.6_Missense_Mutation_p.A96T|ARFRP1_ENST00000609142.1_5'Flank|RP4-583P15.15_ENST00000490623.2_Silent_p.R1R|ZGPAT_ENST00000357119.4_Missense_Mutation_p.A96T|ARFRP1_ENST00000324228.2_5'Flank|ARFRP1_ENST00000359715.5_5'Flank|ARFRP1_ENST00000440854.1_5'Flank|ZGPAT_ENST00000369967.3_Missense_Mutation_p.A96T|ZGPAT_ENST00000448100.2_Missense_Mutation_p.A96T|ARFRP1_ENST00000607873.1_5'Flank	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	96					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					ACCAGCAGCGGCCCGTGGGTC	0.667																																					p.A96T		.											.	ZGPAT-90	0			c.G286A						.						36.0	43.0	41.0					20																	62340218		2201	4298	6499	SO:0001583	missense	84619	exon2			GCAGCGGCCCGTG	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.286G>A	20.37:g.62340218G>A	ENSP00000332013:p.Ala96Thr	135	1		122	72	NM_032527	0	0	7	25	18	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.560698	0.00136	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000431125;ENST00000369967;ENST00000328969	T;T;T;T;T;T	0.45276	1.14;1.14;1.14;0.9;1.14;1.14	0.536	-1.07	0.09968	.	2.240520	0.02968	U	0.144041	T	0.26810	0.0656	L	0.31664	0.95	0.09310	N	1	B;B;B	0.20887	0.049;0.001;0.034	B;B;B	0.24394	0.031;0.006;0.053	T	0.04946	-1.0916	9	0.15952	T	0.53	-0.5515	.	.	.	.	96;96;96	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	T	96	ENSP00000391176:A96T;ENSP00000348242:A96T;ENSP00000349634:A96T;ENSP00000403966:A96T;ENSP00000358984:A96T;ENSP00000332013:A96T	ENSP00000332013:A96T	A	+	1	0	ZGPAT	61810662	0.007000	0.16637	0.000000	0.03702	0.011000	0.07611	0.930000	0.28858	-1.719000	0.01382	-1.048000	0.02349	GCC	.		0.667	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
FBXO7	25793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	32889131	32889131	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr22:32889131C>A	ENST00000266087.7	+	7	1334	c.1007C>A	c.(1006-1008)cCa>cAa	p.P336Q	FBXO7_ENST00000397426.1_Missense_Mutation_p.P222Q|FBXO7_ENST00000382058.3_Missense_Mutation_p.P257Q	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	336	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTCGTCCTCCCATTGGAACTG	0.438																																					p.P336Q		.											.	FBXO7-228	0			c.C1007A						.						371.0	310.0	330.0					22																	32889131		2203	4300	6503	SO:0001583	missense	25793	exon7			TCCTCCCATTGGA	AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.1007C>A	22.37:g.32889131C>A	ENSP00000266087:p.Pro336Gln	270	1		278	111	NM_012179	0	0	30	55	25	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	ENST00000266087.7	37	CCDS13907.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192232	0.78902	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	D;D;D	0.99709	-6.48;-6.48;-6.48	6.08	6.08	0.98989	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	M	0.91459	3.21	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;1.0	D	0.97617	1.0133	10	0.87932	D	0	-17.0815	20.6634	0.99662	0.0:1.0:0.0:0.0	.	336;257;336	A8K7F7;Q9Y3I1-2;Q9Y3I1	.;.;FBX7_HUMAN	Q	336;257;222	ENSP00000266087:P336Q;ENSP00000371490:P257Q;ENSP00000380571:P222Q	ENSP00000266087:P336Q	P	+	2	0	FBXO7	31219131	1.000000	0.71417	0.815000	0.32552	0.630000	0.37929	5.980000	0.70516	2.894000	0.99253	0.655000	0.94253	CCA	.		0.438	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1		
RBM6	10180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50005960	50005960	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr3:50005960G>T	ENST00000266022.4	+	3	1361	c.1102G>T	c.(1102-1104)Gat>Tat	p.D368Y	RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.D236Y	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	368					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TCAAGACCAAGATAAGTCACA	0.463																																					p.D368Y		.											.	RBM6-280	0			c.G1102T						.						80.0	76.0	78.0					3																	50005960		2203	4300	6503	SO:0001583	missense	10180	exon3			GACCAAGATAAGT	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1102G>T	3.37:g.50005960G>T	ENSP00000266022:p.Asp368Tyr	72	0		96	43	NM_005777	0	0	15	28	13	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043431	0.36085	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.36878	1.23;1.25	5.85	3.97	0.46021	.	0.614854	0.16479	N	0.212625	T	0.29389	0.0732	N	0.24115	0.695	0.80722	D	1	D	0.59767	0.986	P	0.49752	0.621	T	0.01988	-1.1234	9	.	.	.	-4.7397	7.5857	0.27991	0.1421:0.1365:0.7214:0.0	.	368	P78332	RBM6_HUMAN	Y	368;236	ENSP00000266022:D368Y;ENSP00000396466:D236Y	.	D	+	1	0	RBM6	49980964	1.000000	0.71417	0.999000	0.59377	0.735000	0.41995	2.640000	0.46579	1.495000	0.48549	0.491000	0.48974	GAT	.		0.463	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
DGKQ	1609	hgsc.bcm.edu	37	4	954919	954919	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr4:954919A>G	ENST00000273814.3	-	22	2718	c.2645T>C	c.(2644-2646)cTc>cCc	p.L882P	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	882					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTGGCCTTGAGGAGCGTGAC	0.692																																					p.L882P	Esophageal Squamous(17;537 645 4447 26373)	.											.	DGKQ-537	0			c.T2645C						.						36.0	43.0	40.0					4																	954919		2199	4298	6497	SO:0001583	missense	1609	exon22			GCCTTGAGGAGCG	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2645T>C	4.37:g.954919A>G	ENSP00000273814:p.Leu882Pro	56	0		34	2	NM_001347	0	0	12	12	0	Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	37	CCDS3342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.07|10.07	1.249271|1.249271	0.22880|0.22880	.|.	.|.	ENSG00000145214|ENSG00000145214	ENST00000273814;ENST00000515182|ENST00000509465	T;T|.	0.29397|.	1.57;1.57|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Diacylglycerol kinase, accessory domain (2);|.	0.222361|.	0.45867|.	D|.	0.000338|.	T|T	0.56717|0.56717	0.2004|0.2004	L|L	0.36672|0.36672	1.1|1.1	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.71184|.	0.959;0.972|.	T|T	0.53961|0.53961	-0.8364|-0.8364	10|5	0.36615|.	T|.	0.2|.	.|.	13.4405|13.4405	0.61109|0.61109	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	882;882|.	E9KL49;P52824|.	.;DGKQ_HUMAN|.	P|P	882;97|816	ENSP00000273814:L882P;ENSP00000421756:L97P|.	ENSP00000273814:L882P|.	L|S	-|-	2|1	0|0	DGKQ|DGKQ	944919|944919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.194000|0.194000	0.23727|0.23727	2.949000|2.949000	0.49074|0.49074	2.069000|2.069000	0.61940|0.61940	0.454000|0.454000	0.30748|0.30748	CTC|TCA	.		0.692	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		
WHSC1	7468	bcgsc.ca	37	4	1957868	1957868	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr4:1957868G>C	ENST00000382895.3	+	17	3265	c.2834G>C	c.(2833-2835)gGc>gCc	p.G945A	WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382888.3_Missense_Mutation_p.G293A|WHSC1_ENST00000382891.5_Missense_Mutation_p.G945A|WHSC1_ENST00000508803.1_Missense_Mutation_p.G945A|WHSC1_ENST00000382892.2_Missense_Mutation_p.G945A	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	945					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GGGGACCGGGGCAGCCGCTAC	0.507			T	IGH@	MM																																p.G945A				Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1-664	0			c.G2834C						.						72.0	89.0	83.0					4																	1957868		2202	4300	6502	SO:0001583	missense	7468	exon15			ACCGGGGCAGCCG	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2834G>C	4.37:g.1957868G>C	ENSP00000372351:p.Gly945Ala	258	2		216	33	NM_133335	0	0	9	9	0	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	34	5.349492	0.95830	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.54	5.54	0.83059	.	0.000000	0.56097	D	0.000025	T	0.76357	0.3976	L	0.46157	1.445	0.80722	D	1	B;D	0.63880	0.389;0.993	B;P	0.61070	0.411;0.883	T	0.77330	-0.2628	10	0.62326	D	0.03	.	19.4951	0.95069	0.0:0.0:1.0:0.0	.	293;945	A2A2T2;O96028	.;NSD2_HUMAN	A	945;945;945;945;293	ENSP00000423972:G945A;ENSP00000372347:G945A;ENSP00000372348:G945A;ENSP00000372351:G945A;ENSP00000372344:G293A	ENSP00000372344:G293A	G	+	2	0	WHSC1	1927666	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.661000	0.98601	2.609000	0.88269	0.655000	0.94253	GGC	.		0.507	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
RBPJ	3516	hgsc.bcm.edu	37	4	26426305	26426305	+	Silent	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr4:26426305C>T	ENST00000361572.6	+	7	920	c.726C>T	c.(724-726)atC>atT	p.I242I	RBPJ_ENST00000348160.4_Silent_p.I229I|RBPJ_ENST00000507561.1_Silent_p.I207I|RBPJ_ENST00000355476.3_Silent_p.I228I|RBPJ_ENST00000504907.1_Silent_p.I228I|RBPJ_ENST00000345843.3_Silent_p.I227I|RBPJ_ENST00000342320.4_Silent_p.I228I|RBPJ_ENST00000342295.1_Silent_p.I242I			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	242					angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				ATGGCTACATCCATTATGGAC	0.373																																					p.I242I		.											.	RBPJ-659	0			c.C726T						.						94.0	89.0	91.0					4																	26426305		2203	4300	6503	SO:0001819	synonymous_variant	3516	exon8			CTACATCCATTAT	L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.726C>T	4.37:g.26426305C>T		99	0		45	3	NM_005349	0	0	6	6	0	B4DY22|Q5XKH9|Q6P1N3	Silent	SNP	ENST00000361572.6	37	CCDS3437.1																																																																																			.		0.373	RBPJ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215046.2	NM_015874	
GATB	5188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	152592364	152592364	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr4:152592364T>C	ENST00000515812.1	-	12	1529	c.1513A>G	c.(1513-1515)Atg>Gtg	p.M505V	RP11-164P12.4_ENST00000508664.1_RNA|PET112_ENST00000263985.6_Missense_Mutation_p.M546V|PET112_ENST00000507592.1_5'UTR																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						TCCTTTATCATGACTGGATCT	0.483																																					p.M546V		.											.	PET112-90	0			c.A1636G						.						178.0	163.0	168.0					4																	152592364		2203	4300	6503	SO:0001583	missense	5188	exon13			TTATCATGACTGG																												ENST00000515812.1:c.1513A>G	4.37:g.152592364T>C	ENSP00000426859:p.Met505Val	156	0		187	88	NM_004564	0	0	46	82	36		Missense_Mutation	SNP	ENST00000515812.1	37		.	.	.	.	.	.	.	.	.	.	T	0.061	-1.224008	0.01530	.	.	ENSG00000059691	ENST00000263985;ENST00000515812	T;T	0.39592	1.07;1.08	5.8	-5.06	0.02946	Asn/Gln amidotransferase (2);	0.986159	0.08279	N	0.970181	T	0.13286	0.0322	N	0.02181	-0.65	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39961	-0.9588	10	0.06365	T	0.9	0.2792	10.1442	0.42753	0.0:0.1381:0.5532:0.3086	.	546	O75879	GATB_HUMAN	V	546;505	ENSP00000263985:M546V;ENSP00000426859:M505V	ENSP00000263985:M546V	M	-	1	0	PET112	152811814	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.347000	0.07750	-0.814000	0.04352	-0.904000	0.02843	ATG	.		0.483	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365672.1		
SPEF2	79925	bcgsc.ca	37	5	35670228	35670228	+	Missense_Mutation	SNP	C	C	A	rs77343152		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr5:35670228C>A	ENST00000356031.3	+	10	1577	c.1423C>A	c.(1423-1425)Caa>Aaa	p.Q475K	SPEF2_ENST00000509059.1_Missense_Mutation_p.Q475K|SPEF2_ENST00000440995.2_Missense_Mutation_p.Q475K|SPEF2_ENST00000282469.6_Missense_Mutation_p.Q475K	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	475					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATATATGAACAAGCCTCTGT	0.358																																					p.Q475K													.	SPEF2-26	0			c.C1423A						.						129.0	136.0	134.0					5																	35670228		2203	4299	6502	SO:0001583	missense	79925	exon10			TATGAACAAGCCT	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1423C>A	5.37:g.35670228C>A	ENSP00000348314:p.Gln475Lys	194	0		200	29	NM_024867	0	0	4	4	0	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481659	0.26598	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000440995	T;T;T;T	0.15718	2.4;2.4;2.4;2.4	5.1	3.15	0.36227	.	0.549745	0.19197	N	0.120271	T	0.10680	0.0261	L	0.34521	1.04	0.80722	D	1	P;B;B	0.38922	0.651;0.068;0.041	B;B;B	0.30943	0.122;0.014;0.011	T	0.11299	-1.0593	10	0.10111	T	0.7	.	14.19	0.65633	0.4519:0.5481:0.0:0.0	.	475;475;475	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	K	475	ENSP00000282469:Q475K;ENSP00000348314:Q475K;ENSP00000421593:Q475K;ENSP00000412125:Q475K	ENSP00000282469:Q475K	Q	+	1	0	SPEF2	35705985	0.985000	0.35326	0.987000	0.45799	0.783000	0.44284	1.542000	0.36137	1.221000	0.43506	0.655000	0.94253	CAA	.		0.358	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
LOX	4015	bcgsc.ca	37	5	121409741	121409741	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr5:121409741G>T	ENST00000231004.4	-	4	1301	c.1002C>A	c.(1000-1002)taC>taA	p.Y334*	LOX_ENST00000513319.1_5'UTR|SRFBP1_ENST00000504881.1_Intron	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	334	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		ATCGCCTGTGGTAGCCATAGT	0.493																																					p.Y334X													.	LOX-650	0			c.C1002A						.						200.0	185.0	190.0					5																	121409741		2203	4300	6503	SO:0001587	stop_gained	4015	exon4			CCTGTGGTAGCCA		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.1002C>A	5.37:g.121409741G>T	ENSP00000231004:p.Tyr334*	329	0		226	20	NM_002317	0	0	2	2	0	B2R5Q3|Q5FWF0	Nonsense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	G	40	7.966282	0.98585	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	.	.	.	5.98	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1432	0.36917	0.2615:0.0:0.7385:0.0	.	.	.	.	X	334;294	.	ENSP00000231004:Y334X	Y	-	3	2	LOX	121437640	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.769000	0.47654	1.540000	0.49301	0.650000	0.86243	TAC	.		0.493	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
F12	2161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176831341	176831341	+	Silent	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr5:176831341G>A	ENST00000253496.3	-	9	922	c.874C>T	c.(874-876)Ctg>Ttg	p.L292L	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	292	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CACTGTGCCAGGTCGCAGTAC	0.692									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L292L		.											.	F12-90	0			c.C874T						.						17.0	21.0	19.0					5																	176831341		2201	4296	6497	SO:0001819	synonymous_variant	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	GTGCCAGGTCGCA	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.874C>T	5.37:g.176831341G>A		50	0	1934	35	15	NM_000505	0	0	0	0	0	P78339	Silent	SNP	ENST00000253496.3	37	CCDS34302.1																																																																																			.		0.692	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
FAM65B	9750	bcgsc.ca	37	6	24850081	24850081	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:24850081A>C	ENST00000259698.4	-	11	1071	c.896T>G	c.(895-897)gTc>gGc	p.V299G	FAM65B_ENST00000540914.1_Missense_Mutation_p.V299G|FAM65B_ENST00000538035.1_Missense_Mutation_p.V328G|FAM65B_ENST00000378023.4_Missense_Mutation_p.V299G|FAM65B_ENST00000510784.2_Missense_Mutation_p.V333G	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	299					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						ATTGATGTCGACAGCCACTAC	0.483																																					p.V299G													.	FAM65B-91	0			c.T896G						.						196.0	204.0	201.0					6																	24850081		2129	4274	6403	SO:0001583	missense	9750	exon11			ATGTCGACAGCCA	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.896T>G	6.37:g.24850081A>C	ENSP00000259698:p.Val299Gly	297	1		238	44	NM_015864	0	0	2	2	0	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.749840	0.89753	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02631	4.22;4.22;4.22;4.22;4.22	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.00641	-1.1631	10	0.87932	D	0	-25.9828	16.0546	0.80788	1.0:0.0:0.0:0.0	.	333;328;299;299	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	G	299;328;299;299;333	ENSP00000259698:V299G;ENSP00000441138:V328G;ENSP00000367262:V299G;ENSP00000438425:V299G;ENSP00000441305:V333G	ENSP00000259698:V299G	V	-	2	0	FAM65B	24958060	1.000000	0.71417	0.484000	0.27391	0.997000	0.91878	8.962000	0.93254	2.191000	0.70037	0.528000	0.53228	GTC	.		0.483	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
ZKSCAN3	80317	bcgsc.ca	37	6	28333714	28333714	+	Silent	SNP	G	G	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:28333714G>A	ENST00000377255.3	+	7	1566	c.1269G>A	c.(1267-1269)gaG>gaA	p.E423E	ZKSCAN3_ENST00000252211.2_Silent_p.E423E|ZKSCAN3_ENST00000341464.5_Silent_p.E275E	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	423					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						ACACTGGGGAGAAGCCGTATC	0.507																																					p.E423E													.	ZKSCAN3-92	0			c.G1269A						.						66.0	68.0	67.0					6																	28333714		2203	4300	6503	SO:0001819	synonymous_variant	80317	exon6			TGGGGAGAAGCCG	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.1269G>A	6.37:g.28333714G>A		73	0		49	14	NM_024493	0	0	4	5	1	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Silent	SNP	ENST00000377255.3	37	CCDS4650.1																																																																																			.		0.507	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
HLA-DOA	3111	broad.mit.edu;bcgsc.ca	37	6	32974906	32974906	+	Missense_Mutation	SNP	C	C	T	rs200140467		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:32974906C>T	ENST00000229829.5	-	4	775	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	HLA-DOA_ENST00000495532.1_5'Flank|HLA-DOA_ENST00000450833.2_Intron	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	234					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						ACGGTGCCCACGAGGAAGCCC	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		16958	0.0		0.001	False		,,,				2504	0.0				p.V234M													.	HLA-DOA-514	0			c.G700A						.	C	MET/VAL	0,4406		0,0,2203	61.0	65.0	63.0		700	-0.5	0.3	6		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	HLA-DOA	NM_002119.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	234/251	32974906	1,13005	2203	4300	6503	SO:0001583	missense	3111	exon4			TGCCCACGAGGAA	M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.700G>A	6.37:g.32974906C>T	ENSP00000229829:p.Val234Met	141	0		106	6	NM_002119	0	0	1	1	0	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Missense_Mutation	SNP	ENST00000229829.5	37	CCDS4763.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.76	3.212303	0.58452	0.0	1.16E-4	ENSG00000204252	ENST00000229829	T	0.02197	4.4	4.81	-0.477	0.12097	.	0.529869	0.19645	N	0.109353	T	0.01523	0.0049	M	0.83312	2.635	0.31226	N	0.696848	D	0.54772	0.968	P	0.44811	0.461	T	0.35992	-0.9766	10	0.66056	D	0.02	.	2.9755	0.05936	0.1321:0.4542:0.2729:0.1408	.	234	P06340	DOA_HUMAN	M	234	ENSP00000229829:V234M	ENSP00000229829:V234M	V	-	1	0	HLA-DOA	33082884	0.000000	0.05858	0.255000	0.24374	0.944000	0.59088	-0.002000	0.12924	-0.202000	0.10268	0.650000	0.86243	GTG	C|0.999;T|0.000		0.627	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076426.2	NM_002119	
FKBP5	2289	bcgsc.ca	37	6	35610559	35610559	+	Missense_Mutation	SNP	T	T	G	rs139048363		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:35610559T>G	ENST00000539068.1	-	2	245	c.43A>C	c.(43-45)Aca>Cca	p.T15P	FKBP5_ENST00000357266.4_Missense_Mutation_p.T15P|FKBP5_ENST00000536438.1_Missense_Mutation_p.T15P|FKBP5_ENST00000542713.1_Missense_Mutation_p.T15P|FKBP5_ENST00000540787.1_Intron	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	15					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						ACAGTGGCTGTGGGGCTTTCT	0.418																																					p.T15P													.	FKBP5-227	0			c.A43C						.						191.0	191.0	191.0					6																	35610559		2203	4300	6503	SO:0001583	missense	2289	exon3			TGGCTGTGGGGCT	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.43A>C	6.37:g.35610559T>G	ENSP00000441205:p.Thr15Pro	311	0		202	23	NM_001145775	0	0	0	0	0	F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	ENST00000539068.1	37	CCDS4808.1	.	.	.	.	.	.	.	.	.	.	T	10.69	1.422509	0.25639	.	.	ENSG00000096060	ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000542713	D;D;D;T	0.83837	-1.77;-1.77;-1.77;-1.48	5.95	4.1	0.47936	.	0.427671	0.26065	N	0.026552	T	0.54271	0.1848	L	0.27053	0.805	0.09310	N	0.999999	B;B	0.17465	0.0;0.022	B;B	0.18263	0.0;0.021	T	0.43909	-0.9362	10	0.31617	T	0.26	-33.2844	8.6902	0.34262	0.0:0.7651:0.0:0.2349	.	15;15	F5H7R1;Q13451	.;FKBP5_HUMAN	P	15	ENSP00000444810:T15P;ENSP00000349811:T15P;ENSP00000441205:T15P;ENSP00000442340:T15P	ENSP00000338160:T15P	T	-	1	0	FKBP5	35718537	0.096000	0.21769	0.950000	0.38849	0.279000	0.26890	0.187000	0.16998	1.513000	0.48852	-0.177000	0.13119	ACA	.		0.418	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040309.2		
FAM184A	79632	bcgsc.ca	37	6	119282964	119282964	+	Silent	SNP	T	T	G	rs534758163	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:119282964T>G	ENST00000338891.7	-	17	3746	c.3303A>C	c.(3301-3303)ccA>ccC	p.P1101P	FAM184A_ENST00000368475.4_Silent_p.P897P|FAM184A_ENST00000521531.1_Silent_p.P1017P|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Silent_p.P932P	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	1101						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GCACTGGCTGTGGAAGTGGTT	0.448													T|||	6	0.00119808	0.0023	0.0	5008	,	,		15675	0.0		0.003	False		,,,				2504	0.0				p.P1101P													.	FAM184A-519	0			c.A3303C						.						191.0	198.0	196.0					6																	119282964		1937	4147	6084	SO:0001819	synonymous_variant	79632	exon17			TGGCTGTGGAAGT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.3303A>C	6.37:g.119282964T>G		355	3		325	38	NM_024581	0	0	0	0	0	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Silent	SNP	ENST00000338891.7	37	CCDS43499.1																																																																																			.		0.448	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
L3MBTL3	84456	bcgsc.ca	37	6	130442104	130442104	+	Splice_Site	SNP	G	G	T	rs200269881		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:130442104G>T	ENST00000529410.1	+	22	2445		c.e22+1		L3MBTL3_ENST00000368136.2_Splice_Site|L3MBTL3_ENST00000361794.2_Splice_Site|L3MBTL3_ENST00000368139.2_Splice_Site|L3MBTL3_ENST00000526019.1_Splice_Site|L3MBTL3_ENST00000533560.1_Splice_Site			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)						chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GAAGCCAGAGGTAGCCATAAT	0.338																																					.													.	L3MBTL3-96	0			c.1966+1G>T						.						78.0	88.0	85.0					6																	130442104		2203	4298	6501	SO:0001630	splice_region_variant	84456	exon20			CCAGAGGTAGCCA	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1966+1G>T	6.37:g.130442104G>T		148	0		71	13	NM_032438	0	0	0	0	0	Q4VXE1|Q5VUM9|Q6P9B5	Splice_Site	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513891	0.64522	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5433	0.68011	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	L3MBTL3	130483797	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	4.082000	0.57635	2.894000	0.99253	0.591000	0.81541	.	.		0.338	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	Intron
PLG	5340	broad.mit.edu	37	6	161152118	161152118	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr6:161152118C>T	ENST00000308192.9	+	11	1355	c.1292C>T	c.(1291-1293)gCc>gTc	p.A431V		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	431	Kringle 4. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AATCCAGATGCCGATAAAGGC	0.507																																					p.A431V													.	PLG-94	0			c.C1292T						.						86.0	93.0	90.0					6																	161152118		2203	4300	6503	SO:0001583	missense	5340	exon11			CAGATGCCGATAA	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1292C>T	6.37:g.161152118C>T	ENSP00000308938:p.Ala431Val	125	0		121	4	NM_000301	0	0	0	0	0	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	C	9.802	1.180726	0.21787	.	.	ENSG00000122194	ENST00000308192	T	0.62941	-0.01	5.11	-10.2	0.00374	Kringle (5);Kringle-like fold (1);Kringle, conserved site (1);	1.961470	0.04210	U	0.331537	T	0.35480	0.0933	M	0.61703	1.905	0.09310	N	0.999995	B	0.12013	0.005	B	0.21151	0.033	T	0.48736	-0.9009	10	0.87932	D	0	.	12.5352	0.56138	0.1802:0.5971:0.2227:0.0	.	431	P00747	PLMN_HUMAN	V	431	ENSP00000308938:A431V	ENSP00000308938:A431V	A	+	2	0	PLG	161072108	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.583000	0.02115	-2.853000	0.00330	-0.302000	0.09304	GCC	.		0.507	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
VPS37D	155382	hgsc.bcm.edu	37	7	73083798	73083798	+	Missense_Mutation	SNP	C	C	G	rs370705512		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr7:73083798C>G	ENST00000324941.4	+	2	322	c.188C>G	c.(187-189)gCg>gGg	p.A63G	VPS37D_ENST00000451519.1_Intron	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCCAACTACGCGCTGGCCAAG	0.677																																					p.A63G		.											.	VPS37D-68	0			c.C188G						.						7.0	9.0	8.0					7																	73083798		1885	4067	5952	SO:0001583	missense	155382	exon2			ACTACGCGCTGGC	AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.188C>G	7.37:g.73083798C>G	ENSP00000320416:p.Ala63Gly	7	0		10	4	NM_001077621	0	0	4	10	6		Missense_Mutation	SNP	ENST00000324941.4	37	CCDS43596.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336561	0.41398	.	.	ENSG00000176428	ENST00000324941	T	0.77229	-1.08	4.3	3.41	0.39046	Modifier of rudimentary, Modr (1);	0.335218	0.24041	U	0.042099	T	0.64438	0.2598	N	0.14661	0.345	0.80722	D	1	P	0.49090	0.919	P	0.46172	0.506	T	0.66002	-0.6031	10	0.66056	D	0.02	.	8.0448	0.30542	0.0:0.8859:0.0:0.1141	.	63	Q86XT2	VP37D_HUMAN	G	63	ENSP00000320416:A63G	ENSP00000320416:A63G	A	+	2	0	VPS37D	72721734	0.015000	0.18098	0.868000	0.34077	0.570000	0.35934	1.008000	0.29872	1.024000	0.39682	0.563000	0.77884	GCG	.		0.677	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	NM_152560	
DPYS	1807	hgsc.bcm.edu	37	8	105479134	105479134	+	Silent	SNP	C	C	T	rs182332679	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr8:105479134C>T	ENST00000351513.2	-	1	147	c.15G>A	c.(13-15)tcG>tcA	p.S5S		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	5					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCAGGAGCCGCGAGGGCGCCG	0.761													C|||	160	0.0319489	0.0098	0.0375	5008	,	,		8520	0.0169		0.0378	False		,,,				2504	0.0675				p.S5S		.											.	DPYS-229	0			c.G15A						.	C		59,3315		0,59,1628	4.0	5.0	5.0		15	0.4	0.0	8		5	163,6381		1,161,3110	no	coding-synonymous	DPYS	NM_001385.2		1,220,4738	TT,TC,CC		2.4908,1.7487,2.2384		5/520	105479134	222,9696	1687	3272	4959	SO:0001819	synonymous_variant	1807	exon1			GAGCCGCGAGGGC	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.15G>A	8.37:g.105479134C>T		1	1		6	6	NM_001385	0	0	0	0	0		Silent	SNP	ENST00000351513.2	37	CCDS6302.1																																																																																			C|0.967;T|0.033		0.761	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
EDF1	8721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139757816	139757816	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr9:139757816C>A	ENST00000224073.1	-	3	242	c.215G>T	c.(214-216)aGg>aTg	p.R72M	EDF1_ENST00000371648.4_Missense_Mutation_p.R72M|EDF1_ENST00000371649.1_Missense_Mutation_p.R72M	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1	72	Interaction with NR5A2, PPARG and NR1H3.|Interaction with TBP and NR5A1.				endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CAGGGTCACCCTGTCATGGTG	0.617																																					p.R72M		.											.	EDF1-90	0			c.G215T						.						150.0	112.0	125.0					9																	139757816		2203	4300	6503	SO:0001583	missense	8721	exon3			GTCACCCTGTCAT	AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948	ENST00000224073.1:c.215G>T	9.37:g.139757816C>A	ENSP00000224073:p.Arg72Met	69	0		48	19	NM_003792	0	0	722	1601	879	Q5T5T2|Q9UIM1	Missense_Mutation	SNP	ENST00000224073.1	37	CCDS7011.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.877120	0.91664	.	.	ENSG00000107223	ENST00000371649;ENST00000224073;ENST00000371648	.	.	.	5.79	4.9	0.64082	Lambda repressor-like, DNA-binding (1);Multiprotein bridging factor 1, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.80847	2.515	0.80722	D	1	P;P	0.48407	0.897;0.91	P;P	0.57425	0.725;0.82	T	0.80741	-0.1247	9	0.87932	D	0	-10.8624	14.6074	0.68489	0.0:0.9301:0.0:0.0699	.	72;72	O60869-2;O60869	.;EDF1_HUMAN	M	72	.	ENSP00000224073:R72M	R	-	2	0	EDF1	138877637	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.317000	0.79018	1.463000	0.47967	0.655000	0.94253	AGG	.		0.617	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055143.1		
DDX3X	1654	bcgsc.ca	37	X	41205659	41205659	+	Missense_Mutation	SNP	C	C	A	rs200427211		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chrX:41205659C>A	ENST00000399959.2	+	13	2348	c.1493C>A	c.(1492-1494)aCa>aAa	p.T498K	DDX3X_ENST00000441189.2_Intron|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000457138.2_Missense_Mutation_p.T482K|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	498	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TTAGTGGCTACAGCAGTATGT	0.403										HNSCC(61;0.18)																											p.T498K													.	DDX3X-715	0			c.C1493A						.						79.0	77.0	78.0					X																	41205659		2202	4300	6502	SO:0001583	missense	1654	exon13			TGGCTACAGCAGT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1493C>A	X.37:g.41205659C>A	ENSP00000382840:p.Thr498Lys	68	0		75	12	NM_001193416	0	0	0	0	0	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.903947	0.92035	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.13089	2.62;2.62	5.1	5.1	0.69264	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.60025	0.2237	H	0.99475	4.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80690	-0.1270	10	0.87932	D	0	-11.1871	17.7156	0.88336	0.0:1.0:0.0:0.0	.	482;510;498	B4E3E8;Q59GX6;O00571	.;.;DDX3X_HUMAN	K	498;482	ENSP00000382840:T498K;ENSP00000392494:T482K	ENSP00000382840:T498K	T	+	2	0	DDX3X	41090603	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.771000	0.85420	2.113000	0.64589	0.600000	0.82982	ACA	.		0.403	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
PHF8	23133	hgsc.bcm.edu	37	X	53966769	53966769	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chrX:53966769C>G	ENST00000357988.5	-	21	3296	c.2938G>C	c.(2938-2940)Gcc>Ccc	p.A980P	PHF8_ENST00000338154.6_Missense_Mutation_p.A944P|PHF8_ENST00000338946.6_Missense_Mutation_p.A843P	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	980					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						CCTGACAGGGCCTCTTGTTTA	0.602																																					p.A980P		.											.	PHF8-133	0			c.G2938C						.						113.0	88.0	97.0					X																	53966769		2202	4300	6502	SO:0001583	missense	23133	exon21			ACAGGGCCTCTTG	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2938G>C	X.37:g.53966769C>G	ENSP00000350676:p.Ala980Pro	50	0		29	2	NM_001184896	0	0	7	7	0	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.817|9.817	1.184706|1.184706	0.21870|0.21870	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277|ENST00000396282	T;T;T|.	0.18502|.	2.48;2.22;2.21|.	5.08|5.08	3.25|3.25	0.37280|0.37280	.|.	0.577499|.	0.17386|.	N|.	0.176132|.	T|T	0.15435|0.15435	0.0372|0.0372	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.0;0.001;0.001|.	T|T	0.23619|0.23619	-1.0183|-1.0183	10|5	0.38643|.	T|.	0.18|.	-5.047|-5.047	7.9511|7.9511	0.30014|0.30014	0.0:0.6387:0.2521:0.1092|0.0:0.6387:0.2521:0.1092	.|.	843;879;980|.	B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;PHF8_HUMAN|.	P|S	980;944;843;873|847	ENSP00000350676:A980P;ENSP00000338868:A944P;ENSP00000340051:A843P|.	ENSP00000338868:A944P|.	A|R	-|-	1|3	0|2	PHF8|PHF8	53983494|53983494	0.718000|0.718000	0.27976|0.27976	0.980000|0.980000	0.43619|0.43619	0.977000|0.977000	0.68977|0.68977	0.287000|0.287000	0.18920|0.18920	0.934000|0.934000	0.37316|0.37316	0.431000|0.431000	0.28591|0.28591	GCC|AGG	.		0.602	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
FGGY	55277	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	60133071	60133091	+	Splice_Site	DEL	TACTGGTAAGTCTGGGAAAGA	TACTGGTAAGTCTGGGAAAGA	-	rs115318188	byFrequency	TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	TACTGGTAAGTCTGGGAAAGA	TACTGGTAAGTCTGGGAAAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr1:60133071_60133091delTACTGGTAAGTCTGGGAAAGA	ENST00000303721.7	+	13	1587_1591	c.1413_1417delTACTGGTAAGTCTGGGAAAGA	c.(1411-1419)attactggt>atgt	p.471_473ITG>M	FGGY_ENST00000371218.4_Splice_Site_p.495_497ITG>M|FGGY_ENST00000371212.1_Splice_Site_p.383_385ITG>M|FGGY_ENST00000371210.1_Splice_Site_p.172_174ITG>M	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	471					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.G361C(1)|p.G473C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					ATGCGGACATTACTGGTAAGTCTGGGAAAGAGGAGAGAAGG	0.466																																					p.495_497del		.											.	FGGY-69	2	Substitution - Missense(2)	lung(2)	c.1485_1489del						.																																			SO:0001630	splice_region_variant	55277	exon14			.		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1417+1TACTGGTAAGTCTGGGAAAGA>-	1.37:g.60133071_60133091delTACTGGTAAGTCTGGGAAAGA		240	0		123	29	NM_001113411	0	0	0	0	0	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Frame_Shift_Del	DEL	ENST00000303721.7	37	CCDS611.2																																																																																			.		0.466	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	In_Frame_Del
OR52H1	390067	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	5566652	5566652	+	Frame_Shift_Del	DEL	C	C	-	rs565760908		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:5566652delC	ENST00000322653.4	-	1	127	c.102delG	c.(100-102)tggfs	p.W34fs	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAATTCCAATCCACACATGGA	0.473																																					p.W34X		.											.	OR52H1-114	0			c.102delG						.						88.0	80.0	83.0					11																	5566652		2201	4297	6498	SO:0001589	frameshift_variant	390067	exon1			.	AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.102delG	11.37:g.5566652delC	ENSP00000326259:p.Trp34fs	99	0		72	27	NM_001005289	0	0	0	0	0	B9EH26|Q6IF79	Nonsense_Mutation	DEL	ENST00000322653.4	37	CCDS31386.1																																																																																			.		0.473	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289	
PPP6R3	55291	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	68318634	68318637	+	Frame_Shift_Del	DEL	CATC	CATC	-			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	CATC	CATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr11:68318634_68318637delCATC	ENST00000393800.2	+	6	852_855	c.598_601delCATC	c.(598-603)catccafs	p.HP200fs	PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000265636.5_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000265637.4_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000524845.1_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000393799.2_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000393801.3_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000524904.1_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000527403.2_Frame_Shift_Del_p.HP200fs|PPP6R3_ENST00000529710.1_Frame_Shift_Del_p.HP200fs	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	200					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GGAAATAGTTCATCCATCGCAAGA	0.348																																					p.200_201del		.											.	PPP6R3-91	0			c.598_601del						.																																			SO:0001589	frameshift_variant	55291	exon6			.	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.598_601delCATC	11.37:g.68318638_68318641delCATC	ENSP00000377389:p.His200fs	79	0		55	25	NM_001164162	0	0	0	0	0	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Frame_Shift_Del	DEL	ENST00000393800.2	37	CCDS53672.1																																																																																			.		0.348	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
SCAF11	9169	broad.mit.edu	37	12	46320707	46320708	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr12:46320707_46320708delTC	ENST00000369367.3	-	11	3009_3010	c.2776_2777delGA	c.(2776-2778)gaafs	p.E926fs	SCAF11_ENST00000419565.2_Frame_Shift_Del_p.E926fs|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000549162.1_Frame_Shift_Del_p.E734fs|SCAF11_ENST00000465950.1_Frame_Shift_Del_p.E611fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	926	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GGTTCTCCTTTCTCTCTCTCTC	0.446																																					p.926_926del													.	SCAF11-93	0			c.2776_2777del						.																																			SO:0001589	frameshift_variant	9169	exon11			CTCCTTTCTCTCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2776_2777delGA	12.37:g.46320717_46320718delTC	ENSP00000358374:p.Glu926fs	183	0		273	6	NM_004719	0	0	0	0	0	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Del	DEL	ENST00000369367.3	37	CCDS8748.2																																																																																			.		0.446	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu	37	20	46252817	46252817	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr20:46252817delA	ENST00000371998.3	+	4	437	c.246delA	c.(244-246)atafs	p.I82fs	NCOA3_ENST00000341724.6_Frame_Shift_Del_p.I82fs|NCOA3_ENST00000371997.3_Frame_Shift_Del_p.I82fs|NCOA3_ENST00000372004.3_Frame_Shift_Del_p.I82fs			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	82	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TACGTCAAATAAAAGAGCAAG	0.378																																					p.I82fs		.											.	NCOA3-229	0			c.246delA						.						61.0	58.0	59.0					20																	46252817		2203	4300	6503	SO:0001589	frameshift_variant	8202	exon4			.	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.246delA	20.37:g.46252817delA	ENSP00000361066:p.Ile82fs	38	0		89	17	NM_181659	0	0	0	0	0	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Frame_Shift_Del	DEL	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.378	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123801801	123801802	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr12:123801801_123801802insT	ENST00000602398.1	-	21	3028_3029	c.2901_2902insA	c.(2899-2904)ttacctfs	p.P968fs	SBNO1_ENST00000602750.1_Frame_Shift_Ins_p.P967fs|SBNO1_ENST00000267176.4_Frame_Shift_Ins_p.P967fs|SBNO1_ENST00000420886.2_Frame_Shift_Ins_p.P968fs			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	968					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		GCGCTCCAAGGTAATTCTAAAG	0.396																																					p.P968fs		.											.	SBNO1-292	0			c.2902_2903insA						.																																			SO:0001589	frameshift_variant	55206	exon20			.	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2902dupA	12.37:g.123801802_123801802dupT	ENSP00000473665:p.Pro968fs	91	0		115	36	NM_001167856	0	0	0	0	0	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Frame_Shift_Ins	INS	ENST00000602398.1	37	CCDS53844.1																																																																																			.		0.396	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
TMCO3	55002	bcgsc.ca	37	13	114188424	114188425	+	In_Frame_Ins	INS	-	-	GGTTTTTTTTTT	rs141899812		TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr13:114188424_114188425insGGTTTTTTTTTT	ENST00000434316.2	+	9	1767_1768	c.1408_1409insGGTTTTTTTTTT	c.(1408-1410)gtt>gGGTTTTTTTTTTtt	p.470_470V>GFFFF	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	470						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			ACTAGCGGCGGTTTTTCTTTTA	0.406																																					p.V470delinsGFFFF													.	TMCO3-90	0			c.1408_1409insGGTTTTTTTTTT						.																																			SO:0001652	inframe_insertion	55002	exon9			GCGGCGGTTTTTC	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	Exception_encountered	13.37:g.114188424_114188425insGGTTTTTTTTTT	ENSP00000389399:p.Val470delinsGlyPhePhePhePhe	207	0		244	5	NM_017905	0	0	0	0	0	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	In_Frame_Ins	INS	ENST00000434316.2	37	CCDS9537.1																																																																																			.		0.406	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
INF2	64423	hgsc.bcm.edu;bcgsc.ca	37	14	105174895	105174896	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr14:105174895_105174896insC	ENST00000392634.4	+	9	1970_1971	c.1858_1859insC	c.(1858-1860)gccfs	p.A620fs	INF2_ENST00000330634.7_Frame_Shift_Ins_p.A620fs	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	620	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CACCATGGTGGCCCCCCGGGCC	0.703											OREG0022959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A620fs		.											.	INF2-492	0			c.1858_1859insC						.																																			SO:0001589	frameshift_variant	64423	exon9			.	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1864dupC	14.37:g.105174901_105174901dupC	ENSP00000376410:p.Ala620fs	44	0	1387	43	22	NM_001031714	0	0	0	0	0	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Frame_Shift_Ins	INS	ENST00000392634.4	37	CCDS9989.2																																																																																			.		0.703	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
PRKRA	8575	hgsc.bcm.edu	37	2	179306335	179306336	+	Splice_Site	DNP	AC	AC	GT			TCGA-DW-5560-01A-01D-1589-08	TCGA-DW-5560-10A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a6ec0d8-cd0a-4f81-b981-27efdc14709c	e5457299-318e-451f-8658-07ea29ecbd40	g.chr2:179306335_179306336AC>GT	ENST00000325748.4	-	6	810		c.e6+1		PRKRA_ENST00000487082.1_Splice_Site|AC009948.5_ENST00000453026.2_RNA|PRKRA_ENST00000438687.3_Splice_Site|PRKRA_ENST00000432031.2_Splice_Site	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator						cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			AACATTACTCACTAAAGAAATG	0.351																																					.	Melanoma(200;68 3001 23825 48764)	.											.	PRKRA	1	Unknown(1)	lung(1)	c.534+1G>A						.																																			SO:0001630	splice_region_variant	8575	exon7			TACTCACTAAAGA	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.610_610delinsGT	2.37:g.179306335_179306336delinsGT		61.0	1.0		80.0	5.0		0	0	0	0	0	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Splice_Site	DNP	ENST00000325748.4	37	CCDS2279.1																																																																																			.		0.351	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	Intron
