#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF436	80818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	23693623	23693623	+	Silent	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:23693623G>A	ENST00000314011.4	-	3	208	c.72C>T	c.(70-72)acC>acT	p.T24T	ZNF436_ENST00000374608.3_Silent_p.T24T|C1orf213_ENST00000454117.1_5'Flank|C1orf213_ENST00000335648.3_5'Flank|C1orf213_ENST00000437367.2_5'Flank|C1orf213_ENST00000518821.1_5'Flank	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ATTCTTCCCGGGTGAGATACA	0.438																																					p.T24T		.											.	ZNF436-153	0			c.C72T						.						136.0	129.0	132.0					1																	23693623		2203	4300	6503	SO:0001819	synonymous_variant	80818	exon3			TTCCCGGGTGAGA	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.72C>T	1.37:g.23693623G>A		108	0		131	47	NM_001077195	0	0	1	3	2	Q658I9	Silent	SNP	ENST00000314011.4	37	CCDS233.1																																																																																			.		0.438	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
KLF17	128209	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	44595405	44595405	+	Silent	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:44595405C>G	ENST00000372299.3	+	2	520	c.462C>G	c.(460-462)ccC>ccG	p.P154P	KLF17_ENST00000476802.1_Intron	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	154					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					TAAGGATGCCCCCCAATGGGC	0.562																																					p.P154P		.											.	KLF17-92	0			c.C462G						.						33.0	37.0	35.0					1																	44595405		2203	4300	6503	SO:0001819	synonymous_variant	128209	exon2			GATGCCCCCCAAT	BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.462C>G	1.37:g.44595405C>G		35	0		43	16	NM_173484	0	0	0	0	0	Q86VQ7|Q8N805	Silent	SNP	ENST00000372299.3	37	CCDS508.1																																																																																			.		0.562	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484	
LRRC8C	84230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90179946	90179946	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:90179946A>C	ENST00000370454.4	+	3	2072	c.1817A>C	c.(1816-1818)cAt>cCt	p.H606P	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	606					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CGTATTCCTCATGCTGTGTTC	0.448																																					p.H606P		.											.	LRRC8C-97	0			c.A1817C						.						57.0	55.0	56.0					1																	90179946		2203	4300	6503	SO:0001583	missense	84230	exon3			TTCCTCATGCTGT		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1817A>C	1.37:g.90179946A>C	ENSP00000359483:p.His606Pro	80	0		121	40	NM_032270	0	0	1	1	0	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.754041	0.49362	.	.	ENSG00000171488	ENST00000370454	T	0.54866	0.55	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.31199	0.0789	N	0.00656	-1.285	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	T	0.63730	-0.6571	10	0.39692	T	0.17	.	16.5441	0.84409	1.0:0.0:0.0:0.0	.	606	Q8TDW0	LRC8C_HUMAN	P	606	ENSP00000359483:H606P	ENSP00000359483:H606P	H	+	2	0	LRRC8C	89952534	1.000000	0.71417	0.397000	0.26308	0.684000	0.39900	9.284000	0.95882	2.364000	0.80123	0.524000	0.50904	CAT	.		0.448	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
EVI5	7813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	93073196	93073196	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:93073196T>A	ENST00000370331.1	-	15	1877	c.1868A>T	c.(1867-1869)aAa>aTa	p.K623I	EVI5_ENST00000540033.1_Missense_Mutation_p.K623I|EVI5_ENST00000543509.1_Missense_Mutation_p.K634I|EVI5_ENST00000491940.1_5'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	623	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		AAGGAGTCCTTTGTTCTGTGC	0.358																																					p.K623I		.											.	EVI5-136	0			c.A1868T						.						166.0	149.0	154.0					1																	93073196		2202	4299	6501	SO:0001583	missense	7813	exon15			AGTCCTTTGTTCT	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1868A>T	1.37:g.93073196T>A	ENSP00000359356:p.Lys623Ile	47	0		88	45	NM_005665	0	0	0	2	2	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.656843	0.88154	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.37584	1.19;1.19;1.19	5.59	4.26	0.50523	.	0.052940	0.85682	D	0.000000	T	0.44286	0.1286	M	0.79123	2.44	0.51767	D	0.999936	P;P	0.49696	0.927;0.88	P;P	0.55455	0.776;0.602	T	0.51124	-0.8745	10	0.87932	D	0	-27.0804	12.0805	0.53667	0.0:0.0783:0.0:0.9217	.	634;623	F5H4R0;O60447	.;EVI5_HUMAN	I	623;623;634	ENSP00000359356:K623I;ENSP00000440826:K623I;ENSP00000445019:K634I	ENSP00000359356:K623I	K	-	2	0	EVI5	92845784	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.949000	0.70257	2.132000	0.65825	0.533000	0.62120	AAA	.		0.358	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
GPSM2	29899	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109439646	109439646	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:109439646T>G	ENST00000406462.2	+	4	990	c.217T>G	c.(217-219)Ttc>Gtc	p.F73V	GPSM2_ENST00000264126.3_Missense_Mutation_p.F73V|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	73					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		CAATGCTTATTTCTATTTGCA	0.378																																					p.F73V													.	GPSM2-227	0			c.T217G						.						122.0	126.0	125.0					1																	109439646		2203	4300	6503	SO:0001583	missense	29899	exon3			GCTTATTTCTATT	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.217T>G	1.37:g.109439646T>G	ENSP00000385510:p.Phe73Val	62	1		67	29	NM_013296	0	0	0	1	1	Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	ENST00000406462.2	37	CCDS792.2	.	.	.	.	.	.	.	.	.	.	T	31	5.083858	0.94050	.	.	ENSG00000121957	ENST00000406462;ENST00000435987;ENST00000264126;ENST00000435475	T;T;T	0.65916	-0.18;-0.18;-0.18	5.61	5.61	0.85477	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	L	0.58810	1.83	0.80722	D	1	P	0.50617	0.937	D	0.64877	0.93	T	0.72603	-0.4243	10	0.59425	D	0.04	-7.2819	15.7996	0.78443	0.0:0.0:0.0:1.0	.	73	P81274	GPSM2_HUMAN	V	73	ENSP00000385510:F73V;ENSP00000408664:F73V;ENSP00000264126:F73V	ENSP00000264126:F73V	F	+	1	0	GPSM2	109241169	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.133000	0.65898	0.533000	0.62120	TTC	.		0.378	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186082053	186082053	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:186082053A>G	ENST00000271588.4	+	72	11328	c.11099A>G	c.(11098-11100)aAg>aGg	p.K3700R	HMCN1_ENST00000367492.2_Missense_Mutation_p.K3700R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3700	Ig-like C2-type 35.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATTGCAGGAAAGACTACAAGA	0.393																																					p.K3700R		.											.	HMCN1-113	0			c.A11099G						.						106.0	101.0	103.0					1																	186082053		2203	4300	6503	SO:0001583	missense	83872	exon72			CAGGAAAGACTAC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11099A>G	1.37:g.186082053A>G	ENSP00000271588:p.Lys3700Arg	46	0		69	24	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.607517	0.46527	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.69561	-0.41;-0.41	4.91	3.77	0.43336	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.134451	0.64402	D	0.000003	T	0.62527	0.2435	N	0.12637	0.245	0.45747	D	0.99864	D	0.69078	0.997	D	0.80764	0.994	T	0.58278	-0.7664	10	0.21014	T	0.42	.	10.2014	0.43087	0.921:0.0:0.079:0.0	.	3700	Q96RW7	HMCN1_HUMAN	R	3700	ENSP00000271588:K3700R;ENSP00000356462:K3700R	ENSP00000271588:K3700R	K	+	2	0	HMCN1	184348676	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.263000	0.58853	1.957000	0.56846	0.533000	0.62120	AAG	.		0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	16941145	16941145	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr10:16941145G>C	ENST00000377833.4	-	54	8513	c.8448C>G	c.(8446-8448)atC>atG	p.I2816M		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2816	CUB 21. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGGGGATCTGATTGTACCAT	0.403																																					p.I2816M		.											.	CUBN-166	0			c.C8448G						.						118.0	112.0	114.0					10																	16941145		2203	4300	6503	SO:0001583	missense	8029	exon54			GGATCTGATTGTA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8448C>G	10.37:g.16941145G>C	ENSP00000367064:p.Ile2816Met	89	0		88	38	NM_001081	0	0	5	12	7	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	9.641	1.139005	0.21123	.	.	ENSG00000107611	ENST00000377833	T	0.40476	1.03	5.63	0.557	0.17260	CUB (5);	0.137522	0.33057	N	0.005332	T	0.64494	0.2603	M	0.93150	3.385	0.80722	D	1	D	0.60160	0.987	P	0.62298	0.9	T	0.64782	-0.6326	10	0.66056	D	0.02	.	7.5405	0.27735	0.1201:0.0:0.4925:0.3874	.	2816	O60494	CUBN_HUMAN	M	2816	ENSP00000367064:I2816M	ENSP00000367064:I2816M	I	-	3	3	CUBN	16981151	1.000000	0.71417	0.001000	0.08648	0.014000	0.08584	3.071000	0.50041	-0.070000	0.12908	-0.940000	0.02684	ATC	.		0.403	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	64974605	64974605	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr10:64974605T>G	ENST00000399262.2	-	8	1540	c.1322A>C	c.(1321-1323)aAa>aCa	p.K441T	JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000402544.1_Missense_Mutation_p.K222T|JMJD1C_ENST00000542921.1_Missense_Mutation_p.K259T|JMJD1C_ENST00000399251.1_Missense_Mutation_p.K222T	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	441					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTCATGTTTTTTATCTTCCTG	0.388																																					p.K441T		.											.	JMJD1C-275	0			c.A1322C						.						148.0	131.0	136.0					10																	64974605		1826	4079	5905	SO:0001583	missense	221037	exon8			TGTTTTTTATCTT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1322A>C	10.37:g.64974605T>G	ENSP00000382204:p.Lys441Thr	30	0		53	16	NM_032776	0	0	1	2	1	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.356618	0.61293	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.55930	0.84;0.49;2.4;0.84	5.85	4.71	0.59529	.	0.256048	0.33290	U	0.005078	T	0.44159	0.1280	L	0.51422	1.61	0.44012	D	0.99672	P;P	0.39282	0.666;0.666	B;B	0.33339	0.162;0.115	T	0.51631	-0.8681	10	0.62326	D	0.03	-15.2085	12.0787	0.53659	0.0:0.0679:0.0:0.9321	.	441;259	Q15652;A0T124	JHD2C_HUMAN;.	T	441;222;222;259	ENSP00000382204:K441T;ENSP00000384990:K222T;ENSP00000382195:K222T;ENSP00000444682:K259T	ENSP00000382195:K222T	K	-	2	0	JMJD1C	64644611	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.933000	0.48948	2.237000	0.73441	0.459000	0.35465	AAA	.		0.388	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
LDB1	8861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103871028	103871028	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr10:103871028A>G	ENST00000425280.1	-	3	500	c.158T>C	c.(157-159)cTg>cCg	p.L53P	LDB1_ENST00000361198.5_Missense_Mutation_p.L17P|LDB1_ENST00000490751.1_5'UTR	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	53					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		CCCTGGCTCCAGGTATGTAGG	0.577																																					p.L53P		.											.	LDB1-289	0			c.T158C						.						98.0	98.0	98.0					10																	103871028		2203	4300	6503	SO:0001583	missense	8861	exon3			GGCTCCAGGTATG	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.158T>C	10.37:g.103871028A>G	ENSP00000392466:p.Leu53Pro	125	0		155	68	NM_001113407	0	0	13	19	6	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	37	CCDS44472.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.149912	0.57151	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.73	5.73	0.89815	.	0.148563	0.46442	D	0.000281	T	0.39733	0.1089	N	0.19112	0.55	0.80722	D	1	P;B	0.48407	0.91;0.0	B;B	0.41135	0.348;0.001	T	0.26503	-1.0101	9	0.31617	T	0.26	-13.3126	15.6898	0.77442	1.0:0.0:0.0:0.0	.	53;17	Q86U70;Q86U70-3	LDB1_HUMAN;.	P	17;53	.	ENSP00000354616:L17P	L	-	2	0	LDB1	103861018	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.008000	0.76341	2.199000	0.70637	0.459000	0.35465	CTG	.		0.577	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407	
FAM53B	9679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	126311947	126311947	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr10:126311947G>A	ENST00000337318.3	-	5	1344	c.1133C>T	c.(1132-1134)tCa>tTa	p.S378L	RP11-12J10.3_ENST00000494792.1_Intron|FAM53B_ENST00000392754.3_Missense_Mutation_p.S378L	NM_014661.3	NP_055476.3	Q14153	FA53B_HUMAN	family with sequence similarity 53, member B	378										cervix(1)|lung(5)|ovary(2)|pancreas(1)	9		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		GCAGCTGTCTGACTCCTCACA	0.711																																					p.S378L		.											.	FAM53B-91	0			c.C1133T						.						21.0	22.0	21.0					10																	126311947		2200	4294	6494	SO:0001583	missense	9679	exon5			CTGTCTGACTCCT	D50930	CCDS7641.1	10q26.13	2004-11-24	2004-11-24	2004-11-24	ENSG00000189319	ENSG00000189319			28968	protein-coding gene	gene with protein product			"""KIAA0140"""	KIAA0140		8590280	Standard	NM_014661		Approved	bA12J10.2	uc001lhv.1	Q14153	OTTHUMG00000019215	ENST00000337318.3:c.1133C>T	10.37:g.126311947G>A	ENSP00000338532:p.Ser378Leu	31	0		38	23	NM_014661	0	0	2	4	2	D3DRF1|Q5VUW1|Q5VUW2|Q8N5S6	Missense_Mutation	SNP	ENST00000337318.3	37	CCDS7641.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.688447	0.29962	.	.	ENSG00000189319	ENST00000337318;ENST00000392754	.	.	.	4.78	3.86	0.44501	.	0.743799	0.11858	N	0.522697	T	0.30978	0.0782	L	0.34521	1.04	0.19945	N	0.999948	B	0.26809	0.16	B	0.31337	0.128	T	0.21793	-1.0235	9	0.06365	T	0.9	-7.9821	11.3285	0.49463	0.0:0.0:0.6724:0.3276	.	378	Q14153	FA53B_HUMAN	L	378	.	ENSP00000338532:S378L	S	-	2	0	FAM53B	126301937	0.742000	0.28228	0.299000	0.25016	0.686000	0.39977	2.551000	0.45820	1.213000	0.43380	0.655000	0.94253	TCA	.		0.711	FAM53B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050879.1	NM_014661	
ADAM12	8038	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	127806755	127806755	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr10:127806755T>G	ENST00000368679.4	-	6	773	c.464A>C	c.(463-465)gAa>gCa	p.E155A	ADAM12_ENST00000368676.4_Missense_Mutation_p.E155A	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	155					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TTTCATTGGTTCTAAGACATA	0.383																																					p.E155A													.	ADAM12-716	0			c.A464C						.						114.0	99.0	104.0					10																	127806755		2203	4300	6503	SO:0001583	missense	8038	exon6			ATTGGTTCTAAGA	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.464A>C	10.37:g.127806755T>G	ENSP00000357668:p.Glu155Ala	56	2		92	36	NM_021641	0	0	0	0	0	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.666850	0.67814	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.10288	2.89;2.89;2.89	5.03	5.03	0.67393	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.40767	0.1130	M	0.91140	3.18	0.52501	D	0.999957	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.97110	0.999;0.998;0.998;0.998;1.0	T	0.50931	-0.8769	10	0.87932	D	0	.	13.1591	0.59535	0.0:0.0:0.0:1.0	.	152;152;155;152;155	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	A	155;155;152	ENSP00000357668:E155A;ENSP00000357665:E155A;ENSP00000391268:E152A	ENSP00000357665:E155A	E	-	2	0	ADAM12	127796745	0.999000	0.42202	0.598000	0.28837	0.711000	0.40976	2.805000	0.47939	2.118000	0.64928	0.533000	0.62120	GAA	.		0.383	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
TRPM5	29850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	2428360	2428360	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:2428360C>T	ENST00000155858.6	-	20	3115	c.3107G>A	c.(3106-3108)cGg>cAg	p.R1036Q	AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000533060.1_Missense_Mutation_p.R1036Q|TRPM5_ENST00000452833.1_Missense_Mutation_p.R1038Q|TRPM5_ENST00000528453.1_Missense_Mutation_p.R1036Q	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGGTGCTCCCGCTTGTGCTC	0.706																																					p.R1036Q	NSCLC(1;49 61 17205 18850 43201)	.											.	TRPM5-137	0			c.G3107A						.						26.0	25.0	26.0					11																	2428360		2193	4288	6481	SO:0001583	missense	29850	exon20			TGCTCCCGCTTGT	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.3107G>A	11.37:g.2428360C>T	ENSP00000155858:p.Arg1036Gln	20	0		24	15	NM_014555	0	0	0	0	0		Missense_Mutation	SNP	ENST00000155858.6	37	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	C	1.660	-0.511828	0.04200	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.61627	0.27;0.21;0.21;0.09;0.21	3.21	1.21	0.21127	.	0.630612	0.15729	N	0.247507	T	0.33644	0.0870	N	0.15975	0.35	0.21553	N	0.999642	B;B;B	0.17465	0.022;0.022;0.006	B;B;B	0.13407	0.007;0.007;0.009	T	0.15065	-1.0450	10	0.25751	T	0.34	-7.4235	6.0447	0.19753	0.0:0.6066:0.0:0.3934	.	1036;1038;1036	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	Q	1030;1036;1038;1036;1036	ENSP00000434383:R1030Q;ENSP00000155858:R1036Q;ENSP00000387965:R1038Q;ENSP00000434121:R1036Q;ENSP00000436809:R1036Q	ENSP00000155858:R1036Q	R	-	2	0	TRPM5	2384936	0.007000	0.16637	0.005000	0.12908	0.300000	0.27592	1.127000	0.31357	0.058000	0.16222	0.134000	0.15878	CGG	.		0.706	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
CALCB	797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	15096663	15096663	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:15096663T>A	ENST00000533448.1	+	3	254	c.143T>A	c.(142-144)cTc>cAc	p.L48H	CALCB_ENST00000324229.6_Missense_Mutation_p.L48H|CALCB_ENST00000523376.1_Missense_Mutation_p.L59H			P10092	CALCB_HUMAN	calcitonin-related polypeptide beta	48					cellular calcium ion homeostasis (GO:0006874)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			endometrium(1)|large_intestine(1)|lung(1)|skin(2)	5						GACGCGCGCCTCCTGCTGGCT	0.627											OREG0020793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L48H		.											.	CALCB-90	0			c.T143A						.						58.0	61.0	60.0					11																	15096663		2200	4294	6494	SO:0001583	missense	797	exon3			CGCGCCTCCTGCT		CCDS7820.1	11p14.2-p12	2013-02-25	2008-02-20			ENSG00000175868		"""Endogenous ligands"""	1438	protein-coding gene	gene with protein product		114160	"""calcitonin 2"""	CALC2			Standard	NM_000728		Approved	FLJ30166, CGRP-II	uc001mlx.1	P10092		ENST00000533448.1:c.143T>A	11.37:g.15096663T>A	ENSP00000433490:p.Leu48His	343	0	700	419	177	NM_000728	0	0	0	0	0	A8K573|D3DQX4|Q569I0|Q9UCN9	Missense_Mutation	SNP	ENST00000533448.1	37	CCDS7820.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370035	0.82573	.	.	ENSG00000175868	ENST00000523376;ENST00000324229;ENST00000533448	T;T;T	0.24151	1.87;1.87;1.87	5.4	3.0	0.34707	.	0.000000	0.46442	D	0.000284	T	0.28267	0.0698	M	0.81239	2.535	0.27438	N	0.953794	B	0.30686	0.29	B	0.32022	0.139	T	0.17077	-1.0381	10	0.44086	T	0.13	-26.0769	6.6446	0.22929	0.1187:0.0:0.3692:0.512	.	48	P10092	CALCB_HUMAN	H	59;48;48	ENSP00000428882:L59H;ENSP00000346017:L48H;ENSP00000433490:L48H	ENSP00000346017:L48H	L	+	2	0	CALCB	15053239	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.094000	0.64523	2.176000	0.68965	0.454000	0.30748	CTC	.		0.627	CALCB-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387433.1	NM_000728	
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17150900	17150900	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:17150900T>G	ENST00000265970.7	-	12	2345	c.2346A>C	c.(2344-2346)agA>agC	p.R782S	PIK3C2A_ENST00000540361.1_Missense_Mutation_p.R402S|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	782	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						CTGGTCCCTTTCTCTGCTTAT	0.388																																					p.R782S		.											.	PIK3C2A-1310	0			c.A2346C						.						90.0	96.0	94.0					11																	17150900		2200	4293	6493	SO:0001583	missense	5286	exon12			TCCCTTTCTCTGC	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.2346A>C	11.37:g.17150900T>G	ENSP00000265970:p.Arg782Ser	96	0		153	55	NM_002645	0	0	7	8	1	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807327	0.70797	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.77229	-1.08;-1.08	6.17	3.81	0.43845	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	D	0.82834	0.5123	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79967	-0.1580	10	0.33940	T	0.23	-23.3516	5.1651	0.15081	0.1256:0.1839:0.0:0.6905	.	782	O00443	P3C2A_HUMAN	S	782;402	ENSP00000265970:R782S;ENSP00000438687:R402S	ENSP00000265970:R782S	R	-	3	2	PIK3C2A	17107476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.962000	0.29280	1.126000	0.42016	0.533000	0.62120	AGA	.		0.388	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
PPFIA1	8500	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	70202285	70202285	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:70202285A>T	ENST00000253925.7	+	19	2722	c.2507A>T	c.(2506-2508)gAt>gTt	p.D836V	AP000487.4_ENST00000324630.5_RNA|AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.D836V	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	836					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TCCGAGACGGATAACTCATCT	0.398																																					p.D836V													.	PPFIA1-228	0			c.A2507T						.						139.0	145.0	143.0					11																	70202285		2200	4294	6494	SO:0001583	missense	8500	exon19			AGACGGATAACTC	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.2507A>T	11.37:g.70202285A>T	ENSP00000253925:p.Asp836Val	136	1		144	55	NM_177423	0	0	8	16	8	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.01|14.01	2.407640|2.407640	0.42715|0.42715	.|.	.|.	ENSG00000131626|ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950|ENST00000528750	T;T|.	0.19250|.	2.16;2.16|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.411876|.	0.24172|.	U|.	0.040892|.	T|T	0.56337|0.56337	0.1978|0.1978	L|L	0.34521|0.34521	1.04|1.04	0.54753|0.54753	D|D	0.999981|0.999981	B;B|.	0.25105|.	0.004;0.118|.	B;B|.	0.24541|.	0.027;0.054|.	T|T	0.53570|0.53570	-0.8420|-0.8420	10|5	0.87932|.	D|.	0|.	.|.	15.0281|15.0281	0.71684|0.71684	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	836;836|.	Q13136;Q13136-2|.	LIPA1_HUMAN;.|.	V|L	836;836;333|279	ENSP00000253925:D836V;ENSP00000374198:D836V|.	ENSP00000253925:D836V|.	D|I	+|+	2|1	0|0	PPFIA1|PPFIA1	69879933|69879933	1.000000|1.000000	0.71417|0.71417	0.048000|0.048000	0.18961|0.18961	0.016000|0.016000	0.09150|0.09150	4.706000|4.706000	0.61845|0.61845	2.004000|2.004000	0.58718|0.58718	0.533000|0.533000	0.62120|0.62120	GAT|ATA	.		0.398	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
MOGAT2	80168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	75431106	75431106	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:75431106C>A	ENST00000198801.5	+	2	231	c.161C>A	c.(160-162)gCg>gAg	p.A54E	MOGAT2_ENST00000526712.1_5'UTR	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	54					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)			NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					GTCCTGTATGCGGCCTGGTGG	0.567																																					p.A54E		.											.	MOGAT2-228	0			c.C161A						.						175.0	164.0	168.0					11																	75431106		2200	4293	6493	SO:0001583	missense	80168	exon2			TGTATGCGGCCTG	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.161C>A	11.37:g.75431106C>A	ENSP00000198801:p.Ala54Glu	81	0		131	47	NM_025098	0	0	0	0	0	A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	37	CCDS8240.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230712	0.58777	.	.	ENSG00000166391	ENST00000198801	T	0.15487	2.42	5.14	3.25	0.37280	.	0.175147	0.49916	D	0.000127	T	0.40595	0.1123	M	0.87180	2.865	0.37511	D	0.917131	D;D	0.67145	0.983;0.996	P;D	0.65233	0.815;0.933	T	0.47071	-0.9145	10	0.62326	D	0.03	.	8.4411	0.32816	0.0:0.6272:0.2933:0.0795	.	54;54	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	E	54	ENSP00000198801:A54E	ENSP00000198801:A54E	A	+	2	0	MOGAT2	75108754	0.114000	0.22134	0.003000	0.11579	0.143000	0.21401	2.008000	0.40893	0.732000	0.32470	-0.215000	0.12644	GCG	.		0.567	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098	
ARCN1	372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118464375	118464375	+	Missense_Mutation	SNP	T	T	G	rs546784519		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:118464375T>G	ENST00000264028.4	+	8	1298	c.1203T>G	c.(1201-1203)aaT>aaG	p.N401K	ARCN1_ENST00000534182.2_Intron|ARCN1_ENST00000359415.4_Missense_Mutation_p.N442K|RNU6-1157P_ENST00000384456.1_RNA|ARCN1_ENST00000392859.3_Missense_Mutation_p.N313K	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	401	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AAGAAGATAATTTAGAACTGA	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		20456	0.001		0.0	False		,,,				2504	0.0				p.N401K		.											.	ARCN1-90	0			c.T1203G						.						118.0	100.0	106.0					11																	118464375		2200	4295	6495	SO:0001583	missense	372	exon8			AGATAATTTAGAA	X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.1203T>G	11.37:g.118464375T>G	ENSP00000264028:p.Asn401Lys	94	0		98	42	NM_001655	0	0	10	19	9	B4E1X2|E9PEU4|Q52M80	Missense_Mutation	SNP	ENST00000264028.4	37	CCDS8400.1	.	.	.	.	.	.	.	.	.	.	T	9.897	1.205804	0.22205	.	.	ENSG00000095139	ENST00000392859;ENST00000359415;ENST00000264028	T;T;T	0.17528	2.27;2.27;2.27	5.95	1.01	0.19927	Clathrin adaptor, mu subunit, C-terminal (3);	0.266986	0.47455	D	0.000229	T	0.10121	0.0248	L	0.29908	0.895	0.29104	N	0.881303	B;B;B	0.14438	0.003;0.01;0.002	B;B;B	0.17979	0.006;0.02;0.005	T	0.18085	-1.0348	10	0.30078	T	0.28	-13.078	5.5305	0.16983	0.0:0.491:0.1917:0.3174	.	313;442;401	E9PEU4;B0YIW6;P48444	.;.;COPD_HUMAN	K	313;442;401	ENSP00000376599:N313K;ENSP00000352385:N442K;ENSP00000264028:N401K	ENSP00000264028:N401K	N	+	3	2	ARCN1	117969585	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.769000	0.26604	0.173000	0.19788	0.460000	0.39030	AAT	.		0.438	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389278.1		
SORL1	6653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	121475939	121475939	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:121475939T>G	ENST00000260197.7	+	34	4898	c.4769T>G	c.(4768-4770)gTc>gGc	p.V1590G	SORL1_ENST00000527934.1_Missense_Mutation_p.V205G|SORL1_ENST00000525532.1_Missense_Mutation_p.V534G|SORL1_ENST00000532694.1_Missense_Mutation_p.V436G|SORL1_ENST00000534286.1_Missense_Mutation_p.V500G	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1590	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GTATATAATGTCTACTACAGG	0.443																																					p.V1590G		.											.	SORL1-228	0			c.T4769G						.						121.0	119.0	120.0					11																	121475939		2203	4299	6502	SO:0001583	missense	6653	exon34			ATAATGTCTACTA	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4769T>G	11.37:g.121475939T>G	ENSP00000260197:p.Val1590Gly	61	0		79	30	NM_003105	0	0	0	0	0	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133710	0.56828	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	5.3	4.17	0.49024	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.537145	0.18359	N	0.143626	T	0.61185	0.2327	N	0.19112	0.55	0.51012	D	0.999904	P;P	0.51933	0.942;0.949	P;P	0.52386	0.697;0.659	T	0.60984	-0.7154	10	0.52906	T	0.07	.	10.8817	0.46942	0.0:0.0749:0.0:0.9251	.	205;1590	E9PKB0;Q92673	.;SORL_HUMAN	G	1590;534;436;500;205	ENSP00000260197:V1590G;ENSP00000434634:V534G;ENSP00000432131:V436G;ENSP00000436447:V500G;ENSP00000435405:V205G	ENSP00000260197:V1590G	V	+	2	0	SORL1	120981149	0.992000	0.36948	0.699000	0.30290	0.670000	0.39368	7.698000	0.84413	0.854000	0.35336	0.533000	0.62120	GTC	.		0.443	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	133789844	133789844	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:133789844G>A	ENST00000321016.8	-	18	4006	c.3776C>T	c.(3775-3777)tCc>tTc	p.S1259F	IGSF9B_ENST00000533871.2_Missense_Mutation_p.S1259F			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1259	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCTGCTCTGGGAGGGGGAGCC	0.687																																					p.S1259F		.											.	IGSF9B-68	0			c.C3776T						.						19.0	25.0	23.0					11																	133789844		1888	4098	5986	SO:0001583	missense	22997	exon18			CTCTGGGAGGGGG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3776C>T	11.37:g.133789844G>A	ENSP00000317980:p.Ser1259Phe	32	0		62	27	NM_014987	0	0	0	0	0	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	G	10.57	1.386761	0.25031	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.68479	-0.0;-0.33	5.29	4.38	0.52667	.	0.164446	0.29119	N	0.013091	T	0.47414	0.1444	N	0.08118	0	0.33398	D	0.577033	B	0.06786	0.001	B	0.04013	0.001	T	0.56402	-0.7985	10	0.66056	D	0.02	.	13.4086	0.60929	0.0768:0.0:0.9232:0.0	.	1259	Q9UPX0	TUTLB_HUMAN	F	1259;1101	ENSP00000317980:S1259F;ENSP00000436552:S1101F	ENSP00000317980:S1259F	S	-	2	0	IGSF9B	133295054	1.000000	0.71417	0.411000	0.26484	0.307000	0.27823	7.382000	0.79729	1.243000	0.43853	0.555000	0.69702	TCC	.		0.687	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
ING4	51147	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	6760401	6760401	+	Splice_Site	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr12:6760401C>T	ENST00000396807.4	-	8	749		c.e8-1		ING4_ENST00000423703.2_Splice_Site|ING4_ENST00000446105.2_Splice_Site|ING4_ENST00000341550.4_Splice_Site|ING4_ENST00000486287.1_Splice_Site|ING4_ENST00000412586.2_Splice_Site|ING4_ENST00000444704.2_Splice_Site	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4						apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						TGGGCAAAACCTGAAACAGAG	0.512																																					.		.											.	ING4-515	0			c.563-1G>A						.						112.0	96.0	102.0					12																	6760401		2203	4300	6503	SO:0001630	splice_region_variant	51147	exon8			CAAAACCTGAAAC	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.711-1G>A	12.37:g.6760401C>T		162	0		238	90	NM_001127586	0	0	0	0	0	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Splice_Site	SNP	ENST00000396807.4	37	CCDS44813.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842434	0.71488	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000412586	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5782	0.84706	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ING4	6630662	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	6.445000	0.73456	2.556000	0.86216	0.561000	0.74099	.	.		0.512	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287	Intron
BHLHE41	79365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26276658	26276658	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr12:26276658T>C	ENST00000242728.4	-	4	598	c.251A>G	c.(250-252)gAg>gGg	p.E84G	RP11-283G6.3_ENST00000535914.1_RNA|RP11-283G6.3_ENST00000545819.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	84	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						TACAGCTTTCTCCAGATGTCC	0.408																																					p.E84G		.											.	BHLHE41-226	0			c.A251G						.						93.0	92.0	92.0					12																	26276658		2202	4300	6502	SO:0001583	missense	79365	exon4			GCTTTCTCCAGAT	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.251A>G	12.37:g.26276658T>C	ENSP00000242728:p.Glu84Gly	44	0		48	19	NM_030762	0	0	9	18	9	A2I2N8	Missense_Mutation	SNP	ENST00000242728.4	37	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546283	0.65198	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	D	0.98120	-4.73	4.15	4.15	0.48705	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	U	0.000000	D	0.98172	0.9396	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98797	1.0738	10	0.87932	D	0	-16.7562	12.4813	0.55844	0.0:0.0:0.0:1.0	.	84	Q9C0J9	BHE41_HUMAN	G	84	ENSP00000242728:E84G	ENSP00000242728:E84G	E	-	2	0	BHLHE41	26167925	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.709000	0.84645	1.876000	0.54355	0.528000	0.53228	GAG	.		0.408	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
ERGIC2	51290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	29502995	29502995	+	Silent	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr12:29502995A>T	ENST00000360150.4	-	9	654	c.579T>A	c.(577-579)atT>atA	p.I193I		NM_016570.2	NP_057654.2	Q96RQ1	ERGI2_HUMAN	ERGIC and golgi 2	193					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)				endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)					GAGGATGTGGAATTGCCCTGA	0.303																																					p.I193I		.											.	ERGIC2-91	0			c.T579A						.						57.0	53.0	54.0					12																	29502995		1824	4085	5909	SO:0001819	synonymous_variant	51290	exon9			ATGTGGAATTGCC	AF216751	CCDS41765.1	12p11.22	2006-02-08							30208	protein-coding gene	gene with protein product		612236				11445006, 12932305	Standard	NM_016570		Approved	PTX1, Erv41	uc001riv.3	Q96RQ1		ENST00000360150.4:c.579T>A	12.37:g.29502995A>T		168	0		214	77	NM_016570	0	0	0	0	0	A6NHH6|Q53GY2|Q8N2Q9|Q9BVV9|Q9NZA3	Silent	SNP	ENST00000360150.4	37	CCDS41765.1	.	.	.	.	.	.	.	.	.	.	a	11.11	1.541269	0.27563	.	.	ENSG00000087502	ENST00000548909	.	.	.	5.78	0.983	0.19767	.	.	.	.	.	T	0.55114	0.1900	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45556	-0.9253	4	.	.	.	.	8.0069	0.30329	0.655:0.0:0.345:0.0	.	.	.	.	T	3	.	.	S	-	1	0	ERGIC2	29394262	0.982000	0.34865	1.000000	0.80357	0.989000	0.77384	0.257000	0.18369	0.143000	0.18926	0.524000	0.50904	TCC	.		0.303	ERGIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403489.1	NM_016570	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	80730767	80730767	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr12:80730767A>T	ENST00000547103.1	+	41	4786	c.4780A>T	c.(4780-4782)Aat>Tat	p.N1594Y	OTOGL_ENST00000458043.2_Missense_Mutation_p.N1606Y			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1594	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						AATAATTGTCAATCGGTTGGC	0.279																																					p.N1606Y		.											.	.	0			c.A4816T						.						28.0	26.0	26.0					12																	80730767		1788	4046	5834	SO:0001583	missense	283310	exon41			ATTGTCAATCGGT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4780A>T	12.37:g.80730767A>T	ENSP00000447211:p.Asn1594Tyr	30	0		12	5	NM_173591	0	0	0	0	0	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	A	14.88	2.668809	0.47677	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.58652	0.32;0.32	4.92	3.72	0.42706	.	.	.	.	.	T	0.65428	0.2690	M	0.72118	2.19	0.28910	N	0.892741	.	.	.	.	.	.	T	0.61888	-0.6970	7	0.59425	D	0.04	.	10.9776	0.47475	0.8598:0.0:0.0:0.1402	.	.	.	.	Y	1594;1606	ENSP00000447211:N1594Y;ENSP00000400895:N1606Y	ENSP00000400895:N1606Y	N	+	1	0	OTOGL	79254898	1.000000	0.71417	0.989000	0.46669	0.943000	0.58893	4.208000	0.58486	0.757000	0.33036	0.482000	0.46254	AAT	.		0.279	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PPP1CC	5501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	111168372	111168372	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr12:111168372C>T	ENST00000335007.5	-	3	570	c.380G>A	c.(379-381)tGt>tAt	p.C127Y	PPP1CC_ENST00000546933.1_Missense_Mutation_p.C136Y|PPP1CC_ENST00000550991.1_Missense_Mutation_p.C127Y|PPP1CC_ENST00000340766.5_Missense_Mutation_p.C127Y|PPP1CC_ENST00000551690.1_5'Flank|PPP1CC_ENST00000551676.1_Missense_Mutation_p.C127Y	NM_002710.3	NP_002701.1	P36873	PP1G_HUMAN	protein phosphatase 1, catalytic subunit, gamma isozyme	127					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|large_intestine(2)|lung(3)	6						GATGCTGGCACATTCATGGTT	0.338																																					p.C127Y		.											.	PPP1CC-1082	0			c.G380A						.						62.0	67.0	65.0					12																	111168372		2203	4300	6503	SO:0001583	missense	5501	exon3			CTGGCACATTCAT		CCDS9150.1, CCDS58279.1	12q24.1-q24.2	2013-01-17	2010-03-05		ENSG00000186298	ENSG00000186298	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9283	protein-coding gene	gene with protein product		176914	"""protein phosphatase 1, catalytic subunit, gamma isoform"""				Standard	NM_002710		Approved	PP1C, PP1gamma	uc021rdx.1	P36873	OTTHUMG00000169531	ENST00000335007.5:c.380G>A	12.37:g.111168372C>T	ENSP00000335084:p.Cys127Tyr	13	0		19	7	NM_002710	0	0	18	35	17		Missense_Mutation	SNP	ENST00000335007.5	37	CCDS9150.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.520313	0.85495	.	.	ENSG00000186298	ENST00000335007;ENST00000340766;ENST00000546933;ENST00000550991;ENST00000551676	D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87	5.61	5.61	0.85477	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.039374	0.85682	D	0.000000	D	0.93015	0.7777	H	0.95611	3.695	0.80722	D	1	P	0.51240	0.943	P	0.50231	0.635	D	0.94583	0.7781	10	0.87932	D	0	-4.8814	19.998	0.97395	0.0:1.0:0.0:0.0	.	127	P36873	PP1G_HUMAN	Y	127;127;136;127;127	ENSP00000335084:C127Y;ENSP00000341779:C127Y;ENSP00000447122:C136Y;ENSP00000448981:C127Y;ENSP00000448437:C127Y	ENSP00000335084:C127Y	C	-	2	0	PPP1CC	109652755	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.692000	0.84203	2.804000	0.96469	0.462000	0.41574	TGT	.		0.338	PPP1CC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404659.1		
SSTR1	6751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	38678806	38678806	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr14:38678806T>C	ENST00000267377.2	+	3	829	c.212T>C	c.(211-213)gTg>gCg	p.V71A		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	71					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	GTGTGCCTGGTGGGGCTGTGT	0.562																																					p.V71A		.											.	SSTR1-947	0			c.T212C						.						144.0	130.0	135.0					14																	38678806		2203	4300	6503	SO:0001583	missense	6751	exon3			GCCTGGTGGGGCT		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.212T>C	14.37:g.38678806T>C	ENSP00000267377:p.Val71Ala	122	0		133	48	NM_001049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000267377.2	37	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.664028	0.47572	.	.	ENSG00000139874	ENST00000267377	T	0.20598	2.06	4.74	3.58	0.41010	.	0.000000	0.48767	D	0.000167	T	0.16685	0.0401	L	0.32530	0.975	0.49687	D	0.99981	B	0.31581	0.329	B	0.32090	0.14	T	0.04427	-1.0952	10	0.52906	T	0.07	.	10.861	0.46827	0.0:0.0:0.1584:0.8416	.	71	P30872	SSR1_HUMAN	A	71	ENSP00000267377:V71A	ENSP00000267377:V71A	V	+	2	0	SSTR1	37748557	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.841000	0.86834	0.828000	0.34709	0.533000	0.62120	GTG	.		0.562	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
ZBTB1	22890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64988346	64988346	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr14:64988346C>G	ENST00000554015.1	+	4	555	c.124C>G	c.(124-126)Cta>Gta	p.L42V	ZBTB1_ENST00000394712.2_Missense_Mutation_p.L42V|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Missense_Mutation_p.L42V			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	42	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		CAAGGCAGTTCTAGCTGCCTG	0.393																																					p.L42V		.											.	ZBTB1-91	0			c.C124G						.						106.0	98.0	101.0					14																	64988346		2203	4300	6503	SO:0001583	missense	22890	exon2			GCAGTTCTAGCTG	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.124C>G	14.37:g.64988346C>G	ENSP00000451000:p.Leu42Val	63	0		87	27	NM_014950	0	0	4	7	3	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937405	0.73557	.	.	ENSG00000126804	ENST00000553583;ENST00000556965;ENST00000554015;ENST00000358738;ENST00000394712	D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52	6.16	2.42	0.29668	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.250565	0.28219	N	0.016157	D	0.95385	0.8502	H	0.95043	3.615	0.46203	D	0.998929	D;D	0.76494	0.999;0.997	D;D	0.85130	0.994;0.997	D	0.94162	0.7415	10	0.87932	D	0	-10.7701	9.9144	0.41425	0.0:0.6811:0.0:0.3189	.	42;42	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	V	42	ENSP00000451584:L42V;ENSP00000450689:L42V;ENSP00000451000:L42V;ENSP00000351587:L42V;ENSP00000378201:L42V	ENSP00000351587:L42V	L	+	1	2	ZBTB1	64058099	0.970000	0.33590	0.892000	0.35008	0.997000	0.91878	1.715000	0.37971	0.195000	0.20347	0.650000	0.86243	CTA	.		0.393	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
NPAP1	23742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	24921405	24921405	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:24921405C>T	ENST00000329468.2	+	1	865	c.391C>T	c.(391-393)Cgt>Tgt	p.R131C		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	131					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R131C(1)									GCCTTCACCACGTGAGCCGGC	0.627																																					p.R131C		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.C391T						.						51.0	43.0	46.0					15																	24921405		2203	4300	6503	SO:0001583	missense	23742	exon1			TCACCACGTGAGC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.391C>T	15.37:g.24921405C>T	ENSP00000333735:p.Arg131Cys	51	0		75	26	NM_018958	0	0	0	0	0		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	7.490	0.650540	0.14516	.	.	ENSG00000185823	ENST00000329468	T	0.06294	3.32	2.27	1.33	0.21861	.	4.968620	0.00575	N	0.000313	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	1	P	0.43094	0.799	B	0.37780	0.258	T	0.39643	-0.9604	10	0.56958	D	0.05	.	8.6687	0.34137	0.2269:0.7731:0.0:0.0	.	131	Q9NZP6	CO002_HUMAN	C	131	ENSP00000333735:R131C	ENSP00000333735:R131C	R	+	1	0	C15orf2	22472498	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.028000	0.13644	0.082000	0.17018	-2.175000	0.00321	CGT	.		0.627	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
TJP1	7082	ucsc.edu;bcgsc.ca	37	15	30010892	30010892	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:30010892C>A	ENST00000346128.6	-	21	3928	c.3454G>T	c.(3454-3456)Gca>Tca	p.A1152S	TJP1_ENST00000356107.6_Missense_Mutation_p.A1152S|TJP1_ENST00000400011.2_Missense_Mutation_p.A1076S|TJP1_ENST00000545208.2_Missense_Mutation_p.A1072S	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1152					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		AGGGCGGATGCTCTAGGTGCC	0.597																																					p.A1152S	Melanoma(77;681 1843 6309 6570)												.	TJP1-95	0			c.G3454T						.						101.0	106.0	104.0					15																	30010892		2100	4228	6328	SO:0001583	missense	7082	exon21			CGGATGCTCTAGG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3454G>T	15.37:g.30010892C>A	ENSP00000281537:p.Ala1152Ser	182	2		230	76	NM_003257	0	0	8	20	12	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	1.722	-0.496273	0.04291	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.05786	3.39;3.5	6.05	2.57	0.30868	.	0.392909	0.28612	N	0.014722	T	0.02380	0.0073	N	0.03608	-0.345	0.80722	D	1	B;B;B;B	0.14438	0.0;0.0;0.0;0.01	B;B;B;B	0.17098	0.001;0.002;0.001;0.017	T	0.49041	-0.8980	10	0.13108	T	0.6	.	5.5402	0.17033	0.0:0.2831:0.1345:0.5823	.	1145;1072;1152;1076	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	S	1152;1076;1152;1072;1072	ENSP00000281537:A1152S;ENSP00000382890:A1076S	ENSP00000281537:A1152S	A	-	1	0	TJP1	27798184	1.000000	0.71417	0.134000	0.22075	0.106000	0.19336	2.424000	0.44714	0.191000	0.20236	-0.312000	0.09012	GCA	.		0.597	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
C15orf52	388115	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40631768	40631768	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:40631768G>A	ENST00000559313.1	-	3	323	c.308C>T	c.(307-309)aCa>aTa	p.T103I	C15orf52_ENST00000557973.1_5'Flank|C15orf52_ENST00000397536.2_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	103							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GAGTGCTGGTGTGGTCACAGC	0.662																																					p.T103I													.	C15orf52-153	0			c.C308T						.						85.0	94.0	91.0					15																	40631768		2140	4235	6375	SO:0001583	missense	388115	exon3			GCTGGTGTGGTCA	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.308C>T	15.37:g.40631768G>A	ENSP00000453969:p.Thr103Ile	109	1		108	49	NM_207380	0	0	4	5	1	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	ENST00000559313.1	37	CCDS10055.2	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436789	0.62955	.	.	ENSG00000188549	ENST00000382688	.	.	.	5.17	4.24	0.50183	.	0.513303	0.17847	N	0.160005	T	0.61098	0.2320	M	0.67953	2.075	0.19575	N	0.999964	D	0.63046	0.992	P	0.59357	0.856	T	0.54443	-0.8293	9	0.72032	D	0.01	-2.0548	11.0227	0.47728	0.0:0.0:0.8139:0.1861	.	103	Q6ZUT6	CO052_HUMAN	I	103	.	ENSP00000372135:T103I	T	-	2	0	C15orf52	38419060	0.145000	0.22656	0.060000	0.19600	0.492000	0.33523	2.204000	0.42761	1.152000	0.42452	0.563000	0.77884	ACA	.		0.662	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54557623	54557623	+	Silent	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:54557623T>A	ENST00000260323.11	+	9	3747	c.3747T>A	c.(3745-3747)gtT>gtA	p.V1249V	UNC13C_ENST00000545554.1_Silent_p.V1249V|UNC13C_ENST00000537900.1_Silent_p.V1247V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1249	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGTTCAAGTTGGAAAGAACA	0.318																																					p.V1249V		.											.	UNC13C-51	0			c.T3747A						.						54.0	50.0	51.0					15																	54557623		1800	4067	5867	SO:0001819	synonymous_variant	440279	exon8			TCAAGTTGGAAAG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3747T>A	15.37:g.54557623T>A		118	0		174	70	NM_001080534	0	0	0	0	0	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																			.		0.318	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
SNX1	6642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64424017	64424017	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:64424017G>C	ENST00000559844.1	+	11	1161	c.1147G>C	c.(1147-1149)Gaa>Caa	p.E383Q	SNX1_ENST00000353874.4_Missense_Mutation_p.E383Q|SNX1_ENST00000261889.5_Missense_Mutation_p.E383Q|SNX1_ENST00000560829.1_Missense_Mutation_p.E165Q|SNX1_ENST00000561026.1_Missense_Mutation_p.E318Q			Q13596	SNX1_HUMAN	sorting nexin 1	383	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GCTCCACCAGGAACAGGCCAA	0.537																																					p.E383Q		.											.	SNX1-226	0			c.G1147C						.						125.0	118.0	120.0					15																	64424017		2203	4300	6503	SO:0001583	missense	6642	exon11			CACCAGGAACAGG	BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1147G>C	15.37:g.64424017G>C	ENSP00000453785:p.Glu383Gln	127	0		174	69	NM_003099	0	0	48	75	27	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Missense_Mutation	SNP	ENST00000559844.1	37	CCDS32266.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180341	0.78677	.	.	ENSG00000028528	ENST00000380285;ENST00000353874;ENST00000261889	T	0.32023	1.47	5.2	5.2	0.72013	Vps5 C-terminal (1);	0.092925	0.64402	D	0.000001	T	0.38532	0.1044	L	0.45137	1.4	0.80722	D	1	P;B;P;P;B;P;P	0.47106	0.89;0.167;0.74;0.74;0.365;0.475;0.571	P;B;P;P;B;B;B	0.48952	0.596;0.34;0.513;0.457;0.142;0.411;0.378	T	0.09885	-1.0654	10	0.52906	T	0.07	-19.057	17.8936	0.88879	0.0:0.0:1.0:0.0	.	383;293;383;383;318;383;383	Q6ZRJ8;Q59GU6;Q53HL9;Q53GY8;Q13596-2;A6NKH4;Q13596	.;.;.;.;.;.;SNX1_HUMAN	Q	383;383;318	ENSP00000326668:E383Q	ENSP00000261889:E318Q	E	+	1	0	SNX1	62211070	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.657000	0.98554	2.693000	0.91896	0.561000	0.74099	GAA	.		0.537	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418559.1	NM_003099	
ANP32A	8125	ucsc.edu	37	15	69072440	69072440	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:69072440C>A	ENST00000465139.2	-	7	873	c.730G>T	c.(730-732)Gag>Tag	p.E244*	ANP32A_ENST00000483551.2_5'UTR	NM_006305.3	NP_006296.1	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	244	Asp/Glu-rich (highly acidic).|Interaction with E4F1. {ECO:0000250}.				gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|nucleocytoplasmic transport (GO:0006913)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						TCTTCTCCCTCATCTTCAGGT	0.408																																					p.E244X													.	.	0			c.G730T						.						64.0	71.0	69.0					15																	69072440		2199	4298	6497	SO:0001587	stop_gained	8125	exon7			CTCCCTCATCTTC	AF025684	CCDS45292.1	15q23	2008-05-14			ENSG00000140350	ENSG00000140350		"""ANP32 acidic nuclear phosphoproteins"""	13233	protein-coding gene	gene with protein product		600832		C15orf1		8970164, 9144194	Standard	NM_006305		Approved	LANP, PP32, I1PP2A, PHAPI, MAPM, mapmodulin	uc002arl.3	P39687	OTTHUMG00000154502	ENST00000465139.2:c.730G>T	15.37:g.69072440C>A	ENSP00000417864:p.Glu244*	54	3		48	22	NM_006305	0	0	26	44	18	B2R6T4|Q53FK4|Q5J8L8|Q7M4N6	Nonsense_Mutation	SNP	ENST00000465139.2	37	CCDS45292.1	.	.	.	.	.	.	.	.	.	.	C	36	5.661156	0.96734	.	.	ENSG00000140350	ENST00000465139	.	.	.	5.11	5.11	0.69529	.	0.138458	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	17.8884	0.88864	0.0:1.0:0.0:0.0	.	.	.	.	X	244	.	ENSP00000417864:E244X	E	-	1	0	ANP32A	66859494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.769000	0.74985	2.537000	0.85549	0.561000	0.74099	GAG	.		0.408	ANP32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335525.2		
ALPK3	57538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	85411510	85411510	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr15:85411510G>C	ENST00000258888.5	+	14	5714	c.5547G>C	c.(5545-5547)agG>agC	p.R1849S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1849					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTGCTGGCAGGAAAGGCTCCC	0.627																																					p.R1849S		.											.	ALPK3-337	0			c.G5547C						.						56.0	65.0	62.0					15																	85411510		2203	4299	6502	SO:0001583	missense	57538	exon14			TGGCAGGAAAGGC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5547G>C	15.37:g.85411510G>C	ENSP00000258888:p.Arg1849Ser	65	0		92	41	NM_020778	0	0	0	6	6	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610641	0.66558	.	.	ENSG00000136383	ENST00000258888	T	0.68903	-0.36	3.93	1.99	0.26369	.	0.271361	0.27778	N	0.017892	T	0.76307	0.3969	M	0.74258	2.255	0.37283	D	0.907916	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.75625	-0.3253	10	0.54805	T	0.06	-23.6009	5.715	0.17954	0.3613:0.0:0.6387:0.0	.	150;1849	B4DU37;Q96L96	.;ALPK3_HUMAN	S	1849	ENSP00000258888:R1849S	ENSP00000258888:R1849S	R	+	3	2	ALPK3	83212514	1.000000	0.71417	0.996000	0.52242	0.906000	0.53458	0.646000	0.24797	0.408000	0.25621	0.313000	0.20887	AGG	.		0.627	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
NPIPB5	100132247	broad.mit.edu;bcgsc.ca	37	16	22545906	22545906	+	Silent	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr16:22545906C>T	ENST00000517539.1	+	8	1677	c.1602C>T	c.(1600-1602)gcC>gcT	p.A534A	NPIPB5_ENST00000424340.1_Silent_p.A534A|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	534	Pro-rich.					integral component of membrane (GO:0016021)											AGACACCTGCCGAGCGTCTGC	0.592																																					p.A534A													.	.	0			c.C1602T						.						4.0	4.0	4.0					16																	22545906		650	1439	2089	SO:0001819	synonymous_variant	0	exon7			ACCTGCCGAGCGT		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1602C>T	16.37:g.22545906C>T		27	0		71	14	NM_001135865	0	0	322	345	23	B4DK13	Silent	SNP	ENST00000517539.1	37	CCDS45443.1																																																																																			.		0.592	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
ZNF668	79759	broad.mit.edu;bcgsc.ca	37	16	31072415	31072415	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr16:31072415C>G	ENST00000538906.1	-	3	2618	c.1834G>C	c.(1834-1836)Gga>Cga	p.G612R	ZNF668_ENST00000426488.2_Missense_Mutation_p.G635R|ZNF668_ENST00000417110.2_5'Flank|ZNF668_ENST00000300849.4_Missense_Mutation_p.G612R|ZNF668_ENST00000394983.2_Missense_Mutation_p.G612R|ZNF668_ENST00000535577.1_Missense_Mutation_p.G612R|ZNF668_ENST00000539836.3_Missense_Mutation_p.G635R	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						TCAGGCATTCCTAGCAAAGCC	0.657																																					p.G635R	Colon(181;1111 1980 5060 10512 25785)												.	ZNF668-585	0			c.G1903C						.						32.0	40.0	37.0					16																	31072415		2158	4276	6434	SO:0001583	missense	79759	exon4			GCATTCCTAGCAA		CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.1834G>C	16.37:g.31072415C>G	ENSP00000440149:p.Gly612Arg	93	2		93	34	NM_001172669	0	0	4	7	3	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	ENST00000538906.1	37	CCDS10701.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004650	0.74932	.	.	ENSG00000167394	ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849	T;T;T;T;T	0.07327	3.2;3.22;3.22;3.22;3.22	5.05	5.05	0.67936	.	0.417562	0.21039	N	0.081215	T	0.10078	0.0247	N	0.14661	0.345	0.42318	D	0.992244	D	0.54207	0.965	P	0.51016	0.656	T	0.40021	-0.9585	10	0.29301	T	0.29	-5.1861	17.3426	0.87301	0.0:1.0:0.0:0.0	.	612	Q96K58	ZN668_HUMAN	R	635;612;612;612;612	ENSP00000442573:G635R;ENSP00000441349:G612R;ENSP00000440149:G612R;ENSP00000378434:G612R;ENSP00000300849:G612R	ENSP00000300849:G612R	G	-	1	0	ZNF668	30979916	0.358000	0.24947	1.000000	0.80357	0.908000	0.53690	2.421000	0.44688	2.640000	0.89533	0.561000	0.74099	GGA	.		0.657	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706	
CES3	23491	broad.mit.edu	37	16	66997181	66997181	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr16:66997181T>G	ENST00000303334.4	+	2	253	c.182T>G	c.(181-183)cTg>cGg	p.L61R	RP11-361L15.4_ENST00000566869.1_RNA|CES3_ENST00000394037.1_Missense_Mutation_p.L61R	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	61						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AATGTCTTTCTGGGCATTCCA	0.662																																					p.L61R													.	CES3-517	0			c.T182G						.						59.0	62.0	61.0					16																	66997181		2200	4300	6500	SO:0001583	missense	23491	exon2			TCTTTCTGGGCAT	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.182T>G	16.37:g.66997181T>G	ENSP00000304782:p.Leu61Arg	64	3		91	10	NM_024922	0	0	3	3	0	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.887142	0.52014	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.70749	-0.51;-0.51	4.31	3.19	0.36642	Carboxylesterase, type B (1);	0.000000	0.30752	N	0.008957	T	0.74504	0.3725	L	0.48260	1.515	0.80722	D	1	D	0.65815	0.995	P	0.61722	0.893	T	0.74682	-0.3583	10	0.87932	D	0	.	9.289	0.37775	0.1615:0.0:0.0:0.8385	.	61	Q6UWW8	EST3_HUMAN	R	61	ENSP00000304782:L61R;ENSP00000377602:L61R	ENSP00000304782:L61R	L	+	2	0	CES3	65554682	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	6.725000	0.74752	0.748000	0.32831	0.533000	0.62120	CTG	.		0.662	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
PKD1L2	114780	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81193369	81193369	+	RNA	SNP	C	C	G	rs566575678	byFrequency	TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr16:81193369C>G	ENST00000525539.1	-	0	3753				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AAATAGTAGACCCCTTCTCCA	0.587																																					.													.	PKD1L2-92	0			.						.						47.0	49.0	48.0					16																	81193369		1997	4182	6179			114780	.			AGTAGACCCCTTC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81193369C>G		103	0		125	52	.	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37																																																																																				.		0.587	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
SSH2	85464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27959441	27959441	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr17:27959441T>A	ENST00000269033.3	-	15	2841	c.2690A>T	c.(2689-2691)aAg>aTg	p.K897M	RP11-68I3.2_ENST00000581474.1_RNA|SSH2_ENST00000540801.1_Missense_Mutation_p.K924M	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	897					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTTTGAATTCTTACGAGTGGA	0.502																																					p.K897M		.											.	SSH2-92	0			c.A2690T						.						184.0	192.0	189.0					17																	27959441		2203	4300	6503	SO:0001583	missense	85464	exon15			GAATTCTTACGAG	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2690A>T	17.37:g.27959441T>A	ENSP00000269033:p.Lys897Met	97	0		189	106	NM_033389	0	0	0	2	2	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.585604	0.66105	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.19806	2.14;2.12	5.97	4.89	0.63831	.	0.456816	0.25546	N	0.029933	T	0.43809	0.1264	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.36407	-0.9749	10	0.87932	D	0	-19.645	11.9775	0.53100	0.0:0.0675:0.0:0.9325	.	924;897	F5H527;Q76I76	.;SSH2_HUMAN	M	897;924	ENSP00000269033:K897M;ENSP00000444743:K924M	ENSP00000269033:K897M	K	-	2	0	SSH2	24983567	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.807000	0.69157	1.089000	0.41292	0.472000	0.43445	AAG	.		0.502	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
TGIF1	7050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	3452341	3452341	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr18:3452341G>C	ENST00000330513.5	+	1	667	c.364G>C	c.(364-366)Ggt>Cgt	p.G122R	TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000577543.1_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	122					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GGGCGCACAGGGTCCAGCTCC	0.687																																					p.G122R		.											.	TGIF1-227	0			c.G364C						.						14.0	16.0	15.0					18																	3452341		2171	4257	6428	SO:0001583	missense	7050	exon1			GCACAGGGTCCAG	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.364G>C	18.37:g.3452341G>C	ENSP00000327959:p.Gly122Arg	98	0		99	50	NM_170695	0	0	0	0	0	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	ENST00000330513.5	37	CCDS11834.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037731	0.54896	.	.	ENSG00000177426	ENST00000330513	T	0.52295	0.67	3.89	3.01	0.34805	.	.	.	.	.	T	0.37348	0.1000	L	0.38175	1.15	0.21473	N	0.999675	P	0.44877	0.845	B	0.41813	0.367	T	0.15235	-1.0444	9	0.52906	T	0.07	3.9769	7.1745	0.25736	0.1232:0.0:0.8768:0.0	.	122	Q15583	TGIF1_HUMAN	R	122	ENSP00000327959:G122R	ENSP00000327959:G122R	G	+	1	0	TGIF1	3442341	0.004000	0.15560	0.040000	0.18447	0.018000	0.09664	1.238000	0.32707	0.855000	0.35359	0.655000	0.94253	GGT	.		0.687	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
PTPRM	5797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	8378412	8378412	+	Splice_Site	SNP	G	G	T	rs374669816		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr18:8378412G>T	ENST00000332175.8	+	25	4610	c.3573G>T	c.(3571-3573)cgG>cgT	p.R1191R	PTPRM_ENST00000580170.1_Splice_Site_p.R1204R|PTPRM_ENST00000400060.4_Splice_Site_p.R1205R|PTPRM_ENST00000400053.4_Splice_Site_p.R1129R|PTPRM_ENST00000444013.1_Splice_Site_p.R978R	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1191	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGGAATTCCGGGTAAGTGATG	0.493																																					p.R1204R		.											.	PTPRM-228	0			c.G3612T						.						116.0	97.0	103.0					18																	8378412		2203	4300	6503	SO:0001630	splice_region_variant	5797	exon27			ATTCCGGGTAAGT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3573+1G>T	18.37:g.8378412G>T		82	0		150	57	NM_001105244	0	0	0	0	0	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.493	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		Silent
KIAA1468	57614	bcgsc.ca	37	18	59954615	59954615	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr18:59954615G>T	ENST00000398130.2	+	26	3517	c.3285G>T	c.(3283-3285)ttG>ttT	p.L1095F	KIAA1468_ENST00000256858.6_Missense_Mutation_p.L1129F	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	1095										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				AGTTAGCCTTGGTGAACAACT	0.353																																					p.L1095F													.	KIAA1468-158	0			c.G3285T						.						165.0	151.0	156.0					18																	59954615		2203	4300	6503	SO:0001583	missense	57614	exon26			AGCCTTGGTGAAC	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.3285G>T	18.37:g.59954615G>T	ENSP00000381198:p.Leu1095Phe	74	0		82	5	NM_020854	0	0	14	14	0		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035142	0.35893	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.74421	-0.84;-0.84	5.71	4.84	0.62591	Armadillo-type fold (1);	0.063705	0.64402	D	0.000003	T	0.51736	0.1692	N	0.08118	0	0.51233	D	0.999914	B;B	0.15141	0.007;0.012	B;B	0.18561	0.022;0.015	T	0.45702	-0.9243	9	.	.	.	-5.9435	9.7506	0.40473	0.0702:0.0:0.7902:0.1396	.	1129;1095	Q9P260-2;Q9P260	.;K1468_HUMAN	F	1095;1129	ENSP00000381198:L1095F;ENSP00000256858:L1129F	.	L	+	3	2	KIAA1468	58105595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.414000	0.59802	1.558000	0.49541	0.650000	0.86243	TTG	.		0.353	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
FUT6	2528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5832530	5832530	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:5832530G>T	ENST00000318336.4	-	3	1243	c.49C>A	c.(49-51)Ctg>Atg	p.L17M	FUT6_ENST00000524754.1_Missense_Mutation_p.L17M|FUT6_ENST00000527106.1_Missense_Mutation_p.L17M|FUT6_ENST00000592563.1_Missense_Mutation_p.L17M|FUT6_ENST00000286955.5_Missense_Mutation_p.L17M	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	17					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						AGCGTGGTCAGACAGCAGCGC	0.572																																					p.L17M		.											.	FUT6-90	0			c.C49A						.						35.0	30.0	32.0					19																	5832530		2203	4300	6503	SO:0001583	missense	2528	exon3			TGGTCAGACAGCA		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.49C>A	19.37:g.5832530G>T	ENSP00000313398:p.Leu17Met	113	0		139	61	NM_000150	0	0	6	17	11	A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	ENST00000318336.4	37	CCDS12152.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377927	0.24944	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955;ENST00000341530;ENST00000529165;ENST00000531085;ENST00000531199;ENST00000532464;ENST00000528505	T;T;T;T;T;T;T;T;T	0.61859	1.81;1.81;1.81;1.81;1.81;0.81;0.24;0.07;0.19	3.7	1.52	0.23074	.	0.960505	0.08559	U	0.927769	T	0.72803	0.3506	M	0.77616	2.38	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.55068	-0.8198	10	0.54805	T	0.06	.	6.2965	0.21089	0.1124:0.195:0.6925:0.0	.	17;17	C9J8A2;P51993	.;FUT6_HUMAN	M	17	ENSP00000431708:L17M;ENSP00000432954:L17M;ENSP00000313398:L17M;ENSP00000286955:L17M;ENSP00000436547:L17M;ENSP00000432161:L17M;ENSP00000436413:L17M;ENSP00000431880:L17M;ENSP00000433811:L17M	ENSP00000286955:L17M	L	-	1	2	FUT6	5783530	0.017000	0.18338	0.005000	0.12908	0.033000	0.12548	1.348000	0.33987	0.849000	0.35215	0.436000	0.28706	CTG	.		0.572	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	NM_000150	
CYP4F8	11283	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15739650	15739650	+	RNA	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:15739650C>G	ENST00000441682.2	+	0	1455							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						TCGGCGGGGCCCAGGTGAGGC	0.582																																					.													.	CYP4F8-90	0			.						.						40.0	45.0	43.0					19																	15739650		2016	4203	6219			11283	.			CGGGGCCCAGGTG	AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15739650C>G		36	0		66	30	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000441682.2	37		.	.	.	.	.	.	.	.	.	.	.	17.80	3.477280	0.63849	.	.	ENSG00000186526	ENST00000441682;ENST00000325723	.	.	.	3.32	3.32	0.38043	Cytochrome P450, conserved site (1);	0.000000	0.64402	U	0.000001	T	0.71459	0.3342	.	.	.	0.49051	D	0.999743	P;D	0.61697	0.566;0.99	P;D	0.63877	0.624;0.919	T	0.81393	-0.0953	7	0.87932	D	0	.	12.1517	0.54053	0.0:1.0:0.0:0.0	.	277;465	B4DU85;P98187	.;CP4F8_HUMAN	R	464;277	.	ENSP00000314398:P277R	P	+	2	0	CYP4F8	15600650	1.000000	0.71417	0.998000	0.56505	0.722000	0.41435	4.681000	0.61663	1.681000	0.50988	0.436000	0.28706	CCC	.		0.582	CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript		NM_007253	
IFNL3	282617	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39735444	39735444	+	Missense_Mutation	SNP	C	C	T	rs201018323	byFrequency	TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:39735444C>T	ENST00000413851.2	-	1	202	c.164G>A	c.(163-165)aGg>aAg	p.R55K	IFNL4_ENST00000606380.1_RNA	NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	55					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											ATCTTTGGCCCTCTTAAAGGC	0.622													C|||	3	0.000599042	0.0008	0.0	5008	,	,		19948	0.0		0.001	False		,,,				2504	0.001				p.R55K		.											.	.	0			c.G164A						.						21.0	24.0	23.0					19																	39735444		2203	4292	6495	SO:0001583	missense	282617	exon1			TTGGCCCTCTTAA	AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.164G>A	19.37:g.39735444C>T	ENSP00000409000:p.Arg55Lys	266	0		347	107	NM_172139	0	0	0	0	0	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Missense_Mutation	SNP	ENST00000413851.2	37	CCDS12530.1	.	.	.	.	.	.	.	.	.	.	C	0.482	-0.879400	0.02550	.	.	ENSG00000197110	ENST00000413851	T	0.26223	1.75	2.97	-4.43	0.03568	.	0.765632	0.12009	N	0.508070	T	0.03739	0.0106	N	0.00521	-1.4	0.18873	N	0.999982	B	0.06786	0.001	B	0.04013	0.001	T	0.37197	-0.9716	10	0.06757	T	0.87	2.9441	0.3638	0.00368	0.1912:0.2524:0.1896:0.3668	.	55	Q8IZI9	IL28B_HUMAN	K	55	ENSP00000409000:R55K	ENSP00000409000:R55K	R	-	2	0	IL28B	44427284	0.000000	0.05858	0.388000	0.26195	0.653000	0.38743	-1.727000	0.01860	-0.398000	0.07679	0.194000	0.17425	AGG	.		0.622	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139	
PSG4	5672	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43708130	43708130	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:43708130G>A	ENST00000405312.3	-	2	575	c.338C>T	c.(337-339)aCg>aTg	p.T113M	PSG4_ENST00000433626.2_Missense_Mutation_p.T113M|PSG4_ENST00000244295.9_Missense_Mutation_p.T113M	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	113	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				ATCCTCCTGCGTGACATTCTG	0.458																																					p.P113L													.	PSG4-91	0			c.C338T						.						272.0	278.0	276.0					19																	43708130		2140	4271	6411	SO:0001583	missense	5672	exon2			TCCTGCGTGACAT		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.338C>T	19.37:g.43708130G>A	ENSP00000384770:p.Thr113Met	236	1		302	95	NM_002780	0	0	0	0	0	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	N	11.42	1.632906	0.29068	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626;ENST00000451895	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	1.65	1.65	0.23941	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82300	0.5007	M	0.91038	3.17	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;1.0	T	0.67569	-0.5637	9	0.87932	D	0	.	6.8053	0.23774	0.0:0.0:1.0:0.0	.	113;113;113	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	M	113;113;113;129	ENSP00000244295:T113M;ENSP00000384770:T113M;ENSP00000387864:T113M;ENSP00000388134:T129M	ENSP00000244295:T113M	T	-	2	0	PSG4	48399970	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	-0.474000	0.06607	1.251000	0.43983	0.173000	0.16961	ACG	.		0.458	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
CCDC9	26093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47767895	47767895	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:47767895G>T	ENST00000221922.6	+	6	720	c.498G>T	c.(496-498)aaG>aaT	p.K166N		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	166							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		ACATTGAGAAGATGAATGAGG	0.617																																					p.K166N		.											.	CCDC9-90	0			c.G498T						.						80.0	63.0	69.0					19																	47767895		2202	4299	6501	SO:0001583	missense	26093	exon6			TGAGAAGATGAAT	AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.498G>T	19.37:g.47767895G>T	ENSP00000221922:p.Lys166Asn	36	0		52	17	NM_015603	0	0	5	7	2		Missense_Mutation	SNP	ENST00000221922.6	37	CCDS12698.1	.	.	.	.	.	.	.	.	.	.	g	16.68	3.191307	0.58017	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	T	0.27890	1.64	4.63	4.63	0.57726	.	0.356482	0.30667	N	0.009121	T	0.53769	0.1817	M	0.67953	2.075	0.44694	D	0.997682	D	0.89917	1.0	D	0.77004	0.989	T	0.55477	-0.8135	10	0.52906	T	0.07	-46.2641	16.3937	0.83548	0.0:0.0:1.0:0.0	.	166	Q9Y3X0	CCDC9_HUMAN	N	166;148	ENSP00000221922:K166N	ENSP00000221922:K166N	K	+	3	2	CCDC9	52459735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.672000	0.54583	2.416000	0.81992	0.561000	0.74099	AAG	.		0.617	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466917.1	NM_015603	
ZNF600	162966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53269420	53269420	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:53269420T>A	ENST00000338230.3	-	3	1856	c.1589A>T	c.(1588-1590)gAg>gTg	p.E530V		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		CTTGCTGCACTCATTACACTT	0.458																																					p.E530V	Esophageal Squamous(196;1235 2112 2375 33339 34207)	.											.	ZNF600-90	0			c.A1589T						.						220.0	195.0	204.0					19																	53269420		2203	4300	6503	SO:0001583	missense	162966	exon3			CTGCACTCATTAC	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.1589A>T	19.37:g.53269420T>A	ENSP00000344791:p.Glu530Val	67	0		109	37	NM_198457	0	0	10	12	2	Q6MZR0	Missense_Mutation	SNP	ENST00000338230.3	37	CCDS12856.1	.	.	.	.	.	.	.	.	.	.	.	12.82	2.052449	0.36181	.	.	ENSG00000189190	ENST00000338230	T	0.17528	2.27	1.51	0.278	0.15673	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18593	0.0446	N	0.11789	0.175	0.09310	N	1	D	0.55172	0.97	D	0.74348	0.983	T	0.16928	-1.0386	9	0.45353	T	0.12	.	5.4227	0.16409	0.251:0.0:0.0:0.749	.	530	Q6ZNG1	ZN600_HUMAN	V	530	ENSP00000344791:E530V	ENSP00000344791:E530V	E	-	2	0	ZNF600	57961232	0.000000	0.05858	0.001000	0.08648	0.042000	0.13812	0.274000	0.18680	-0.139000	0.11414	0.163000	0.16589	GAG	.		0.458	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463093.1	NM_198457	
ZNF761	388561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53959526	53959526	+	RNA	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr19:53959526T>G	ENST00000454407.1	+	0	2218							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AGCTTACAGTTTCAAATCAAA	0.403																																					p.F589V		.											.	ZNF761-91	0			c.T1765G						.						98.0	102.0	101.0					19																	53959526		2203	4299	6502			388561	exon7			TACAGTTTCAAAT	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959526T>G		83	0		103	47	NM_001008401	0	0	1	3	2	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.403	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	15519770	15519770	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:15519770G>T	ENST00000281513.5	-	30	3571	c.3546C>A	c.(3544-3546)ttC>ttA	p.F1182L	NBAS_ENST00000441750.1_Missense_Mutation_p.F1062L	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1182					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TAGAAGAATTGAAGTACTCTC	0.443																																					p.F1182L		.											.	NBAS-94	0			c.C3546A						.						115.0	113.0	114.0					2																	15519770		2203	4300	6503	SO:0001583	missense	51594	exon30			AGAATTGAAGTAC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3546C>A	2.37:g.15519770G>T	ENSP00000281513:p.Phe1182Leu	110	0		150	61	NM_015909	0	0	3	6	3	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.8|27.8	4.863074|4.863074	0.91511|0.91511	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755|ENST00000442506	T;T;T|.	0.32272|.	1.46;1.46;1.46|.	5.79|5.79	4.92|4.92	0.64577|0.64577	Secretory pathway Sec39 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75258|.	0.3825|.	M|M	0.78637|0.78637	2.42|2.42	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	0.992;1.0|.	D;D|.	0.91635|.	0.965;0.999|.	T|.	0.76699|.	-0.2863|.	10|.	0.87932|.	D|.	0|.	.|.	14.7925|14.7925	0.69854|0.69854	0.0691:0.0:0.9309:0.0|0.0691:0.0:0.9309:0.0	.|.	1062;1182|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	L|X	1062;1182;229|230	ENSP00000413201:F1062L;ENSP00000281513:F1182L;ENSP00000396501:F229L|.	ENSP00000281513:F1182L|.	F|S	-|-	3|2	2|0	NBAS|NBAS	15437221|15437221	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.815000|4.815000	0.62634|0.62634	1.461000|1.461000	0.47929|0.47929	0.563000|0.563000	0.77884|0.77884	TTC|TCA	.		0.443	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
ANKRD30BL	554226	bcgsc.ca	37	2	132905741	132905741	+	Missense_Mutation	SNP	G	G	A	rs111770980		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:132905741G>A	ENST00000409867.1	-	6	989	c.740C>T	c.(739-741)aCg>aTg	p.T247M	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	247										endometrium(1)|kidney(3)	4						GCTTTCAGCCGTGTCAGGTGT	0.438																																					.													.	.	0			.						.																																			SO:0001583	missense	554226	.			TCAGCCGTGTCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.740C>T	2.37:g.132905741G>A	ENSP00000386398:p.Thr247Met	284	2		329	17	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.003	-2.579831	0.00129	.	.	ENSG00000163046	ENST00000409867	T	0.40225	1.04	0.109	-0.218	0.13142	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20306	-1.0279	5	0.36615	T	0.2	.	.	.	.	.	.	.	.	M	247	ENSP00000386398:T247M	ENSP00000386398:T247M	T	-	2	0	ANKRD30BL	132622211	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-2.520000	0.00951	-2.990000	0.00280	-3.030000	0.00073	ACG	.		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
RIF1	55183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152320162	152320162	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:152320162A>T	ENST00000243326.5	+	29	4611	c.4128A>T	c.(4126-4128)aaA>aaT	p.K1376N	RIF1_ENST00000444746.2_Missense_Mutation_p.K1376N|RIF1_ENST00000453091.2_Missense_Mutation_p.K1376N|RIF1_ENST00000428287.2_Missense_Mutation_p.K1376N|RIF1_ENST00000430328.2_Missense_Mutation_p.K1376N			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TAGAGGAGAAAAATGTAGAAA	0.348																																					p.K1376N		.											.	RIF1-300	0			c.A4128T						.						72.0	78.0	76.0					2																	152320162		2203	4300	6503	SO:0001583	missense	55183	exon30			GGAGAAAAATGTA	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4128A>T	2.37:g.152320162A>T	ENSP00000243326:p.Lys1376Asn	26	0		25	11	NM_018151	0	0	1	4	3	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	A	0.921	-0.715998	0.03206	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.45	1.54	0.23209	.	0.844182	0.10956	N	0.615469	T	0.20210	0.0486	L	0.41710	1.295	0.09310	N	1	B;B	0.28512	0.078;0.214	B;B	0.21546	0.015;0.035	T	0.21895	-1.0232	10	0.39692	T	0.17	-9.694	3.1462	0.06472	0.5289:0.0:0.2045:0.2666	.	1376;1376	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	N	1376	ENSP00000390181:K1376N;ENSP00000414615:K1376N;ENSP00000415691:K1376N;ENSP00000243326:K1376N;ENSP00000416123:K1376N	ENSP00000243326:K1376N	K	+	3	2	RIF1	152028408	0.003000	0.15002	0.001000	0.08648	0.192000	0.23643	0.898000	0.28404	0.384000	0.24942	0.455000	0.32223	AAA	.		0.348	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160825863	160825863	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:160825863C>G	ENST00000283243.7	-	19	2874	c.2668G>C	c.(2668-2670)Gat>Cat	p.D890H	PLA2R1_ENST00000392771.1_Missense_Mutation_p.D890H	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	890	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GGTGTTCCATCTCTCCAGCTG	0.408																																					p.D890H		.											.	PLA2R1-93	0			c.G2668C						.						116.0	110.0	112.0					2																	160825863		2203	4300	6503	SO:0001583	missense	22925	exon19			TTCCATCTCTCCA	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2668G>C	2.37:g.160825863C>G	ENSP00000283243:p.Asp890His	57	0		59	15	NM_001195641	0	0	0	0	0	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867614	0.72065	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.15834	2.39;2.39	5.8	4.92	0.64577	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.107665	0.64402	D	0.000009	T	0.51143	0.1657	H	0.95365	3.66	0.47994	D	0.999564	B;D;D	0.89917	0.372;1.0;0.999	B;D;D	0.71414	0.309;0.973;0.966	T	0.62604	-0.6819	10	0.51188	T	0.08	.	11.2567	0.49058	0.0:0.9128:0.0:0.0872	.	890;890;890	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	H	890	ENSP00000283243:D890H;ENSP00000376524:D890H	ENSP00000283243:D890H	D	-	1	0	PLA2R1	160534109	0.976000	0.34144	0.999000	0.59377	0.993000	0.82548	1.512000	0.35812	1.426000	0.47256	0.650000	0.86243	GAT	.		0.408	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
TTLL4	9654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219611762	219611762	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:219611762A>C	ENST00000392102.1	+	9	2351	c.2011A>C	c.(2011-2013)Aag>Cag	p.K671Q	TTLL4_ENST00000442769.1_Intron|TTLL4_ENST00000457313.1_Missense_Mutation_p.K506Q|TTLL4_ENST00000258398.4_Missense_Mutation_p.K671Q	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	671	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		GATTGGGAGGAAGGACCGGCT	0.537																																					p.K671Q	GBM(172;1818 2053 15407 20943 49753)	.											.	TTLL4-93	0			c.A2011C						.						135.0	125.0	128.0					2																	219611762		2203	4300	6503	SO:0001583	missense	9654	exon9			GGGAGGAAGGACC		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2011A>C	2.37:g.219611762A>C	ENSP00000375951:p.Lys671Gln	109	0		197	73	NM_014640	0	0	7	11	4	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.973585	0.92919	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000258398	T;T;T	0.09255	3.0;3.0;3.0	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.50548	0.1622	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69982	-0.4997	10	0.87932	D	0	.	15.3584	0.74448	1.0:0.0:0.0:0.0	.	506;671	E9PH58;Q14679	.;TTLL4_HUMAN	Q	506;671;671	ENSP00000393332:K506Q;ENSP00000375951:K671Q;ENSP00000258398:K671Q	ENSP00000258398:K671Q	K	+	1	0	TTLL4	219320006	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.904000	0.92590	2.217000	0.71921	0.482000	0.46254	AAG	.		0.537	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
CCDC108	255101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219878079	219878079	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:219878079C>T	ENST00000341552.5	-	24	3942	c.3859G>A	c.(3859-3861)Ggt>Agt	p.G1287S	CCDC108_ENST00000453220.1_Missense_Mutation_p.G1287S|CCDC108_ENST00000441968.1_Missense_Mutation_p.G1287S|AC097468.4_ENST00000441450.1_RNA	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1287						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTGTCACACCTATGAAATTT	0.542																																					p.G1287S		.											.	CCDC108-94	0			c.G3859A						.						96.0	86.0	89.0					2																	219878079		2202	4299	6501	SO:0001583	missense	255101	exon24			TCACACCTATGAA	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.3859G>A	2.37:g.219878079C>T	ENSP00000340776:p.Gly1287Ser	114	0		179	76	NM_194302	0	0	0	0	0	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	C	31	5.066292	0.93898	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.13307	2.6;2.6;2.6	5.11	5.11	0.69529	.	0.000000	0.42420	D	0.000714	T	0.40222	0.1108	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.31081	-0.9956	10	0.72032	D	0.01	-14.6861	18.1538	0.89686	0.0:1.0:0.0:0.0	.	1287	Q6ZU64	CC108_HUMAN	S	1287	ENSP00000340776:G1287S;ENSP00000413377:G1287S;ENSP00000409117:G1287S	ENSP00000340776:G1287S	G	-	1	0	CCDC108	219586323	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	6.610000	0.74178	2.372000	0.80975	0.650000	0.86243	GGT	.		0.542	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220349151	220349151	+	Silent	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:220349151C>T	ENST00000312358.7	+	30	7098	c.6966C>T	c.(6964-6966)agC>agT	p.S2322S	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2322					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GTCTCAGTAGCAGCATCGAAA	0.692																																					p.S2322S		.											.	SPEG-383	0			c.C6966T						.						15.0	19.0	18.0					2																	220349151		1916	4034	5950	SO:0001819	synonymous_variant	10290	exon30			CAGTAGCAGCATC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.6966C>T	2.37:g.220349151C>T		44	0		52	15	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																			.		0.692	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
STK11IP	114790	hgsc.bcm.edu	37	2	220470428	220470428	+	Silent	SNP	G	G	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr2:220470428G>T	ENST00000456909.1	+	8	807	c.717G>T	c.(715-717)ctG>ctT	p.L239L	STK11IP_ENST00000295641.10_Silent_p.L250L|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	250					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTGATACTGCGAGGCAATG	0.602																																					p.L250L		.											.	STK11IP-91	0			c.G750T						.						32.0	32.0	32.0					2																	220470428		1964	4137	6101	SO:0001819	synonymous_variant	114790	exon8			GATACTGCGAGGC	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.717G>T	2.37:g.220470428G>T		27	0		43	4	NM_052902	0	0	4	4	0	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37																																																																																				.		0.602	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
CRNKL1	51340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	20026023	20026023	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr20:20026023A>T	ENST00000377340.2	-	7	1244	c.1213T>A	c.(1213-1215)Ttc>Atc	p.F405I	CRNKL1_ENST00000536226.1_Missense_Mutation_p.F244I|CRNKL1_ENST00000377327.4_Missense_Mutation_p.F393I	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	405					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TCTCCAAAGAATTCCACAGCT	0.398																																					p.F405I		.											.	CRNKL1-137	0			c.T1213A						.						175.0	173.0	173.0					20																	20026023		2203	4300	6503	SO:0001583	missense	51340	exon7			CAAAGAATTCCAC	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1213T>A	20.37:g.20026023A>T	ENSP00000366557:p.Phe405Ile	110	0		153	54	NM_016652	0	0	5	7	2	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	ENST00000377340.2	37	CCDS33446.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.764213	0.69878	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.08984	3.03;3.03;3.03	5.8	5.8	0.92144	Tetratricopeptide-like helical (1);	0.091092	0.85682	D	0.000000	T	0.13114	0.0318	M	0.70787	2.145	0.80722	D	1	B	0.29716	0.255	B	0.26517	0.07	T	0.02301	-1.1180	10	0.33141	T	0.24	-21.9403	16.1384	0.81506	1.0:0.0:0.0:0.0	.	405	Q9BZJ0	CRNL1_HUMAN	I	393;405;244	ENSP00000366544:F393I;ENSP00000366557:F405I;ENSP00000440733:F244I	ENSP00000366544:F393I	F	-	1	0	CRNKL1	19974023	1.000000	0.71417	0.976000	0.42696	0.987000	0.75469	9.339000	0.96797	2.203000	0.70933	0.460000	0.39030	TTC	.		0.398	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1		
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L													.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		66	2		112	6	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	538	7		773	25	.	0	0	34	34	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
KIAA1755	85449	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	36841970	36841970	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr20:36841970C>T	ENST00000279024.4	-	14	3348	c.3077G>A	c.(3076-3078)cGg>cAg	p.R1026Q		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1026										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CAGGCCTGCCCGGCTCAGGGA	0.677																																					p.R1026Q		.											.	KIAA1755-95	0			c.G3077A						.						25.0	25.0	25.0					20																	36841970		2200	4297	6497	SO:0001583	missense	85449	exon14			CCTGCCCGGCTCA	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3077G>A	20.37:g.36841970C>T	ENSP00000279024:p.Arg1026Gln	47	0		51	23	NM_001029864	0	0	0	0	0	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421251	0.25639	.	.	ENSG00000149633	ENST00000279024	T	0.05717	3.4	5.29	-4.25	0.03766	.	0.891096	0.09443	N	0.801481	T	0.03011	0.0089	N	0.11064	0.09	0.09310	N	1	B	0.17667	0.023	B	0.08055	0.003	T	0.48692	-0.9013	10	0.10902	T	0.67	.	11.6604	0.51343	0.0:0.3634:0.0:0.6366	.	1026	Q5JYT7	K1755_HUMAN	Q	1026	ENSP00000279024:R1026Q	ENSP00000279024:R1026Q	R	-	2	0	KIAA1755	36275384	0.000000	0.05858	0.002000	0.10522	0.669000	0.39330	-2.684000	0.00835	-1.072000	0.03141	-0.224000	0.12420	CGG	.		0.677	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
CABLES2	81928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60967982	60967982	+	Silent	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr20:60967982C>G	ENST00000279101.5	-	7	986	c.978G>C	c.(976-978)tcG>tcC	p.S326S		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	326					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCACCATGTACGACGCAAAGA	0.657																																					p.S326S		.											.	CABLES2-91	0			c.G978C						.						140.0	122.0	128.0					20																	60967982		2203	4300	6503	SO:0001819	synonymous_variant	81928	exon7			CATGTACGACGCA	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.978G>C	20.37:g.60967982C>G		118	0		147	52	NM_031215	0	0	0	0	0	Q5JWL0|Q9BYK0	Silent	SNP	ENST00000279101.5	37	CCDS33503.1	.	.	.	.	.	.	.	.	.	.	C	0.070	-1.204574	0.01568	.	.	ENSG00000149679	ENST00000453274	.	.	.	5.05	-10.1	0.00402	.	.	.	.	.	T	0.30448	0.0765	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39742	-0.9599	4	.	.	.	-34.41	0.1912	0.00134	0.2752:0.1684:0.22:0.3364	.	.	.	.	P	120	.	.	R	-	2	0	CABLES2	60401377	0.000000	0.05858	0.020000	0.16555	0.052000	0.14988	-2.225000	0.01212	-2.475000	0.00527	-1.774000	0.00658	CGT	.		0.657	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
DGCR8	54487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	20077782	20077782	+	Splice_Site	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr22:20077782G>C	ENST00000351989.3	+	5	1735		c.e5+1		DGCR8_ENST00000407755.1_Splice_Site|DGCR8_ENST00000383024.2_Splice_Site	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit						gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GAATCCGTTGGTGAGTTTTTG	0.532																																					.		.											.	DGCR8-90	0			c.1306+1G>C						.						34.0	41.0	38.0					22																	20077782		2198	4297	6495	SO:0001630	splice_region_variant	54487	exon5			CCGTTGGTGAGTT	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1306+1G>C	22.37:g.20077782G>C		36	0		57	25	NM_001190326	0	0	0	0	0	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Splice_Site	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002878	0.35320	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.878	0.88830	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DGCR8	18457782	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	9.225000	0.95219	2.618000	0.88619	0.467000	0.42956	.	.		0.532	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		Intron
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46931730	46931730	+	Silent	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr22:46931730G>A	ENST00000262738.3	-	1	1337	c.1338C>T	c.(1336-1338)taC>taT	p.Y446Y	CELSR1_ENST00000395964.1_Silent_p.Y446Y|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	446	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCACCTCGATGTACACGGTGG	0.672																																					p.Y446Y		.											.	CELSR1-525	0			c.C1338T						.						64.0	39.0	47.0					22																	46931730		2198	4295	6493	SO:0001819	synonymous_variant	9620	exon1			CTCGATGTACACG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1338C>T	22.37:g.46931730G>A		29	0		28	9	NM_014246	0	0	3	4	1	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																			.		0.672	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
IL17RC	84818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9971714	9971714	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:9971714T>C	ENST00000295981.3	+	14	1590	c.1372T>C	c.(1372-1374)Tcc>Ccc	p.S458P	IL17RC_ENST00000383812.4_Missense_Mutation_p.S372P|IL17RC_ENST00000455057.1_Missense_Mutation_p.S355P|IL17RC_ENST00000413608.1_Missense_Mutation_p.S387P|IL17RC_ENST00000498214.1_Intron|IL17RC_ENST00000403601.3_Missense_Mutation_p.S387P|IL17RC_ENST00000416074.2_Missense_Mutation_p.S226P	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	458					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCTTCCAGACTCCCTGGGGCC	0.597																																					p.S458P		.											.	IL17RC-92	0			c.T1372C						.						62.0	66.0	65.0					3																	9971714		2203	4300	6503	SO:0001583	missense	84818	exon14			CCAGACTCCCTGG	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1372T>C	3.37:g.9971714T>C	ENSP00000295981:p.Ser458Pro	86	0		116	44	NM_153461	0	0	0	0	0	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	37	CCDS2590.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.526941	0.64860	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23;2.23	5.84	1.78	0.24846	.	0.258488	0.27223	N	0.020354	T	0.25269	0.0614	L	0.59436	1.845	0.26156	N	0.980074	D;D;P;P;P;P;P;D;D;D	0.59357	0.98;0.967;0.93;0.93;0.883;0.883;0.944;0.958;0.966;0.985	P;P;B;P;P;P;B;P;P;P	0.56916	0.731;0.642;0.368;0.462;0.462;0.462;0.439;0.663;0.543;0.809	T	0.03148	-1.1067	10	0.72032	D	0.01	-27.1927	5.0209	0.14361	0.2862:0.0:0.2374:0.4764	.	372;226;355;370;387;387;226;372;458;387	Q8NAC3-4;F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;B4E008;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;.;.;I17RC_HUMAN;.	P	372;458;362;387;226;355;387	ENSP00000373323:S372P;ENSP00000295981:S458P;ENSP00000401128:S362P;ENSP00000384969:S387P;ENSP00000395315:S226P;ENSP00000407894:S355P;ENSP00000396064:S387P	ENSP00000295981:S458P	S	+	1	0	IL17RC	9946714	0.275000	0.24201	1.000000	0.80357	0.836000	0.47400	0.499000	0.22546	1.000000	0.39049	0.459000	0.35465	TCC	.		0.597	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
SCAP	22937	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47460314	47460314	+	Missense_Mutation	SNP	C	C	A	rs199794833		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:47460314C>A	ENST00000265565.5	-	14	2372	c.1960G>T	c.(1960-1962)Gtc>Ttc	p.V654F	SCAP_ENST00000545718.1_Missense_Mutation_p.V262F|SCAP_ENST00000465628.1_5'Flank|SCAP_ENST00000441517.2_Missense_Mutation_p.V399F	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	654					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		ACTGGGATGACGGGCAGCAGG	0.706																																					p.V654F	Pancreas(149;978 1908 29304 37806 46700)												.	SCAP-91	0			c.G1960T						.						23.0	22.0	23.0					3																	47460314		2201	4297	6498	SO:0001583	missense	22937	exon14			GGATGACGGGCAG	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1960G>T	3.37:g.47460314C>A	ENSP00000265565:p.Val654Phe	42	0		23	4	NM_012235	0	0	19	38	19	Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664257	0.47572	.	.	ENSG00000114650	ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.80393	-1.37;-1.33;0.81	4.65	3.78	0.43462	.	0.205924	0.41500	D	0.000872	T	0.72391	0.3454	L	0.44542	1.39	0.47905	D	0.999548	P;B	0.39094	0.659;0.429	B;B	0.38327	0.271;0.124	T	0.72462	-0.4286	10	0.56958	D	0.05	-31.8419	8.9911	0.36024	0.0:0.8289:0.0:0.1711	.	399;654	F8W921;Q12770	.;SCAP_HUMAN	F	281;654;399;262	ENSP00000265565:V654F;ENSP00000416847:V399F;ENSP00000438956:V262F	ENSP00000265565:V654F	V	-	1	0	SCAP	47435318	1.000000	0.71417	0.975000	0.42487	0.422000	0.31414	4.644000	0.61397	1.182000	0.42928	0.561000	0.74099	GTC	.		0.706	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
RFT1	91869	ucsc.edu;bcgsc.ca	37	3	53126088	53126088	+	Splice_Site	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:53126088T>A	ENST00000296292.3	-	13	1520		c.e13-2		RP11-894J14.5_ENST00000607203.1_Intron|RFT1_ENST00000394738.3_Splice_Site	NM_052859.3	NP_443091.1	Q96AA3	RFT1_HUMAN	RFT1 homolog (S. cerevisiae)						carbohydrate transport (GO:0008643)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)	lipid transporter activity (GO:0005319)			NS(1)|breast(1)|kidney(1)|lung(5)|skin(2)|urinary_tract(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		GAGGAATACCTGGGGAAAGAA	0.557																																					.													.	RFT1-91	0			c.1459-2A>T						.						52.0	45.0	47.0					3																	53126088		2203	4300	6503	SO:0001630	splice_region_variant	91869	exon14			AATACCTGGGGAA	AJ318099	CCDS2869.1	3p21.1	2014-02-06	2005-01-26		ENSG00000163933	ENSG00000163933			30220	protein-coding gene	gene with protein product	"""congenital disorder of glycosylation 1N"""	611908	"""RFT1, requiring fifty three 1 homolog (S. cerevisiae)"""			12477932	Standard	NM_052859		Approved	CDG1N	uc003dgj.3	Q96AA3	OTTHUMG00000074035	ENST00000296292.3:c.1459-2A>T	3.37:g.53126088T>A		132	1		161	80	NM_052859	0	0	0	1	1	Q96J03	Splice_Site	SNP	ENST00000296292.3	37	CCDS2869.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.292549	0.40594	.	.	ENSG00000163933	ENST00000296292;ENST00000394738	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4957	0.33127	0.1725:0.0:0.0:0.8275	.	.	.	.	.	-1	.	.	.	-	.	.	RFT1	53101128	1.000000	0.71417	0.976000	0.42696	0.457000	0.32468	7.337000	0.79256	2.219000	0.72066	0.459000	0.35465	.	.		0.557	RFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157136.2	NM_052859	Intron
DZIP1L	199221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137813760	137813760	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:137813760A>T	ENST00000327532.2	-	4	1014	c.652T>A	c.(652-654)Tgg>Agg	p.W218R	DZIP1L_ENST00000469243.1_Missense_Mutation_p.W218R|DZIP1L_ENST00000488595.1_5'Flank	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	218					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						CCTTGGGTCCACTTTAGCTTG	0.567																																					p.W218R		.											.	DZIP1L-92	0			c.T652A						.						204.0	183.0	190.0					3																	137813760		2203	4300	6503	SO:0001583	missense	199221	exon5			GGGTCCACTTTAG	AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.652T>A	3.37:g.137813760A>T	ENSP00000332148:p.Trp218Arg	103	0		166	58	NM_001170538	0	0	0	2	2	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	.	.	.	.	.	.	.	.	.	.	A	2.056	-0.416478	0.04766	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.58940	0.3;0.3	4.85	0.616	0.17613	.	0.838115	0.10499	N	0.667430	T	0.49287	0.1548	L	0.57536	1.79	0.24258	N	0.995292	B;B	0.16166	0.016;0.007	B;B	0.15870	0.01;0.014	T	0.44967	-0.9293	10	0.49607	T	0.09	-4.0524	5.9081	0.19012	0.3628:0.38:0.0:0.2572	.	218;218	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	R	218	ENSP00000332148:W218R;ENSP00000419486:W218R	ENSP00000332148:W218R	W	-	1	0	DZIP1L	139296450	0.994000	0.37717	0.993000	0.49108	0.676000	0.39594	0.188000	0.17018	0.280000	0.22209	0.460000	0.39030	TGG	.		0.567	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1	NM_173543	
ARAP2	116984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	36069579	36069579	+	Missense_Mutation	SNP	G	G	A	rs377015356		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr4:36069579G>A	ENST00000303965.4	-	33	5554	c.5065C>T	c.(5065-5067)Cgg>Tgg	p.R1689W		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1689					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GTTCTTGACCGTTGTAGAACC	0.358																																					p.R1689W		.											.	ARAP2-93	0			c.C5065T						.						97.0	98.0	98.0					4																	36069579		2203	4300	6503	SO:0001583	missense	116984	exon33			TTGACCGTTGTAG	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.5065C>T	4.37:g.36069579G>A	ENSP00000302895:p.Arg1689Trp	76	0		79	33	NM_015230	0	0	2	7	5	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069954	0.55539	.	.	ENSG00000047365	ENST00000303965	T	0.10573	2.86	5.79	2.62	0.31277	.	0.081885	0.48286	D	0.000197	T	0.19327	0.0464	L	0.32530	0.975	0.26832	N	0.968552	D	0.89917	1.0	D	0.65573	0.936	T	0.02391	-1.1166	10	0.87932	D	0	.	12.1751	0.54180	0.0:0.0:0.5359:0.4641	.	1689	Q8WZ64	ARAP2_HUMAN	W	1689	ENSP00000302895:R1689W	ENSP00000302895:R1689W	R	-	1	2	ARAP2	35745974	0.543000	0.26434	0.703000	0.30354	0.768000	0.43524	1.288000	0.33296	0.691000	0.31592	0.650000	0.86243	CGG	.		0.358	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
GABRB1	2560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	47427723	47427723	+	Silent	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr4:47427723C>G	ENST00000295454.3	+	9	1405	c.1113C>G	c.(1111-1113)acC>acG	p.T371T	GABRB1_ENST00000538619.1_Silent_p.T301T	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	371					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCCTCAGCACCCTGGAAATCC	0.547																																					p.T371T		.											.	GABRB1-92	0			c.C1113G						.						77.0	75.0	76.0					4																	47427723		2203	4300	6503	SO:0001819	synonymous_variant	2560	exon9			CAGCACCCTGGAA		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1113C>G	4.37:g.47427723C>G		77	0		128	50	NM_000812	0	0	0	0	0	B2R6U7|D6REL3|Q16166|Q8TBK3	Silent	SNP	ENST00000295454.3	37	CCDS3474.1																																																																																			.		0.547	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
PRR16	51334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	120021685	120021685	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr5:120021685C>A	ENST00000407149.2	+	2	405	c.196C>A	c.(196-198)Cag>Aag	p.Q66K	PRR16_ENST00000446965.1_5'UTR|PRR16_ENST00000505123.1_5'UTR|PRR16_ENST00000379551.2_Missense_Mutation_p.Q43K			Q569H4	LARGN_HUMAN	proline rich 16	66					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CTCTGACCTACAGCTGGAGGA	0.463																																					p.Q43K		.											.	PRR16-71	0			c.C127A						.						97.0	88.0	91.0					5																	120021685		2203	4300	6503	SO:0001583	missense	51334	exon3			GACCTACAGCTGG	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.196C>A	5.37:g.120021685C>A	ENSP00000385118:p.Gln66Lys	87	0		87	37	NM_016644	0	0	0	0	0	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37		.	.	.	.	.	.	.	.	.	.	C	22.1	4.240061	0.79912	.	.	ENSG00000184838	ENST00000407149;ENST00000379551	T;T	0.45668	0.89;0.89	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	L	0.43152	1.355	0.80722	D	1	D;D	0.67145	0.988;0.996	P;P	0.57911	0.829;0.829	T	0.44190	-0.9344	9	.	.	.	-0.1775	17.7817	0.88526	0.0:1.0:0.0:0.0	.	66;43	Q569H4;Q569H4-3	PRR16_HUMAN;.	K	66;43	ENSP00000385118:Q66K;ENSP00000368869:Q43K	.	Q	+	1	0	PRR16	120049584	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.383000	0.79741	2.568000	0.86640	0.555000	0.69702	CAG	.		0.463	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
CCNI2	645121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132088594	132088594	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr5:132088594G>A	ENST00000378731.1	+	6	1093	c.1042G>A	c.(1042-1044)Gta>Ata	p.V348I	SEPT8_ENST00000481030.1_Intron|SEPT8_ENST00000378719.2_Intron	NM_001039780.2	NP_001034869.1	Q6ZMN8	CCNI2_HUMAN	cyclin I family, member 2	348					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAAGGAACTTGTAATGCAGCA	0.478																																					p.V348I		.											.	CCNI2-68	0			c.G1042A						.						122.0	105.0	111.0					5																	132088594		2203	4300	6503	SO:0001583	missense	645121	exon6			GAACTTGTAATGC	BC132837	CCDS34236.1, CCDS75297.1	5q31.1	2014-07-03			ENSG00000205089	ENSG00000205089			33869	protein-coding gene	gene with protein product						23707792	Standard	NM_001287252		Approved	FLJ16793	uc003kxq.1	Q6ZMN8	OTTHUMG00000059737	ENST00000378731.1:c.1042G>A	5.37:g.132088594G>A	ENSP00000368005:p.Val348Ile	78	0		98	38	NM_001039780	0	0	0	0	0	B2RNE2|B7ZMB7|B7ZMB8	Missense_Mutation	SNP	ENST00000378731.1	37	CCDS34236.1	.	.	.	.	.	.	.	.	.	.	g	15.24	2.775517	0.49786	.	.	ENSG00000205089	ENST00000378731	T	0.42131	0.98	5.35	2.54	0.30619	.	0.252001	0.38959	N	0.001518	T	0.43055	0.1230	M	0.66297	2.02	0.09310	N	0.999999	B;B;P	0.41710	0.261;0.261;0.76	B;B;P	0.45232	0.03;0.052;0.474	T	0.31194	-0.9952	10	0.52906	T	0.07	.	6.9365	0.24468	0.1591:0.1432:0.6976:0.0	.	349;364;348	B7ZMB7;B7ZMB8;Q6ZMN8	.;.;CCNI2_HUMAN	I	348	ENSP00000368005:V348I	ENSP00000368005:V348I	V	+	1	0	CCNI2	132116493	0.435000	0.25577	0.001000	0.08648	0.003000	0.03518	1.780000	0.38634	0.434000	0.26340	-0.144000	0.13903	GTA	.		0.478	CCNI2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132833.1	NM_001039780	
FAM13B	51306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137354741	137354741	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr5:137354741T>C	ENST00000033079.3	-	3	511	c.60A>G	c.(58-60)atA>atG	p.I20M	FAM13B_ENST00000425075.2_Intron|FAM13B_ENST00000420893.2_Missense_Mutation_p.I20M	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	20					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GAATTCCAAATATTTTGTTAG	0.448																																					p.I20M		.											.	.	0			c.A60G						.						102.0	99.0	100.0					5																	137354741		2203	4300	6503	SO:0001583	missense	51306	exon3			TCCAAATATTTTG	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.60A>G	5.37:g.137354741T>C	ENSP00000033079:p.Ile20Met	188	0		256	120	NM_001101800	0	0	1	1	0	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327093	0.60743	.	.	ENSG00000031003	ENST00000033079;ENST00000420893;ENST00000514310;ENST00000502471;ENST00000509596;ENST00000508403;ENST00000505961	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.87	5.87	0.94306	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.045544	0.85682	D	0.000000	T	0.48874	0.1524	N	0.14661	0.345	0.43394	D	0.995515	D;D	0.76494	0.999;0.998	D;D	0.74023	0.952;0.982	T	0.56986	-0.7888	10	0.87932	D	0	-9.9548	16.27	0.82612	0.0:0.0:0.0:1.0	.	20;20	Q9NYF5-2;Q9NYF5	.;FA13B_HUMAN	M	20	ENSP00000033079:I20M;ENSP00000388521:I20M;ENSP00000425326:I20M;ENSP00000424785:I20M;ENSP00000422311:I20M;ENSP00000426863:I20M;ENSP00000422673:I20M	ENSP00000033079:I20M	I	-	3	3	FAM13B	137382640	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.908000	0.56355	2.248000	0.74166	0.533000	0.62120	ATA	.		0.448	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
FAM217A	222826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4069042	4069042	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr6:4069042A>G	ENST00000274673.3	-	7	1818	c.1415T>C	c.(1414-1416)cTt>cCt	p.L472P	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	472																	TTGTCGGTAAAGTTTCTTTTT	0.403																																					p.L472P		.											.	.	0			c.T1415C						.						87.0	92.0	90.0					6																	4069042		2203	4300	6503	SO:0001583	missense	222826	exon7			CGGTAAAGTTTCT	BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.1415T>C	6.37:g.4069042A>G	ENSP00000274673:p.Leu472Pro	70	0		97	35	NM_173563	0	0	0	0	0	Q5JYK1	Missense_Mutation	SNP	ENST00000274673.3	37	CCDS4489.1	.	.	.	.	.	.	.	.	.	.	A	9.632	1.136613	0.21123	.	.	ENSG00000145975	ENST00000274673;ENST00000538080	T	0.19806	2.12	4.94	1.19	0.21007	.	0.439613	0.19414	N	0.114873	T	0.04724	0.0128	L	0.27053	0.805	0.38087	D	0.936832	B	0.22683	0.073	B	0.25884	0.064	T	0.21586	-1.0241	10	0.45353	T	0.12	.	3.9837	0.09506	0.6123:0.1915:0.1961:0.0	.	472	Q8IXS0	CF146_HUMAN	P	472;319	ENSP00000274673:L472P	ENSP00000274673:L472P	L	-	2	0	C6orf146	4014041	0.583000	0.26757	0.264000	0.24511	0.732000	0.41865	1.295000	0.33377	0.055000	0.16094	0.477000	0.44152	CTT	.		0.403	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352577.2	NM_173563	
MYLIP	29116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	16143330	16143330	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr6:16143330A>G	ENST00000356840.3	+	4	742	c.544A>G	c.(544-546)Atg>Gtg	p.M182V	MYLIP_ENST00000349606.4_Start_Codon_SNP_p.M1V|MIR4639_ENST00000584938.1_RNA	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	182	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			TGTGTCGGCAATGGAAAACTA	0.473																																					p.M182V		.											.	MYLIP-91	0			c.A544G						.						130.0	122.0	125.0					6																	16143330		2203	4300	6503	SO:0001583	missense	29116	exon4			TCGGCAATGGAAA	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.544A>G	6.37:g.16143330A>G	ENSP00000349298:p.Met182Val	102	0		158	77	NM_013262	0	0	8	20	12	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Missense_Mutation	SNP	ENST00000356840.3	37	CCDS4536.1	.	.	.	.	.	.	.	.	.	.	A	11.61	1.689703	0.29962	.	.	ENSG00000007944	ENST00000356840;ENST00000349606	T;T	0.76839	-1.05;1.32	5.57	5.57	0.84162	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.135191	0.64402	D	0.000002	T	0.57548	0.2061	L	0.38175	1.15	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.63125	-0.6707	10	0.87932	D	0	.	11.5381	0.50651	0.7336:0.2664:0.0:0.0	.	182	Q8WY64	MYLIP_HUMAN	V	182;1	ENSP00000349298:M182V;ENSP00000008686:M1V	ENSP00000008686:M1V	M	+	1	0	MYLIP	16251309	0.995000	0.38212	0.927000	0.36925	0.499000	0.33736	3.374000	0.52402	2.230000	0.72887	0.533000	0.62120	ATG	.		0.473	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043864.1	NM_013262	
SLC17A1	6568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25811999	25811999	+	Splice_Site	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr6:25811999C>T	ENST00000244527.4	-	9	1013		c.e9-1		SLC17A1_ENST00000468082.1_Splice_Site|SLC17A1_ENST00000427328.1_Splice_Site|SLC17A1_ENST00000476801.1_Splice_Site	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1						ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AGAACCCATTCTGAAGAGGAA	0.403																																					.		.											.	SLC17A1-94	0			c.898-1G>A						.						87.0	79.0	82.0					6																	25811999		2203	4300	6503	SO:0001630	splice_region_variant	6568	exon10			CCCATTCTGAAGA		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.898-1G>A	6.37:g.25811999C>T		61	0		73	26	NM_005074	0	0	1	4	3	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Splice_Site	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	C	7.361	0.624846	0.14193	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5584	0.45131	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC17A1	25919978	1.000000	0.71417	0.946000	0.38457	0.079000	0.17450	4.214000	0.58527	2.191000	0.70037	0.650000	0.86243	.	.		0.403	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		Intron
GCLC	2729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53370243	53370243	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr6:53370243G>C	ENST00000229416.6	-	12	1825	c.1342C>G	c.(1342-1344)Ctc>Gtc	p.L448V	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	448					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	ACTCTGGTGAGCAGTACCACA	0.403																																					p.L448V		.											.	GCLC-515	0			c.C1342G						.						98.0	90.0	93.0					6																	53370243		2203	4300	6503	SO:0001583	missense	2729	exon12			TGGTGAGCAGTAC	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.1342C>G	6.37:g.53370243G>C	ENSP00000229416:p.Leu448Val	137	0		178	72	NM_001498	0	0	7	11	4	Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	CCDS4952.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.15|17.15	3.315237|3.315237	0.60524|0.60524	.|.	.|.	ENSG00000001084|ENSG00000001084	ENST00000514373|ENST00000229416	.|T	.|0.77358	.|-1.09	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.055897	.|0.85682	.|D	.|0.000000	T|T	0.71787|0.71787	0.3381|0.3381	M|M	0.66297|0.66297	2.02|2.02	0.80722|0.80722	D|D	1|1	.|B	.|0.18968	.|0.032	.|B	.|0.22152	.|0.038	T|T	0.66779|0.66779	-0.5837|-0.5837	5|10	.|0.42905	.|T	.|0.14	.|.	20.3594|20.3594	0.98849|0.98849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|448	.|P48506	.|GSH1_HUMAN	W|V	49|448	.|ENSP00000229416:L448V	.|ENSP00000229416:L448V	C|L	-|-	3|1	2|0	GCLC|GCLC	53478202|53478202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.830000|0.830000	0.47004|0.47004	8.018000|8.018000	0.88722|0.88722	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	TGC|CTC	.		0.403	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		
SMIM8	57150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	88046811	88046811	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr6:88046811A>C	ENST00000392863.1	+	3	151	c.62A>C	c.(61-63)cAa>cCa	p.Q21P	SMIM8_ENST00000608525.1_Missense_Mutation_p.Q21P|SMIM8_ENST00000608868.1_Missense_Mutation_p.Q21P|RP1-102H19.8_ENST00000448282.2_Missense_Mutation_p.Q21P|SMIM8_ENST00000608353.1_Missense_Mutation_p.Q21P|SMIM8_ENST00000229570.5_Missense_Mutation_p.Q21P	NM_001042493.1	NP_001035958.1	Q96KF7	SMIM8_HUMAN	small integral membrane protein 8	21						integral component of membrane (GO:0016021)											AAAGAGTTTCAAAGCCCAGGG	0.398																																					p.Q21P		.											.	.	0			c.A62C						.						89.0	91.0	90.0					6																	88046811		2203	4300	6503	SO:0001583	missense	57150	exon3			AGTTTCAAAGCCC	AL050201	CCDS34496.1, CCDS75493.1	6q15	2013-06-21	2012-11-20	2012-11-20	ENSG00000111850	ENSG00000111850			21401	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 162"""	C6orf162			Standard	NM_001287445		Approved	DKFZP586E1923, dJ102H19.2	uc003plq.1	Q96KF7	OTTHUMG00000015168	ENST00000392863.1:c.62A>C	6.37:g.88046811A>C	ENSP00000376603:p.Gln21Pro	41	0		64	31	NM_001042493	0	0	2	3	1	B2R4V6|E1P505|Q5TEZ3|Q6NSD2|Q8IZ10	Missense_Mutation	SNP	ENST00000392863.1	37	CCDS34496.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.015538	0.35511	.	.	ENSG00000111850	ENST00000392863;ENST00000229570	.	.	.	5.69	-0.263	0.12954	.	0.368122	0.29501	N	0.011965	T	0.08044	0.0201	.	.	.	0.25064	N	0.991047	B	0.02656	0.0	B	0.04013	0.001	T	0.35475	-0.9787	8	0.25106	T	0.35	0.3915	5.1987	0.15252	0.2411:0.3105:0.4483:0.0	.	21	Q96KF7	CF162_HUMAN	P	21	.	ENSP00000229570:Q21P	Q	+	2	0	C6orf162	88103530	0.489000	0.26004	0.812000	0.32479	0.823000	0.46562	0.679000	0.25291	-0.373000	0.07979	0.533000	0.62120	CAA	.		0.398	SMIM8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472479.2	NM_020425	
MET	4233	hgsc.bcm.edu;bcgsc.ca	37	7	116411675	116411675	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr7:116411675T>G	ENST00000318493.6	+	13	3095	c.2908T>G	c.(2908-2910)Ttc>Gtc	p.F970V	MET_ENST00000397752.3_Missense_Mutation_p.F952V			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			ACTTGGGTTTTTCCTGTGGCT	0.348			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.F970V		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.T2908G						.						117.0	110.0	112.0					7																	116411675		1845	4085	5930	SO:0001583	missense	4233	exon13	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGGTTTTTCCTGT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.2908T>G	7.37:g.116411675T>G	ENSP00000317272:p.Phe970Val	52	0		97	15	NM_001127500	0	0	124	124	0	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377141	0.42105	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000454623	T;T	0.72167	-0.63;-0.63	5.76	5.76	0.90799	.	0.096961	0.64402	D	0.000001	T	0.67420	0.2891	M	0.73598	2.24	0.80722	D	1	P;B	0.38129	0.619;0.349	B;B	0.35510	0.204;0.185	T	0.67428	-0.5673	10	0.31617	T	0.26	.	10.6767	0.45789	0.0:0.0713:0.0:0.9287	.	970;952	P08581-2;P08581	.;MET_HUMAN	V	952;970;84	ENSP00000380860:F952V;ENSP00000317272:F970V	ENSP00000317272:F970V	F	+	1	0	MET	116198911	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	2.954000	0.49113	2.324000	0.78689	0.533000	0.62120	TTC	.		0.348	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
MTUS1	57509	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	17579357	17579357	+	Intron	SNP	T	T	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:17579357T>A	ENST00000262102.6	-	4	2674				MTUS1_ENST00000381861.3_Missense_Mutation_p.K18N|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_Intron|MTUS1_ENST00000519263.1_Intron	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1						cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TGATAAAGATTTTTGAAGAAA	0.428																																					p.K18N		.											.	MTUS1-92	0			c.A54T						.						86.0	86.0	86.0					8																	17579357		1840	4094	5934	SO:0001627	intron_variant	57509	exon1			AAAGATTTTTGAA	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2449+1823A>T	8.37:g.17579357T>A		57	0		74	35	NM_001001931	0	0	0	0	0	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.116072	0.37339	.	.	ENSG00000129422	ENST00000381861	T	0.15487	2.42	5.48	1.4	0.22301	.	.	.	.	.	T	0.07234	0.0183	.	.	.	0.23602	N	0.997312	B	0.09022	0.002	B	0.11329	0.006	T	0.39860	-0.9593	8	0.16896	T	0.51	.	0.4383	0.00482	0.2369:0.2954:0.15:0.3178	.	18	Q9ULD2-6	.	N	18	ENSP00000371285:K18N	ENSP00000371285:K18N	K	-	3	2	MTUS1	17623637	0.479000	0.25925	0.804000	0.32291	0.992000	0.81027	0.640000	0.24705	0.443000	0.26582	0.533000	0.62120	AAA	.		0.428	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
LPL	4023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	19811710	19811710	+	Silent	SNP	C	C	T	rs118204076		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:19811710C>T	ENST00000311322.8	+	5	1091	c.621C>T	c.(619-621)gaC>gaT	p.D207D		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	207			D -> E (in LPL deficiency). {ECO:0000269|PubMed:8288243}.		chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	ATTTTGTAGACGTCTTACACA	0.483																																					p.D207D		.											.	LPL-92	0			c.C621T	GRCh37	CM930483	LPL	M	rs118204076	.						139.0	134.0	135.0					8																	19811710		2203	4300	6503	SO:0001819	synonymous_variant	4023	exon5			TGTAGACGTCTTA		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.621C>T	8.37:g.19811710C>T		109	0		155	73	NM_000237	0	0	1	1	0	B2R5T9|Q16282|Q16283|Q96FC4	Silent	SNP	ENST00000311322.8	37	CCDS6012.1																																																																																			.		0.483	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
PPP2R2A	5520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	26211991	26211991	+	Missense_Mutation	SNP	T	T	C	rs373174942		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:26211991T>C	ENST00000380737.3	+	4	517	c.188T>C	c.(187-189)aTc>aCc	p.I63T	PPP2R2A_ENST00000315985.7_Missense_Mutation_p.I73T	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	63					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TAGAACAAAATCCAGTCTCAT	0.318																																					p.I73T		.											.	PPP2R2A-659	0			c.T218C						.	T	THR/ILE,THR/ILE	0,4406		0,0,2203	70.0	73.0	72.0		218,188	4.8	1.0	8		72	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	PPP2R2A	NM_001177591.1,NM_002717.3	89,89	0,1,6501	CC,CT,TT		0.0116,0.0,0.0077	,	73/458,63/448	26211991	1,13003	2203	4299	6502	SO:0001583	missense	5520	exon4			ACAAAATCCAGTC	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.188T>C	8.37:g.26211991T>C	ENSP00000370113:p.Ile63Thr	35	0		38	12	NM_001177591	0	0	0	0	0	B2RBU8|B4E1T7|P50409|Q00007	Missense_Mutation	SNP	ENST00000380737.3	37	CCDS34867.1	.	.	.	.	.	.	.	.	.	.	T	6.035	0.374882	0.11409	0.0	1.16E-4	ENSG00000221914	ENST00000380737;ENST00000315985	T;T	0.29142	1.59;1.58	5.97	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.287722	0.32204	U	0.006432	T	0.08358	0.0208	N	0.01576	-0.805	0.37304	D	0.908831	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28522	-1.0041	10	0.09843	T	0.71	-14.6536	2.6676	0.05057	0.0:0.1705:0.291:0.5384	.	73;63	B4E1T7;P63151	.;2ABA_HUMAN	T	63;73	ENSP00000370113:I63T;ENSP00000325074:I73T	ENSP00000325074:I73T	I	+	2	0	PPP2R2A	26267908	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.834000	0.39171	2.285000	0.76669	0.528000	0.53228	ATC	.		0.318	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375954.2	NM_002717	
ASPH	444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	62460750	62460750	+	Silent	SNP	C	C	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:62460750C>T	ENST00000379454.4	-	21	1831	c.1644G>A	c.(1642-1644)gaG>gaA	p.E548E	ASPH_ENST00000541428.1_Silent_p.E519E	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	548					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)	p.E548E(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TGTGCCCAAGCTCATACCACT	0.403																																					p.E548E		.											.	ASPH-93	1	Substitution - coding silent(1)	large_intestine(1)	c.G1644A						.						119.0	102.0	108.0					8																	62460750		2203	4300	6503	SO:0001819	synonymous_variant	444	exon21			CCCAAGCTCATAC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.1644G>A	8.37:g.62460750C>T		102	0		134	54	NM_004318	0	0	7	16	9	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Silent	SNP	ENST00000379454.4	37	CCDS34898.1																																																																																			.		0.403	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
TRAPPC9	83696	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	141301159	141301159	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:141301159C>G	ENST00000438773.2	-	12	1920	c.1787G>C	c.(1786-1788)gGa>gCa	p.G596A	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.G694A|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.G587A	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	596					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						ACACACATCTCCTTGAACCCA	0.368																																					p.G694A													.	TRAPPC9-228	0			c.G2081C						.						158.0	138.0	145.0					8																	141301159		2203	4300	6503	SO:0001583	missense	83696	exon12			ACATCTCCTTGAA	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.1787G>C	8.37:g.141301159C>G	ENSP00000405060:p.Gly596Ala	139	1		184	81	NM_031466	0	0	6	9	3	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.474358|4.474358	0.84640|0.84640	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73598|0.73598	0.3607|0.3607	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999994|0.999994	D;D;D;D|.	0.71674|.	0.998;0.998;0.996;0.998|.	D;D;D;D|.	0.73708|.	0.977;0.964;0.919;0.981|.	T|T	0.71856|0.71856	-0.4466|-0.4466	9|5	0.72032|.	D|.	0.01|.	.|.	18.9153|18.9153	0.92503|0.92503	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	694;596;587;694|.	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2|.	.;TPPC9_HUMAN;.;.|.	A|S	694;587;596|439	.|.	ENSP00000373978:G587A|.	G|R	-|-	2|3	0|2	TRAPPC9|TRAPPC9	141370341|141370341	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	4.423000|4.423000	0.59861|0.59861	2.484000|2.484000	0.83849|0.83849	0.561000|0.561000	0.74099|0.74099	GGA|AGG	.		0.368	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
LRRC14	9684	broad.mit.edu	37	8	145745730	145745730	+	Silent	SNP	A	A	G			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:145745730A>G	ENST00000292524.1	+	3	584	c.438A>G	c.(436-438)acA>acG	p.T146T	LRRC14_ENST00000529022.1_Silent_p.T146T|RECQL4_ENST00000532237.1_5'Flank|RECQL4_ENST00000428558.2_5'Flank	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	146										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TAGCTCGCACATGCATTGCCC	0.662																																					p.T146T													.	LRRC14-90	0			c.A438G						.						71.0	75.0	74.0					8																	145745730		2203	4300	6503	SO:0001819	synonymous_variant	9684	exon4			TCGCACATGCATT	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.438A>G	8.37:g.145745730A>G		28	0		29	4	NM_001272036	0	0	2	3	1	A8K0A8|D3DWM8	Silent	SNP	ENST00000292524.1	37	CCDS6432.1																																																																																			.		0.662	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
ODF2	4957	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131256869	131256869	+	Silent	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr9:131256869T>C	ENST00000434106.3	+	17	2196	c.1833T>C	c.(1831-1833)gcT>gcC	p.A611A	ODF2_ENST00000372791.3_Silent_p.A592A|ODF2_ENST00000448249.3_Silent_p.A530A|ODF2_ENST00000546203.1_Silent_p.A592A|ODF2_ENST00000372807.5_Silent_p.A606A|ODF2_ENST00000444119.2_Silent_p.A587A|ODF2_ENST00000351030.3_Silent_p.A606A|ODF2_ENST00000604420.1_Silent_p.A611A|ODF2_ENST00000372814.3_Silent_p.A655A|ODF2_ENST00000393527.3_Silent_p.A587A|ODF2_ENST00000393533.2_Silent_p.A611A	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	611					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						CGAAGCTGGCTGAGTGCCAAG	0.572																																					p.A675A													.	ODF2-69	0			c.T2025C						.						74.0	64.0	68.0					9																	131256869		2203	4300	6503	SO:0001819	synonymous_variant	4957	exon17			GCTGGCTGAGTGC	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1833T>C	9.37:g.131256869T>C		194	1		228	88	NM_153435	0	0	4	8	4	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Silent	SNP	ENST00000434106.3	37	CCDS56588.1																																																																																			.		0.572	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
NUP214	8021	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134019825	134019825	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr9:134019825G>C	ENST00000359428.5	+	12	1597	c.1453G>C	c.(1453-1455)Ggt>Cgt	p.G485R	RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.G485R|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.G485R|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	485	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GTTCTCCTTTGGTTCTTCATC	0.577			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.G485R	Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.G1453C						.						217.0	219.0	218.0					9																	134019825		2203	4300	6503	SO:0001583	missense	8021	exon12			TCCTTTGGTTCTT	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1453G>C	9.37:g.134019825G>C	ENSP00000352400:p.Gly485Arg	65	1		77	30	NM_005085	0	0	1	2	1	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861397	0.71949	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899	T;T;T	0.80738	-1.41;-1.41;-1.41	5.79	5.79	0.91817	.	0.000000	0.41823	D	0.000813	T	0.72170	0.3427	N	0.08118	0	0.28472	N	0.915369	D;D	0.57571	0.98;0.98	P;P	0.56700	0.804;0.804	T	0.64672	-0.6352	10	0.20046	T	0.44	-17.3717	10.2889	0.43584	0.093:0.0:0.907:0.0	.	485;485	P35658-4;P35658	.;NU214_HUMAN	R	485;485;485;485;78	ENSP00000352400:G485R;ENSP00000396576:G485R;ENSP00000405014:G485R	ENSP00000352400:G485R	G	+	1	0	NUP214	133009646	0.876000	0.30132	1.000000	0.80357	0.916000	0.54674	1.801000	0.38843	2.726000	0.93360	0.655000	0.94253	GGT	.		0.577	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
KDM5C	8242	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53245084	53245084	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chrX:53245084T>C	ENST00000375401.3	-	7	1388	c.856A>G	c.(856-858)Aca>Gca	p.T286A	KDM5C_ENST00000404049.3_Missense_Mutation_p.T285A|KDM5C_ENST00000452825.3_Missense_Mutation_p.T219A|KDM5C_ENST00000375379.3_Missense_Mutation_p.T286A|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000375383.3_Missense_Mutation_p.T245A	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	286					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TTAGGCGATGTTGACTCCACC	0.547			"""N, F, S"""		clear cell renal carcinoma								T|||	1	0.000264901	0.0	0.0	3775	,	,		14662	0.0		0.0	False		,,,				2504	0.001				p.T286A				Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C-1272	0			c.A856G						.						216.0	158.0	177.0					X																	53245084		2203	4300	6503	SO:0001583	missense	8242	exon7			GCGATGTTGACTC	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.856A>G	X.37:g.53245084T>C	ENSP00000364550:p.Thr286Ala	72	1		106	84	NM_004187	0	0	0	16	16	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.484126	0.01027	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.85629	-2.01;-1.7;-1.7;-1.7;-1.84	5.25	-8.15	0.01065	.	1.077560	0.07053	N	0.832366	T	0.55737	0.1939	N	0.01800	-0.715	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.54886	-0.8226	10	0.07482	T	0.82	0.2577	7.9029	0.29744	0.1202:0.6219:0.1198:0.1381	.	219;285;286	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	A	219;286;285;286;245	ENSP00000445176:T219A;ENSP00000364550:T286A;ENSP00000385394:T285A;ENSP00000364528:T286A;ENSP00000364532:T245A	ENSP00000364528:T286A	T	-	1	0	KDM5C	53261809	0.000000	0.05858	0.222000	0.23844	0.453000	0.32348	-1.761000	0.01805	-1.875000	0.01132	0.430000	0.28490	ACA	.		0.547	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
RBMXL3	139804	hgsc.bcm.edu	37	X	114425196	114425196	+	Missense_Mutation	SNP	G	G	A	rs386827028|rs12399211		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chrX:114425196G>A	ENST00000424776.3	+	1	1234	c.1192G>A	c.(1192-1194)Gac>Aac	p.D398N	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	398	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCGCTCGCCCGACGCCCACAG	0.627																																					p.D398N		.											.	.	0			c.G1192A						.																																			SO:0001583	missense	139804	exon1			TCGCCCGACGCCC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1192G>A	X.37:g.114425196G>A	ENSP00000417451:p.Asp398Asn	6	0		59	53	NM_001145346	0	0	0	0	0	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	856	0.5159734779987944	181	0.42890995260663506	151	0.4870967741935484	216	0.4268774703557312	298	0.473015873015873	G	13.89	2.371776	0.42003	.	.	ENSG00000175718	ENST00000424776	T	0.05996	3.36	0.341	0.341	0.15991	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.67145	0.996	P	0.57468	0.821	T	0.48647	-0.9017	8	0.87932	D	0	.	2.8111	0.05442	0.4108:0.0:0.5892:0.0	rs12399211	398	Q8N7X1	RMXL3_HUMAN	N	398	ENSP00000417451:D398N	ENSP00000417451:D398N	D	+	1	0	RBMXL3	114331452	0.003000	0.15002	0.002000	0.10522	0.077000	0.17291	0.196000	0.17176	0.424000	0.26061	0.124000	0.15798	GAC	G|0.483;A|0.517		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
ATP11C	286410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	138880882	138880882	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chrX:138880882A>C	ENST00000327569.3	-	9	838	c.740T>G	c.(739-741)cTc>cGc	p.L247R	ATP11C_ENST00000460773.1_5'Flank|ATP11C_ENST00000361648.2_Missense_Mutation_p.L247R|ATP11C_ENST00000359686.2_Missense_Mutation_p.L247R|ATP11C_ENST00000370543.1_Missense_Mutation_p.L247R|ATP11C_ENST00000370557.1_Missense_Mutation_p.L244R	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	247					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TTTCAGCAAGAGATTTTCAGG	0.368																																					p.L247R		.											.	ATP11C-198	0			c.T740G						.						61.0	56.0	58.0					X																	138880882		2203	4300	6503	SO:0001583	missense	286410	exon9			AGCAAGAGATTTT	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.740T>G	X.37:g.138880882A>C	ENSP00000332756:p.Leu247Arg	56	0		59	49	NM_001010986	0	0	0	3	3	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.355898	0.82243	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75	5.62	5.62	0.85841	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.96911	0.8991	H	0.96748	3.875	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.98001	1.0360	10	0.87932	D	0	.	13.8743	0.63643	1.0:0.0:0.0:0.0	.	247;247	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	R	244;247;247;247;247	ENSP00000359588:L244R;ENSP00000355165:L247R;ENSP00000332756:L247R;ENSP00000359574:L247R;ENSP00000352715:L247R	ENSP00000332756:L247R	L	-	2	0	ATP11C	138708548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	1.873000	0.54277	0.481000	0.45027	CTC	.		0.368	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
EDEM3	80267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	184723718	184723718	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr1:184723718delT	ENST00000318130.8	-	1	329	c.63delA	c.(61-63)ctafs	p.L21fs	EDEM3_ENST00000367512.3_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	21					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCGCCGCCACTAGTCTCCATC	0.716																																					p.L21fs		.											.	EDEM3-91	0			c.63delA						.						5.0	10.0	9.0					1																	184723718		667	1557	2224	SO:0001589	frameshift_variant	80267	exon1			.	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.63delA	1.37:g.184723718delT	ENSP00000318147:p.Leu21fs	89	0		54	13	NM_025191	0	0	0	0	0	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Frame_Shift_Del	DEL	ENST00000318130.8	37	CCDS1363.2																																																																																			.		0.716	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191	
OR5AR1	219493	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	56432020	56432028	+	In_Frame_Del	DEL	CCCTTGATC	CCCTTGATC	-	rs139654321		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	CCCTTGATC	CCCTTGATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr11:56432020_56432028delCCCTTGATC	ENST00000302969.2	+	1	883_891	c.859_867delCCCTTGATC	c.(859-867)cccttgatcdel	p.PLI287del		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						CATGTTAAATCCCTTGATCTACAGTTTGC	0.407																																					p.287_289del		.											.	OR5AR1-68	0			c.859_867del						.																																			SO:0001651	inframe_deletion	219493	exon1			.	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.859_867delCCCTTGATC	11.37:g.56432020_56432028delCCCTTGATC	ENSP00000302639:p.Pro287_Ile289del	147	0		169	27	NM_001004730	0	0	0	0	0	Q6IF61	In_Frame_Del	DEL	ENST00000302969.2	37	CCDS31535.1																																																																																			.		0.407	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730	
SLX4	84464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3645657	3645657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr16:3645657delC	ENST00000294008.3	-	9	2602	c.1962delG	c.(1960-1962)gggfs	p.G654fs		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	654	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCACCACAAACCCAGTCAGAG	0.627								Direct reversal of damage																													p.G654fs		.											.	SLX4-94	0			c.1962delG						.						63.0	65.0	64.0					16																	3645657		2197	4300	6497	SO:0001589	frameshift_variant	84464	exon9			.	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1962delG	16.37:g.3645657delC	ENSP00000294008:p.Gly654fs	75	0		103	41	NM_032444	0	0	0	0	0	Q69YT8|Q8TF15|Q96JP1	Frame_Shift_Del	DEL	ENST00000294008.3	37	CCDS10506.2																																																																																			.		0.627	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
STAT5B	6777	broad.mit.edu	37	17	40370236	40370236	+	Frame_Shift_Del	DEL	G	G	-	rs144993426		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr17:40370236delG	ENST00000293328.3	-	9	1270	c.1102delC	c.(1102-1104)cagfs	p.Q368fs		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	368					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	GCCTTCACCTGGGGGGGGTTC	0.577																																					p.Q368fs													.	STAT5B-850	0			c.1102delC						.						109.0	87.0	94.0					17																	40370236		2203	4300	6503	SO:0001589	frameshift_variant	6777	exon9			TCACCTGGGGGGG	BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1102delC	17.37:g.40370236delG	ENSP00000293328:p.Gln368fs	182	0		383	9	NM_012448	0	0	0	0	0	Q8WWS8	Frame_Shift_Del	DEL	ENST00000293328.3	37	CCDS11423.1																																																																																			.		0.577	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	
IL5RA	3568	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	3139630	3139630	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:3139630delA	ENST00000446632.2	-	7	1207	c.633delT	c.(631-633)cttfs	p.L211fs	IL5RA_ENST00000383846.1_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000418488.2_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000256452.3_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000311981.8_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000438560.1_Frame_Shift_Del_p.L211fs|IL5RA_ENST00000456302.1_Frame_Shift_Del_p.L211fs	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	211					cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		CAAGCACCGCAAGCCAGTCAC	0.507																																					p.L211fs	GBM(169;430 2801 24955 28528)	.											.	IL5RA-91	0			c.633delT						.						112.0	97.0	102.0					3																	3139630		2203	4300	6503	SO:0001589	frameshift_variant	3568	exon7			.	M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.633delT	3.37:g.3139630delA	ENSP00000412209:p.Leu211fs	168	0		217	86	NM_001243099	0	0	0	0	0	B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Frame_Shift_Del	DEL	ENST00000446632.2	37	CCDS2559.1																																																																																			.		0.507	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2		
ARL13B	200894	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	93761993	93761993	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:93761993delT	ENST00000394222.3	+	7	1208	c.933delT	c.(931-933)aatfs	p.N312fs	ARL13B_ENST00000303097.7_Frame_Shift_Del_p.N205fs|ARL13B_ENST00000471138.1_Frame_Shift_Del_p.N312fs|ARL13B_ENST00000535334.1_Frame_Shift_Del_p.N209fs|ARL13B_ENST00000539730.1_Frame_Shift_Del_p.N33fs	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	312					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						GCCAAAAAAATAATGAATTTG	0.373																																					p.N311fs		.											.	ARL13B-91	0			c.933delT						.						81.0	80.0	81.0					3																	93761993		2203	4300	6503	SO:0001589	frameshift_variant	200894	exon7			.	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.933delT	3.37:g.93761993delT	ENSP00000377769:p.Asn312fs	158	0		164	56	NM_182896	0	0	0	0	0	D3DN29|G3V1S8|Q504W8|Q8TCL5	Frame_Shift_Del	DEL	ENST00000394222.3	37	CCDS2925.1																																																																																			.		0.373	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	
MTRR	4552	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	7895903	7895903	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr5:7895903delC	ENST00000264668.2	+	12	1725	c.1695delC	c.(1693-1695)atcfs	p.I565fs	MTRR_ENST00000440940.2_Frame_Shift_Del_p.I538fs	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	565					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACCCCTCAATCCCCATCATAA	0.403																																					p.I565fs		.											.	MTRR-91	0			c.1695delC						.						137.0	138.0	138.0					5																	7895903		2203	4300	6503	SO:0001589	frameshift_variant	4552	exon12			.	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1695delC	5.37:g.7895903delC	ENSP00000264668:p.Ile565fs	84	0		81	39	NM_024010	0	0	0	0	0	O60471|Q32MA9|Q7Z4M8	Frame_Shift_Del	DEL	ENST00000264668.2	37	CCDS3874.1																																																																																			.		0.403	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
GBX1	2636	broad.mit.edu	37	7	150864527	150864529	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	GCG	GCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr7:150864527_150864529delGCG	ENST00000297537.4	-	1	106_108	c.107_109delCGC	c.(106-111)ccgcgc>cgc	p.P36del	GBX1_ENST00000475831.1_Intron	NM_001098834.1	NP_001092304.1	Q14549	GBX1_HUMAN	gastrulation brain homeobox 1	36	Pro-rich.				adult walking behavior (GO:0007628)|neuron fate commitment (GO:0048663)|proprioception (GO:0019230)|regulation of transcription, DNA-templated (GO:0006355)|sensory neuron axon guidance (GO:0097374)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(5)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGCCGGAGCGCGGCGGCGGCGG	0.773																																					p.36_37del													.	GBX1-68	0			c.107_109del						.			5,2199		0,5,1097						2.6	0.7			3	12,4672		2,8,2332	no	coding	GBX1	NM_001098834.1		2,13,3429	A1A1,A1R,RR		0.2562,0.2269,0.2468				17,6871				SO:0001651	inframe_deletion	2636	exon1			CGGAGCGCGGCGG	L11239	CCDS43682.1	7q36.1	2012-03-09	2005-12-22		ENSG00000164900	ENSG00000164900		"""Homeoboxes / ANTP class : HOXL subclass"""	4185	protein-coding gene	gene with protein product		603354	"""gastrulation brain homeo box 1"""			7903253	Standard	NM_001098834		Approved		uc011kvg.2	Q14549	OTTHUMG00000158751	ENST00000297537.4:c.107_109delCGC	7.37:g.150864536_150864538delGCG	ENSP00000297537:p.Pro36del	4	0		6	2	NM_001098834	0	0	0	0	0		In_Frame_Del	DEL	ENST00000297537.4	37	CCDS43682.1																																																																																			.		0.773	GBX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352029.1		
ADAM9	8754	broad.mit.edu	37	8	38854664	38854670	+	Frame_Shift_Del	DEL	GGTGCGG	GGTGCGG	-	rs576406930		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	GGTGCGG	GGTGCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr8:38854664_38854670delGGTGCGG	ENST00000487273.2	+	1	160_166	c.82_88delGGTGCGG	c.(82-90)ggtgcggcgfs	p.GAA28fs	TM2D2_ENST00000412303.1_5'Flank|TM2D2_ENST00000456845.2_5'Flank|TM2D2_ENST00000397070.2_5'Flank|TM2D2_ENST00000456397.2_5'Flank|ADAM9_ENST00000466936.1_Frame_Shift_Del_p.GAA28fs|TM2D2_ENST00000522434.1_5'Flank|ADAM9_ENST00000481513.1_Frame_Shift_Del_p.GAA28fs	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	28				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			CCCAGTCCTCGGTGCGGCGCGGCCAGG	0.715																																					p.28_30del													.	ADAM9-227	0			c.82_88del						.																																			SO:0001589	frameshift_variant	8754	exon1			GTCCTCGGTGCGG	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.82_88delGGTGCGG	8.37:g.38854664_38854670delGGTGCGG	ENSP00000419446:p.Gly28fs	15	0		8	4	NM_003816	0	0	0	0	0	B7ZLN7|Q10718|Q8NFM6	Frame_Shift_Del	DEL	ENST00000487273.2	37	CCDS6112.1																																																																																			.		0.715	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
FOXD4L3	286380	hgsc.bcm.edu;broad.mit.edu	37	9	70919081	70919082	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr9:70919081_70919082delGG	ENST00000342833.2	+	1	1806_1807	c.1214_1215delGG	c.(1213-1215)cggfs	p.R405fs		NM_199135.4	NP_954586.4	Q6VB84	FX4L3_HUMAN	forkhead box D4-like 3	405						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CCAAGGGCGCGGTGCTGGGCGG	0.668																																					p.405_405del		.											.	FOXD4L3-40	0			c.1214_1215del						.																																			SO:0001589	frameshift_variant	286380	exon1			.	AY344642	CCDS43833.1	9q13	2008-05-13				ENSG00000187559			18523	protein-coding gene	gene with protein product		611086				12421752	Standard	NM_199135		Approved	OTTHUMG00000019959, FOXD6	uc004agm.1	Q6VB84	OTTHUMG00000019959	ENST00000342833.2:c.1214_1215delGG	9.37:g.70919081_70919082delGG	ENSP00000341961:p.Arg405fs	186	0		144	27	NM_199135	0	0	0	0	0	Q5JTX9	Frame_Shift_Del	DEL	ENST00000342833.2	37	CCDS43833.1																																																																																			.		0.668	FOXD4L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052539.2	NM_199358	
WDR20	91833	hgsc.bcm.edu;bcgsc.ca	37	14	102674963	102674964	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr14:102674963_102674964insA	ENST00000342702.3	+	3	487_488	c.456_457insA	c.(457-459)accfs	p.T153fs	WDR20_ENST00000335263.5_Frame_Shift_Ins_p.T153fs|WDR20_ENST00000499851.2_Intron|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000556807.1_Frame_Shift_Ins_p.T92fs|WDR20_ENST00000556511.2_Frame_Shift_Ins_p.T92fs|WDR20_ENST00000454394.2_Frame_Shift_Ins_p.T184fs|WDR20_ENST00000545563.1_5'UTR|WDR20_ENST00000424963.2_Frame_Shift_Ins_p.T29fs	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	153										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						AGTCACGAGTTACCTGTGTCAA	0.45																																					p.V183fs		.											.	WDR20-90	0			c.549_550insA						.																																			SO:0001589	frameshift_variant	91833	exon4			.	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.457dupA	14.37:g.102674964_102674964dupA	ENSP00000341037:p.Thr153fs	50	0		60	14	NM_001242417	0	0	0	0	0	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Frame_Shift_Ins	INS	ENST00000342702.3	37	CCDS9969.1																																																																																			.		0.450	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		.											.	NEFH-90	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	22.37:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	205	0		309	49	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EOMES	8320	broad.mit.edu;bcgsc.ca	37	3	27760357	27760358	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr3:27760357_27760358insT	ENST00000295743.4	-	4	1388_1389	c.1185_1186insA	c.(1183-1188)aaatacfs	p.Y396fs	EOMES_ENST00000449599.1_Frame_Shift_Ins_p.Y396fs|EOMES_ENST00000537516.1_Frame_Shift_Ins_p.Y101fs|EOMES_ENST00000461503.1_5'UTR			O95936	EOMES_HUMAN	eomesodermin	396					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						CGGGGTTGGTATTTGTGTAAGG	0.381																																					p.Y396fs													.	EOMES-156	0			c.1186_1187insA						.																																			SO:0001589	frameshift_variant	8320	exon4			GTTGGTATTTGTG	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.1186dupA	3.37:g.27760360_27760360dupT	ENSP00000295743:p.Tyr396fs	25	0		38	11	NM_005442	0	0	0	0	0	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Frame_Shift_Ins	INS	ENST00000295743.4	37	CCDS2646.1																																																																																			.		0.381	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
MET	4233	hgsc.bcm.edu	37	7	116411633	116411634	+	In_Frame_Ins	INS	-	-	TTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr7:116411633_116411634insTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT	ENST00000318493.6	+	13	3053_3054	c.2866_2867insTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT	c.(2866-2868)gtt>gTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGTtt	p.969_970insVSISTALLLLLGF	MET_ENST00000397752.3_In_Frame_Ins_p.951_952insVSISTALLLLLGF			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GATTGCTGGTGTTGTCTCAATA	0.347			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V956delinsVVSISTALLLLLGF		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.2866_2867insTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT						.																																			SO:0001652	inframe_insertion	4233	exon13	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	.	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.2867_2905dupTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT	7.37:g.116411633_116411634insTTGTCTCAATATCAACAGCACTGTTATTACTACTTGGGT	ENSP00000317272:p.Val957_Phe969dup	68	0		110	20	NM_001127500	0	0	0	0	0	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	In_Frame_Ins	INS	ENST00000318493.6	37	CCDS47689.1																																																																																			.		0.347	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
PLXNA4	91584	hgsc.bcm.edu;bcgsc.ca	37	7	131859582	131859583	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-HE-A5NH-01A-11D-A26P-10	TCGA-HE-A5NH-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	33b7e799-ad10-498f-9948-8ce433311539	10fb6a4b-3cb8-484e-abfd-0987cdecb32e	g.chr7:131859582_131859583insAA	ENST00000359827.3	-	21	4933_4934	c.3971_3972insTT	c.(3970-3972)gtgfs	p.V1324fs	PLXNA4_ENST00000321063.4_Frame_Shift_Ins_p.V1324fs			Q9HCM2	PLXA4_HUMAN	plexin A4	1324					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CTGGGAACAGCACCCGCATGGT	0.569																																					p.V1324fs		.											.	PLXNA4-91	0			c.3972_3973insTT						.																																			SO:0001589	frameshift_variant	91584	exon21			.	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3971_3972insTT	7.37:g.131859582_131859583insAA	ENSP00000352882:p.Val1324fs	120	0		172	55	NM_020911	0	0	0	0	0	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Frame_Shift_Ins	INS	ENST00000359827.3	37	CCDS43646.1																																																																																			.		0.569	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
