#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CEP164	22897	hgsc.bcm.edu;mdanderson.org	37	11	117214946	117214946	+	Silent	SNP	G	G	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:117214946G>T	ENST00000278935.3	+	4	294	c.147G>T	c.(145-147)ctG>ctT	p.L49L		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	49	Interaction with ATRIP.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TGATGTGGCTGGCGCGAGAGG	0.557																																						.											0													41.0	38.0	39.0					11																	117214946		2201	4296	6497	SO:0001819	synonymous_variant	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.147G>T	11.37:g.117214946G>T			Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	ENST00000278935.3	37	CCDS31683.1																																																																																				0.557	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
OR10Z1	128368	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	158576392	158576392	+	Missense_Mutation	SNP	T	T	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:158576392T>A	ENST00000361284.1	+	1	164	c.164T>A	c.(163-165)cTg>cAg	p.L55Q		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					GATAGCCATCTGCACACCCCC	0.512																																						.											0													257.0	247.0	250.0					1																	158576392		2203	4300	6503	SO:0001583	missense	128368			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.164T>A	1.37:g.158576392T>A	ENSP00000354707:p.Leu55Gln		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	37	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.465083	0.63513	.	.	ENSG00000198967	ENST00000361284	T	0.14893	2.47	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32244	N	0.006371	T	0.55000	0.1893	H	0.99689	4.705	0.28824	N	0.897528	D	0.89917	1.0	D	0.87578	0.998	T	0.71417	-0.4599	10	0.87932	D	0	.	14.4836	0.67599	0.0:0.0:0.0:1.0	.	55	Q8NGY1	O10Z1_HUMAN	Q	55	ENSP00000354707:L55Q	ENSP00000354707:L55Q	L	+	2	0	OR10Z1	156843016	1.000000	0.71417	0.142000	0.22268	0.716000	0.41182	7.809000	0.86057	2.246000	0.74042	0.533000	0.62120	CTG		0.512	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
ACBD3	64746	broad.mit.edu;hgsc.bcm.edu	37	1	226349254	226349255	+	In_Frame_Ins	INS	-	-	TTC			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:226349254_226349255insTTC	ENST00000366812.5	-	4	759_760	c.705_706insGAA	c.(703-708)gaaagg>gaaGAAagg	p.235_236insE	ACBD3_ENST00000464927.1_5'UTR	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	235	Arg-rich.|Glu-rich.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		AACCGAAGcctttcttcttcta	0.396																																						.											0																																										SO:0001652	inframe_insertion	64746			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.703_705dupGAA	1.37:g.226349261_226349263dupTTC	ENSP00000355777:p.Glu235_Glu235dup		B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	In_Frame_Ins	INS	ENST00000366812.5	37	CCDS1551.1																																																																																				0.396	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091528.1	NM_022735	
MPHOSPH8	54737	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	13	20220943	20220943	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr13:20220943G>C	ENST00000361479.5	+	3	798	c.730G>C	c.(730-732)Gaa>Caa	p.E244Q	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.E244Q	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	244	Lys-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		gaaaacaagagaagatcccaa	0.313																																						.											0													24.0	28.0	27.0					13																	20220943		2135	4255	6390	SO:0001583	missense	54737			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.730G>C	13.37:g.20220943G>C	ENSP00000355388:p.Glu244Gln		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	37	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186009	0.78789	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.38887	1.11;1.11	6.02	6.02	0.97574	.	0.778438	0.12648	N	0.450698	T	0.62380	0.2423	L	0.56769	1.78	0.58432	D	0.999996	D;D;D	0.67145	0.987;0.996;0.993	P;P;P	0.61658	0.638;0.892;0.782	T	0.58103	-0.7695	10	0.56958	D	0.05	.	19.5254	0.95203	0.0:0.0:1.0:0.0	.	244;244;244	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	Q	244	ENSP00000414663:E244Q;ENSP00000355388:E244Q	ENSP00000355388:E244Q	E	+	1	0	MPHOSPH8	19118943	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.921000	0.70028	2.857000	0.98124	0.650000	0.86243	GAA		0.313	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	NM_017520	
CPT2	1376	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	53676357	53676357	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:53676357C>G	ENST00000371486.3	+	4	1526	c.1011C>G	c.(1009-1011)caC>caG	p.H337Q	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	337					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	ACCTTGTCCACTTGTCCCACA	0.498																																						.											0													81.0	75.0	77.0					1																	53676357		2203	4300	6503	SO:0001583	missense	1376			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1011C>G	1.37:g.53676357C>G	ENSP00000360541:p.His337Gln		B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	ENST00000371486.3	37	CCDS575.1	.	.	.	.	.	.	.	.	.	.	C	7.566	0.665649	0.14710	.	.	ENSG00000157184	ENST00000371486	D	0.88741	-2.42	5.72	-1.81	0.07882	.	0.086182	0.85682	D	0.000000	D	0.86184	0.5872	L	0.42008	1.315	0.31634	N	0.648631	D	0.55800	0.973	P	0.52514	0.701	D	0.84180	0.0439	10	0.28530	T	0.3	-10.899	11.4141	0.49941	0.0:0.5086:0.0:0.4914	.	337	P23786	CPT2_HUMAN	Q	337	ENSP00000360541:H337Q	ENSP00000360541:H337Q	H	+	3	2	CPT2	53448945	0.998000	0.40836	0.416000	0.26546	0.686000	0.39977	1.073000	0.30691	-0.338000	0.08413	-0.767000	0.03436	CAC		0.498	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024757.1	NM_000098	
SIGLEC14	100049587	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	19	52149193	52149193	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:52149193G>A	ENST00000360844.6	-	3	583	c.542C>T	c.(541-543)aCg>aTg	p.T181M	SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000534261.2_5'Flank	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	181	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T181M(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GGCATTCCCCGTCCAGGAGAA	0.657																																						.											2	Substitution - Missense(2)	ovary(2)																																								SO:0001583	missense	100049587			AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.542C>T	19.37:g.52149193G>A	ENSP00000354090:p.Thr181Met		Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	CCDS42604.1	.	.	.	.	.	.	.	.	.	.	G	4.638	0.118691	0.08881	.	.	ENSG00000254415	ENST00000360844	D	0.86432	-2.12	3.09	-6.18	0.02085	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	2.183180	0.02203	N	0.062409	T	0.73401	0.3582	N	0.16266	0.395	0.09310	N	1	D	0.55172	0.97	P	0.45232	0.474	T	0.68712	-0.5336	10	0.07990	T	0.79	.	4.391	0.11341	0.5534:0.0:0.1647:0.2819	.	181	Q08ET2	SIG14_HUMAN	M	181	ENSP00000354090:T181M	ENSP00000354090:T181M	T	-	2	0	SIGLEC14	56841005	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-5.926000	0.00090	-1.582000	0.01640	0.508000	0.49915	ACG		0.657	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612	
NLRP7	199713	hgsc.bcm.edu;mdanderson.org	37	19	55450827	55450827	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:55450827G>A	ENST00000590030.1	-	3	1400	c.1360C>T	c.(1360-1362)Ctc>Ttc	p.L454F	NLRP7_ENST00000328092.5_Missense_Mutation_p.L454F|NLRP7_ENST00000446217.1_Missense_Mutation_p.L482F|NLRP7_ENST00000592784.1_Missense_Mutation_p.L454F|NLRP7_ENST00000448121.2_Missense_Mutation_p.L454F|NLRP7_ENST00000588756.1_Missense_Mutation_p.L454F|NLRP7_ENST00000340844.2_Missense_Mutation_p.L454F			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	454	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TCCTGGCGGAGGATGTCTCCG	0.617																																						.											0													35.0	33.0	34.0					19																	55450827		2203	4296	6499	SO:0001583	missense	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1360C>T	19.37:g.55450827G>A	ENSP00000465520:p.Leu454Phe		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153871	0.38021	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.72615	-0.64;-0.64;-0.67;-0.62	1.92	0.761	0.18448	.	0.000000	0.30134	N	0.010329	T	0.68100	0.2964	L	0.52905	1.665	0.09310	N	1	P;P;P;P	0.52842	0.927;0.927;0.927;0.956	P;P;P;P	0.53593	0.685;0.542;0.542;0.73	T	0.57260	-0.7842	10	0.33940	T	0.23	.	5.2422	0.15477	0.0:0.0:0.6591:0.3409	.	482;454;454;454	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	F	454;454;454;482;221	ENSP00000329568:L454F;ENSP00000409137:L454F;ENSP00000339491:L454F;ENSP00000414273:L482F	ENSP00000329568:L454F	L	-	1	0	NLRP7	60142639	0.042000	0.20092	0.010000	0.14722	0.052000	0.14988	1.187000	0.32090	0.313000	0.23062	0.462000	0.41574	CTC		0.617	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
MARCO	8685	hgsc.bcm.edu	37	2	119750740	119750740	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr2:119750740delC	ENST00000327097.4	+	16	1428	c.1293delC	c.(1291-1293)aacfs	p.N431fs	MARCO_ENST00000541757.1_Frame_Shift_Del_p.N353fs	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	431	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.N431K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GCAGTAGTAACCGAGGCCGGG	0.532																																					GBM(8;18 374 7467 11269 32796)	.											1	Substitution - Missense(1)	large_intestine(1)											132.0	124.0	126.0					2																	119750740		2203	4300	6503	SO:0001589	frameshift_variant	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1293delC	2.37:g.119750740delC	ENSP00000318916:p.Asn431fs		B4DW79|Q9Y5S3	Frame_Shift_Del	DEL	ENST00000327097.4	37	CCDS2124.1																																																																																				0.532	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
SMARCC2	6601	hgsc.bcm.edu	37	12	56565715	56565715	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr12:56565715C>T	ENST00000267064.4	-	20	1926	c.1840G>A	c.(1840-1842)Gaa>Aaa	p.E614K	SMARCC2_ENST00000394023.3_Missense_Mutation_p.E645K|SMARCC2_ENST00000550164.1_Missense_Mutation_p.E645K|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Missense_Mutation_p.E645K	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	614	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.E614K(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TTGTACATTTCCAGTGCCTGG	0.507																																						.											1	Substitution - Missense(1)	skin(1)											77.0	65.0	69.0					12																	56565715		2203	4300	6503	SO:0001583	missense	6601			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1840G>A	12.37:g.56565715C>T	ENSP00000267064:p.Glu614Lys		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798517	0.90538	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	3.89	3.0	0.34707	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.122444	0.52532	D	0.000069	T	0.38134	0.1029	L	0.61387	1.9	0.58432	D	0.999994	B;B;B;B;B	0.33345	0.409;0.356;0.409;0.409;0.356	B;B;B;B;B	0.30572	0.117;0.071;0.117;0.117;0.115	T	0.40308	-0.9570	10	0.56958	D	0.05	-11.0784	11.0341	0.47791	0.0:0.9047:0.0:0.0953	.	534;645;649;614;645	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	K	645;645;645;614	ENSP00000377591:E645K;ENSP00000449396:E645K;ENSP00000302919:E645K;ENSP00000267064:E614K	ENSP00000267064:E614K	E	-	1	0	SMARCC2	54851982	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	1.211000	0.43351	0.655000	0.94253	GAA		0.507	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
KLHL40	131377	hgsc.bcm.edu	37	3	42730128	42730128	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:42730128C>T	ENST00000287777.4	+	3	1440	c.1340C>T	c.(1339-1341)cCg>cTg	p.P447L		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	447					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GAATCGGACCCGCTGCCTTAC	0.612																																						.											0													82.0	67.0	72.0					3																	42730128		2203	4300	6503	SO:0001583	missense	131377			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1340C>T	3.37:g.42730128C>T	ENSP00000287777:p.Pro447Leu		Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	c	15.52	2.857538	0.51376	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.69806	-0.43	4.55	4.55	0.56014	Kelch-type beta propeller (1);	0.359095	0.32093	N	0.006600	T	0.81716	0.4881	H	0.94345	3.525	0.58432	D	0.999996	P	0.49696	0.927	P	0.49387	0.609	D	0.88197	0.2881	10	0.72032	D	0.01	.	17.3734	0.87384	0.0:1.0:0.0:0.0	.	447	Q2TBA0	KBTB5_HUMAN	L	447;192	ENSP00000287777:P447L	ENSP00000287777:P447L	P	+	2	0	KBTBD5	42705132	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	5.884000	0.69729	2.107000	0.64212	0.444000	0.29173	CCG		0.612	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
C3orf38	285237	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	88205252	88205252	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:88205252C>A	ENST00000318887.3	+	3	767	c.457C>A	c.(457-459)Ctt>Att	p.L153I	C3orf38_ENST00000486971.1_Intron	NM_173824.3	NP_776185.2	Q5JPI3	CC038_HUMAN	chromosome 3 open reading frame 38	153					apoptotic process (GO:0006915)					breast(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	12		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		CTTTGGACTTCTTAATTCTCA	0.378																																						.											0													69.0	67.0	68.0					3																	88205252		2203	4300	6503	SO:0001583	missense	285237			AL832398	CCDS2921.1, CCDS2921.2	3p11.1	2011-01-25			ENSG00000179021	ENSG00000179021			28384	protein-coding gene	gene with protein product						12477932	Standard	NM_173824		Approved	MGC26717	uc003dqw.3	Q5JPI3	OTTHUMG00000155752	ENST00000318887.3:c.457C>A	3.37:g.88205252C>A	ENSP00000322469:p.Leu153Ile		B2R8X6|Q8TC85	Missense_Mutation	SNP	ENST00000318887.3	37	CCDS2921.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051753	0.75960	.	.	ENSG00000179021	ENST00000318887	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.77558	0.4148	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79412	-0.1814	9	0.87932	D	0	-21.3008	12.4168	0.55498	0.0:0.9238:0.0:0.0762	.	153	Q5JPI3	CC038_HUMAN	I	153	.	ENSP00000322469:L153I	L	+	1	0	C3orf38	88287942	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.365000	0.52335	2.745000	0.94114	0.563000	0.77884	CTT		0.378	C3orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341513.1	NM_173824	
COL28A1	340267	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	7477054	7477054	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr7:7477054T>C	ENST00000399429.3	-	22	1902	c.1762A>G	c.(1762-1764)Aca>Gca	p.T588A		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	588					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GGAATTGATGTTCCAGGCATT	0.398																																						.											0													64.0	60.0	61.0					7																	7477054		1815	4076	5891	SO:0001583	missense	340267			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1762A>G	7.37:g.7477054T>C	ENSP00000382356:p.Thr588Ala		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	T	1.279	-0.610799	0.03690	.	.	ENSG00000215018	ENST00000399429;ENST00000435823;ENST00000399419	D;D	0.94092	-3.35;-2.19	4.68	0.111	0.14619	.	1.291790	0.06060	N	0.658230	T	0.80308	0.4599	N	0.03029	-0.43	0.09310	N	0.99999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.68930	-0.5279	10	0.13853	T	0.58	-0.0421	4.3873	0.11323	0.0:0.3617:0.3764:0.2619	.	588;588;588	Q2UY09-2;B5MDS6;Q2UY09	.;.;COSA1_HUMAN	A	588;5;588	ENSP00000382356:T588A;ENSP00000410557:T5A	ENSP00000382347:T588A	T	-	1	0	COL28A1	7443579	0.948000	0.32251	0.978000	0.43139	0.977000	0.68977	-0.431000	0.06965	-0.077000	0.12752	-0.408000	0.06270	ACA		0.398	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
RPRD2	23248	broad.mit.edu	37	1	150432553	150432553	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:150432553A>G	ENST00000369068.4	+	9	1175	c.1171A>G	c.(1171-1173)Aaa>Gaa	p.K391E	RPRD2_ENST00000539519.1_Missense_Mutation_p.K365E|RPRD2_ENST00000401000.4_Missense_Mutation_p.K365E|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	391						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CAGGAAGGAAAAACCTGCAGA	0.403																																						.											0													90.0	88.0	89.0					1																	150432553		1895	4123	6018	SO:0001583	missense	23248			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.1171A>G	1.37:g.150432553A>G	ENSP00000358064:p.Lys391Glu		A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	A	15.63	2.889132	0.52014	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.46451	0.87;0.87;0.87	5.02	5.02	0.67125	.	0.323100	0.33980	N	0.004380	T	0.37679	0.1012	L	0.50333	1.59	0.36784	D	0.884518	P;D;D	0.58268	0.941;0.97;0.982	P;P;P	0.58013	0.453;0.681;0.831	T	0.27226	-1.0080	10	0.33940	T	0.23	-12.9847	9.3946	0.38394	0.9192:0.0:0.0808:0.0	.	365;391;365	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	E	365;365;391	ENSP00000383785:K365E;ENSP00000445482:K365E;ENSP00000358064:K391E	ENSP00000358064:K391E	K	+	1	0	RPRD2	148699177	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.345000	0.65987	2.235000	0.73313	0.459000	0.35465	AAA		0.403	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
PEAR1	375033	broad.mit.edu	37	1	156877478	156877478	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:156877478T>C	ENST00000338302.3	+	8	946	c.721T>C	c.(721-723)Ttc>Ctc	p.F241L	PEAR1_ENST00000292357.7_Missense_Mutation_p.F241L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	241	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGGAGGTGTCTTCCAAACCCC	0.617																																						.											0													126.0	129.0	128.0					1																	156877478		2203	4300	6503	SO:0001583	missense	375033			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.721T>C	1.37:g.156877478T>C	ENSP00000344465:p.Phe241Leu		Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470186	0.63625	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.33216	1.42;1.42	5.04	3.91	0.45181	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.873050	0.09701	N	0.766941	T	0.10852	0.0265	L	0.36672	1.1	0.23063	N	0.998359	B;B	0.17465	0.022;0.002	B;B	0.06405	0.002;0.001	T	0.34625	-0.9821	10	0.87932	D	0	.	8.4374	0.32795	0.0:0.0967:0.0:0.9033	.	42;241	Q8N780;Q5VY43	.;PEAR1_HUMAN	L	241	ENSP00000344465:F241L;ENSP00000292357:F241L	ENSP00000292357:F241L	F	+	1	0	PEAR1	155144102	0.994000	0.37717	0.778000	0.31720	0.882000	0.50991	5.023000	0.64084	0.887000	0.36136	0.459000	0.35465	TTC		0.617	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
FOLH1B	219595	broad.mit.edu;mdanderson.org	37	11	89421805	89421805	+	RNA	SNP	G	G	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:89421805G>C	ENST00000532352.1	+	0	1475							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						CAACGACTTGGAATTGCTTCA	0.299																																						.											0													61.0	69.0	66.0					11																	89421805		2196	4294	6490			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89421805G>C				Missense_Mutation	SNP	ENST00000532352.1	37																																																																																					0.299	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696	
PGR	5241	broad.mit.edu	37	11	100999089	100999089	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:100999089delT	ENST00000325455.5	-	1	2166	c.713delA	c.(712-714)aagfs	p.K238fs	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Frame_Shift_Del_p.K238fs	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	238	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	AGGTTTGCCCTTCAGAAGCGG	0.721																																					Pancreas(124;2271 2354 21954 22882)	.											0													9.0	11.0	11.0					11																	100999089		2129	4263	6392	SO:0001589	frameshift_variant	5241			M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.713delA	11.37:g.100999089delT	ENSP00000325120:p.Lys238fs		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Frame_Shift_Del	DEL	ENST00000325455.5	37	CCDS8310.1																																																																																				0.721	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
KMT2D	8085	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	49432249	49432249	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr12:49432249C>A	ENST00000301067.7	-	34	8889	c.8890G>T	c.(8890-8892)Gtc>Ttc	p.V2964F	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2964	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCCGGTTGACCAGCTCCAAA	0.607																																						.											0													69.0	75.0	73.0					12																	49432249		1922	4121	6043	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8890G>T	12.37:g.49432249C>A	ENSP00000301067:p.Val2964Phe		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	9.138	1.013049	0.19277	.	.	ENSG00000167548	ENST00000301067	T	0.79454	-1.27	5.73	5.73	0.89815	.	0.000000	0.34906	N	0.003589	T	0.60064	0.2240	N	0.08118	0	0.25068	N	0.991018	P	0.44195	0.828	B	0.38880	0.284	T	0.62770	-0.6784	10	0.87932	D	0	.	13.4164	0.60972	0.0:0.8427:0.1573:0.0	.	2964	O14686	MLL2_HUMAN	F	2964	ENSP00000301067:V2964F	ENSP00000301067:V2964F	V	-	1	0	MLL2	47718516	0.444000	0.25649	1.000000	0.80357	0.865000	0.49528	1.100000	0.31025	2.882000	0.98803	0.655000	0.94253	GTC		0.607	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
RGMA	56963	broad.mit.edu	37	15	93588500	93588500	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr15:93588500C>T	ENST00000329082.7	-	4	1352	c.1081G>A	c.(1081-1083)Gtg>Atg	p.V361M	RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000557301.1_Missense_Mutation_p.V369M|RGMA_ENST00000425933.2_Missense_Mutation_p.V345M|RGMA_ENST00000556658.1_Missense_Mutation_p.V252M|RGMA_ENST00000542321.2_Missense_Mutation_p.V345M|RGMA_ENST00000543599.1_Missense_Mutation_p.V345M|RGMA_ENST00000538818.1_Missense_Mutation_p.V252M	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	361					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			CACTTGGCCACGGCTGTCTCG	0.667																																						.											0																																										SO:0001583	missense	56963			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.1081G>A	15.37:g.93588500C>T	ENSP00000330005:p.Val361Met		B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	37	CCDS45357.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378059	0.24944	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85;-1.85;-1.85	4.87	2.7	0.31948	Repulsive guidance molecule, C-terminal (1);	0.698695	0.14162	N	0.337299	T	0.67850	0.2937	N	0.08118	0	0.09310	N	1	B;B	0.18741	0.03;0.021	B;B	0.20184	0.016;0.028	T	0.55970	-0.8056	10	0.32370	T	0.25	-14.2297	6.0953	0.20017	0.0:0.6333:0.0:0.3667	.	369;361	G3V518;Q96B86	.;RGMA_HUMAN	M	345;345;361;345;252;369	ENSP00000442498:V345M;ENSP00000404442:V345M;ENSP00000330005:V361M;ENSP00000440025:V345M;ENSP00000442546:V252M;ENSP00000452126:V369M	ENSP00000330005:V361M	V	-	1	0	RGMA	91389504	0.013000	0.17824	0.916000	0.36221	0.692000	0.40212	2.102000	0.41796	1.033000	0.39918	0.491000	0.48974	GTG		0.667	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	NM_020211	
SPAG5	10615	broad.mit.edu	37	17	26919762	26919762	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr17:26919762T>C	ENST00000321765.5	-	3	832	c.500A>G	c.(499-501)gAc>gGc	p.D167G		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	167					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CACCAGATCGTCTGTTCTCAA	0.478																																						.											0													149.0	146.0	147.0					17																	26919762		2203	4300	6503	SO:0001583	missense	10615			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.500A>G	17.37:g.26919762T>C	ENSP00000323300:p.Asp167Gly		O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	T	2.541	-0.306243	0.05458	.	.	ENSG00000076382	ENST00000321765	T	0.18810	2.19	5.94	-1.78	0.07957	.	0.956671	0.08687	N	0.908487	T	0.03739	0.0106	N	0.00162	-1.95	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43180	-0.9407	10	0.17369	T	0.5	0.0	6.4053	0.21660	0.0:0.4283:0.1351:0.4366	.	167	Q96R06	SPAG5_HUMAN	G	167	ENSP00000323300:D167G	ENSP00000323300:D167G	D	-	2	0	SPAG5	23943889	0.001000	0.12720	0.068000	0.19968	0.132000	0.20833	-1.047000	0.03521	-0.106000	0.12110	-0.132000	0.14878	GAC		0.478	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
DNASE2	1777	broad.mit.edu;mdanderson.org;bcgsc.ca	37	19	12985463	12985463	+	IGR	SNP	C	C	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:12985463C>A	ENST00000222219.3	-	0	1955				MAST1_ENST00000251472.4_Missense_Mutation_p.P1498T|AC020934.1_ENST00000578125.1_RNA	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal						apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						TCGCTCCAAGCCCGCCTCCCC	0.721																																						.											0													21.0	19.0	20.0					19																	12985463		2195	4294	6489	SO:0001628	intergenic_variant	22983			AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115			19.37:g.12985463C>A			B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	ENST00000222219.3	37	CCDS12284.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033777	0.35893	.	.	ENSG00000105613	ENST00000251472	T	0.66995	-0.24	5.49	5.49	0.81192	.	0.520555	0.17475	N	0.172942	T	0.67107	0.2858	N	0.14661	0.345	0.44927	D	0.997947	D	0.89917	1.0	D	0.79108	0.992	T	0.61128	-0.7125	10	0.16896	T	0.51	-17.0268	14.8889	0.70590	0.0:1.0:0.0:0.0	.	1498	Q9Y2H9	MAST1_HUMAN	T	1498	ENSP00000251472:P1498T	ENSP00000251472:P1498T	P	+	1	0	MAST1	12846463	0.998000	0.40836	0.994000	0.49952	0.383000	0.30230	2.684000	0.46951	2.589000	0.87451	0.650000	0.86243	CCC		0.721	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1		
MYO9B	4650	broad.mit.edu	37	19	17321179	17321179	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:17321179A>G	ENST00000594824.1	+	37	5933	c.5786A>G	c.(5785-5787)gAg>gGg	p.E1929G	MYO9B_ENST00000397274.2_Missense_Mutation_p.E1929G|MYO9B_ENST00000595618.1_Missense_Mutation_p.E1929G|CTD-3032J10.3_ENST00000601929.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	1929	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TCTCCCTATGAGGGGGTCCTG	0.632																																						.											0													79.0	78.0	78.0					19																	17321179		2027	4190	6217	SO:0001583	missense	4650				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.5786A>G	19.37:g.17321179A>G	ENSP00000471367:p.Glu1929Gly		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.457778	0.84317	.	.	ENSG00000099331	ENST00000397274;ENST00000319396	D	0.85339	-1.97	4.86	4.86	0.63082	.	0.000000	0.49305	D	0.000144	D	0.89884	0.6844	L	0.56769	1.78	0.44668	D	0.997659	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	D	0.89121	0.3503	10	0.38643	T	0.18	.	13.6066	0.62050	1.0:0.0:0.0:0.0	.	1929;1935	Q13459;Q4LE74	MYO9B_HUMAN;.	G	1929;274	ENSP00000380444:E1929G	ENSP00000314032:E274G	E	+	2	0	MYO9B	17182179	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.366000	0.79548	1.818000	0.53035	0.459000	0.35465	GAG		0.632	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
ZNF528	84436	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	52909852	52909852	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:52909852C>T	ENST00000360465.3	+	6	653	c.227C>T	c.(226-228)gCa>gTa	p.A76V	ZNF528_ENST00000598192.1_Missense_Mutation_p.A76V|ZNF528_ENST00000594530.1_Missense_Mutation_p.A76V|ZNF528_ENST00000391788.2_Missense_Mutation_p.A66V	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	76	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GAGAAAATAGCAAACGATCCA	0.463																																						.											0													103.0	99.0	100.0					19																	52909852		2203	4300	6503	SO:0001583	missense	84436			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.227C>T	19.37:g.52909852C>T	ENSP00000353652:p.Ala76Val		B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	37	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	C	8.296	0.818786	0.16607	.	.	ENSG00000167555	ENST00000391788;ENST00000391787;ENST00000360465	T;T;T	0.05199	5.56;5.63;3.48	1.47	-1.01	0.10169	Krueppel-associated box (1);	.	.	.	.	T	0.04998	0.0134	L	0.47078	1.49	0.09310	N	1	B	0.18610	0.029	B	0.12837	0.008	T	0.44832	-0.9302	9	0.22109	T	0.4	.	2.7793	0.05356	0.0:0.487:0.3032:0.2098	.	76	Q3MIS6	ZN528_HUMAN	V	66;76;76	ENSP00000375665:A66V;ENSP00000375664:A76V;ENSP00000353652:A76V	ENSP00000353652:A76V	A	+	2	0	ZNF528	57601664	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.449000	0.02392	-0.197000	0.10350	-0.373000	0.07131	GCA		0.463	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
MFSD6	54842	broad.mit.edu	37	2	191364759	191364759	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr2:191364759G>A	ENST00000392328.1	+	8	2515	c.2191G>A	c.(2191-2193)Gaa>Aaa	p.E731K	MFSD6_ENST00000535751.1_Missense_Mutation_p.E193K|MFSD6_ENST00000281416.7_Missense_Mutation_p.E731K	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	731					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TGAGAATAGGGAAAATTCTCC	0.468																																						.											0													65.0	60.0	62.0					2																	191364759		2203	4300	6503	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.2191G>A	2.37:g.191364759G>A	ENSP00000376141:p.Glu731Lys		D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	CCDS2306.1	.	.	.	.	.	.	.	.	.	.	G	5.451	0.268328	0.10349	.	.	ENSG00000151690	ENST00000392328;ENST00000281416;ENST00000542423;ENST00000535751	T;T	0.32515	1.45;1.45	5.13	2.36	0.29203	.	1.482540	0.03781	N	0.261270	T	0.16642	0.0400	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22941	-1.0202	10	0.10636	T	0.68	-0.2343	4.8252	0.13412	0.2523:0.1555:0.5922:0.0	.	731	Q6ZSS7	MFSD6_HUMAN	K	731;731;171;193	ENSP00000376141:E731K;ENSP00000281416:E731K	ENSP00000281416:E731K	E	+	1	0	MFSD6	191073004	0.006000	0.16342	0.006000	0.13384	0.472000	0.32918	0.495000	0.22483	0.328000	0.23435	-0.122000	0.15005	GAA		0.468	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
BHLHE40	8553	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	5025274	5025274	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:5025274A>C	ENST00000256495.3	+	5	1739	c.1136A>C	c.(1135-1137)cAg>cCg	p.Q379P		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	379					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						CTCATGCCCCAGAGACTCCCT	0.557																																						.											0													145.0	142.0	143.0					3																	5025274		2203	4300	6503	SO:0001583	missense	8553			AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.1136A>C	3.37:g.5025274A>C	ENSP00000256495:p.Gln379Pro		Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	37	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.676777	0.29783	.	.	ENSG00000134107	ENST00000256495	T	0.37411	1.2	5.51	5.51	0.81932	.	0.000000	0.56097	D	0.000024	T	0.26085	0.0636	N	0.25144	0.715	0.53688	D	0.999975	B	0.09022	0.002	B	0.09377	0.004	T	0.06320	-1.0833	10	0.18710	T	0.47	.	15.6247	0.76845	1.0:0.0:0.0:0.0	.	379	O14503	BHE40_HUMAN	P	379	ENSP00000256495:Q379P	ENSP00000256495:Q379P	Q	+	2	0	BHLHE40	5000274	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.403000	0.73264	2.093000	0.63338	0.533000	0.62120	CAG		0.557	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
ALG1L	200810	broad.mit.edu	37	3	125647387	125647387	+	IGR	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:125647387G>A	ENST00000340333.3	-	0	805				FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like								transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						ACCAGAAACTGTTTCCCTATG	0.502																																						.											0																																										SO:0001628	intergenic_variant	100125556			BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588		3.37:g.125647387G>A			D3DNA5	RNA	SNP	ENST00000340333.3	37	CCDS33840.1																																																																																				0.502	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	NM_001015050	
SDAD1	55153	broad.mit.edu	37	4	76896979	76896979	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr4:76896979A>G	ENST00000356260.5	-	6	614	c.496T>C	c.(496-498)Tac>Cac	p.Y166H	SDAD1_ENST00000513089.1_5'Flank|SDAD1_ENST00000395711.4_Missense_Mutation_p.Y129H	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	166					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AACATGGTGTACATGAAATTT	0.378																																						.											0													151.0	142.0	145.0					4																	76896979		2203	4300	6503	SO:0001583	missense	55153			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.496T>C	4.37:g.76896979A>G	ENSP00000348596:p.Tyr166His		Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	ENST00000356260.5	37	CCDS3573.2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333274	0.81801	.	.	ENSG00000198301	ENST00000356260;ENST00000395711	T;T	0.74002	-0.8;2.65	5.31	5.31	0.75309	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83788	0.5330	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	D	0.84275	0.0491	10	0.48119	T	0.1	-14.0096	13.4856	0.61364	1.0:0.0:0.0:0.0	.	129;166	E7EW05;Q9NVU7	.;SDA1_HUMAN	H	166;129	ENSP00000348596:Y166H;ENSP00000379061:Y129H	ENSP00000348596:Y166H	Y	-	1	0	SDAD1	77116003	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.923000	0.92808	2.128000	0.65567	0.533000	0.62120	TAC		0.378	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115	
NDST4	64579	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	115767025	115767025	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr4:115767025A>T	ENST00000264363.2	-	10	2747	c.2069T>A	c.(2068-2070)aTc>aAc	p.I690N		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	690	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GAGGATGGTGATGATCTTGGC	0.428																																						.											0													134.0	125.0	128.0					4																	115767025		2203	4300	6503	SO:0001583	missense	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2069T>A	4.37:g.115767025A>T	ENSP00000264363:p.Ile690Asn		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.573228	0.86542	.	.	ENSG00000138653	ENST00000264363	T	0.72167	-0.63	5.61	5.61	0.85477	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.88047	0.6332	M	0.93898	3.47	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.91197	0.4988	10	0.87932	D	0	.	15.8104	0.78557	1.0:0.0:0.0:0.0	.	690	Q9H3R1	NDST4_HUMAN	N	690	ENSP00000264363:I690N	ENSP00000264363:I690N	I	-	2	0	NDST4	115986474	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.851000	0.92205	2.125000	0.65367	0.533000	0.62120	ATC		0.428	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
ABCE1	6059	broad.mit.edu	37	4	146041093	146041093	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr4:146041093delT	ENST00000296577.4	+	11	1447	c.932delT	c.(931-933)attfs	p.I311fs	OTUD4_ENST00000455611.2_Intron|ABCE1_ENST00000502803.1_3'UTR	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	311	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GGCATAAACATTTTTTTGGAT	0.358																																						.											0													37.0	37.0	37.0					4																	146041093		2203	4299	6502	SO:0001589	frameshift_variant	6059			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.932delT	4.37:g.146041093delT	ENSP00000296577:p.Ile311fs		O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Frame_Shift_Del	DEL	ENST00000296577.4	37	CCDS34071.1																																																																																				0.358	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
CDC23	8697	broad.mit.edu	37	5	137524673	137524673	+	Silent	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr5:137524673C>T	ENST00000394886.2	-	16	1818	c.1788G>A	c.(1786-1788)acG>acA	p.T596T		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	596					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CCAACTATGGCGTGACAGAAG	0.493																																						.											0													122.0	115.0	117.0					5																	137524673		2203	4300	6503	SO:0001819	synonymous_variant	8697			AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.1788G>A	5.37:g.137524673C>T			A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Silent	SNP	ENST00000394886.2	37	CCDS4200.2																																																																																				0.493	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
LAMB4	22798	broad.mit.edu	37	7	107763584	107763584	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr7:107763584delA	ENST00000388781.3	-	2	109	c.26delT	c.(25-27)ttgfs	p.L9fs	LAMB4_ENST00000414450.2_Frame_Shift_Del_p.L9fs|LAMB4_ENST00000205386.4_Frame_Shift_Del_p.L9fs|LAMB4_ENST00000388780.3_Frame_Shift_Del_p.L9fs|LAMB4_ENST00000418464.1_Frame_Shift_Del_p.L9fs	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	9					cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ACCAAGGTGCAAAAAAAGGGT	0.308																																						.											0													101.0	103.0	102.0					7																	107763584		2203	4300	6503	SO:0001589	frameshift_variant	22798			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.26delT	7.37:g.107763584delA	ENSP00000373433:p.Leu9fs		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Frame_Shift_Del	DEL	ENST00000388781.3	37	CCDS34732.1																																																																																				0.308	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
DOCK5	80005	broad.mit.edu	37	8	25203089	25203089	+	Silent	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr8:25203089C>T	ENST00000276440.7	+	26	2760	c.2716C>T	c.(2716-2718)Ctg>Ttg	p.L906L		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	906					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTCGCAGCTTCTGAGCAACAT	0.552																																					Pancreas(145;34 1887 3271 10937 30165)	.											0													162.0	140.0	148.0					8																	25203089		2203	4300	6503	SO:0001819	synonymous_variant	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2716C>T	8.37:g.25203089C>T			B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	C	9.928	1.213958	0.22289	.	.	ENSG00000147459	ENST00000444569	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	T	0.70842	0.3270	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67845	-0.5565	4	.	.	.	.	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	.	.	.	F	677	.	.	S	+	2	0	DOCK5	25259006	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.643000	0.61390	2.941000	0.99782	0.655000	0.94253	TCT		0.552	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
ORM1	5004	broad.mit.edu	37	9	117088629	117088629	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr9:117088629G>A	ENST00000259396.8	+	6	676	c.598G>A	c.(598-600)Gaa>Aaa	p.E200K		NM_000607.2	NP_000598.2	P02763	A1AG1_HUMAN	orosomucoid 1	200					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|large_intestine(4)|lung(2)	8		Myeloproliferative disorder(63;0.163)			Abiraterone(DB05812)|Acenocoumarol(DB01418)|Ajmaline(DB01426)|Alfentanil(DB00802)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aprindine(DB01429)|Bupropion(DB01156)|Canagliflozin(DB08907)|Celecoxib(DB00482)|Chlorpromazine(DB00477)|Desipramine(DB01151)|Disopyramide(DB00280)|Doxazosin(DB00590)|Doxepin(DB01142)|Erlotinib(DB00530)|Fluoxetine(DB00472)|Gefitinib(DB00317)|Imatinib(DB00619)|Imipramine(DB00458)|Ivacaftor(DB08820)|Maprotiline(DB00934)|Mirabegron(DB08893)|Nateglinide(DB00731)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxycodone(DB00497)|Penbutolol(DB01359)|Pethidine(DB00454)|Phenprocoumon(DB00946)|Pitavastatin(DB08860)|Prazosin(DB00457)|Propranolol(DB00571)|Quinidine(DB00908)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Tamsulosin(DB00706)|Telaprevir(DB05521)|Thalidomide(DB01041)|Trazodone(DB00656)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Vismodegib(DB08828)|Warfarin(DB00682)	GGAGGAGGGGGAATCCTAGCA	0.567																																						.											0													10.0	14.0	13.0					9																	117088629		2135	4212	6347	SO:0001583	missense	5004				CCDS6803.1	9q32	2013-09-19			ENSG00000229314	ENSG00000229314		"""Lipocalins"""	8498	protein-coding gene	gene with protein product		138600					Standard	NM_000607		Approved		uc004bik.4	P02763	OTTHUMG00000021012	ENST00000259396.8:c.598G>A	9.37:g.117088629G>A	ENSP00000259396:p.Glu200Lys		B7ZKQ5|Q5T539|Q5U067|Q8TC16	Missense_Mutation	SNP	ENST00000259396.8	37	CCDS6803.1	.	.	.	.	.	.	.	.	.	.	-	8.126	0.781943	0.16189	.	.	ENSG00000229314	ENST00000259396	T	0.09538	2.97	2.31	1.4	0.22301	.	4.185410	0.00481	N	0.000130	T	0.10423	0.0255	L	0.37630	1.12	0.09310	N	0.999999	B	0.21821	0.061	B	0.11329	0.006	T	0.27938	-1.0059	10	0.45353	T	0.12	3.0E-4	5.045	0.14479	0.1769:0.0:0.8231:0.0	.	200	P02763	A1AG1_HUMAN	K	200	ENSP00000259396:E200K	ENSP00000259396:E200K	E	+	1	0	ORM1	116128450	0.007000	0.16637	0.000000	0.03702	0.263000	0.26337	1.175000	0.31944	0.539000	0.28788	0.164000	0.16699	GAA		0.567	ORM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055426.1		
FAM9A	171482	broad.mit.edu	37	X	8767124	8767124	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chrX:8767124C>T	ENST00000543214.1	-	3	238	c.103G>A	c.(103-105)Gcc>Acc	p.A35T	FAM9A_ENST00000381003.3_Missense_Mutation_p.A35T	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	35						nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				AAGTTAGAGGCGATCCCTGAA	0.542																																						.											0													55.0	42.0	46.0					X																	8767124		2202	4277	6479	SO:0001583	missense	171482				CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.103G>A	X.37:g.8767124C>T	ENSP00000440163:p.Ala35Thr		B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	c	4.889	0.165142	0.09339	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.439	-0.879	0.10613	.	.	.	.	.	T	0.20577	0.0495	L	0.27053	0.805	0.09310	N	1	D	0.65815	0.995	P	0.45971	0.499	T	0.12243	-1.0555	7	0.48119	T	0.1	.	.	.	.	.	35	Q8IZU1	FAM9A_HUMAN	T	35	.	ENSP00000370391:A35T	A	-	1	0	FAM9A	8727124	0.184000	0.23200	0.002000	0.10522	0.002000	0.02628	0.759000	0.26461	-0.536000	0.06298	-0.544000	0.04233	GCC		0.542	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951	
SRP14	6727	broad.mit.edu	37	15	40328594	40328595	+	In_Frame_Ins	INS	-	-	GGG			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr15:40328594_40328595insGGG	ENST00000267884.6	-	5	421_422	c.350_351insCCC	c.(349-351)cct>ccCCCt	p.117_117P>PP	SRP14_ENST00000560773.1_In_Frame_Ins_p.37_37P>PP|SRP14-AS1_ENST00000504245.1_lincRNA|SRP14_ENST00000558527.1_5'UTR|SRP14_ENST00000558720.1_In_Frame_Ins_p.37_37P>PP	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)	117	Ala/Thr-rich.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		ctgctgcggcaggtgctgctgc	0.48																																						.											0																																										SO:0001652	inframe_insertion	6727				CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108		ENST00000267884.6:c.350_351insCCC	15.37:g.40328594_40328595insGGG	ENSP00000267884:p.Pro117dup		B5BUF5|Q6B0K5|Q96Q14	In_Frame_Ins	INS	ENST00000267884.6	37	CCDS42017.1																																																																																				0.480	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418262.2	NM_003134	
SRRM2	23524	broad.mit.edu	37	16	2818052	2818053	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:2818052_2818053insC	ENST00000301740.8	+	11	8072_8073	c.7523_7524insC	c.(7522-7527)gagccafs	p.EP2508fs	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2508	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GATGTGGGGGAGCCACCTGCCT	0.639																																						.											0																																										SO:0001589	frameshift_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	Exception_encountered	16.37:g.2818052_2818053insC	ENSP00000301740:p.Glu2508fs		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Frame_Shift_Ins	INS	ENST00000301740.8	37	CCDS32373.1																																																																																				0.639	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
CDH13	1012	broad.mit.edu	37	16	83636109	83636110	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:83636109_83636110insG	ENST00000566620.1	+	8	1301_1302	c.1011_1012insG	c.(1012-1014)ggafs	p.G338fs	CDH13_ENST00000428848.3_Frame_Shift_Ins_p.G299fs|CDH13_ENST00000268613.10_Frame_Shift_Ins_p.G385fs	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	338	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AAGATATGGCTGGACTGGATGT	0.421																																						.											0																																										SO:0001589	frameshift_variant	1012			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1013dupG	16.37:g.83636111_83636111dupG	ENSP00000454435:p.Gly338fs		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Frame_Shift_Ins	INS	ENST00000566620.1	37	CCDS58486.1																																																																																				0.421	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
FAM122B	159090	broad.mit.edu	37	X	133930385	133930386	+	5'UTR	INS	-	-	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chrX:133930385_133930386insC	ENST00000370790.1	-	0	778_779				FAM122B_ENST00000493333.1_5'UTR|FAM122B_ENST00000486347.1_5'Flank|FAM122B_ENST00000298090.6_5'UTR|FAM122B_ENST00000343004.5_5'UTR|FAM122C_ENST00000414371.2_5'Flank	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B											breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					gggggcgggggctgggggcgga	0.639																																						.											0																																										SO:0001623	5_prime_UTR_variant	159090			BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.-151->G	X.37:g.133930386_133930386dupC			A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Splice_Site	INS	ENST00000370790.1	37	CCDS55497.1																																																																																				0.639	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058382.1	NM_145284	
CLASP2	23122	ucsc.edu;mdanderson.org	37	3	33586217	33586217	+	Silent	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:33586217G>A	ENST00000468888.2	-	31	3340	c.3294C>T	c.(3292-3294)caC>caT	p.H1098H	CLASP2_ENST00000539981.1_Silent_p.H867H|CLASP2_ENST00000461133.3_Silent_p.H857H|CLASP2_ENST00000399362.4_Silent_p.H1097H|CLASP2_ENST00000307312.7_Silent_p.H579H|CLASP2_ENST00000480013.1_Silent_p.H877H|CLASP2_ENST00000359576.5_Silent_p.H1089H			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	878	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TGTTTCGAAGGTGATTATGAA	0.328																																						.											0													97.0	93.0	94.0					3																	33586217		1840	4082	5922	SO:0001819	synonymous_variant	23122			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3294C>T	3.37:g.33586217G>A			Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	G	8.326	0.825430	0.16749	.	.	ENSG00000163539	ENST00000480385	.	.	.	5.62	4.74	0.60224	.	.	.	.	.	T	0.62073	0.2398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58836	-0.7566	4	.	.	.	-10.8157	11.1819	0.48633	0.1383:0.0:0.8617:0.0	.	.	.	.	S	154	.	.	P	-	1	0	CLASP2	33561221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.305000	0.51873	2.631000	0.89168	0.650000	0.86243	CCT		0.328	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
EFEMP2	30008	ucsc.edu	37	11	65635766	65635766	+	Splice_Site	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:65635766T>C	ENST00000307998.6	-	9	1204	c.974A>G	c.(973-975)aAc>aGc	p.N325S	EFEMP2_ENST00000528176.1_Splice_Site_p.N325S|EFEMP2_ENST00000532648.1_5'Flank	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	325	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		ATTGACTCACTTCTCAGAGAC	0.602																																						.											0													37.0	36.0	36.0					11																	65635766		2201	4296	6497	SO:0001630	splice_region_variant	30008			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.974+1A>G	11.37:g.65635766T>C			A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	CCDS8116.1	.	.	.	.	.	.	.	.	.	.	T	9.495	1.101722	0.20632	.	.	ENSG00000172638	ENST00000531645;ENST00000528176;ENST00000307998	D;D;D	0.91740	-2.9;-2.9;-2.9	4.82	4.82	0.62117	Epidermal growth factor-like (1);EGF-like calcium-binding (1);	0.000000	0.53938	D	0.000051	D	0.89842	0.6832	L	0.48877	1.53	0.58432	D	0.999998	P;P	0.40731	0.63;0.728	B;B	0.43728	0.191;0.429	D	0.88380	0.3001	9	.	.	.	.	12.3479	0.55132	0.0:0.0:0.0:1.0	.	325;325	E9PRU1;O95967	.;FBLN4_HUMAN	S	41;325;325	ENSP00000436521:N41S;ENSP00000434151:N325S;ENSP00000309953:N325S	.	N	-	2	0	EFEMP2	65392342	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	5.764000	0.68826	1.814000	0.52955	0.374000	0.22700	AAC		0.602	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938	Missense_Mutation
FAM184A	79632	ucsc.edu	37	6	119332586	119332586	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr6:119332586T>C	ENST00000338891.7	-	6	1984	c.1541A>G	c.(1540-1542)gAa>gGa	p.E514G	FAM184A_ENST00000352896.5_Missense_Mutation_p.E394G|FAM184A_ENST00000521531.1_Missense_Mutation_p.E514G|FAM184A_ENST00000522284.1_Missense_Mutation_p.E394G|FAM184A_ENST00000368475.4_Missense_Mutation_p.E394G|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	514						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GTTATGTTGTTCTTCCAAATC	0.279																																						.											0													85.0	73.0	77.0					6																	119332586		1791	4055	5846	SO:0001583	missense	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1541A>G	6.37:g.119332586T>C	ENSP00000342604:p.Glu514Gly		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.33|15.33	2.801527|2.801527	0.50315|0.50315	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284|ENST00000448815	T;T;T;T;T|.	0.00362|.	7.84;7.84;7.84;7.84;7.84|.	4.9|4.9	3.73|3.73	0.42828|0.42828	.|.	0.185306|.	0.47455|.	D|.	0.000234|.	T|T	0.42787|0.42787	0.1218|0.1218	L|L	0.44542|0.44542	1.39|1.39	0.36858|0.36858	D|D	0.888276|0.888276	P;P;P|.	0.49559|.	0.925;0.634;0.897|.	P;B;B|.	0.46758|.	0.526;0.234;0.371|.	T|T	0.35101|0.35101	-0.9802|-0.9802	10|5	0.41790|.	T|.	0.15|.	-5.3679|-5.3679	11.9853|11.9853	0.53145|0.53145	0.0:0.0:0.1449:0.855|0.0:0.0:0.1449:0.855	.|.	514;394;514|.	Q8NB25-2;F8W8D6;Q8NB25|.	.;.;F184A_HUMAN|.	G|D	514;394;394;514;394|100	ENSP00000342604:E514G;ENSP00000326608:E394G;ENSP00000357460:E394G;ENSP00000430442:E514G;ENSP00000429826:E394G|.	ENSP00000342604:E514G|.	E|N	-|-	2|1	0|0	FAM184A|FAM184A	119374285|119374285	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.394000|0.394000	0.30568|0.30568	4.388000|4.388000	0.59633|0.59633	0.886000|0.886000	0.36113|0.36113	0.397000|0.397000	0.26171|0.26171	GAA|AAC		0.279	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
PPFIA1	8500	ucsc.edu	37	11	70178163	70178163	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:70178163A>G	ENST00000253925.7	+	9	1390	c.1175A>G	c.(1174-1176)gAg>gGg	p.E392G	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.E392G	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	392					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCGGAGGTGGAGGCGGAGCTG	0.572																																						.											0													107.0	103.0	105.0					11																	70178163		2200	4294	6494	SO:0001583	missense	8500			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1175A>G	11.37:g.70178163A>G	ENSP00000253925:p.Glu392Gly		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	A	31	5.069588	0.93950	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	T;T	0.37915	1.17;1.17	5.13	5.13	0.70059	.	0.000000	0.85682	U	0.000000	T	0.66781	0.2824	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.75365	-0.3343	10	0.87932	D	0	.	14.9748	0.71264	1.0:0.0:0.0:0.0	.	392;392	Q13136;Q13136-2	LIPA1_HUMAN;.	G	392	ENSP00000253925:E392G;ENSP00000374198:E392G	ENSP00000253925:E392G	E	+	2	0	PPFIA1	69855811	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.116000	0.94341	1.931000	0.55961	0.533000	0.62120	GAG		0.572	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
TFAM	7019	ucsc.edu	37	10	60148464	60148464	+	Missense_Mutation	SNP	T	T	G	rs77418790		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr10:60148464T>G	ENST00000487519.1	+	4	852	c.326T>G	c.(325-327)gTa>gGa	p.V109G	TFAM_ENST00000373899.3_3'UTR|TFAM_ENST00000373895.3_Missense_Mutation_p.V109G	NM_001270782.1|NM_003201.2	NP_001257711.1|NP_003192.1	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial	109					DNA-dependent DNA replication (GO:0006261)|gene expression (GO:0010467)|mitochondrial respiratory chain complex assembly (GO:0033108)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|mitochondrial light strand promoter sense binding (GO:0070363)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						GAGTGGCAGGTATATAAAGAA	0.348																																						.											0																																										SO:0001583	missense	7019			BC018628	CCDS7253.1, CCDS59217.1	10q21	2010-09-24			ENSG00000108064	ENSG00000108064			11741	protein-coding gene	gene with protein product		600438		TCF6, TCF6L2		7789991	Standard	NM_003201		Approved		uc001jkf.4	Q00059	OTTHUMG00000018270	ENST00000487519.1:c.326T>G	10.37:g.60148464T>G	ENSP00000420588:p.Val109Gly		A8MRB2|A9QXC6|B5BU05|Q5U0C6	Missense_Mutation	SNP	ENST00000487519.1	37	CCDS7253.1	.	.	.	.	.	.	.	.	.	.	T	9.686	1.150562	0.21371	.	.	ENSG00000108064	ENST00000487519;ENST00000373895	D;D	0.97941	-4.62;-4.62	5.93	-1.14	0.09741	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.851711	0.10843	N	0.627976	D	0.95815	0.8638	M	0.66939	2.045	0.26014	N	0.981958	P;P	0.48694	0.811;0.914	B;P	0.45167	0.433;0.472	D	0.90352	0.4367	10	0.33940	T	0.23	.	6.2978	0.21095	0.0:0.4583:0.1274:0.4143	.	109;109	A8MRB2;Q00059	.;TFAM_HUMAN	G	109	ENSP00000420588:V109G;ENSP00000363002:V109G	ENSP00000363002:V109G	V	+	2	0	TFAM	59818470	0.014000	0.17966	0.565000	0.28409	0.047000	0.14425	-0.297000	0.08276	-0.097000	0.12307	-0.242000	0.12053	GTA		0.348	TFAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048146.1	NM_003201	
TBC1D12	23232	ucsc.edu	37	10	96163181	96163181	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr10:96163181T>C	ENST00000225235.4	+	1	921	c.811T>C	c.(811-813)Ttc>Ctc	p.F271L		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	271							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TGACATTCACTTCAACTCTCG	0.731																																						.											0													8.0	11.0	10.0					10																	96163181		1754	3895	5649	SO:0001583	missense	23232			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.811T>C	10.37:g.96163181T>C	ENSP00000225235:p.Phe271Leu		Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	ENST00000225235.4	37	CCDS41553.1	.	.	.	.	.	.	.	.	.	.	T	9.097	1.003103	0.19121	.	.	ENSG00000108239	ENST00000225235	T	0.03468	3.92	3.63	2.44	0.29823	.	2.556960	0.02013	N	0.047196	T	0.02304	0.0071	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40997	-0.9533	10	0.02654	T	1	1.4128	6.9045	0.24301	0.0:0.0:0.2373:0.7627	.	271	O60347	TBC12_HUMAN	L	271	ENSP00000225235:F271L	ENSP00000225235:F271L	F	+	1	0	TBC1D12	96153171	0.048000	0.20356	0.002000	0.10522	0.197000	0.23852	0.095000	0.15127	0.540000	0.28808	0.379000	0.24179	TTC		0.731	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
ADAM29	11086	mdanderson.org	37	4	175899075	175899076	+	Missense_Mutation	DNP	CA	CA	TG	rs140568401|rs61744599	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr4:175899075_175899076CA>TG	ENST00000359240.3	+	5	3069_3070	c.2399_2400CA>TG	c.(2398-2400)aCA>aTG	p.T800M	ADAM29_ENST00000514159.1_Missense_Mutation_p.T800M|ADAM29_ENST00000445694.1_Missense_Mutation_p.T800M|ADAM29_ENST00000404450.4_Missense_Mutation_p.T800M|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	800	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CCTCCTGTGACACCCTCCCAGA	0.564																																					Ovarian(140;1727 1835 21805 25838 41440)	.											0																																										SO:0001583	missense	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	Exception_encountered	4.37:g.175899075_175899076delinsTG	ENSP00000352177:p.Thr800Met		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	DNP	ENST00000359240.3	37	CCDS3823.1																																																																																				0.564	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ADCYAP1	116	mdanderson.org	37	18	907710	907710	+	Missense_Mutation	SNP	A	A	G	rs2856966	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr18:907710A>G	ENST00000579794.1	+	2	439	c.161A>G	c.(160-162)gAt>gGt	p.D54G	RP11-672L10.2_ENST00000577358.1_RNA|ADCYAP1_ENST00000450565.3_Missense_Mutation_p.D54G|RP11-672L10.2_ENST00000581719.2_RNA|RP11-672L10.2_ENST00000580612.1_RNA|RP11-672L10.3_ENST00000582554.1_RNA	NM_001117.3	NP_001108.2	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary)	54			D -> G (in dbSNP:rs2856966). {ECO:0000269|PubMed:11968092, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:1730060, ECO:0000269|PubMed:1739432}.		activation of adenylate cyclase activity (GO:0007190)|ATP metabolic process (GO:0046034)|behavioral fear response (GO:0001662)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|cellular response to glucocorticoid stimulus (GO:0071385)|female pregnancy (GO:0007565)|histamine secretion (GO:0001821)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of acute inflammatory response to non-antigenic stimulus (GO:0002878)|negative regulation of cell cycle (GO:0045786)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of Rho GTPase activity (GO:0034259)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|pituitary gland development (GO:0021983)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of somatostatin secretion (GO:0090274)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)|regulation of postsynaptic membrane potential (GO:0060078)|regulation of protein localization (GO:0032880)|response to ethanol (GO:0045471)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	neuropeptide hormone activity (GO:0005184)|peptide hormone receptor binding (GO:0051428)|pituitary adenylate cyclase activating polypeptide activity (GO:0016521)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						CCAGACTTCGATGGCTCGGAg	0.736													A|||	721	0.14397	0.0953	0.1527	5008	,	,		7649	0.0565		0.2495	False		,,,				2504	0.1851					.											0								A	GLY/ASP,GLY/ASP	372,3918		17,338,1790	6.0	8.0	7.0		161,161	4.0	0.2	18	dbSNP_100	7	1799,6595		196,1407,2594	yes	missense,missense	ADCYAP1	NM_001099733.1,NM_001117.3	94,94	213,1745,4384	GG,GA,AA		21.432,8.6713,17.1161	benign,benign	54/177,54/177	907710	2171,10513	2145	4197	6342	SO:0001583	missense	116			S83513	CCDS11825.1	18p11	2013-02-28			ENSG00000141433	ENSG00000141433		"""Endogenous ligands"""	241	protein-coding gene	gene with protein product	"""prepro-PACAP"""	102980				1730060	Standard	NM_001099733		Approved	PACAP	uc010dkh.4	P18509	OTTHUMG00000131479	ENST00000579794.1:c.161A>G	18.37:g.907710A>G	ENSP00000462647:p.Asp54Gly		B2R7N4|Q52LQ0	Missense_Mutation	SNP	ENST00000579794.1	37	CCDS11825.1	321	0.14697802197802198	55	0.11178861788617886	62	0.1712707182320442	34	0.05944055944055944	170	0.22427440633245382	A	1.915	-0.449794	0.04572	0.086713	0.21432	ENSG00000141433	ENST00000450565;ENST00000400219;ENST00000269200	.	.	.	3.95	3.95	0.45737	.	0.459988	0.24710	N	0.036227	T	0.00012	0.0000	N	0.08118	0	0.52501	P	4.099999999995774E-5	B	0.09022	0.002	B	0.01281	0.0	T	0.13980	-1.0489	8	0.21014	T	0.42	.	7.8153	0.29256	0.9042:0.0:0.0958:0.0	rs2856966;rs58369534;rs2856966	54	P18509	PACA_HUMAN	G	193;54;54	.	ENSP00000269200:D54G	D	+	2	0	ADCYAP1	897710	0.778000	0.28640	0.216000	0.23742	0.004000	0.04260	1.322000	0.33689	2.019000	0.59389	0.379000	0.24179	GAT		0.736	ADCYAP1-003	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440765.3	NM_001117	
AGPAT9	84803	mdanderson.org	37	4	84502873	84502873	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr4:84502873T>C	ENST00000395226.2	+	4	585	c.367T>C	c.(367-369)Tca>Cca	p.S123P	AGPAT9_ENST00000264409.4_Missense_Mutation_p.S123P	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	123					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				GGAGCTAGTGTCATGGAATCT	0.473																																						.											0													204.0	189.0	194.0					4																	84502873		2203	4300	6503	SO:0001583	missense	84803			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.367T>C	4.37:g.84502873T>C	ENSP00000378651:p.Ser123Pro		Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	37	CCDS3606.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.970641	0.92919	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	T;T	0.50001	0.76;0.76	5.66	5.66	0.87406	.	0.063176	0.64402	D	0.000002	T	0.64821	0.2633	L	0.58969	1.84	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62987	-0.6737	10	0.37606	T	0.19	-8.3228	15.9352	0.79698	0.0:0.0:0.0:1.0	.	123	Q53EU6	GPAT3_HUMAN	P	123	ENSP00000378651:S123P;ENSP00000264409:S123P	ENSP00000264409:S123P	S	+	1	0	AGPAT9	84721897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.174000	0.68829	0.524000	0.50904	TCA		0.473	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
CLEC18B	497190	mdanderson.org	37	16	74444923	74444923	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:74444923C>T	ENST00000339953.5	-	9	1115	c.994G>A	c.(994-996)Ggg>Agg	p.G332R		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	332	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.G332R(6)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GCCAGCACCCCGCCTTTCCTC	0.612																																						.											6	Substitution - Missense(6)	kidney(6)											61.0	70.0	67.0					16																	74444923		2189	4246	6435	SO:0001583	missense	497190			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.994G>A	16.37:g.74444923C>T	ENSP00000341051:p.Gly332Arg		B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	N	16.90	3.249709	0.59212	.	.	ENSG00000140839	ENST00000429489;ENST00000339953	T	0.25749	1.78	3.14	3.14	0.36123	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.131736	0.49916	D	0.000130	T	0.59770	0.2218	H	0.95884	3.735	0.45354	D	0.998344	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.69716	-0.5070	10	0.87932	D	0	.	9.6467	0.39872	0.0:1.0:0.0:0.0	.	332;332	C9JSV1;Q6UXF7	.;CL18B_HUMAN	R	332	ENSP00000341051:G332R	ENSP00000341051:G332R	G	-	1	0	CLEC18B	73002424	0.998000	0.40836	0.928000	0.36995	0.695000	0.40330	6.316000	0.72857	1.602000	0.50124	0.425000	0.28330	GGG		0.612	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
EML3	256364	mdanderson.org	37	11	62378660	62378660	+	Silent	SNP	G	G	A	rs12808829	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:62378660G>A	ENST00000394773.2	-	3	658	c.351C>T	c.(349-351)agC>agT	p.S117S	EML3_ENST00000494176.2_Silent_p.S89S|EML3_ENST00000529309.1_Silent_p.S117S|EML3_ENST00000278845.4_Silent_p.S118S|EML3_ENST00000531557.1_5'Flank|ROM1_ENST00000278833.3_5'Flank|ROM1_ENST00000534093.1_5'Flank	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	117						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ATTGGGTCCCGCTAGGCTCTT	0.687													A|||	972	0.194089	0.1936	0.2032	5008	,	,		15245	0.0506		0.3161	False		,,,				2504	0.2106					.											0								A		926,3418		102,722,1348	11.0	14.0	13.0		351	-5.5	0.1	11	dbSNP_121	13	2990,5538		549,1892,1823	no	coding-synonymous	EML3	NM_153265.2		651,2614,3171	AA,AG,GG		35.061,21.3168,30.4226		117/897	62378660	3916,8956	2172	4264	6436	SO:0001819	synonymous_variant	256364			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.351C>T	11.37:g.62378660G>A			Q6ZQW7|Q8NA55	Silent	SNP	ENST00000394773.2	37	CCDS8023.2	472	0.21611721611721613	112	0.22764227642276422	91	0.2513812154696133	32	0.055944055944055944	237	0.31266490765171506	A	4.052	0.007268	0.07866	0.213168	0.35061	ENSG00000149499	ENST00000394776	.	.	.	5.05	-5.49	0.02584	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999872094	.	.	.	.	.	.	T	0.37865	-0.9687	3	.	.	.	-0.0522	7.3335	0.26596	0.2996:0.2839:0.4165:0.0	rs12808829	.	.	.	W	112	.	.	R	-	1	2	EML3	62135236	0.008000	0.16893	0.095000	0.20976	0.334000	0.28698	-0.688000	0.05150	-1.005000	0.03417	-0.521000	0.04368	CGG		0.687	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
FAM86A	196483	mdanderson.org	37	16	5141852	5141852	+	Silent	SNP	C	C	T	rs540885158	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:5141852C>T	ENST00000427587.4	-	4	353	c.285G>A	c.(283-285)gcG>gcA	p.A95A	FAM86A_ENST00000458008.4_Intron|FAM86A_ENST00000587133.1_Intron	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	95						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TCTCCGCCAGCGCTTCATACA	0.577													c|||	30	0.00599042	0.0219	0.0014	5008	,	,		19555	0.0		0.0	False		,,,				2504	0.0					.											0													45.0	43.0	44.0					16																	5141852		2197	4300	6497	SO:0001819	synonymous_variant	196483			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.285G>A	16.37:g.5141852C>T			D3DUF0|Q96S85	Silent	SNP	ENST00000427587.4	37	CCDS10529.1																																																																																				0.577	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
FAM86A	196483	mdanderson.org	37	16	5141855	5141855	+	Silent	SNP	T	T	C	rs529631996	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:5141855T>C	ENST00000427587.4	-	4	350	c.282A>G	c.(280-282)gaA>gaG	p.E94E	FAM86A_ENST00000458008.4_Intron|FAM86A_ENST00000587133.1_Intron	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	94						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						CCGCCAGCGCTTCATACAGCT	0.572													t|||	30	0.00599042	0.0219	0.0014	5008	,	,		18725	0.0		0.0	False		,,,				2504	0.0					.											0													46.0	44.0	45.0					16																	5141855		2197	4300	6497	SO:0001819	synonymous_variant	196483			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.282A>G	16.37:g.5141855T>C			D3DUF0|Q96S85	Silent	SNP	ENST00000427587.4	37	CCDS10529.1																																																																																				0.572	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
FLG	2312	mdanderson.org	37	1	152276282	152276282	+	Missense_Mutation	SNP	C	C	G	rs55707024	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:152276282C>G	ENST00000368799.1	-	3	11115	c.11080G>C	c.(11080-11082)Gag>Cag	p.E3694Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3694	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.E3694Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGTGGACTCTTGGTGGCTC	0.587									Ichthyosis				C|||	911	0.181909	0.0772	0.232	5008	,	,		20697	0.3452		0.1004	False		,,,				2504	0.2035					.											1	Substitution - Missense(1)	skin(1)											50.0	56.0	54.0					1																	152276282		2202	4278	6480	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11080G>C	1.37:g.152276282C>G	ENSP00000357789:p.Glu3694Gln		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	8.701	0.909632	0.17833	.	.	ENSG00000143631	ENST00000368799	T	0.01787	4.64	2.52	-3.46	0.04767	.	.	.	.	.	T	0.01454	0.0047	M	0.75447	2.3	0.09310	N	1	D	0.65815	0.995	P	0.61070	0.883	T	0.34254	-0.9836	9	0.20519	T	0.43	.	0.3502	0.00348	0.1921:0.291:0.2301:0.2868	rs55707024;rs58436539	3694	P20930	FILA_HUMAN	Q	3694	ENSP00000357789:E3694Q	ENSP00000357789:E3694Q	E	-	1	0	FLG	150542906	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.189000	0.03061	-0.738000	0.04817	0.552000	0.68991	GAG		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FRG1B	284802	mdanderson.org	37	20	29624054	29624054	+	Silent	SNP	T	T	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr20:29624054T>A	ENST00000278882.3	+	4	458	c.78T>A	c.(76-78)ccT>ccA	p.P26P	FRG1B_ENST00000439954.2_Silent_p.P31P|FRG1B_ENST00000358464.4_Silent_p.P26P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	26										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCCCTAGTCCTCCAGAGCAGT	0.279																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.78T>A	20.37:g.29624054T>A			C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628243	29628243	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr20:29628243T>C	ENST00000278882.3	+	6	625	c.245T>C	c.(244-246)tTg>tCg	p.L82S	FRG1B_ENST00000439954.2_Missense_Mutation_p.L87S|FRG1B_ENST00000358464.4_Missense_Mutation_p.L82S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	82								p.L82S(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGGCTTTGTTGGCCTCAAAT	0.363																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.245T>C	20.37:g.29628243T>C	ENSP00000278882:p.Leu82Ser		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.848999	0.32699	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49139	0.79	2.08	2.08	0.27032	Actin cross-linking (1);	0.147685	0.45361	D	0.000380	T	0.38665	0.1049	.	.	.	0.46185	D	0.99891	B;B	0.27656	0.03;0.184	B;B	0.35813	0.11;0.211	T	0.24548	-1.0157	9	0.38643	T	0.18	.	8.0833	0.30758	0.0:0.0:0.0:1.0	.	87;82	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	82;87;82	ENSP00000408863:L87S	ENSP00000278882:L82S	L	+	2	0	FRG1B	28241904	1.000000	0.71417	0.998000	0.56505	0.541000	0.35023	6.955000	0.76007	1.208000	0.43306	0.347000	0.21830	TTG		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628245	29628245	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr20:29628245G>A	ENST00000278882.3	+	6	627	c.247G>A	c.(247-249)Gcc>Acc	p.A83T	FRG1B_ENST00000439954.2_Missense_Mutation_p.A88T|FRG1B_ENST00000358464.4_Missense_Mutation_p.A83T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	83								p.A83T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGCTTTGTTGGCCTCAAATAG	0.353																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.247G>A	20.37:g.29628245G>A	ENSP00000278882:p.Ala83Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.80	3.700173	0.68501	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50277	0.75	2.08	2.08	0.27032	Actin cross-linking (1);	0.055129	0.64402	D	0.000001	T	0.40473	0.1118	.	.	.	0.51482	D	0.99992	B;P	0.40875	0.016;0.731	B;P	0.45558	0.085;0.485	T	0.12502	-1.0545	9	0.21540	T	0.41	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	88;83	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	83;88;83	ENSP00000408863:A88T	ENSP00000278882:A83T	A	+	1	0	FRG1B	28241906	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCC		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E|FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
GART	2618	mdanderson.org	37	21	34903861	34903861	+	Missense_Mutation	SNP	C	C	A	rs142038738		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr21:34903861C>A	ENST00000381831.3	-	6	794	c.531G>T	c.(529-531)gaG>gaT	p.E177D	GART_ENST00000497313.1_5'UTR|GART_ENST00000381815.4_Missense_Mutation_p.E177D|GART_ENST00000361093.5_Missense_Mutation_p.E177D|GART_ENST00000381839.3_Missense_Mutation_p.E177D	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	177	ATP-grasp.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CAAAGGCTTTCTCCTGATTGT	0.328													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13906	0.0		0.0	False		,,,				2504	0.0					.											0								C	ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU	2,4404	4.2+/-10.8	0,2,2201	100.0	101.0	101.0		531,531,531,531	-3.2	0.9	21	dbSNP_134	101	16,8584	11.9+/-42.8	0,16,4284	yes	missense,missense,missense,missense	GART	NM_000819.4,NM_001136005.1,NM_001136006.1,NM_175085.2	45,45,45,45	0,18,6485	AA,AC,CC		0.186,0.0454,0.1384	benign,benign,benign,benign	177/1011,177/1011,177/1011,177/434	34903861	18,12988	2203	4300	6503	SO:0001583	missense	2618			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.531G>T	21.37:g.34903861C>A	ENSP00000371253:p.Glu177Asp		A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	C	5.450	0.268162	0.10349	4.54E-4	0.00186	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000361093;ENST00000430874;ENST00000426819	T;T;T;T;T;T	0.44482	1.53;1.53;1.53;1.54;0.94;0.92	6.07	-3.18	0.05186	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (1);	0.172604	0.64402	N	0.000009	T	0.09818	0.0241	N	0.01003	-1.06	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09618	-1.0666	10	0.33141	T	0.24	-6.3852	0.8613	0.01194	0.4025:0.2436:0.1422:0.2117	.	177	P22102	PUR2_HUMAN	D	177	ENSP00000371236:E177D;ENSP00000371253:E177D;ENSP00000371261:E177D;ENSP00000354388:E177D;ENSP00000413040:E177D;ENSP00000398631:E177D	ENSP00000354388:E177D	E	-	3	2	GART	33825731	0.902000	0.30710	0.936000	0.37596	0.897000	0.52465	0.030000	0.13688	-0.809000	0.04381	0.650000	0.86243	GAG		0.328	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
GOLGA6A	342096	mdanderson.org	37	15	74363307	74363307	+	Missense_Mutation	SNP	C	C	T	rs201661955		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr15:74363307C>T	ENST00000290438.3	-	18	2066	c.2026G>A	c.(2026-2028)Gac>Aac	p.D676N	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	676						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						GTGGGGTTGTCATGGGGAGAA	0.587																																						.											0													29.0	30.0	29.0					15																	74363307		1471	3135	4606	SO:0001583	missense	342096			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.2026G>A	15.37:g.74363307C>T	ENSP00000290438:p.Asp676Asn		A8K959|Q9NYA7	Missense_Mutation	SNP	ENST00000290438.3	37	CCDS32290.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983824	0.35036	.	.	ENSG00000159289	ENST00000290438	T	0.23754	1.89	0.856	0.856	0.19019	.	.	.	.	.	T	0.42449	0.1203	M	0.66506	2.035	0.22081	N	0.999372	D	0.69078	0.997	D	0.73380	0.98	T	0.14254	-1.0479	9	0.38643	T	0.18	.	7.6108	0.28129	0.0:0.9999:0.0:1.0E-4	.	676	Q9NYA3	GOG6A_HUMAN	N	676	ENSP00000290438:D676N	ENSP00000290438:D676N	D	-	1	0	GOLGA6A	72150360	0.983000	0.35010	0.319000	0.25293	0.013000	0.08279	2.223000	0.42936	0.770000	0.33336	0.162000	0.16502	GAC		0.587	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	
MEFV	4210	mdanderson.org	37	16	3304654	3304654	+	Silent	SNP	T	T	C	rs224224	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:3304654T>C	ENST00000219596.1	-	2	453	c.414A>G	c.(412-414)ggA>ggG	p.G138G	MEFV_ENST00000339854.4_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	138			G -> A (association with renal amyloidosis). {ECO:0000269|PubMed:11139244}.		inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCTGGCAGCTCCGCCCCCGT	0.716													C|||	1936	0.386581	0.5257	0.5937	5008	,	,		11024	0.1587		0.4742	False		,,,				2504	0.1963					.											0								C	,	2119,2193		569,981,606	13.0	15.0	14.0		414,	-2.9	0.0	16	dbSNP_79	14	3830,4614		944,1942,1336	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1513,2923,1942	CC,CT,TT		45.3577,49.1419,46.6369	,	138/782,	3304654	5949,6807	2156	4222	6378	SO:0001819	synonymous_variant	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.414A>G	16.37:g.3304654T>C			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																				0.716	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
MUC4	4585	mdanderson.org	37	3	195509331	195509331	+	Silent	SNP	C	C	A	rs369416005		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:195509331C>A	ENST00000463781.3	-	2	9579	c.9120G>T	c.(9118-9120)ccG>ccT	p.P3040P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.P3040P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	981					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3040P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGCGGGGTGGCGT	0.607																																						.											1	Substitution - coding silent(1)	endometrium(1)											9.0	7.0	7.0					3																	195509331		602	1470	2072	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9120G>T	3.37:g.195509331C>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512445	195512445	+	Silent	SNP	C	C	A	rs200972857	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr3:195512445C>A	ENST00000463781.3	-	2	6465	c.6006G>T	c.(6004-6006)ccG>ccT	p.P2002P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.P2002P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCGGTGACCGGAAGAGGGG	0.597													.|||	130	0.0259585	0.0817	0.0072	5008	,	,		27306	0.0119		0.004	False		,,,				2504	0.001					.											0													39.0	40.0	40.0					3																	195512445		667	1585	2252	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6006G>T	3.37:g.195512445C>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017530	1017530	+	Silent	SNP	G	G	A			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:1017530G>A	ENST00000421673.2	-	31	5321	c.5271C>T	c.(5269-5271)caC>caT	p.H1757H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1757	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTCAGGATGGTGTGTGGAGG	0.562																																						.											0													794.0	752.0	766.0					11																	1017530		2201	4294	6495	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5271C>T	11.37:g.1017530G>A			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1018394	1018394	+	Silent	SNP	C	C	T	rs111444881		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr11:1018394C>T	ENST00000421673.2	-	31	4457	c.4407G>A	c.(4405-4407)caG>caA	p.Q1469Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1469	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTGGCCATCTGTGCGTGGG	0.567																																						.											0													271.0	265.0	267.0					11																	1018394		2190	4284	6474	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4407G>A	11.37:g.1018394C>T			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
PRAMEF1	65121	mdanderson.org	37	1	12854401	12854401	+	Nonsense_Mutation	SNP	G	G	T	rs201717831		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:12854401G>T	ENST00000332296.7	+	3	728	c.625G>T	c.(625-627)Gag>Tag	p.E209*	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	209					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGTATTCAAGAGCTGGAAAT	0.398																																						.											0													363.0	333.0	343.0					1																	12854401		2203	4300	6503	SO:0001587	stop_gained	65121			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.625G>T	1.37:g.12854401G>T	ENSP00000332134:p.Glu209*		Q9UQP2	Nonsense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	16.09	3.023241	0.54683	.	.	ENSG00000116721	ENST00000332296	.	.	.	1.74	0.76	0.18442	.	0.742629	0.12834	N	0.435382	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	3.5875	0.07977	0.2694:0.0:0.7306:0.0	.	.	.	.	X	209	.	ENSP00000332134:E209X	E	+	1	0	PRAMEF1	12776988	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	0.426000	0.21363	0.256000	0.21614	0.543000	0.68304	GAG		0.398	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
PRAMEF4	400735	mdanderson.org	37	1	12939548	12939548	+	Silent	SNP	G	G	C	rs28599804	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:12939548G>C	ENST00000235349.5	-	4	1324	c.1254C>G	c.(1252-1254)ccC>ccG	p.P418P		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	418					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACTCTCCCGGGGGGCAGGAT	0.517																																						.											0													93.0	104.0	100.0					1																	12939548		1503	2686	4189	SO:0001819	synonymous_variant	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1254C>G	1.37:g.12939548G>C			Q5LJB5	Silent	SNP	ENST00000235349.5	37	CCDS30592.1																																																																																				0.517	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PRDM9	56979	mdanderson.org	37	5	23527323	23527323	+	Missense_Mutation	SNP	C	C	G	rs200539936	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr5:23527323C>G	ENST00000296682.3	+	11	2308	c.2126C>G	c.(2125-2127)aCt>aGt	p.T709S		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	709					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GTCCTCCTCACTCACCAGAGG	0.587										HNSCC(3;0.000094)			c|||	492	0.0982428	0.2398	0.0893	5008	,	,		21450	0.0387		0.0298	False		,,,				2504	0.045					.											0													16.0	15.0	15.0					5																	23527323		1825	3640	5465	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2126C>G	5.37:g.23527323C>G	ENSP00000296682:p.Thr709Ser		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-4.409211	0.00000	.	.	ENSG00000164256	ENST00000296682	T	0.17370	2.28	2.57	-5.13	0.02884	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	3.203060	0.01089	N	0.005146	T	0.07999	0.0200	N	0.12920	0.275	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32771	-0.9894	10	0.10111	T	0.7	.	1.0864	0.01654	0.2843:0.3342:0.1048:0.2768	.	709	Q9NQV7	PRDM9_HUMAN	S	709	ENSP00000296682:T709S	ENSP00000296682:T709S	T	+	2	0	PRDM9	23563080	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-20.000000	0.00000	-6.649000	0.00003	-6.748000	0.00000	ACT		0.587	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
PSG9	5678	mdanderson.org	37	19	43763023	43763023	+	Missense_Mutation	SNP	A	A	G	rs1135905	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:43763023A>G	ENST00000270077.3	-	4	1070	c.974T>C	c.(973-975)aTc>aCc	p.I325T	PSG9_ENST00000244293.7_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000443718.3_Missense_Mutation_p.I232T|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000418820.2_Missense_Mutation_p.I232T|PSG9_ENST00000593948.1_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	325	Ig-like C2-type 2.		I -> T (in dbSNP:rs1135905).		female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GACATTTAGGATGACTGGGTT	0.502													A|||	285	0.0569089	0.0567	0.0403	5008	,	,		15899	0.0685		0.0487	False		,,,				2504	0.0654					.											0								A	THR/ILE	171,4097		36,99,1999	98.0	101.0	100.0		974	0.2	0.0	19	dbSNP_86	100	278,8278		25,228,4025	no	missense	PSG9	NM_002784.3	89	61,327,6024	GG,GA,AA		3.2492,4.0066,3.5012	benign	325/427	43763023	449,12375	2134	4278	6412	SO:0001583	missense	5678			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.974T>C	19.37:g.43763023A>G	ENSP00000270077:p.Ile325Thr		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	37	CCDS12618.1	106	0.048534798534798536	19	0.03861788617886179	19	0.052486187845303865	37	0.06468531468531469	31	0.040897097625329816	N	0	-2.853274	0.00066	0.040066	0.032492	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.11063	2.81;2.81	1.39	0.2	0.15181	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00210	0.0006	N	0.00101	-2.135	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.41610	-0.9499	9	0.02654	T	1	.	4.0401	0.09748	0.2545:0.0:0.7455:0.0	rs1135905;rs3179039;rs3198901;rs17420337	232;325	E7EW65;Q00887	.;PSG9_HUMAN	T	325;232;286	ENSP00000270077:I325T;ENSP00000396753:I232T	ENSP00000270077:I325T	I	-	2	0	PSG9	48454863	0.008000	0.16893	0.013000	0.15412	0.002000	0.02628	0.050000	0.14120	-0.070000	0.12908	-1.355000	0.01225	ATC		0.502	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
RBMXL1	494115	mdanderson.org	37	1	89448841	89448841	+	Silent	SNP	T	T	C	rs150045246		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:89448841T>C	ENST00000321792.5	-	2	1096	c.669A>G	c.(667-669)agA>agG	p.R223R	CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000399794.2_Silent_p.R223R|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000260508.4_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	223					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										TTGGGTAATCTCTGCTTGAAT	0.448																																						.											0													185.0	168.0	174.0					1																	89448841		2203	4300	6503	SO:0001819	synonymous_variant	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.669A>G	1.37:g.89448841T>C				Silent	SNP	ENST00000321792.5	37	CCDS716.1																																																																																				0.448	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
RBMXL1	494115	mdanderson.org	37	1	89448868	89448868	+	Nonsense_Mutation	SNP	A	A	T	rs200907077		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:89448868A>T	ENST00000321792.5	-	2	1069	c.642T>A	c.(640-642)taT>taA	p.Y214*	CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000399794.2_Nonsense_Mutation_p.Y214*|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000260508.4_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	214					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CTTTAGTAGAATACCCATCAT	0.453																																						.											0													158.0	152.0	154.0					1																	89448868		2203	4298	6501	SO:0001587	stop_gained	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.642T>A	1.37:g.89448868A>T	ENSP00000318415:p.Tyr214*			Nonsense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	A	38	7.031767	0.98013	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	.	.	.	1.53	-0.998	0.10212	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4608	5.5401	0.17033	0.3541:0.0:0.6459:0.0	.	.	.	.	X	214	.	ENSP00000318415:Y214X	Y	-	3	2	RBMXL1	89221456	0.964000	0.33143	0.990000	0.47175	0.840000	0.47671	-0.198000	0.09505	-0.074000	0.12820	0.254000	0.18369	TAT		0.453	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
SLC19A1	6573	mdanderson.org	37	21	46951556	46951556	+	Silent	SNP	A	A	G	rs12659	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr21:46951556A>G	ENST00000311124.4	-	3	848	c.696T>C	c.(694-696)ccT>ccC	p.P232P	SLC19A1_ENST00000380010.4_Silent_p.P232P|SLC19A1_ENST00000485649.2_Silent_p.P192P|SLC19A1_ENST00000567670.1_Silent_p.P232P	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	232					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	CGCCTGGGCCAGGATTCATGC	0.711													G|||	2770	0.553115	0.5189	0.5908	5008	,	,		12778	0.4752		0.5557	False		,,,				2504	0.6503					.											0								G	,,	2461,1943		713,1035,454	31.0	37.0	35.0		696,576,696	-6.6	0.0	21	dbSNP_52	35	4985,3615		1473,2039,788	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC19A1	NM_001205206.1,NM_001205207.1,NM_194255.2	,,	2186,3074,1242	GG,GA,AA		42.0349,44.119,42.7407	,,	232/490,192/552,232/592	46951556	7446,5558	2202	4300	6502	SO:0001819	synonymous_variant	6573			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.696T>C	21.37:g.46951556A>G			B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Silent	SNP	ENST00000311124.4	37	CCDS13725.1																																																																																				0.711	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1		
SLC35G5	83650	mdanderson.org	37	8	11189601	11189601	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr8:11189601G>T	ENST00000382435.4	+	1	1205	c.986G>T	c.(985-987)aGc>aTc	p.S329I		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	329						integral component of membrane (GO:0016021)											CGGAACCTCAGCTGTGAGAGG	0.517																																						.											0													67.0	68.0	68.0					8																	11189601		2203	4300	6503	SO:0001583	missense	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.986G>T	8.37:g.11189601G>T	ENSP00000371872:p.Ser329Ile		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	g	0.299	-0.974907	0.02215	.	.	ENSG00000177710	ENST00000382435	T	0.28666	1.6	.	.	.	.	0.000000	0.52532	D	0.000061	T	0.22244	0.0536	L	0.54323	1.7	0.26188	N	0.979621	B	0.02656	0.0	B	0.06405	0.002	T	0.18241	-1.0343	8	0.22706	T	0.39	-1.3917	.	.	.	.	329	Q96KT7	S35G5_HUMAN	I	329	ENSP00000371872:S329I	ENSP00000371872:S329I	S	+	2	0	SLC35G5	11227011	0.173000	0.23056	0.298000	0.25002	0.299000	0.27559	0.335000	0.19806	0.064000	0.16427	0.064000	0.15345	AGC		0.517	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
SULT1A2	6799	mdanderson.org	37	16	28603721	28603721	+	Missense_Mutation	SNP	C	C	T	rs141581853	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:28603721C>T	ENST00000395630.1	-	7	988	c.638G>A	c.(637-639)cGc>cAc	p.R213H	SULT1A2_ENST00000335715.4_Missense_Mutation_p.R213H|SULT1A2_ENST00000533150.1_Missense_Mutation_p.R180H	NM_177528.2	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2	213					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine biosynthetic process (GO:0009309)|catecholamine metabolic process (GO:0006584)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|sulfotransferase activity (GO:0008146)	p.R213H(4)		NS(2)|breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|skin(2)	14						TGGCAGGGAGCGCCCCACAAA	0.532													.|||	134	0.0267572	0.0363	0.0677	5008	,	,		20273	0.005		0.0268	False		,,,				2504	0.0072					.											4	Substitution - Missense(4)	skin(2)|large_intestine(1)|NS(1)											132.0	119.0	123.0					16																	28603721		2197	4300	6497	SO:0001583	missense	6799			U34804	CCDS10636.1	16p12.1	2008-02-05			ENSG00000197165	ENSG00000197165	2.8.2.1	"""Sulfotransferases, cytosolic"""	11454	protein-coding gene	gene with protein product		601292		STP2		8661000, 8912648	Standard	NM_001054		Approved	HAST4	uc002dqh.2	P50226	OTTHUMG00000048082	ENST00000395630.1:c.638G>A	16.37:g.28603721C>T	ENSP00000378992:p.Arg213His		A9QY25|P78393|Q14CJ7	Missense_Mutation	SNP	ENST00000395630.1	37	CCDS10636.1	.	.	.	.	.	.	.	.	.	.	c	15.21	2.765812	0.49574	.	.	ENSG00000197165	ENST00000533150;ENST00000335715;ENST00000395630	D;D;D	0.82526	-1.62;-1.62;-1.62	4.98	3.0	0.34707	Sulfotransferase domain (1);	0.265029	0.30329	N	0.009878	T	0.81307	0.4795	M	0.85462	2.755	0.22081	N	0.999373	B	0.12013	0.005	B	0.06405	0.002	T	0.73867	-0.3847	10	0.62326	D	0.03	.	6.5172	0.22254	0.0:0.7359:0.0:0.2641	.	213	P50226	ST1A2_HUMAN	H	180;213;213	ENSP00000435271:R180H;ENSP00000338742:R213H;ENSP00000378992:R213H	ENSP00000338742:R213H	R	-	2	0	SULT1A2	28511222	0.000000	0.05858	1.000000	0.80357	0.908000	0.53690	-0.149000	0.10204	2.300000	0.77407	0.456000	0.33151	CGC		0.532	SULT1A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109415.2	NM_001054	
TAS2R31	259290	mdanderson.org	37	12	11183066	11183066	+	Missense_Mutation	SNP	A	A	T	rs138895028		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr12:11183066A>T	ENST00000390675.2	-	1	940	c.869T>A	c.(868-870)tTt>tAt	p.F290Y	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	290					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						AACTGAAAGAAAAGTCTGCTT	0.428																																						.											0													205.0	208.0	207.0					12																	11183066		1976	4186	6162	SO:0001583	missense	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.869T>A	12.37:g.11183066A>T	ENSP00000375093:p.Phe290Tyr		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	11.50	1.657910	0.29425	.	.	ENSG00000256436	ENST00000390675	T	0.42131	0.98	2.41	2.41	0.29592	.	.	.	.	.	T	0.43787	0.1263	M	0.81614	2.55	0.09310	N	1	P	0.35944	0.529	B	0.37451	0.25	T	0.36866	-0.9730	9	0.42905	T	0.14	.	6.6503	0.22959	1.0:0.0:0.0:0.0	.	290	P59538	T2R31_HUMAN	Y	290	ENSP00000375093:F290Y	ENSP00000375093:F290Y	F	-	2	0	TAS2R31	11074333	0.000000	0.05858	0.003000	0.11579	0.127000	0.20565	0.972000	0.29409	1.128000	0.42052	0.155000	0.16302	TTT		0.428	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
TAS2R31	259290	mdanderson.org	37	12	11183496	11183496	+	Missense_Mutation	SNP	T	T	C	rs199736450		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr12:11183496T>C	ENST00000390675.2	-	1	510	c.439A>G	c.(439-441)Ata>Gta	p.I147V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	147					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						TTCATGTTTATCACAAAAAGT	0.383																																						.											0													78.0	80.0	79.0					12																	11183496		2077	4242	6319	SO:0001583	missense	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.439A>G	12.37:g.11183496T>C	ENSP00000375093:p.Ile147Val		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	0.060	-1.225300	0.01530	.	.	ENSG00000256436	ENST00000390675	T	0.00792	5.69	2.45	-4.89	0.03103	.	.	.	.	.	T	0.00468	0.0015	N	0.11818	0.18	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.43114	-0.9411	9	0.17832	T	0.49	.	4.2721	0.10792	0.1787:0.2132:0.0:0.6081	.	147	P59538	T2R31_HUMAN	V	147	ENSP00000375093:I147V	ENSP00000375093:I147V	I	-	1	0	TAS2R31	11074763	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.931000	0.01556	-1.115000	0.02973	-1.140000	0.01884	ATA		0.383	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
TPRX1	284355	mdanderson.org	37	19	48305555	48305555	+	Missense_Mutation	SNP	G	G	A	rs147380237		TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr19:48305555G>A	ENST00000322175.3	-	2	868	c.713C>T	c.(712-714)cCg>cTg	p.P238L	TPRX1_ENST00000535759.1_Missense_Mutation_p.P335L|TPRX1_ENST00000543508.1_Missense_Mutation_p.P228L	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	238	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgggatcgggcctgggtt	0.662																																					Esophageal Squamous(123;175 2281 3051 32395)	.											0													10.0	8.0	9.0					19																	48305555		2095	4129	6224	SO:0001583	missense	284355				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.713C>T	19.37:g.48305555G>A	ENSP00000323455:p.Pro238Leu		A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	24	0.01098901098901099	0	0.0	3	0.008287292817679558	0	0.0	21	0.027704485488126648	g	8.014	0.758252	0.15846	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.93659	-2.01;-3.26	0.495	0.495	0.16890	.	.	.	.	.	T	0.79936	0.4532	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	P	0.60286	0.872	T	0.76977	-0.2759	8	0.45353	T	0.12	.	.	.	.	.	238	Q8N7U7	TPRX1_HUMAN	L	238;335;228	ENSP00000323455:P238L;ENSP00000438832:P335L	ENSP00000323455:P238L	P	-	2	0	TPRX1	52997367	0.000000	0.05858	0.020000	0.16555	0.015000	0.08874	-2.180000	0.01258	0.561000	0.29186	0.420000	0.28162	CCG		0.662	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
TYSND1	219743	mdanderson.org	37	10	71905695	71905695	+	Silent	SNP	A	A	G	rs35587847|rs10999158	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr10:71905695A>G	ENST00000287078.6	-	1	647	c.648T>C	c.(646-648)ggT>ggC	p.G216G	TYSND1_ENST00000335494.5_Silent_p.G216G|TYSND1_ENST00000494143.1_5'Flank	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	216					protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						GCAATGGCGCACCCTTGGGCA	0.701													G|||	1634	0.326278	0.3775	0.2911	5008	,	,		12458	0.0615		0.4791	False		,,,				2504	0.3978					.											0								G	,	1632,2678		358,916,881	11.0	13.0	12.0		648,648	0.9	1.0	10	dbSNP_120	12	3557,4851		845,1867,1492	no	coding-synonymous,coding-synonymous	TYSND1	NM_001040273.1,NM_173555.2	,	1203,2783,2373	GG,GA,AA		42.3049,37.8654,40.8004	,	216/399,216/567	71905695	5189,7529	2155	4204	6359	SO:0001819	synonymous_variant	219743			BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.648T>C	10.37:g.71905695A>G			Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Silent	SNP	ENST00000287078.6	37	CCDS31213.1																																																																																				0.701	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
WDR59	79726	mdanderson.org	37	16	74942828	74942828	+	Missense_Mutation	SNP	A	A	G	rs201965155	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:74942828A>G	ENST00000262144.6	-	17	1820	c.1690T>C	c.(1690-1692)Tct>Cct	p.S564P		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	564										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						TCTGTGGGAGACACCGCCCGA	0.567																																						.											0								A	PRO/SER	1,4395	2.1+/-5.4	0,1,2197	84.0	72.0	76.0		1690	5.4	1.0	16		76	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WDR59	NM_030581.3	74	0,2,6496	GG,GA,AA		0.0116,0.0227,0.0154	benign	564/975	74942828	2,12994	2198	4300	6498	SO:0001583	missense	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1690T>C	16.37:g.74942828A>G	ENSP00000262144:p.Ser564Pro		B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.595306	0.46318	2.27E-4	1.16E-4	ENSG00000103091	ENST00000262144	T	0.69435	-0.4	5.45	5.45	0.79879	.	0.052446	0.85682	D	0.000000	T	0.50582	0.1624	N	0.14661	0.345	0.50632	D	0.99988	B	0.02656	0.0	B	0.04013	0.001	T	0.43829	-0.9367	10	0.29301	T	0.29	-21.7048	15.8122	0.78573	1.0:0.0:0.0:0.0	.	564	Q6PJI9	WDR59_HUMAN	P	564	ENSP00000262144:S564P	ENSP00000262144:S564P	S	-	1	0	WDR59	73500329	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.070000	0.71220	2.200000	0.70718	0.477000	0.44152	TCT		0.567	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
WDR59	79726	mdanderson.org	37	16	74942844	74942844	+	Silent	SNP	T	T	C	rs147993698	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:74942844T>C	ENST00000262144.6	-	17	1804	c.1674A>G	c.(1672-1674)acA>acG	p.T558T		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	558										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CCCGATGCATTGTCATGGGCC	0.567													C|||	77	0.0153754	0.0325	0.0086	5008	,	,		17777	0.0079		0.0099	False		,,,				2504	0.0102					.											0													91.0	80.0	84.0					16																	74942844		2198	4300	6498	SO:0001819	synonymous_variant	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1674A>G	16.37:g.74942844T>C			B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Silent	SNP	ENST00000262144.6	37	CCDS32488.1																																																																																				0.567	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
WDR59	79726	mdanderson.org	37	16	74942865	74942865	+	Silent	SNP	T	T	C	rs141093453	byFrequency	TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr16:74942865T>C	ENST00000262144.6	-	17	1783	c.1653A>G	c.(1651-1653)gtA>gtG	p.V551V		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	551										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						TTGTGAAATATACCAGGTAAC	0.547																																						.											0													90.0	79.0	83.0					16																	74942865		2198	4300	6498	SO:0001819	synonymous_variant	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1653A>G	16.37:g.74942865T>C			B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Silent	SNP	ENST00000262144.6	37	CCDS32488.1																																																																																				0.547	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
MARCO	8685	bcgsc.ca	37	2	119750741	119750741	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr2:119750741delC	ENST00000327097.4	+	16	1429	c.1294delC	c.(1294-1296)cgafs	p.R432fs	MARCO_ENST00000541757.1_Frame_Shift_Del_p.R354fs	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	432	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CAGTAGTAACCGAGGCCGGGC	0.527																																					GBM(8;18 374 7467 11269 32796)	.											0													132.0	124.0	127.0					2																	119750741		2203	4300	6503	SO:0001589	frameshift_variant	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1294delC	2.37:g.119750741delC	ENSP00000318916:p.Arg432fs		B4DW79|Q9Y5S3	Frame_Shift_Del	DEL	ENST00000327097.4	37	CCDS2124.1																																																																																				0.527	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
CNGB3	54714	bcgsc.ca	37	8	87660049	87660049	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr8:87660049T>C	ENST00000320005.5	-	8	1017	c.970A>G	c.(970-972)Aga>Gga	p.R324G		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	324					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						CTATTTGCTCTAAACATTGGA	0.294																																						.											0													99.0	97.0	98.0					8																	87660049		2203	4298	6501	SO:0001583	missense	54714			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.970A>G	8.37:g.87660049T>C	ENSP00000316605:p.Arg324Gly		C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506625	0.64410	.	.	ENSG00000170289	ENST00000320005	D	0.98792	-5.14	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98737	1.0715	10	0.87932	D	0	.	13.385	0.60791	0.0:0.0:0.1308:0.8692	.	324;324	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	G	324	ENSP00000316605:R324G	ENSP00000316605:R324G	R	-	1	2	CNGB3	87729165	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	3.316000	0.51960	2.270000	0.75569	0.482000	0.46254	AGA		0.294	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
ACBD3	64746	bcgsc.ca	37	1	226349255	226349256	+	In_Frame_Ins	INS	-	-	TTC			TCGA-KN-8422-01A-11D-2310-10	TCGA-KN-8422-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d648c804-4eaf-4252-8b6f-13378158a07d	e13915df-0ba2-4242-b4f7-27733b6a01c1	g.chr1:226349255_226349256insTTC	ENST00000366812.5	-	4	758_759	c.704_705insGAA	c.(703-705)gaa>gaGAAa	p.235_236insK	ACBD3_ENST00000464927.1_5'UTR	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	235	Arg-rich.|Glu-rich.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		ACCGAAGcctttcttcttctat	0.401																																						.											0																																										SO:0001652	inframe_insertion	64746			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.704_705insGAA	1.37:g.226349255_226349256insTTC	ENSP00000355777:p.Glu235_Arg236insLys		B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	In_Frame_Ins	INS	ENST00000366812.5	37	CCDS1551.1																																																																																				0.401	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091528.1	NM_022735	
