#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HNRNPF	3185	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	10	43882268	43882268	+	Missense_Mutation	SNP	T	T	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr10:43882268T>A	ENST00000544000.1	-	4	1472	c.1065A>T	c.(1063-1065)agA>agT	p.R355S	HNRNPF_ENST00000356053.3_Missense_Mutation_p.R355S|HNRNPF_ENST00000337970.3_Missense_Mutation_p.R355S|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000357065.4_Missense_Mutation_p.R355S|HNRNPF_ENST00000443950.2_Missense_Mutation_p.R355S	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	355	Interaction with RNA.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						GTTCTATATATCTGTGCTGCA	0.517																																						.											0													111.0	113.0	112.0					10																	43882268		2203	4300	6503	SO:0001583	missense	3185				CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.1065A>T	10.37:g.43882268T>A	ENSP00000438061:p.Arg355Ser		B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	ENST00000544000.1	37	CCDS7204.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368200	0.42003	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73	4.38	3.22	0.36961	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	M	0.76838	2.35	0.58432	D	0.999999	P	0.44380	0.834	P	0.58520	0.84	T	0.02942	-1.1091	10	0.62326	D	0.03	-30.795	9.5933	0.39559	0.0:0.0:0.1767:0.8233	.	355	P52597	HNRPF_HUMAN	S	355;355;355;355;355;278	ENSP00000438061:R355S;ENSP00000400433:R355S;ENSP00000348345:R355S;ENSP00000349573:R355S;ENSP00000338477:R355S	ENSP00000338477:R355S	R	-	3	2	HNRNPF	43202274	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	0.986000	0.29590	0.979000	0.38497	0.533000	0.62120	AGA		0.517	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047705.2		
DENND5B	160518	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	31540710	31540710	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:31540710G>A	ENST00000389082.5	-	21	3916	c.3652C>T	c.(3652-3654)Ctc>Ttc	p.L1218F	DENND5B_ENST00000306833.6_Missense_Mutation_p.L1253F|DENND5B_ENST00000536562.1_Missense_Mutation_p.L1253F	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1218	RUN 2. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CACTGTGGGAGCAGGCGATCC	0.517																																						.											0													74.0	71.0	72.0					12																	31540710		2034	4187	6221	SO:0001583	missense	160518			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3652C>T	12.37:g.31540710G>A	ENSP00000373734:p.Leu1218Phe		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147927	0.78001	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.68025	-0.3;-0.3;-0.3	5.29	5.29	0.74685	RUN (3);	0.000000	0.64402	D	0.000005	D	0.83408	0.5248	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85166	0.0995	10	0.87932	D	0	-37.8866	19.1165	0.93343	0.0:0.0:1.0:0.0	.	1218;1253	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	F	1218;1253;1253	ENSP00000373734:L1218F;ENSP00000306482:L1253F;ENSP00000444889:L1253F	ENSP00000306482:L1253F	L	-	1	0	DENND5B	31431977	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.173000	0.65010	2.761000	0.94854	0.655000	0.94253	CTC		0.517	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
KIAA1551	55196	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	12	32136955	32136955	+	Silent	SNP	T	T	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:32136955T>A	ENST00000312561.4	+	4	3480	c.3066T>A	c.(3064-3066)ccT>ccA	p.P1022P	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1022																	ATATTTACCCTCAGGAAATAG	0.433																																						.											0													72.0	68.0	69.0					12																	32136955		2203	4299	6502	SO:0001819	synonymous_variant	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3066T>A	12.37:g.32136955T>A			B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	37	CCDS8725.2																																																																																				0.433	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
OTOGL	283310	hgsc.bcm.edu;ucsc.edu	37	12	80655788	80655788	+	Silent	SNP	C	C	T	rs150597873		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:80655788C>T	ENST00000547103.1	+	18	1908	c.1902C>T	c.(1900-1902)caC>caT	p.H634H	OTOGL_ENST00000458043.2_Silent_p.H634H			Q3ZCN5	OTOGL_HUMAN	otogelin-like	634	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CACAACTTCACGCAAATGCGT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		15144	0.0		0.0	False		,,,				2504	0.001					.											0													137.0	138.0	138.0					12																	80655788		1932	4131	6063	SO:0001819	synonymous_variant	283310			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1902C>T	12.37:g.80655788C>T			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	37																																																																																					0.413	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
TP53	7157	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7574015	7574015	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr17:7574015A>T	ENST00000269305.4	-	10	1201	c.1012T>A	c.(1012-1014)Ttc>Atc	p.F338I	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.F338I|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	338	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		F -> I (in a sporadic cancer; somatic mutation).|F -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.F338fs*9(2)|p.F338I(1)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACATCTCGAAGCGCTCACGC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	13	Whole gene deletion(8)|Insertion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|large_intestine(1)|stomach(1)|breast(1)|ovary(1)											58.0	45.0	50.0					17																	7574015		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1012T>A	17.37:g.7574015A>T	ENSP00000269305:p.Phe338Ile		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.929207	0.73327	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.94687	-3.49;-3.49	5.43	5.43	0.79202	p53, tetramerisation domain (3);	0.327214	0.33144	N	0.005234	D	0.96297	0.8792	M	0.77820	2.39	0.45390	D	0.998373	D	0.53885	0.963	P	0.57776	0.827	D	0.96673	0.9498	10	0.87932	D	0	-11.118	13.43	0.61049	1.0:0.0:0.0:0.0	.	338	P04637	P53_HUMAN	I	338;338;327	ENSP00000269305:F338I;ENSP00000391478:F338I	ENSP00000269305:F338I	F	-	1	0	TP53	7514740	0.934000	0.31675	0.010000	0.14722	0.295000	0.27426	7.690000	0.84178	2.061000	0.61500	0.459000	0.35465	TTC		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SMCHD1	23347	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	2703826	2703826	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr18:2703826C>A	ENST00000320876.6	+	13	2122	c.1784C>A	c.(1783-1785)cCc>cAc	p.P595H	SMCHD1_ENST00000261598.8_Missense_Mutation_p.P595H|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	595					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AAGCAAGGTCCCTGGGCAACA	0.348																																						.											0													75.0	74.0	74.0					18																	2703826		1832	4101	5933	SO:0001583	missense	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.1784C>A	18.37:g.2703826C>A	ENSP00000326603:p.Pro595His		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926320	0.34002	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.26373	1.74;1.75	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	L	0.55481	1.735	0.53005	D	0.999967	D	0.89917	1.0	D	0.87578	0.998	T	0.44283	-0.9338	10	0.87932	D	0	-4.9546	20.1086	0.97902	0.0:1.0:0.0:0.0	.	595	A6NHR9	SMHD1_HUMAN	H	595	ENSP00000326603:P595H;ENSP00000261598:P595H	ENSP00000261598:P595H	P	+	2	0	SMCHD1	2693826	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.925000	0.75829	2.756000	0.94617	0.563000	0.77884	CCC		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
BAGE2	85319	hgsc.bcm.edu;mdanderson.org	37	21	11097574	11097574	+	RNA	SNP	T	T	A	rs55673353	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr21:11097574T>A	ENST00000470054.1	-	0	295							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ggctccaacctccagctcacc	0.542																																						.											0													57.0	74.0	68.0					21																	11097574		1412	2555	3967			574			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097574T>A			A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37																																																																																					0.542	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
ABCE1	6059	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	146044440	146044440	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:146044440A>G	ENST00000296577.4	+	15	1963	c.1448A>G	c.(1447-1449)tAt>tGt	p.Y483C	OTUD4_ENST00000455611.2_Intron|ABCE1_ENST00000502803.1_3'UTR	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	483	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GCTGATGTCTATTTAATTGAT	0.423																																						.											0													84.0	85.0	85.0					4																	146044440		2203	4300	6503	SO:0001583	missense	6059			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.1448A>G	4.37:g.146044440A>G	ENSP00000296577:p.Tyr483Cys		O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	ENST00000296577.4	37	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133266	0.77662	.	.	ENSG00000164163	ENST00000296577	D	0.91686	-2.89	5.69	4.49	0.54785	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96194	0.8759	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96356	0.9262	10	0.87932	D	0	.	13.1877	0.59691	0.8667:0.1333:0.0:0.0	.	483	P61221	ABCE1_HUMAN	C	483	ENSP00000296577:Y483C	ENSP00000296577:Y483C	Y	+	2	0	ABCE1	146263890	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.339000	0.96797	1.068000	0.40764	-0.313000	0.08912	TAT		0.423	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
FAT1	2195	broad.mit.edu;hgsc.bcm.edu	37	4	187584589	187584589	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:187584589delG	ENST00000441802.2	-	3	3653	c.3444delC	c.(3442-3444)atcfs	p.I1148fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1148	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AATTTTCCATGATTTCTGGGT	0.413										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	.											0													176.0	169.0	171.0					4																	187584589		1895	4121	6016	SO:0001589	frameshift_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.3444delC	4.37:g.187584589delG	ENSP00000406229:p.Ile1148fs			Frame_Shift_Del	DEL	ENST00000441802.2	37	CCDS47177.1																																																																																				0.413	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SLC1A3	6507	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	36680556	36680556	+	Missense_Mutation	SNP	G	G	A	rs115702388	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:36680556G>A	ENST00000265113.4	+	8	1630	c.1154G>A	c.(1153-1155)cGc>cAc	p.R385H	SLC1A3_ENST00000381918.3_Missense_Mutation_p.R385H|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	385					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTGGACAAGCGCGTCACCAGA	0.522													G|||	5	0.000998403	0.0038	0.0	5008	,	,		20116	0.0		0.0	False		,,,				2504	0.0					.											0								G	HIS/ARG,HIS/ARG	11,4395	17.9+/-39.9	0,11,2192	108.0	91.0	97.0		1154,1154	5.8	0.9	5	dbSNP_132	97	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	SLC1A3	NM_001166695.1,NM_004172.4	29,29	0,12,6491	AA,AG,GG		0.0116,0.2497,0.0923	probably-damaging,probably-damaging	385/498,385/543	36680556	12,12994	2203	4300	6503	SO:0001583	missense	6507				CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1154G>A	5.37:g.36680556G>A	ENSP00000265113:p.Arg385His		B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	32	5.152219	0.94645	0.002497	1.16E-4	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	T;T	0.59772	0.24;0.24	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.77538	0.4145	M	0.75884	2.315	0.58432	D	0.999999	P;D	0.71674	0.903;0.998	B;D	0.80764	0.33;0.994	T	0.77485	-0.2570	10	0.56958	D	0.05	-10.6026	20.0609	0.97674	0.0:0.0:1.0:0.0	.	385;385	Q4JCQ8;P43003	.;EAA1_HUMAN	H	385;333;385	ENSP00000265113:R385H;ENSP00000371343:R385H	ENSP00000265113:R385H	R	+	2	0	SLC1A3	36716313	1.000000	0.71417	0.868000	0.34077	0.657000	0.38888	8.054000	0.89451	2.755000	0.94549	0.655000	0.94253	CGC		0.522	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
KCNT1	57582	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	138641963	138641963	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:138641963G>A	ENST00000263604.3	+	3	217	c.217G>A	c.(217-219)Gtc>Atc	p.V73I	KCNT1_ENST00000487664.1_Missense_Mutation_p.V44I|KCNT1_ENST00000298480.5_Missense_Mutation_p.V92I|KCNT1_ENST00000488444.2_Missense_Mutation_p.V73I|KCNT1_ENST00000486577.2_Missense_Mutation_p.V53I|KCNT1_ENST00000371757.2_Missense_Mutation_p.V92I|KCNT1_ENST00000490355.2_Missense_Mutation_p.V73I|KCNT1_ENST00000491806.2_Missense_Mutation_p.V59I			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	73					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGAGTTCTACGTCAACGAGAA	0.607																																						.											0													82.0	68.0	73.0					9																	138641963		2203	4300	6503	SO:0001583	missense	57582			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.217G>A	9.37:g.138641963G>A	ENSP00000263604:p.Val73Ile		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	g	22.2	4.255822	0.80135	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T;T	0.50548	1.75;1.66;1.66;0.74;1.72	4.18	4.18	0.49190	.	0.000000	0.64402	D	0.000002	T	0.59622	0.2207	M	0.72353	2.195	0.80722	D	1	D;D	0.58268	0.97;0.982	P;P	0.53006	0.522;0.715	T	0.66630	-0.5875	10	0.59425	D	0.04	-9.5267	15.8483	0.78907	0.0:0.0:1.0:0.0	.	92;44	B9EGP2;G5E9V0	.;.	I	44;92;92;39;53;59;73;73;73	ENSP00000417851:V44I;ENSP00000298480:V92I;ENSP00000360822:V92I;ENSP00000420764:V39I;ENSP00000263604:V73I	ENSP00000263604:V73I	V	+	1	0	KCNT1	137781784	1.000000	0.71417	0.951000	0.38953	0.904000	0.53231	9.449000	0.97603	2.053000	0.61076	0.561000	0.74099	GTC		0.607	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
GPR50	9248	hgsc.bcm.edu	37	X	150349560	150349560	+	Missense_Mutation	SNP	C	C	T	rs377556761|rs199797606|rs68058591		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:150349560C>T	ENST00000218316.3	+	2	1574	c.1505C>T	c.(1504-1506)aCc>aTc	p.T502I	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	502	Pro-rich.		Missing (lower fasting circulating triglyceride levels). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8647286, ECO:0000269|Ref.2}.		cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.T502_H505delTTGH(1)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CCTAAACCCACCACTGGCCAC	0.612																																						.											1	Deletion - In frame(1)	ovary(1)											68.0	80.0	76.0					X																	150349560		1957	3997	5954	SO:0001583	missense	9248			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1505C>T	X.37:g.150349560C>T	ENSP00000218316:p.Thr502Ile		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	458	0.2760699216395419	91	0.21875	100	0.3184713375796178	85	0.15625	133	0.19674556213017752	C	4.117	0.019984	0.08006	.	.	ENSG00000102195	ENST00000218316	T	0.72282	-0.64	3.47	1.66	0.24008	.	0.547897	0.19336	N	0.116768	T	0.00012	0.0000	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.12682	-1.0538	10	0.87932	D	0	-1.8077	2.4216	0.04449	0.2395:0.4806:0.0:0.2799	.	502	Q13585	MTR1L_HUMAN	I	502	ENSP00000218316:T502I	ENSP00000218316:T502I	T	+	2	0	GPR50	150100218	0.000000	0.05858	0.003000	0.11579	0.049000	0.14656	-0.093000	0.11111	0.311000	0.23014	0.529000	0.55759	ACC		0.612	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
ATP6AP1	537	broad.mit.edu;hgsc.bcm.edu	37	X	153662709	153662745	+	Frame_Shift_Del	DEL	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:153662709_153662745delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	ENST00000369762.2	+	7	901_937	c.840_876delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	c.(838-876)gaccagtgggaggacctgactcccctcacctttggggtgfs	p.DQWEDLTPLTFGV280fs	GDI1_ENST00000447750.2_5'Flank	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	280					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.L288R(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGTACAAGGACCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTGCAGGAACTCA	0.57																																						.											1	Substitution - Missense(1)	ovary(1)																																								SO:0001589	frameshift_variant	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.840_876delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	X.37:g.153662709_153662745delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	ENSP00000358777:p.Asp280fs		A6ZKI4|Q8NBT4|Q9H0C7	Frame_Shift_Del	DEL	ENST00000369762.2	37	CCDS35451.1																																																																																				0.570	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183	
NIN	51199	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	14	51196406	51196406	+	Silent	SNP	C	C	T	rs145555295		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr14:51196406C>T	ENST00000382041.3	-	29	6103	c.5913G>A	c.(5911-5913)ccG>ccA	p.P1971P	NIN_ENST00000530997.2_Silent_p.P1971P|NIN_ENST00000382043.4_Silent_p.P1258P|NIN_ENST00000453196.1_Silent_p.P1971P|NIN_ENST00000389868.3_3'UTR|NIN_ENST00000324330.9_3'UTR|NIN_ENST00000245441.5_Silent_p.P1971P	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1971					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CATGAGGGGACGGGCTAGGCG	0.597			T	PDGFRB	MPD								C|||	1	0.000199681	0.0	0.0014	5008	,	,		14363	0.0		0.0	False		,,,				2504	0.0					.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0								C	,,,	0,4406		0,0,2203	69.0	58.0	62.0		3774,5913,5913,5913	-10.5	0.0	14	dbSNP_134	62	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NIN	NM_016350.4,NM_020921.3,NM_182944.2,NM_182946.1	,,,	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	,,,	1258/1378,1971/2134,1971/2047,1971/2091	51196406	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	51199			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.5913G>A	14.37:g.51196406C>T			A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	37	CCDS32079.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	0.070	-1.205154	0.01568	0.0	5.81E-4	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.23	-10.5	0.00291	.	.	.	.	.	T	0.20577	0.0495	.	.	.	0.26831	N	0.968587	.	.	.	.	.	.	T	0.08764	-1.0706	4	.	.	.	-13.8346	5.2917	0.15731	0.1504:0.4781:0.1573:0.2142	.	.	.	.	I	1462	.	.	V	-	1	0	NIN	50266156	0.000000	0.05858	0.016000	0.15963	0.049000	0.14656	-3.635000	0.00408	-3.021000	0.00269	-1.801000	0.00618	GTC		0.597	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
ENO1	2023	broad.mit.edu;mdanderson.org	37	1	8922983	8922983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:8922983G>A	ENST00000234590.4	-	11	1317	c.1198C>T	c.(1198-1200)Cga>Tga	p.R400*		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	400					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CGCTCAGATCGGCAAGGGGCA	0.562											OREG0013068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(21;302 608 19946 22210 33560)	.											0													69.0	63.0	65.0					1																	8922983		2203	4300	6503	SO:0001587	stop_gained	2023			BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.1198C>T	1.37:g.8922983G>A	ENSP00000234590:p.Arg400*	653	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Nonsense_Mutation	SNP	ENST00000234590.4	37	CCDS97.1	.	.	.	.	.	.	.	.	.	.	G	38	6.671518	0.97751	.	.	ENSG00000074800	ENST00000234590	.	.	.	5.59	2.45	0.29901	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	9.2527	13.3525	0.60609	0.0:0.0:0.4613:0.5387	.	.	.	.	X	400	.	ENSP00000234590:R400X	R	-	1	2	ENO1	8845570	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.068000	0.41471	0.684000	0.31448	0.561000	0.74099	CGA		0.562	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	NM_001428	
DPM3	54344	broad.mit.edu	37	1	155112594	155112594	+	Silent	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:155112594C>A	ENST00000341298.3	-	2	258	c.123G>T	c.(121-123)ctG>ctT	p.L41L	DPM3_ENST00000368400.4_Silent_p.L41L|DPM3_ENST00000368399.1_Silent_p.L71L			Q9P2X0	DPM3_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 3	41					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein C-linked glycosylation via 2'-alpha-mannosyl-L-tryptophan (GO:0018406)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)|regulation of protein stability (GO:0031647)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mannosyltransferase complex (GO:0031501)|membrane (GO:0016020)				endometrium(2)	2	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGTAGGCGGGCAGTGGCCACA	0.662																																						.											0													32.0	33.0	33.0					1																	155112594		2202	4299	6501	SO:0001819	synonymous_variant	54344			AB028128	CCDS1094.1, CCDS1095.1	1q22	2013-02-26			ENSG00000179085	ENSG00000179085			3007	protein-coding gene	gene with protein product	"""DPM synthase complex subunit"""	605951				10835346	Standard	NM_018973		Approved	MGC34275, MGC125904, MGC125905	uc001fhm.3	Q9P2X0	OTTHUMG00000035335	ENST00000341298.3:c.123G>T	1.37:g.155112594C>A			Q5SR62|Q5SR63|Q9BXN4|Q9BXN5	Silent	SNP	ENST00000341298.3	37	CCDS1095.1																																																																																				0.662	DPM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085519.1	NM_153741	
USH2A	7399	broad.mit.edu;bcgsc.ca	37	1	215953292	215953292	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:215953292C>T	ENST00000307340.3	-	55	11218	c.10832G>A	c.(10831-10833)aGt>aAt	p.S3611N	USH2A_ENST00000366943.2_Missense_Mutation_p.S3611N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3611	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCAGGGACACTCCAGCTCAG	0.532										HNSCC(13;0.011)																												.											0													166.0	131.0	143.0					1																	215953292		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10832G>A	1.37:g.215953292C>T	ENSP00000305941:p.Ser3611Asn		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	4.798	0.148453	0.09134	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.58652	0.32;0.32	5.74	1.39	0.22231	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.568938	0.15713	N	0.248327	T	0.45438	0.1342	M	0.64676	1.99	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.29336	-1.0015	10	0.20519	T	0.43	.	2.4629	0.04546	0.1103:0.3484:0.3191:0.2222	.	3611	O75445	USH2A_HUMAN	N	3611	ENSP00000305941:S3611N;ENSP00000355910:S3611N	ENSP00000305941:S3611N	S	-	2	0	USH2A	214019915	0.000000	0.05858	0.151000	0.22473	0.960000	0.62799	-1.142000	0.03203	0.229000	0.21039	0.650000	0.86243	AGT		0.532	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CTSF	8722	broad.mit.edu;mdanderson.org	37	11	66335107	66335107	+	Silent	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr11:66335107C>T	ENST00000310325.5	-	3	448	c.339G>A	c.(337-339)gaG>gaA	p.E113E	CTSF_ENST00000533168.1_5'UTR	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	113					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GTCTTCCGAGCTCATCCAGGA	0.612																																						.											0													69.0	71.0	71.0					11																	66335107		2200	4295	6495	SO:0001819	synonymous_variant	8722			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.339G>A	11.37:g.66335107C>T			B2R964|O95240|Q9NSU4|Q9UKQ5	Silent	SNP	ENST00000310325.5	37	CCDS8144.1																																																																																				0.612	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393047.1	NM_003793	
RECQL	5965	broad.mit.edu	37	12	21623272	21623272	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:21623272delC	ENST00000444129.2	-	15	2274	c.1806delG	c.(1804-1806)tcgfs	p.S603fs	PYROXD1_ENST00000240651.9_3'UTR|PYROXD1_ENST00000538582.1_3'UTR|RECQL_ENST00000421138.2_Frame_Shift_Del_p.S603fs	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	603					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						AAGTTTGAGACGATTCAGCCT	0.333								Other identified genes with known or suspected DNA repair function																														.											0													16.0	15.0	15.0					12																	21623272		2171	4280	6451	SO:0001589	frameshift_variant	5965			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1806delG	12.37:g.21623272delC	ENSP00000416739:p.Ser603fs		A8K6G2	Frame_Shift_Del	DEL	ENST00000444129.2	37	CCDS31756.1																																																																																				0.333	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
ACSS3	79611	broad.mit.edu;mdanderson.org	37	12	81503375	81503375	+	Silent	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:81503375C>T	ENST00000548058.1	+	2	1258	c.348C>T	c.(346-348)gcC>gcT	p.A116A	ACSS3_ENST00000261206.3_Silent_p.A115A|RP11-543H12.1_ENST00000547123.1_RNA			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	116						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GTTACAATGCCGTTGATCGTC	0.328																																						.											0													107.0	105.0	105.0					12																	81503375		2203	4299	6502	SO:0001819	synonymous_variant	79611				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.348C>T	12.37:g.81503375C>T			Q8NC66	Silent	SNP	ENST00000548058.1	37	CCDS9022.1																																																																																				0.328	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
HVCN1	84329	broad.mit.edu	37	12	111099110	111099112	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:111099110_111099112delCTC	ENST00000356742.5	-	3	916_918	c.163_165delGAG	c.(163-165)gagdel	p.E55del	HVCN1_ENST00000439744.2_In_Frame_Del_p.E35del|HVCN1_ENST00000548312.1_In_Frame_Del_p.E55del|HVCN1_ENST00000242607.8_In_Frame_Del_p.E55del			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	55	Poly-Glu.				cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						GTGGTGGCTGctcctcctcctcc	0.606																																						.											0																																										SO:0001651	inframe_deletion	84329			BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.163_165delGAG	12.37:g.111099119_111099121delCTC	ENSP00000349181:p.Glu55del		A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	In_Frame_Del	DEL	ENST00000356742.5	37	CCDS31900.1																																																																																				0.606	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	NM_032369	
UNC13C	440279	broad.mit.edu	37	15	54527276	54527276	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr15:54527276delA	ENST00000260323.11	+	4	3120	c.3120delA	c.(3118-3120)agafs	p.R1040fs	UNC13C_ENST00000545554.1_Frame_Shift_Del_p.R1040fs|UNC13C_ENST00000537900.1_Frame_Shift_Del_p.R1040fs	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1040					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ATCTTCGCAGAAAAAAAACTT	0.368																																						.											0													142.0	133.0	136.0					15																	54527276		1849	4096	5945	SO:0001589	frameshift_variant	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3120delA	15.37:g.54527276delA	ENSP00000260323:p.Arg1040fs		Q0P613|Q8ND48|Q96NP3	Frame_Shift_Del	DEL	ENST00000260323.11	37	CCDS45264.1																																																																																				0.368	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
LINC00933	100506874	broad.mit.edu	37	15	85121557	85121557	+	RNA	DEL	A	A	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr15:85121557delA	ENST00000557887.1	+	0	757					NR_038273.1|NR_038274.1				long intergenic non-protein coding RNA 933																		TTCTTGCCTTAAAAAAAAAAA	0.279																																						.											0																																												0					15q25.2	2013-05-29			ENSG00000259728	ENSG00000259728		"""Long non-coding RNAs"""	48625	non-coding RNA	RNA, long non-coding							Standard	NR_038273		Approved				OTTHUMG00000172445		15.37:g.85121557delA				RNA	DEL	ENST00000557887.1	37																																																																																					0.279	LINC00933-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000418591.1		
HSD11B2	3291	broad.mit.edu;mdanderson.org;bcgsc.ca	37	16	67470735	67470735	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr16:67470735C>A	ENST00000326152.5	+	5	1179	c.1047C>A	c.(1045-1047)ttC>ttA	p.F349L	ATP6V0D1_ENST00000567694.1_5'Flank	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2	349					female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		TCATGTACTTCATCCACTACT	0.647																																						.											0													69.0	76.0	73.0					16																	67470735		2198	4299	6497	SO:0001583	missense	3291			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.1047C>A	16.37:g.67470735C>A	ENSP00000316786:p.Phe349Leu		A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	Missense_Mutation	SNP	ENST00000326152.5	37	CCDS10837.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103821	0.56291	.	.	ENSG00000176387	ENST00000326152	D	0.89270	-2.49	4.78	3.82	0.43975	NAD(P)-binding domain (1);	0.049609	0.85682	D	0.000000	T	0.78272	0.4257	N	0.25992	0.78	0.53688	D	0.999975	B	0.28378	0.209	B	0.25987	0.065	T	0.70506	-0.4853	10	0.02654	T	1	.	11.7105	0.51623	0.0:0.9121:0.0:0.0879	.	349	P80365	DHI2_HUMAN	L	349	ENSP00000316786:F349L	ENSP00000316786:F349L	F	+	3	2	HSD11B2	66028236	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.517000	0.45529	0.995000	0.38917	0.563000	0.77884	TTC		0.647	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268826.3	NM_000196	
GNG7	2788	broad.mit.edu	37	19	2515020	2515020	+	Nonstop_Mutation	SNP	T	T	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:2515020T>A	ENST00000382159.3	-	5	404	c.207A>T	c.(205-207)taA>taT	p.*69Y		NM_052847.2	NP_443079.1	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein), gamma 7	0					behavioral fear response (GO:0001662)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of adenylate cyclase activity (GO:0045761)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			central_nervous_system(2)|large_intestine(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAACACAGTTATAAAATAA	0.478																																						.											0													59.0	64.0	62.0					19																	2515020		2203	4300	6503	SO:0001578	stop_lost	2788			AB010414	CCDS12091.1	19p13.3	2010-02-17			ENSG00000176533	ENSG00000176533			4410	protein-coding gene	gene with protein product		604430				9600093	Standard	NM_052847		Approved	FLJ00058	uc002lwd.2	O60262		ENST00000382159.3:c.207A>T	19.37:g.2515020T>A			B2R496	Missense_Mutation	SNP	ENST00000382159.3	37	CCDS12091.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.243295	0.39697	.	.	ENSG00000176533	ENST00000382159	.	.	.	4.16	3.03	0.35002	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7023	0.28630	0.0:0.7966:0.0:0.2034	.	.	.	.	Y	69	.	.	X	-	3	2	GNG7	2466020	1.000000	0.71417	0.330000	0.25442	0.591000	0.36615	2.069000	0.41481	0.836000	0.34901	-0.337000	0.08149	TAA		0.478	GNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451345.1	NM_052847	
SIGLEC8	27181	broad.mit.edu	37	19	51961617	51961619	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	GCA	GCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:51961617_51961619delGCA	ENST00000321424.3	-	1	89_91	c.23_25delTGC	c.(22-27)ctgccc>ccc	p.L8del	SIGLEC8_ENST00000340550.5_In_Frame_Del_p.L8del|SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000430817.1_In_Frame_Del_p.L8del	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	8					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGagcaggggcagcagcagcag	0.596																																						.											0																																										SO:0001651	inframe_deletion	27181			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.23_25delTGC	19.37:g.51961626_51961628delGCA	ENSP00000321077:p.Leu8del		Q7Z728	In_Frame_Del	DEL	ENST00000321424.3	37	CCDS33086.1																																																																																				0.596	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
ACTR3BP2	440888	broad.mit.edu	37	2	92129663	92129663	+	IGR	DEL	T	T	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr2:92129663delT								SLC9B1P2 (27425 upstream) : None (None downstream)																							ACCTGAAATATTTTTTTACCC	0.388																																						.											0																																										SO:0001628	intergenic_variant	440888																															2.37:g.92129663delT				RNA	DEL		37																																																																																				0	0.388								
UGGT1	56886	broad.mit.edu;mdanderson.org	37	2	128945096	128945096	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr2:128945096A>G	ENST00000259253.6	+	40	4597	c.4550A>G	c.(4549-4551)gAc>gGc	p.D1517G	UGGT1_ENST00000375990.3_Missense_Mutation_p.D1493G|UGGT1_ENST00000465836.1_3'UTR	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1517	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CAGGACTACGACCAAGAGATC	0.478																																						.											0													55.0	52.0	53.0					2																	128945096		2203	4300	6503	SO:0001583	missense	56886			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4550A>G	2.37:g.128945096A>G	ENSP00000259253:p.Asp1517Gly		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	31	5.090764	0.94149	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.22134	1.97;1.97	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.62134	0.2403	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76096	-0.3084	9	.	.	.	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	1517	Q9NYU2	UGGG1_HUMAN	G	1493;1517	ENSP00000365158:D1493G;ENSP00000259253:D1517G	.	D	+	2	0	UGGT1	128661566	1.000000	0.71417	0.902000	0.35471	0.969000	0.65631	8.669000	0.91163	2.371000	0.80710	0.533000	0.62120	GAC		0.478	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
GLS	2744	broad.mit.edu	37	2	191765397	191765397	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr2:191765397C>T	ENST00000320717.3	+	4	971	c.713C>T	c.(712-714)gCt>gTt	p.A238V	GLS_ENST00000338435.4_Missense_Mutation_p.A238V	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	238					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	TATGAAAGTGCTAAAAAGCAG	0.328																																						.											0													120.0	115.0	117.0					2																	191765397		2203	4299	6502	SO:0001583	missense	2744			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.713C>T	2.37:g.191765397C>T	ENSP00000317379:p.Ala238Val		Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	37	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768840	0.49680	.	.	ENSG00000115419	ENST00000320717;ENST00000338435	T;T	0.42131	0.98;0.98	5.49	5.49	0.81192	Beta-lactamase/transpeptidase-like (1);	0.058328	0.64402	D	0.000002	T	0.38558	0.1045	L	0.42245	1.32	0.80722	D	1	B;B	0.17268	0.003;0.021	B;B	0.16722	0.002;0.016	T	0.17107	-1.0380	10	0.16420	T	0.52	-15.4944	19.736	0.96205	0.0:1.0:0.0:0.0	.	238;238	O94925;O94925-3	GLSK_HUMAN;.	V	238	ENSP00000317379:A238V;ENSP00000340689:A238V	ENSP00000317379:A238V	A	+	2	0	GLS	191473642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.824000	0.62701	2.732000	0.93576	0.557000	0.71058	GCT		0.328	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
GAL3ST2	64090	broad.mit.edu	37	2	242743069	242743070	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr2:242743069_242743070delCA	ENST00000192314.6	+	4	816_817	c.685_686delCA	c.(685-687)cacfs	p.H229fs	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	229	Arg-rich.				biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CATCGCCGAGCACCTGGACGAG	0.733																																						.											0																																										SO:0001589	frameshift_variant	64090			AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.685_686delCA	2.37:g.242743069_242743070delCA	ENSP00000192314:p.His229fs		Q17RK0|Q57Z52	Frame_Shift_Del	DEL	ENST00000192314.6	37	CCDS33427.1																																																																																				0.733	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1	NM_022134	
CELSR3	1951	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	48681698	48681698	+	Missense_Mutation	SNP	G	G	A	rs373490754		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:48681698G>A	ENST00000164024.4	-	27	8396	c.8116C>T	c.(8116-8118)Cgc>Tgc	p.R2706C	MIR4793_ENST00000577502.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.R2711C	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2706					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CAGGATGTGCGGGCAGCGAGG	0.622													g|||	1	0.000199681	0.0	0.0	5008	,	,		18242	0.0		0.0	False		,,,				2504	0.001					.											0									CYS/ARG	0,4406		0,0,2203	63.0	59.0	60.0		8116	4.2	1.0	3		60	1,8595	1.2+/-3.3	0,1,4297	no	missense	CELSR3	NM_001407.2	180	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2706/3313	48681698	1,13001	2203	4298	6501	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.8116C>T	3.37:g.48681698G>A	ENSP00000164024:p.Arg2706Cys		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	g	25.2	4.612736	0.87258	0.0	1.16E-4	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.44482	0.92;0.92	5.13	4.16	0.48862	GPCR, family 2-like (1);	.	.	.	.	T	0.61048	0.2316	M	0.83692	2.655	0.41257	D	0.986755	D;D	0.65815	0.99;0.995	P;P	0.61070	0.883;0.745	T	0.67011	-0.5778	9	0.87932	D	0	.	10.4662	0.44609	0.0:0.0:0.5547:0.4453	.	2706;2803	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	C	2706;2711	ENSP00000164024:R2706C;ENSP00000445694:R2711C	ENSP00000164024:R2706C	R	-	1	0	CELSR3	48656702	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.969000	0.63735	2.382000	0.81193	0.556000	0.70494	CGC		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
ATP13A3	79572	broad.mit.edu;mdanderson.org	37	3	194158061	194158061	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:194158061C>T	ENST00000439040.1	-	19	2769	c.1978G>A	c.(1978-1980)Ggt>Agt	p.G660S	ATP13A3_ENST00000256031.4_Missense_Mutation_p.G660S			Q9H7F0	AT133_HUMAN	ATPase type 13A3	660						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TTACAGAGACCGGCAATGGCC	0.443																																						.											0													119.0	119.0	119.0					3																	194158061		1849	4091	5940	SO:0001583	missense	79572			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.1978G>A	3.37:g.194158061C>T	ENSP00000416508:p.Gly660Ser		Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	C	5.577	0.291253	0.10567	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	T;T	0.69685	-0.42;-0.42	6.08	1.04	0.20106	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.149212	0.85682	N	0.000000	T	0.28599	0.0708	N	0.01076	-1.035	0.24675	N	0.993396	B	0.02656	0.0	B	0.04013	0.001	T	0.36163	-0.9759	10	0.02654	T	1	0.4724	10.721	0.46040	0.0:0.2926:0.0:0.7074	.	660	Q9H7F0	AT133_HUMAN	S	660;660;398	ENSP00000416508:G660S;ENSP00000256031:G660S	ENSP00000256031:G660S	G	-	1	0	ATP13A3	195639350	0.992000	0.36948	0.992000	0.48379	0.799000	0.45148	0.520000	0.22878	0.187000	0.20147	-0.294000	0.09567	GGT		0.443	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524	
NKD2	85409	broad.mit.edu	37	5	1038447	1038461	+	In_Frame_Del	DEL	CACCACCACCACCAC	CACCACCACCACCAC	-	rs3840989|rs143388141		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	CACCACCACCACCAC	CACCACCACCACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:1038447_1038461delCACCACCACCACCAC	ENST00000296849.5	+	10	1544_1558	c.1315_1329delCACCACCACCACCAC	c.(1315-1329)caccaccaccaccacdel	p.HHHHH439del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.PPPPP79del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	439	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccaccaccaccaccacc	0.688																																						.											0																																										SO:0001651	inframe_deletion	85409			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1329delCACCACCACCACCAC	5.37:g.1038447_1038461delCACCACCACCACCAC	ENSP00000296849:p.His439_His443del		Q96EK8|Q9BSN0	In_Frame_Del	DEL	ENST00000296849.5	37	CCDS3859.1																																																																																				0.688	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
SLC6A19	340024	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	1214087	1214087	+	Missense_Mutation	SNP	C	C	T	rs148139045		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:1214087C>T	ENST00000304460.10	+	6	850	c.794C>T	c.(793-795)cCg>cTg	p.P265L		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	265					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CTGGCCCAGCCGGACACCTGG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		17246	0.0		0.001	False		,,,				2504	0.0					.											0								C	LEU/PRO	0,4406		0,0,2203	75.0	78.0	77.0		794	5.0	0.9	5	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC6A19	NM_001003841.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	265/635	1214087	1,13005	2203	4300	6503	SO:0001583	missense	340024			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.794C>T	5.37:g.1214087C>T	ENSP00000305302:p.Pro265Leu		A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	19.61	3.860605	0.71834	0.0	1.16E-4	ENSG00000174358	ENST00000304460	T	0.77358	-1.09	4.96	4.96	0.65561	.	0.099721	0.64402	D	0.000001	D	0.83538	0.5276	M	0.74881	2.28	0.80722	D	1	D	0.56968	0.978	P	0.51453	0.67	D	0.86435	0.1763	10	0.72032	D	0.01	.	17.1671	0.86819	0.0:1.0:0.0:0.0	.	265	Q695T7	S6A19_HUMAN	L	265	ENSP00000305302:P265L	ENSP00000305302:P265L	P	+	2	0	SLC6A19	1267087	0.939000	0.31865	0.923000	0.36655	0.629000	0.37895	1.987000	0.40687	2.296000	0.77279	0.491000	0.48974	CCG		0.657	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
FNIP1	96459	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131008278	131008278	+	Missense_Mutation	SNP	T	T	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:131008278T>A	ENST00000510461.1	-	14	1954	c.1859A>T	c.(1858-1860)cAa>cTa	p.Q620L	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.Q592L|FNIP1_ENST00000307954.8_Missense_Mutation_p.Q575L	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	620					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CTCTACATTTTGCCCAAGGAG	0.373																																						.											0													128.0	132.0	130.0					5																	131008278		2203	4300	6503	SO:0001583	missense	96459			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1859A>T	5.37:g.131008278T>A	ENSP00000421985:p.Gln620Leu		D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983243	0.35036	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.14144	2.53;2.53;2.53	5.97	4.75	0.60458	.	.	.	.	.	T	0.11665	0.0284	L	0.34521	1.04	0.80722	D	1	B;P;B	0.38504	0.277;0.634;0.022	B;B;B	0.35971	0.206;0.215;0.014	T	0.06716	-1.0811	9	0.49607	T	0.09	-1.3887	12.9473	0.58379	0.0:0.0:0.1349:0.8651	.	620;592;620	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	L	592;575;372;620	ENSP00000309266:Q592L;ENSP00000310453:Q575L;ENSP00000421985:Q620L	ENSP00000310453:Q575L	Q	-	2	0	FNIP1	131036177	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	2.247000	0.43151	2.288000	0.76882	0.533000	0.62120	CAA		0.373	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
PCLO	27445	broad.mit.edu;mdanderson.org	37	7	82579610	82579610	+	Missense_Mutation	SNP	C	C	T	rs202185916		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:82579610C>T	ENST00000333891.9	-	6	10631	c.10294G>A	c.(10294-10296)Gat>Aat	p.D3432N	PCLO_ENST00000437081.1_Missense_Mutation_p.D152N|PCLO_ENST00000423517.2_Missense_Mutation_p.D3432N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CGGGGATCATCTGTCATATTT	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		21775	0.0		0.001	False		,,,				2504	0.0					.											0								C	ASN/ASP,ASN/ASP	0,3786		0,0,1893	124.0	114.0	117.0		10294,10294	5.9	1.0	7		117	4,8234		0,4,4115	yes	missense,missense	PCLO	NM_014510.2,NM_033026.5	23,23	0,4,6008	TT,TC,CC		0.0486,0.0,0.0333	possibly-damaging,possibly-damaging	3432/4936,3432/5143	82579610	4,12020	1893	4119	6012	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10294G>A	7.37:g.82579610C>T	ENSP00000334319:p.Asp3432Asn			Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	13.27	2.187005	0.38609	0.0	4.86E-4	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.35048	2.4;2.4;1.33	5.95	5.95	0.96441	.	.	.	.	.	T	0.42017	0.1184	L	0.36672	1.1	0.36920	D	0.891354	B;P;P	0.46142	0.023;0.873;0.873	B;P;P	0.47346	0.023;0.544;0.544	T	0.44452	-0.9327	9	0.87932	D	0	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	3363;3432;3432	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	N	3363;3432;3432;152	ENSP00000334319:D3432N;ENSP00000388393:D3432N;ENSP00000393760:D152N	ENSP00000334319:D3432N	D	-	1	0	PCLO	82417546	0.997000	0.39634	0.997000	0.53966	0.742000	0.42306	4.382000	0.59594	2.825000	0.97269	0.655000	0.94253	GAT		0.418	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
GRIN3A	116443	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	104432589	104432589	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:104432589C>A	ENST00000361820.3	-	3	2705	c.2105G>T	c.(2104-2106)gGt>gTt	p.G702V		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	702					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGGAGTCAAACCAAATGGACT	0.473																																						.											0													130.0	136.0	134.0					9																	104432589		2203	4300	6503	SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2105G>T	9.37:g.104432589C>A	ENSP00000355155:p.Gly702Val		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764413	0.69878	.	.	ENSG00000198785	ENST00000361820	T	0.53640	0.61	5.39	5.39	0.77823	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80999	-0.1131	10	0.87932	D	0	.	19.5908	0.95509	0.0:1.0:0.0:0.0	.	702	Q8TCU5	NMD3A_HUMAN	V	702	ENSP00000355155:G702V	ENSP00000355155:G702V	G	-	2	0	GRIN3A	103472410	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	7.773000	0.85462	2.714000	0.92807	0.580000	0.79431	GGT		0.473	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
NDST2	8509	broad.mit.edu	37	10	75563396	75563397	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr10:75563396_75563397insG	ENST00000309979.6	-	11	2633_2634	c.2077_2078insC	c.(2077-2079)ctgfs	p.L693fs	RP11-574K11.31_ENST00000603027.1_Frame_Shift_Ins_p.L693fs|NDST2_ENST00000299641.4_Frame_Shift_Ins_p.L570fs|ZSWIM8-AS1_ENST00000456638.2_RNA			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	693	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGCTCGTGGCAGGAGGGCAGCC	0.535																																						.											0																																										SO:0001589	frameshift_variant	8509			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.2078dupC	10.37:g.75563398_75563398dupG	ENSP00000310657:p.Leu693fs		Q2TB32|Q59H89	Frame_Shift_Ins	INS	ENST00000309979.6	37	CCDS7335.1																																																																																				0.535	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
Unknown	0	broad.mit.edu	37	12	90833	90834	+	IGR	INS	-	-	G	rs577348764		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:90833_90834insG								AC215219.1 (17511 upstream) : AC026369.1 (56217 downstream)																							GTGAGGGGCCCGGAGGAGCCTT	0.653																																						.											0																																										SO:0001628	intergenic_variant	0																															12.37:g.90835_90835dupG				RNA	INS		37																																																																																				0	0.653								
ERCC4	2072	broad.mit.edu	37	16	14041910	14041911	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr16:14041910_14041911insA	ENST00000311895.7	+	11	2466_2467	c.2457_2458insA	c.(2458-2460)aagfs	p.K820fs		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	820					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						TGAAACAAAGCAAGCCACAGCC	0.515			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	0																																										SO:0001589	frameshift_variant	2072	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2459dupA	16.37:g.14041912_14041912dupA	ENSP00000310520:p.Lys820fs		A5PKV6|A8K111|O00140|Q8TD83	Frame_Shift_Ins	INS	ENST00000311895.7	37	CCDS32390.1																																																																																				0.515	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
ABCC6	368	broad.mit.edu	37	16	16278826	16278827	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr16:16278826_16278827insG	ENST00000205557.7	-	15	1961_1962	c.1932_1933insC	c.(1930-1935)ccctgcfs	p.C645fs	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	645	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CTGTGGAGGCAGGGAGGGCTTT	0.579																																						.											0																																										SO:0001589	frameshift_variant	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1933dupC	16.37:g.16278829_16278829dupG	ENSP00000205557:p.Cys645fs		A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Frame_Shift_Ins	INS	ENST00000205557.7	37	CCDS10568.1																																																																																				0.579	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
MUC16	94025	broad.mit.edu	37	19	9054266	9054267	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:9054266_9054267insG	ENST00000397910.4	-	4	31558_31559	c.31355_31356insC	c.(31354-31356)cctfs	p.P10452fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10454	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGATGTCTGAGGGCCTTTGAC	0.47																																						.											0																																										SO:0001589	frameshift_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31356dupC	19.37:g.9054269_9054269dupG	ENSP00000381008:p.Pro10452fs		Q6ZQW5|Q96RK2	Frame_Shift_Ins	INS	ENST00000397910.4	37	CCDS54212.1																																																																																				0.470	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
AIFM3	150209	ucsc.edu	37	22	21334338	21334338	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr22:21334338T>C	ENST00000399167.2	+	19	1922	c.1682T>C	c.(1681-1683)aTg>aCg	p.M561T	LZTR1_ENST00000215739.8_5'Flank|LZTR1_ENST00000479606.1_3'UTR|AIFM3_ENST00000333607.6_Missense_Mutation_p.M561T|AIFM3_ENST00000440238.2_Missense_Mutation_p.M561T|AIFM3_ENST00000405089.1_Missense_Mutation_p.M567T|AIFM3_ENST00000335375.5_Missense_Mutation_p.M549T|AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000399163.2_Missense_Mutation_p.M561T|XXbac-B135H6.18_ENST00000610278.1_lincRNA|LZTR1_ENST00000389355.3_5'Flank	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	561					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GTGGCCAGCATGAACTACGAT	0.617																																						.											0													71.0	57.0	61.0					22																	21334338		2203	4300	6503	SO:0001583	missense	150209			AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.1682T>C	22.37:g.21334338T>C	ENSP00000382120:p.Met561Thr		B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Missense_Mutation	SNP	ENST00000399167.2	37	CCDS13786.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329743	0.81690	.	.	ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000099949	ENST00000399167;ENST00000399163;ENST00000405089;ENST00000335375;ENST00000440238;ENST00000333607;ENST00000539817	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	4.87	4.87	0.63330	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (1);	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	M	0.84511	2.7	0.80722	D	1	D;P;P;P;P;P	0.65815	0.995;0.814;0.865;0.93;0.93;0.885	P;P;B;P;P;B	0.58721	0.844;0.774;0.306;0.62;0.62;0.416	T	0.69250	-0.5194	10	0.66056	D	0.02	-4.5669	12.4825	0.55852	0.0:0.0:0.0:1.0	.	549;1;549;567;561;561	B7Z9S7;F5GXU8;B7Z376;Q96NN9-2;Q96NN9-3;Q96NN9	.;.;.;.;.;AIFM3_HUMAN	T	561;561;567;549;561;561;1	ENSP00000382120:M561T;ENSP00000382116:M561T;ENSP00000385800:M567T;ENSP00000335369:M549T;ENSP00000390798:M561T;ENSP00000327671:M561T	ENSP00000327671:M561T	M	+	2	0	AIFM3;LZTR1	19664338	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.993000	0.76245	2.047000	0.60756	0.533000	0.62120	ATG		0.617	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1	NM_144704	
CAPN11	11131	ucsc.edu	37	6	44140054	44140054	+	Missense_Mutation	SNP	T	T	C	rs397947482|rs57288791|rs111320370	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:44140054T>C	ENST00000398776.1	+	5	463	c.425T>C	c.(424-426)cTg>cCg	p.L142P	CAPN11_ENST00000542245.1_Missense_Mutation_p.L142P	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	142	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCTGGCTGCTGGCTGCCATC	0.582											OREG0017466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													12.0	15.0	14.0					6																	44140054		1959	4096	6055	SO:0001583	missense	11131			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.425T>C	6.37:g.44140054T>C	ENSP00000381758:p.Leu142Pro	921	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.354124	0.82243	.	.	ENSG00000137225	ENST00000398776;ENST00000542245;ENST00000532171	D;D;D	0.93019	-3.15;-3.15;-3.15	4.05	4.05	0.47172	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.38605	N	0.001632	D	0.98353	0.9453	H	0.99887	4.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98507	1.0617	10	0.87932	D	0	.	13.2146	0.59851	0.0:0.0:0.0:1.0	.	142	Q9UMQ6	CAN11_HUMAN	P	142;142;172	ENSP00000381758:L142P;ENSP00000441078:L142P;ENSP00000432420:L172P	ENSP00000381758:L142P	L	+	2	0	CAPN11	44248032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.650000	0.83521	2.062000	0.61559	0.533000	0.62120	CTG		0.582	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
ERICH6B	220081	ucsc.edu	37	13	46170726	46170726	+	Missense_Mutation	SNP	A	A	G	rs28548352|rs142875900|rs375947127	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:46170726A>G	ENST00000298738.2	-	3	579	c.415T>C	c.(415-417)Tat>Cat	p.Y139H		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		139	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTCCCCAGATActcttcctcc	0.488																																						.											0													134.0	79.0	95.0					13																	46170726		692	1566	2258	SO:0001583	missense	220081																														ENST00000298738.2:c.415T>C	13.37:g.46170726A>G	ENSP00000298738:p.Tyr139His		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089484	0.07053	.	.	ENSG00000165837	ENST00000298738	T	0.06294	3.32	2.4	-0.599	0.11645	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.27594	0.182;0.071	B;B	0.26310	0.068;0.009	T	0.43925	-0.9361	9	0.87932	D	0	0.4727	0.1132	0.00058	0.3431:0.2385:0.1823:0.236	rs28548352	139;139	A2VDI6;Q5W0A0	.;F194B_HUMAN	H	139	ENSP00000298738:Y139H	ENSP00000298738:Y139H	Y	-	1	0	FAM194B	45068727	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-6.553000	0.00061	0.160000	0.19432	0.358000	0.22013	TAT		0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	ucsc.edu	37	13	46170735	46170735	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs28460344|rs375947127	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:46170735C>T	ENST00000298738.2	-	3	570	c.406G>A	c.(406-408)Gag>Aag	p.E136K		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TActcttcctcctccagatgc	0.483													C|||	1385	0.276558	0.1362	0.4308	5008	,	,		19628	0.1627		0.494	False		,,,				2504	0.2505					.											0													134.0	78.0	95.0					13																	46170735		692	1565	2257	SO:0001583	missense	220081																														ENST00000298738.2:c.406G>A	13.37:g.46170735C>T	ENSP00000298738:p.Glu136Lys		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869929	0.17322	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.1	0.141	0.14811	.	.	.	.	.	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.001	T	0.43015	-0.9417	9	0.87932	D	0	-1.9096	5.6342	0.17528	0.0:0.5396:0.0:0.4604	rs28460344	136;136	A2VDI6;Q5W0A0	.;F194B_HUMAN	K	136	ENSP00000298738:E136K	ENSP00000298738:E136K	E	-	1	0	FAM194B	45068736	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.079000	0.14782	-0.180000	0.10637	-1.380000	0.01176	GAG		0.483	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	ucsc.edu	37	13	46170737	46170737	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs375947127|rs117004691	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:46170737T>C	ENST00000298738.2	-	3	568	c.404A>G	c.(403-405)gAg>gGg	p.E135G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						ctcttcctcctccagatgctc	0.493													T|||	1383	0.276158	0.1362	0.4308	5008	,	,		19669	0.1607		0.494	False		,,,				2504	0.2505					.											0													133.0	77.0	94.0					13																	46170737		692	1565	2257	SO:0001583	missense	220081																														ENST00000298738.2:c.404A>G	13.37:g.46170737T>C	ENSP00000298738:p.Glu135Gly		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	8.448	0.852491	0.17106	.	.	ENSG00000165837	ENST00000298738	T	0.06608	3.28	2.24	-2.01	0.07410	.	.	.	.	.	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40534	-0.9558	9	0.87932	D	0	-2.345	6.5075	0.22204	0.0:0.4358:0.0:0.5642	.	135;135	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	135	ENSP00000298738:E135G	ENSP00000298738:E135G	E	-	2	0	FAM194B	45068738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.707000	0.05041	-0.286000	0.09076	-1.636000	0.00776	GAG		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
FBXW9	84261	ucsc.edu	37	19	12807079	12807079	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:12807079A>G	ENST00000380339.3	-	1	353	c.317T>C	c.(316-318)gTg>gCg	p.V106A	FBXW9_ENST00000393261.3_Missense_Mutation_p.V106A|FBXW9_ENST00000544494.1_5'UTR|FBXW9_ENST00000587955.1_Missense_Mutation_p.V106A			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	106	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						CGCGTGGCACACCCGCGACAG	0.697																																						.											0													10.0	14.0	13.0					19																	12807079		1984	4113	6097	SO:0001583	missense	84261			BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.317T>C	19.37:g.12807079A>G	ENSP00000369696:p.Val106Ala		B3KVP7|Q9BT89	Missense_Mutation	SNP	ENST00000380339.3	37		.	.	.	.	.	.	.	.	.	.	A	33	5.231393	0.95207	.	.	ENSG00000132004	ENST00000393261;ENST00000380339	T;T	0.72394	-0.65;-0.65	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000010	T	0.81044	0.4741	M	0.68952	2.095	0.80722	D	1	D;D	0.69078	0.997;0.994	D;P	0.69654	0.965;0.888	T	0.82388	-0.0482	10	0.56958	D	0.05	-28.5893	12.6408	0.56709	1.0:0.0:0.0:0.0	.	106;106	Q5XUX1-2;Q5XUX1-3	.;.	A	106	ENSP00000376945:V106A;ENSP00000369696:V106A	ENSP00000369696:V106A	V	-	2	0	FBXW9	12668079	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.956000	0.70315	1.984000	0.57885	0.459000	0.35465	GTG		0.697	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
FHAD1	114827	ucsc.edu	37	1	15707279	15707279	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:15707279T>C	ENST00000375998.4	+	27	3722	c.3722T>C	c.(3721-3723)cTc>cCc	p.L1241P	FHAD1_ENST00000314740.8_Missense_Mutation_p.L494P|FHAD1_ENST00000417793.1_Missense_Mutation_p.L1205P|FHAD1_ENST00000375999.3_Missense_Mutation_p.L1241P|FHAD1_ENST00000358897.4_Missense_Mutation_p.L1241P|FHAD1_ENST00000471347.1_3'UTR			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	1241										skin(1)|stomach(1)	2						GCTTTAGAGCTCAGTGAAAAG	0.493																																						.											0													68.0	65.0	66.0					1																	15707279		692	1591	2283	SO:0001583	missense	114827			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.3722T>C	1.37:g.15707279T>C	ENSP00000365166:p.Leu1241Pro		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.54|18.54	3.645930|3.645930	0.67358|0.67358	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668|ENST00000444385	T;T;T;T;T;T;T|.	0.55588|.	0.52;0.53;0.51;0.52;0.57;0.58;0.58|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|.	.|.	.|.	.|.	T|T	0.72550|0.72550	0.3474|0.3474	M|M	0.74881|0.74881	2.28|2.28	0.58432|0.58432	D|D	0.999996|0.999996	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.91635|.	0.999;0.982|.	T|T	0.73544|0.73544	-0.3949|-0.3949	9|5	0.31617|.	T|.	0.26|.	.|.	11.9961|11.9961	0.53204|0.53204	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	494;1241|.	B7WPP2;B1AJZ9|.	.;FHAD1_HUMAN|.	P|P	1241;1205;1241;1241;512;494;476|560	ENSP00000351770:L1241P;ENSP00000407615:L1205P;ENSP00000365167:L1241P;ENSP00000365166:L1241P;ENSP00000434909:L512P;ENSP00000322979:L494P;ENSP00000318812:L476P|.	ENSP00000318812:L476P|.	L|S	+|+	2|1	0|0	FHAD1|FHAD1	15579866|15579866	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.920000|0.920000	0.55202|0.55202	4.767000|4.767000	0.62286|0.62286	2.144000|2.144000	0.66660|0.66660	0.533000|0.533000	0.62120|0.62120	CTC|TCA		0.493	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
IRF5	3663	ucsc.edu	37	7	128587374	128587374	+	Missense_Mutation	SNP	G	G	A	rs199508964|rs113806178|rs60344245	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:128587374G>A	ENST00000402030.2	+	6	596	c.524G>A	c.(523-525)cGg>cAg	p.R175Q	IRF5_ENST00000249375.4_Missense_Mutation_p.R175Q|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000473745.1_Missense_Mutation_p.R175Q|IRF5_ENST00000357234.5_Missense_Mutation_p.R191Q	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	175					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						CCCACTCTGCGGCCGCCTACT	0.657																																						.											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											6.0	8.0	7.0					7																	128587374		1947	3850	5797	SO:0001583	missense	3663				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.524G>A	7.37:g.128587374G>A	ENSP00000385352:p.Arg175Gln		A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	ENST00000402030.2	37	CCDS5808.1	628|628	0.2875457875457875|0.2875457875457875	155|155	0.3150406504065041|0.3150406504065041	88|88	0.2430939226519337|0.2430939226519337	148|148	0.25874125874125875|0.25874125874125875	237|237	0.31266490765171506|0.31266490765171506	G|G	0.019|0.019	-1.454282|-1.454282	0.01071|0.01071	.|.	.|.	ENSG00000128604|ENSG00000128604	ENST00000430204|ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745	.|D;D;D;D	.|0.97256	.|-4.25;-4.31;-4.31;-4.31	.|.	.|.	.|.	.|.	.|5.726080	.|0.00166	.|N	.|0.000000	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;.	.|0.02656	.|0.0;.	.|B;.	.|0.01281	.|0.0;.	T|T	0.62562|0.62562	-0.6828|-0.6828	3|7	0.06757|0.13470	T|T	0.87|0.59	.|.	.|.	.|.	.|.	.|.	164|175;191	E9PC81|Q13568;Q13568-2	.|IRF5_HUMAN;.	S|Q	164|191;175;175;175	.|ENSP00000349770:R191Q;ENSP00000385352:R175Q;ENSP00000249375:R175Q;ENSP00000419149:R175Q	ENSP00000409106:G164S|ENSP00000249375:R175Q	G|R	+|+	1|2	0|0	IRF5|IRF5	128374610|128374610	0.019000|0.019000	0.18553|0.18553	0.128000|0.128000	0.21923|0.21923	0.042000|0.042000	0.13812|0.13812	-1.450000|-1.450000	0.02390|0.02390	-1.505000|-1.505000	0.01807|0.01807	-1.490000|-1.490000	0.00973|0.00973	GGC|CGG		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
KRTAP10-10	353333	ucsc.edu	37	21	46057634	46057634	+	Silent	SNP	T	T	C	rs61029972	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr21:46057634T>C	ENST00000380095.1	+	1	362	c.300T>C	c.(298-300)tgT>tgC	p.C100C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	100	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						ctgtctgctgtgtgcccgtct	0.632													C|||	539	0.107628	0.2383	0.0591	5008	,	,		18755	0.0109		0.0557	False		,,,				2504	0.1186					.											0													126.0	121.0	123.0					21																	46057634		2203	4298	6501	SO:0001819	synonymous_variant	353333			AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.300T>C	21.37:g.46057634T>C				Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																				0.632	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
PEG3	5178	ucsc.edu;mdanderson.org	37	19	57328023	57328023	+	Missense_Mutation	SNP	T	T	C	rs79960989	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:57328023T>C	ENST00000326441.9	-	10	2150	c.1787A>G	c.(1786-1788)cAt>cGt	p.H596R	PEG3_ENST00000598410.1_Missense_Mutation_p.H472R|PEG3_ENST00000593695.1_Missense_Mutation_p.H470R|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.H596R	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	596					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ttcacgttcatgttcacgctc	0.458													T|||	60	0.0119808	0.0424	0.0043	5008	,	,		21623	0.001		0.0	False		,,,				2504	0.0					.											0								T	ARG/HIS,ARG/HIS,ARG/HIS,ARG/HIS,,,ARG/HIS,	134,4272	96.2+/-134.9	2,130,2071	107.0	83.0	91.0		1787,1409,1787,1415,,,1787,	-0.9	0.0	19	dbSNP_131	91	0,8600		0,0,4300	yes	missense,missense,missense,missense,intron,intron,missense,intron	PEG3,ZIM2	NM_001146184.1,NM_001146185.1,NM_001146186.1,NM_001146187.1,NM_001146326.1,NM_001146327.1,NM_006210.2,NM_015363.4	29,29,29,29,,,29,	2,130,6371	CC,CT,TT		0.0,3.0413,1.0303	benign,benign,benign,benign,,,benign,	596/1589,470/1463,596/1589,472/1465,,,596/1589,	57328023	134,12872	2203	4300	6503	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1787A>G	19.37:g.57328023T>C	ENSP00000326581:p.His596Arg		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	17	0.007783882783882784	16	0.032520325203252036	1	0.0027624309392265192	0	0.0	0	0.0	T	0.007	-2.013031	0.00422	0.030413	0.0	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.03004	4.08;4.08	1.69	-0.871	0.10642	.	.	.	.	.	T	0.00300	0.0009	N	0.00308	-1.67	.	.	.	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45702	-0.9243	8	0.02654	T	1	.	3.022	0.06078	0.0:0.5185:0.2895:0.192	.	472;596;531	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	596	ENSP00000326581:H596R;ENSP00000403051:H596R	ENSP00000326581:H596R	H	-	2	0	ZIM2	62019835	0.000000	0.05858	0.002000	0.10522	0.108000	0.19459	-0.752000	0.04797	-0.083000	0.12618	-0.317000	0.08691	CAT		0.458	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PEX6	5190	ucsc.edu	37	6	42933101	42933101	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:42933101A>G	ENST00000304611.8	-	14	2546	c.2477T>C	c.(2476-2478)gTg>gCg	p.V826A	PEX6_ENST00000244546.4_3'UTR	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	826					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GAGCTGAGACACCACCCTGGA	0.577																																						.											0													94.0	80.0	85.0					6																	42933101		2203	4300	6503	SO:0001583	missense	5190			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2477T>C	6.37:g.42933101A>G	ENSP00000303511:p.Val826Ala		Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	37	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.710784	0.89112	.	.	ENSG00000124587	ENST00000304611	D	0.93763	-3.28	5.84	5.84	0.93424	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.95351	0.8491	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.95948	0.8952	10	0.72032	D	0.01	-20.2207	15.9056	0.79427	1.0:0.0:0.0:0.0	.	826	Q13608	PEX6_HUMAN	A	826	ENSP00000303511:V826A	ENSP00000303511:V826A	V	-	2	0	PEX6	43041079	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.090000	0.94144	2.233000	0.73108	0.454000	0.30748	GTG		0.577	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
TMEM147	10430	ucsc.edu;bcgsc.ca	37	19	36036858	36036858	+	Splice_Site	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:36036858A>G	ENST00000222284.5	+	2	291	c.146A>G	c.(145-147)aAg>aGg	p.K49R	TMEM147_ENST00000392205.1_Splice_Site_p.K49R|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000590125.1_RNA|TMEM147_ENST00000392204.2_5'UTR|AD000090.2_ENST00000444728.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	49						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAACTCTGCAAGGTGAGGGCC	0.682																																						.											0													47.0	41.0	43.0					19																	36036858		2203	4300	6503	SO:0001630	splice_region_variant	10430			BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.147+1A>G	19.37:g.36036858A>G			A8MWW0|O75790	Missense_Mutation	SNP	ENST00000222284.5	37	CCDS12466.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.809674	0.50421	.	.	ENSG00000105677	ENST00000222284;ENST00000392205	T;T	0.64085	-0.08;-0.08	4.98	2.88	0.33553	.	0.109198	0.64402	D	0.000009	T	0.71787	0.3381	M	0.83692	2.655	0.58432	D	0.999998	D	0.61697	0.99	P	0.58266	0.836	T	0.69347	-0.5169	10	0.54805	T	0.06	.	5.0146	0.14330	0.6976:0.206:0.0964:0.0	.	49	Q9BVK8	TM147_HUMAN	R	49	ENSP00000222284:K49R;ENSP00000376041:K49R	ENSP00000222284:K49R	K	+	2	0	TMEM147	40728698	1.000000	0.71417	0.999000	0.59377	0.000000	0.00434	7.959000	0.87885	0.385000	0.24970	-1.046000	0.02355	AAG		0.682	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109469.2	NM_032635	Missense_Mutation
ABCD1	215	mdanderson.org	37	X	153008788	153008788	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:153008788G>A	ENST00000218104.3	+	9	2378	c.1979G>A	c.(1978-1980)cGg>cAg	p.R660Q	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	660	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> P (in ALD; CALD-type). {ECO:0000269|PubMed:11438993}.|R -> Q (in ALD). {ECO:0000269|PubMed:21889498}.|R -> W (in ALD; CALD, ALMD and AS-types).		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCACCCACCGGCCCTCCCTG	0.692																																						.											0			GRCh37	CM012042	ABCD1	M							19.0	16.0	17.0					X																	153008788		2189	4274	6463	SO:0001583	missense	215			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1979G>A	X.37:g.153008788G>A	ENSP00000218104:p.Arg660Gln		Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839976	0.91117	.	.	ENSG00000101986	ENST00000218104	D	0.99855	-7.2	4.69	4.69	0.59074	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.64402	D	0.000017	D	0.99862	0.9935	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96260	0.9190	10	0.87932	D	0	-33.9595	15.8397	0.78835	0.0:0.0:1.0:0.0	.	660	P33897	ABCD1_HUMAN	Q	660	ENSP00000218104:R660Q	ENSP00000218104:R660Q	R	+	2	0	ABCD1	152661982	1.000000	0.71417	0.994000	0.49952	0.613000	0.37349	9.349000	0.97066	2.073000	0.62155	0.523000	0.50628	CGG		0.692	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
ADAM22	53616	mdanderson.org	37	7	87607668	87607668	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:87607668A>G	ENST00000265727.7	+	3	343	c.264A>G	c.(262-264)caA>caG	p.Q88Q	ADAM22_ENST00000315984.7_Silent_p.Q88Q|ADAM22_ENST00000398209.3_Silent_p.Q88Q|ADAM22_ENST00000439864.1_Silent_p.Q88Q|ADAM22_ENST00000398204.4_Silent_p.Q88Q|ADAM22_ENST00000398201.4_Silent_p.Q88Q			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	88					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ATGTTGACCAAGCAAGCTTCC	0.348																																						.											0													198.0	175.0	182.0					7																	87607668		1890	4112	6002	SO:0001819	synonymous_variant	53616			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.264A>G	7.37:g.87607668A>G			O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1																																																																																				0.348	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
ADGB	79747	mdanderson.org	37	6	147045409	147045409	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:147045409T>C	ENST00000397944.3	+	18	2259	c.2183T>C	c.(2182-2184)gTt>gCt	p.V728A	ADGB_ENST00000367493.3_Missense_Mutation_p.V147A	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	728					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GGCAGTCTTGTTCTGAAGATT	0.423																																						.											0													145.0	121.0	128.0					6																	147045409		692	1591	2283	SO:0001583	missense	79747			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2183T>C	6.37:g.147045409T>C	ENSP00000381036:p.Val728Ala		Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	T	20.5	4.004341	0.74932	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.37752	1.18	5.44	5.44	0.79542	.	0.174208	0.35936	N	0.002899	T	0.28200	0.0696	M	0.72894	2.215	0.35757	D	0.819844	P	0.48911	0.917	B	0.41917	0.37	T	0.40059	-0.9583	10	0.87932	D	0	-11.7961	13.0319	0.58847	0.0:0.0:0.0:1.0	.	728	Q8N7X0	CAN7L_HUMAN	A	728;147	ENSP00000381036:V728A	ENSP00000356463:V147A	V	+	2	0	C6orf103	147087102	0.194000	0.23325	0.842000	0.33263	0.586000	0.36452	4.368000	0.59505	2.057000	0.61298	0.533000	0.62120	GTT		0.423	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
ALG11	440138	mdanderson.org;bcgsc.ca	37	13	52586578	52586578	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:52586578G>T	ENST00000521508.1	+	1	29	c.24G>T	c.(22-24)tgG>tgT	p.W8C	ALG11_ENST00000523764.1_Missense_Mutation_p.W8C|ATP7B_ENST00000418097.2_5'Flank|ATP7B_ENST00000400366.3_5'Flank|ATP7B_ENST00000242839.4_5'Flank|ATP7B_ENST00000400370.3_5'Flank|ATP7B_ENST00000344297.5_5'Flank|ATP7B_ENST00000448424.2_5'Flank	NM_001004127.2	NP_001004127.2	Q2TAA5	ALG11_HUMAN	ALG11, alpha-1,2-mannosyltransferase	8					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GDP-Man:Man3GlcNAc2-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0004377)			endometrium(1)|large_intestine(6)|lung(4)|ovary(2)	13		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.44e-08)		AAAGGAGCTGGTGCCTGTGCA	0.562																																						.											0													88.0	82.0	84.0					13																	52586578		2203	4300	6503	SO:0001583	missense	440138			AK025456	CCDS31977.1	13q14.3	2013-02-22	2013-02-22		ENSG00000253710	ENSG00000253710	2.4.1.131	"""Glycosyltransferase group 1 domain containing"""	32456	protein-coding gene	gene with protein product	"""GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"""	613666	"""asparagine-linked glycosylation 11 homolog (S. cerevisiae, alpha-1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)"""			20080937	Standard	NM_001004127		Approved	KIAA0266		Q2TAA5	OTTHUMG00000016959	ENST00000521508.1:c.24G>T	13.37:g.52586578G>T	ENSP00000430236:p.Trp8Cys		A5PLP3|B4DKW9|Q5TAN9|Q6DKI6|Q96FI7	Missense_Mutation	SNP	ENST00000521508.1	37	CCDS31977.1	.	.	.	.	.	.	.	.	.	.	G	6.786	0.513952	0.12944	.	.	ENSG00000253710	ENST00000523764;ENST00000521508	T;T	0.76316	0.67;-1.01	5.1	5.1	0.69264	.	0.645519	0.13472	U	0.385360	T	0.73969	0.3655	L	0.44542	1.39	0.41399	D	0.987666	P	0.51653	0.947	B	0.43360	0.417	T	0.76849	-0.2807	10	0.72032	D	0.01	.	14.2046	0.65725	0.0:0.0:1.0:0.0	.	8	Q2TAA5	ALG11_HUMAN	C	8	ENSP00000429497:W8C;ENSP00000430236:W8C	ENSP00000430236:W8C	W	+	3	0	ALG11	51484579	0.967000	0.33354	0.839000	0.33178	0.006000	0.05464	2.613000	0.46351	2.818000	0.97014	0.591000	0.81541	TGG		0.562	ALG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045050.1	NM_001004127	
ANK3	288	mdanderson.org	37	10	61815749	61815749	+	Silent	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr10:61815749T>C	ENST00000280772.2	-	42	12923	c.12732A>G	c.(12730-12732)gaA>gaG	p.E4244E	RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000373827.2_Silent_p.E1728E|ANK3_ENST00000503366.1_Silent_p.E1735E|ANK3_ENST00000355288.2_Silent_p.E868E	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4244					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATTTGCCAGCTTCTCCTTTGA	0.383																																						.											0													87.0	86.0	86.0					10																	61815749		2203	4300	6503	SO:0001819	synonymous_variant	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12732A>G	10.37:g.61815749T>C			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																				0.383	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ANKRD20A5P	440482	mdanderson.org	37	18	14184006	14184006	+	RNA	SNP	G	G	C	rs62085008	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr18:14184006G>C	ENST00000581935.1	+	0	695							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						GGATATCTACGGCAACACTGC	0.458																																						.											0													100.0	100.0	100.0					18																	14184006		2202	4294	6496			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184006G>C			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.458	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
AQP9	366	mdanderson.org	37	15	58458901	58458901	+	Silent	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr15:58458901T>C	ENST00000219919.4	+	2	511	c.141T>C	c.(139-141)gcT>gcC	p.A47A	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000558772.1_5'UTR|AQP9_ENST00000536493.1_Silent_p.A47A	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	47					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TTGCCCAAGCTATTCTCAGTC	0.473																																						.											0													254.0	226.0	236.0					15																	58458901		2192	4292	6484	SO:0001819	synonymous_variant	366			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.141T>C	15.37:g.58458901T>C			Q9NP32	Silent	SNP	ENST00000219919.4	37	CCDS10165.1																																																																																				0.473	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
ARHGEF5	7984	mdanderson.org	37	7	144070326	144070326	+	Silent	SNP	A	A	G	rs201695853	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:144070326A>G	ENST00000056217.5	+	10	4263	c.4089A>G	c.(4087-4089)cgA>cgG	p.R1363R	ARHGEF5_ENST00000471847.2_Silent_p.R285R	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1363					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					AGAGTATGCGACGGACAGAGG	0.512													A|||	3	0.000599042	0.0	0.0043	5008	,	,		19709	0.0		0.0	False		,,,				2504	0.0					.											0													127.0	118.0	121.0					7																	144070326		2055	4072	6127	SO:0001819	synonymous_variant	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4089A>G	7.37:g.144070326A>G			A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	A	2.328	-0.354109	0.05173	.	.	ENSG00000050327	ENST00000474817	.	.	.	4.54	-9.07	0.00724	.	.	.	.	.	T	0.42921	0.1224	.	.	.	0.53005	D	0.999967	.	.	.	.	.	.	T	0.49925	-0.8887	4	.	.	.	-9.5765	5.4746	0.16688	0.146:0.309:0.4434:0.1015	.	.	.	.	G	617	.	.	D	+	2	0	ARHGEF5	143701259	0.047000	0.20315	0.213000	0.23690	0.278000	0.26855	-0.764000	0.04735	-2.655000	0.00422	-1.106000	0.02097	GAC		0.512	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
PRR27	401137	mdanderson.org	37	4	71021777	71021777	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:71021777T>C	ENST00000344526.5	+	2	247	c.58T>C	c.(58-60)Ttc>Ctc	p.F20L	C4orf40_ENST00000502294.1_Missense_Mutation_p.F20L|C4orf40_ENST00000502441.2_3'UTR	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		20						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TTAGAGACGGTTCCCCTTCAT	0.264																																						.											0													38.0	40.0	39.0					4																	71021777		2197	4280	6477	SO:0001583	missense	401137																														ENST00000344526.5:c.58T>C	4.37:g.71021777T>C	ENSP00000343172:p.Phe20Leu		A8MXP0|Q6MZR6	Missense_Mutation	SNP	ENST00000344526.5	37	CCDS3535.1	.	.	.	.	.	.	.	.	.	.	T	11.91	1.779120	0.31502	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.38560	1.13;1.13	3.32	0.843	0.18935	.	.	.	.	.	T	0.23727	0.0574	N	0.19112	0.55	0.09310	N	1	B	0.19817	0.039	B	0.14578	0.011	T	0.18053	-1.0349	9	0.33940	T	0.23	-0.0543	5.1565	0.15038	0.0:0.2532:0.0:0.7468	.	20	Q6MZM9	CD040_HUMAN	L	20	ENSP00000426249:F20L;ENSP00000343172:F20L	ENSP00000343172:F20L	F	+	1	0	C4orf40	71056366	0.009000	0.17119	0.000000	0.03702	0.007000	0.05969	0.718000	0.25866	0.190000	0.20209	0.491000	0.48974	TTC		0.264	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251558.1		
C9orf152	401546	mdanderson.org	37	9	112963527	112963527	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:112963527T>C	ENST00000400613.4	-	2	1030	c.421A>G	c.(421-423)Agg>Ggg	p.R141G	C9orf152_ENST00000473442.1_Intron	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	141										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AGCTTGCCCCTATGATGTACT	0.537																																						.											0													184.0	169.0	174.0					9																	112963527		2203	4300	6503	SO:0001583	missense	401546			BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.421A>G	9.37:g.112963527T>C	ENSP00000383456:p.Arg141Gly		A8MWT6	Missense_Mutation	SNP	ENST00000400613.4	37	CCDS35102.2	.	.	.	.	.	.	.	.	.	.	T	10.77	1.444469	0.25987	.	.	ENSG00000188959	ENST00000400613	.	.	.	4.53	0.742	0.18341	.	0.457912	0.20100	N	0.099247	T	0.15609	0.0376	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.24155	0.051	T	0.13388	-1.0511	9	0.54805	T	0.06	-7.2526	4.2112	0.10512	0.0:0.184:0.3508:0.4652	.	141	Q5JTZ5	CI152_HUMAN	G	141	.	ENSP00000383456:R141G	R	-	1	2	C9orf152	112003348	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.794000	0.26958	0.112000	0.17975	-0.250000	0.11733	AGG		0.537	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053602.2	NM_001012993	
CCDC64	92558	mdanderson.org	37	12	120530940	120530940	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:120530940T>C	ENST00000397558.2	+	9	1697	c.1697T>C	c.(1696-1698)cTc>cCc	p.L566P	CCDC64_ENST00000257583.4_Missense_Mutation_p.L263P|CCDC64_ENST00000546857.1_3'UTR|CCDC64_ENST00000446727.2_Missense_Mutation_p.L237P	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	566					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCAAACGACTCTTCTCATTC	0.612																																						.											0													27.0	32.0	30.0					12																	120530940		2008	4157	6165	SO:0001583	missense	92558			U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1697T>C	12.37:g.120530940T>C	ENSP00000380690:p.Leu566Pro		A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199926	0.79015	.	.	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	T;T	0.62364	0.61;0.03	4.9	4.9	0.64082	.	1.075700	0.07390	U	0.888905	T	0.76371	0.3978	L	0.50333	1.59	0.80722	D	1	D;D;D	0.71674	0.993;0.998;0.998	P;D;D	0.69142	0.858;0.962;0.914	T	0.67887	-0.5554	10	0.72032	D	0.01	-0.4316	14.6842	0.69037	0.0:0.0:0.0:1.0	.	263;237;566	B4DWL0;B4DNE7;Q6ZP65	.;.;BICR1_HUMAN	P	566;237;284;263	ENSP00000380690:L566P;ENSP00000399658:L237P	ENSP00000257583:L263P	L	+	2	0	CCDC64	119015323	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.852000	0.69488	2.054000	0.61138	0.459000	0.35465	CTC		0.612	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311	
CDC27	996	mdanderson.org	37	17	45234327	45234327	+	Missense_Mutation	SNP	C	C	T	rs7350889		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr17:45234327C>T	ENST00000066544.3	-	7	887	c.794G>A	c.(793-795)gGt>gAt	p.G265D	CDC27_ENST00000531206.1_Missense_Mutation_p.G265D|CDC27_ENST00000527547.1_Missense_Mutation_p.G265D|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.G204D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	265					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.G265D(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAACTTCGACCAGTTTTTGG	0.368																																						.											2	Substitution - Missense(2)	skin(2)											60.0	65.0	63.0					17																	45234327		2201	4295	6496	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.794G>A	17.37:g.45234327C>T	ENSP00000066544:p.Gly265Asp		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725453	0.48833	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.3;-0.11;-0.31;0.86	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.32350	0.251;0.366;0.247;0.251	B;B;B;B	0.27076	0.045;0.056;0.076;0.055	T	0.51694	-0.8673	10	0.33141	T	0.24	1.6987	17.2083	0.86924	0.0:1.0:0.0:0.0	rs7350889;rs7350889	204;265;265;265	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	265;265;204;265;265	ENSP00000066544:G265D;ENSP00000434614:G265D;ENSP00000392802:G204D;ENSP00000437339:G265D;ENSP00000432105:G265D	ENSP00000066544:G265D	G	-	2	0	CDC27	42589326	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.618000	0.67722	2.665000	0.90641	0.460000	0.39030	GGT		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDCP1	64866	mdanderson.org	37	3	45136963	45136963	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:45136963A>G	ENST00000296129.1	-	5	1256	c.1122T>C	c.(1120-1122)tgT>tgC	p.C374C		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	374						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GACACACGAAACAGCCAGGGA	0.502																																						.											0													146.0	129.0	135.0					3																	45136963		2203	4300	6503	SO:0001819	synonymous_variant	64866			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1122T>C	3.37:g.45136963A>G			Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	ENST00000296129.1	37	CCDS2727.1																																																																																				0.502	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
CDKL2	8999	mdanderson.org	37	4	76532490	76532490	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:76532490A>G	ENST00000429927.2	-	4	1122	c.419T>C	c.(418-420)gTc>gCc	p.V140A	CDKL2_ENST00000307465.4_Missense_Mutation_p.V140A	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GCATAGCTTGACAACGCCAGA	0.418																																						.											0													89.0	82.0	84.0					4																	76532490		2203	4300	6503	SO:0001583	missense	8999			U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.419T>C	4.37:g.76532490A>G	ENSP00000412365:p.Val140Ala		B2R695	Missense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	a	22.9	4.344614	0.82022	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.49139	0.79;0.79	4.72	4.72	0.59763	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.41050	0.1142	N	0.21583	0.68	0.44123	D	0.996901	P;B	0.40931	0.733;0.277	P;B	0.44597	0.454;0.166	T	0.44967	-0.9293	9	0.72032	D	0.01	-4.7673	13.6112	0.62080	1.0:0.0:0.0:0.0	.	140;140	B4DH08;Q92772	.;CDKL2_HUMAN	A	140	ENSP00000412365:V140A;ENSP00000306340:V140A	ENSP00000306340:V140A	V	-	2	0	CDKL2	76751514	1.000000	0.71417	0.884000	0.34674	0.981000	0.71138	5.041000	0.64196	2.105000	0.64084	0.520000	0.50463	GTC		0.418	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
CHEK2	11200	mdanderson.org	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	TG	CA	rs142470496|rs146546850	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr22:29091840_29091841TG>CA	ENST00000405598.1	-	12	1307_1308	c.1116_1117CA>TG	c.(1114-1119)tcCAag>tcTGag	p.K373E	CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000464581.1_5'Flank			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)|p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCAA	0.416			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																														.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	17	Substitution - Missense(9)|Substitution - coding silent(8)	kidney(8)|prostate(4)|endometrium(2)|central_nervous_system(2)|stomach(1)																																								SO:0001583	missense	11200			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116_1117delinsCA	22.37:g.29091840_29091841delinsCA	ENSP00000386087:p.Lys373Glu		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	DNP	ENST00000405598.1	37	CCDS13843.1																																																																																				0.416	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
CNOT6L	246175	mdanderson.org	37	4	78641756	78641756	+	Silent	SNP	G	G	A	rs537970000		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:78641756G>A	ENST00000504123.1	-	12	1627	c.1497C>T	c.(1495-1497)aaC>aaT	p.N499N	CNOT6L_ENST00000264903.4_Silent_p.N499N			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	499	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						CACCAAGCACGTTCATATGAG	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20508	0.0		0.0	False		,,,				2504	0.0					.											0													147.0	142.0	144.0					4																	78641756		1919	4131	6050	SO:0001819	synonymous_variant	246175			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.1497C>T	4.37:g.78641756G>A			Q9UF92	Silent	SNP	ENST00000504123.1	37																																																																																					0.428	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1		
CRISP1	167	mdanderson.org	37	6	49825056	49825056	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:49825056A>G	ENST00000335847.4	-	2	159	c.58T>C	c.(58-60)Tcc>Ccc	p.S20P	CRISP1_ENST00000355791.2_Missense_Mutation_p.S20P|CRISP1_ENST00000329411.5_Missense_Mutation_p.S20P|CRISP1_ENST00000536021.1_Missense_Mutation_p.S20P|CRISP1_ENST00000505118.1_Missense_Mutation_p.S20P|CRISP1_ENST00000507853.1_Missense_Mutation_p.S20P	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	20					binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)			endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					ACTTTCATGGACAACATAGGC	0.333																																						.											0													90.0	82.0	85.0					6																	49825056		2203	4300	6503	SO:0001583	missense	167			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.58T>C	6.37:g.49825056A>G	ENSP00000338276:p.Ser20Pro		B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	37	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	A	1.910	-0.450893	0.04572	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	T;T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0;3.0	4.22	-1.85	0.07784	CAP domain (2);	1.552690	0.03792	N	0.263113	T	0.01254	0.0041	N	0.04787	-0.16	0.09310	N	1	B;B	0.22851	0.076;0.046	B;B	0.23716	0.048;0.021	T	0.44467	-0.9326	9	.	.	.	.	4.321	0.11016	0.1521:0.163:0.0:0.6849	.	20;20	P54107-2;P54107	.;CRIS1_HUMAN	P	20	ENSP00000425020:S20P;ENSP00000338276:S20P;ENSP00000348044:S20P;ENSP00000331317:S20P;ENSP00000427589:S20P;ENSP00000441798:S20P	.	S	-	1	0	CRISP1	49933015	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.139000	0.10358	-0.291000	0.09012	-0.168000	0.13345	TCC		0.333	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
CTBP1	1487	mdanderson.org	37	4	1244962	1244962	+	5'Flank	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:1244962T>C	ENST00000290921.6	-	0	0				CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		CTGTCCTGGCTTGTTCCAAGC	0.572																																						.											0													29.0	24.0	25.0					4																	1244962		2153	4242	6395	SO:0001631	upstream_gene_variant	92070			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244962T>C	Exception_encountered		Q4W5N3|Q7Z2Q5	RNA	SNP	ENST00000290921.6	37	CCDS3348.1																																																																																				0.572	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328	
DCAF13	25879	mdanderson.org	37	8	104442840	104442840	+	Splice_Site	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr8:104442840A>G	ENST00000297579.5	+	6	1358	c.1081A>G	c.(1081-1083)Aca>Gca	p.T361A	DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	209					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TTGTTTTTAGACATTTCTCTT	0.363																																						.											0													226.0	218.0	221.0					8																	104442840		2203	4300	6503	SO:0001630	splice_region_variant	25879			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1081-1A>G	8.37:g.104442840A>G			Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	37	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.120313	0.56613	.	.	ENSG00000164934	ENST00000297579	T	0.01347	4.99	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.03871	0.0109	M	0.77712	2.385	0.80722	D	1	B	0.27117	0.168	B	0.34489	0.184	T	0.42396	-0.9454	9	.	.	.	-18.7305	15.1592	0.72767	1.0:0.0:0.0:0.0	.	209	Q9NV06	DCA13_HUMAN	A	361	ENSP00000297579:T361A	.	T	+	1	0	DCAF13	104512016	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	6.490000	0.73645	1.996000	0.58369	0.455000	0.32223	ACA		0.363	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420	Missense_Mutation
DOCK4	9732	mdanderson.org;bcgsc.ca	37	7	111580241	111580241	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:111580241A>G	ENST00000437633.1	-	11	1157	c.901T>C	c.(901-903)Ttt>Ctt	p.F301L	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.F301L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	301					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCACAGCCAAAGGGTCGTCGG	0.448																																						.											0													181.0	187.0	185.0					7																	111580241		1968	4144	6112	SO:0001583	missense	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.901T>C	7.37:g.111580241A>G	ENSP00000404179:p.Phe301Leu		O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509593	0.64522	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.03831	3.79;3.79	6.06	4.89	0.63831	.	0.095096	0.85682	D	0.000000	T	0.08935	0.0221	M	0.62723	1.935	0.80722	D	1	B;B;B	0.28552	0.049;0.049;0.215	B;B;B	0.32465	0.024;0.016;0.146	T	0.03641	-1.1017	10	0.52906	T	0.07	.	13.4862	0.61366	0.8694:0.1306:0.0:0.0	.	301;301;301	A4D0S8;Q149N5;Q8N1I0	.;.;DOCK4_HUMAN	L	289;301;301;289;300	ENSP00000410746:F301L;ENSP00000404179:F301L	ENSP00000345432:F289L	F	-	1	0	DOCK4	111367477	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	6.873000	0.75541	1.091000	0.41335	0.533000	0.62120	TTT		0.448	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
DSPP	1834	mdanderson.org	37	4	88537081	88537081	+	Silent	SNP	C	C	T	rs367717407|rs370267258	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:88537081C>T	ENST00000282478.7	+	4	3300	c.3267C>T	c.(3265-3267)gaC>gaT	p.D1089D	DSPP_ENST00000399271.1_Silent_p.D1089D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1089	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagcaata	0.537													c|||	838	0.167332	0.2292	0.2133	5008	,	,		14171	0.1131		0.1461	False		,,,				2504	0.1288					.											0								C		1383,707		577,229,239	19.0	24.0	22.0		3267	0.6	0.0	4		22	2123,1867		754,615,626	no	coding-synonymous	DSPP	NM_014208.3		1331,844,865	TT,TC,CC		46.792,33.8278,42.3355		1089/1302	88537081	3506,2574	1045	1995	3040	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3267C>T	4.37:g.88537081C>T			A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																				0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
EIF4E	1977	mdanderson.org	37	4	99806181	99806181	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:99806181T>C	ENST00000450253.2	-	6	1955	c.431A>G	c.(430-432)gAc>gGc	p.D144G	EIF4E_ENST00000505992.1_Missense_Mutation_p.D175G|EIF4E_ENST00000280892.6_Missense_Mutation_p.D164G|EIF4E_ENST00000504432.1_Missense_Mutation_p.D172G	NM_001968.3	NP_001959.1	P06730	IF4E_HUMAN	eukaryotic translation initiation factor 4E	144					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of mitotic cell cycle (GO:0045931)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|mRNA cap binding complex (GO:0005845)|RISC complex (GO:0016442)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)		ATCACTGTAGTCATCAAAAGA	0.338																																						.											0													56.0	51.0	53.0					4																	99806181		2203	4298	6501	SO:0001583	missense	1977			M15353	CCDS34031.1, CCDS47109.1, CCDS54779.1	4q21-q25	2008-02-05			ENSG00000151247	ENSG00000151247			3287	protein-coding gene	gene with protein product		133440		EIF4EL1, EIF4F		9330633, 1916814	Standard	NM_001968		Approved	EIF4E1	uc011cea.1	P06730	OTTHUMG00000161090	ENST00000450253.2:c.431A>G	4.37:g.99806181T>C	ENSP00000389624:p.Asp144Gly		B7Z6V1|D6RCQ6|Q96E95	Missense_Mutation	SNP	ENST00000450253.2	37	CCDS34031.1	.	.	.	.	.	.	.	.	.	.	T	17.79	3.475597	0.63737	.	.	ENSG00000151247	ENST00000450253;ENST00000280892;ENST00000504432;ENST00000505992	T;T;T;T	0.44083	0.93;0.93;0.93;1.59	5.05	5.05	0.67936	Translation Initiation factor eIF- 4e-like  domain (2);	0.046398	0.85682	D	0.000000	T	0.49440	0.1557	M	0.74881	2.28	0.80722	D	1	B;B;B	0.16603	0.018;0.005;0.003	B;B;B	0.30782	0.085;0.12;0.085	T	0.52208	-0.8606	10	0.59425	D	0.04	-11.665	14.8686	0.70437	0.0:0.0:0.0:1.0	.	175;164;144	P06730-2;B7Z6V1;P06730	.;.;IF4E_HUMAN	G	144;164;172;175	ENSP00000389624:D144G;ENSP00000280892:D164G;ENSP00000423977:D172G;ENSP00000425561:D175G	ENSP00000280892:D164G	D	-	2	0	EIF4E	100025204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.850000	0.86915	1.910000	0.55303	0.451000	0.29950	GAC		0.338	EIF4E-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363739.1	NM_001968	
ENPEP	2028	mdanderson.org	37	4	111430851	111430851	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:111430851A>G	ENST00000265162.5	+	5	1424	c.1082A>G	c.(1081-1083)aAc>aGc	p.N361S	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	361	Substrate binding. {ECO:0000250}.				angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GCCATGGAGAACTGGGGACTC	0.438																																						.											0													150.0	143.0	145.0					4																	111430851		2203	4300	6503	SO:0001583	missense	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1082A>G	4.37:g.111430851A>G	ENSP00000265162:p.Asn361Ser		Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.766774	0.49574	.	.	ENSG00000138792	ENST00000265162	T	0.07908	3.15	5.76	4.56	0.56223	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.076730	0.85682	D	0.000000	T	0.41994	0.1183	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.59473	-0.7448	10	0.87932	D	0	.	13.0524	0.58962	0.8655:0.1345:0.0:0.0	.	361	Q07075	AMPE_HUMAN	S	361	ENSP00000265162:N361S	ENSP00000265162:N361S	N	+	2	0	ENPEP	111650300	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	9.291000	0.96070	0.979000	0.38497	-0.316000	0.08728	AAC		0.438	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
EPB41L4B	54566	mdanderson.org	37	9	112015799	112015799	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:112015799A>G	ENST00000374566.3	-	12	1718	c.1201T>C	c.(1201-1203)Tcc>Ccc	p.S401P	EPB41L4B_ENST00000374557.4_Missense_Mutation_p.S401P	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	401					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTAACCTGGAGCCATGTGTA	0.408																																						.											0													154.0	160.0	158.0					9																	112015799		1894	4125	6019	SO:0001583	missense	54566			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1201T>C	9.37:g.112015799A>G	ENSP00000363694:p.Ser401Pro		Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	37	CCDS43859.1	.	.	.	.	.	.	.	.	.	.	A	14.04	2.416937	0.42918	.	.	ENSG00000095203	ENST00000262536;ENST00000374566;ENST00000374557;ENST00000311609	D;D	0.88741	-2.42;-2.42	5.26	-3.23	0.05109	FERM adjacent (FA) (1);	0.623793	0.13393	N	0.391269	D	0.84511	0.5488	L	0.45581	1.43	0.23787	N	0.996842	B;P	0.34562	0.307;0.457	B;B	0.41412	0.132;0.356	T	0.76713	-0.2858	10	0.66056	D	0.02	.	7.251	0.26150	0.5718:0.2369:0.0:0.1913	.	401;401	Q9H329-2;Q9H329	.;E41LB_HUMAN	P	86;401;401;323	ENSP00000363694:S401P;ENSP00000363685:S401P	ENSP00000262536:S86P	S	-	1	0	EPB41L4B	111055620	0.042000	0.20092	0.079000	0.20413	0.971000	0.66376	0.089000	0.15002	-0.902000	0.03886	-1.508000	0.00951	TCC		0.408	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	
ERG	2078	mdanderson.org	37	21	39817391	39817391	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr21:39817391A>G	ENST00000417133.2	-	4	378	c.193T>C	c.(193-195)Tct>Cct	p.S65P	ERG_ENST00000398897.1_Intron|ERG_ENST00000429727.2_Missense_Mutation_p.S58P|ERG_ENST00000398919.2_Missense_Mutation_p.S65P|ERG_ENST00000398905.1_Missense_Mutation_p.S58P|ERG_ENST00000398907.1_Missense_Mutation_p.S58P|ERG_ENST00000442448.1_Missense_Mutation_p.S65P|ERG_ENST00000288319.7_Missense_Mutation_p.S58P|ERG_ENST00000398910.1_Missense_Mutation_p.S65P|ERG_ENST00000398911.1_Missense_Mutation_p.S65P|ERG_ENST00000453032.2_Intron	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.		T -> P (in LQT2; dbSNP:rs28933095). {ECO:0000269|PubMed:12354768, ECO:0000269|PubMed:15840476}.		cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGGGGTTGAGACAGCCAATCC	0.567			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	.		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0													99.0	82.0	88.0					21																	39817391		2203	4300	6503	SO:0001583	missense	2078				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.193T>C	21.37:g.39817391A>G	ENSP00000414150:p.Ser65Pro		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128379	0.37533	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000398919;ENST00000429727	T;T;T;T;T;T;T;T	0.15256	2.46;2.44;2.46;2.45;2.46;2.45;2.45;2.46	5.77	3.1	0.35709	.	0.355623	0.28828	N	0.014019	T	0.11281	0.0275	N	0.19112	0.55	0.41687	D	0.989328	B;B;B;B;B	0.11235	0.001;0.0;0.004;0.001;0.0	B;B;B;B;B	0.17098	0.006;0.001;0.017;0.003;0.0	T	0.09751	-1.0660	10	0.39692	T	0.17	.	10.8199	0.46599	0.851:0.0:0.149:0.0	.	58;65;65;65;58	B4E3C5;P11308;P11308-6;P11308-1;P11308-4	.;ERG_HUMAN;.;.;.	P	58;58;58;65;65;65;65;65;58	ENSP00000381877:S58P;ENSP00000381879:S58P;ENSP00000288319:S58P;ENSP00000381882:S65P;ENSP00000414150:S65P;ENSP00000381881:S65P;ENSP00000394694:S65P;ENSP00000381891:S65P	ENSP00000288319:S58P	S	-	1	0	ERG	38739261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.432000	0.59922	1.011000	0.39340	0.533000	0.62120	TCT		0.567	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
FAM118A	55007	mdanderson.org	37	22	45723920	45723920	+	Silent	SNP	C	C	T	rs111386114		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr22:45723920C>T	ENST00000216214.3	+	5	1332	c.498C>T	c.(496-498)tcC>tcT	p.S166S	FAM118A_ENST00000405673.1_Silent_p.S166S|FAM118A_ENST00000441876.2_Silent_p.S166S|FAM118A_ENST00000405548.3_5'Flank	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	166						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CCATGGAGTCCCTGGACTTGA	0.617																																						.											0													11.0	10.0	10.0					22																	45723920		2198	4293	6491	SO:0001819	synonymous_variant	55007			BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.498C>T	22.37:g.45723920C>T			B3KWG4|B4DY02|Q5TII5|Q96CY3	Silent	SNP	ENST00000216214.3	37	CCDS14065.1																																																																																				0.617	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322260.1	NM_017911	
FAM157A	728262	mdanderson.org	37	3	197894668	197894668	+	lincRNA	SNP	G	G	A	rs200450190		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:197894668G>A	ENST00000437428.2	+	0	829							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A									p.R337K(1)		NS(1)|skin(1)	2						TTCCCGCTGAGGTGCCAGAAG	0.607											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											1	Substitution - Missense(1)	NS(1)											33.0	31.0	31.0					3																	197894668		689	1588	2277			728262					3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894668G>A		2094		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	4.173	0.030697	0.08101	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	0.467	0.16721	.	.	.	.	.	T	0.17365	0.0417	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32090	0.14	T	0.31888	-0.9927	6	.	.	.	.	.	.	.	.	337	C9JC47	F157A_HUMAN	K	337	.	.	R	+	2	0	FAM157A	199379065	0.074000	0.21230	0.015000	0.15790	0.049000	0.14656	0.293000	0.19029	0.539000	0.28788	0.388000	0.25769	AGG		0.607	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
FAM157B	100132403	mdanderson.org	37	9	141107526	141107526	+	lincRNA	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:141107526C>T	ENST00000446912.2	+	0	9							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		TTACAAGAACCGgcagcggcg	0.567																																						.											0													16.0	19.0	18.0					9																	141107526		692	1591	2283			100132403					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107526C>T				Missense_Mutation	SNP	ENST00000446912.2	37																																																																																					0.567	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000055378.2	NM_001145249	
FAM182A	284800	mdanderson.org	37	20	26061909	26061909	+	RNA	SNP	G	G	A	rs116264914		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:26061909G>A	ENST00000376398.2	+	0	929					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						AGCACTGCGGGTGCCCAGCAA	0.562																																						.											0													29.0	25.0	26.0					20																	26061909		691	1558	2249			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061909G>A			A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37																																																																																					0.562	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FAM9C	171484	mdanderson.org	37	X	13058890	13058890	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:13058890T>C	ENST00000333995.3	-	5	446	c.316A>G	c.(316-318)Aca>Gca	p.T106A	FAM9C_ENST00000542843.1_3'UTR|FAM9C_ENST00000380625.3_Missense_Mutation_p.T106A			Q8IZT9	FAM9C_HUMAN	family with sequence similarity 9, member C	106						nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						TTTAGTTGTGTTGTTCTCAAA	0.299																																						.											0													104.0	81.0	89.0					X																	13058890		2202	4294	6496	SO:0001583	missense	171484				CCDS35203.1	Xp22.32	2013-03-14			ENSG00000187268	ENSG00000187268			18405	protein-coding gene	gene with protein product	"""testis expressed 39C"""	300479					Standard	NM_174901		Approved	TEX39C	uc004cvh.2	Q8IZT9	OTTHUMG00000021143	ENST00000333995.3:c.316A>G	X.37:g.13058890T>C	ENSP00000334430:p.Thr106Ala		B2R9G7|Q5HYJ6	Missense_Mutation	SNP	ENST00000333995.3	37	CCDS35203.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.694937	0.00731	.	.	ENSG00000187268	ENST00000380625;ENST00000333995	T;T	0.21191	2.02;2.02	0.588	0.588	0.17445	.	.	.	.	.	T	0.09379	0.0231	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.33317	-0.9873	8	0.30854	T	0.27	.	.	.	.	.	106	Q8IZT9	FAM9C_HUMAN	A	106	ENSP00000369999:T106A;ENSP00000334430:T106A	ENSP00000334430:T106A	T	-	1	0	FAM9C	12968811	0.997000	0.39634	0.001000	0.08648	0.033000	0.12548	0.391000	0.20784	0.436000	0.26393	0.150000	0.16122	ACA		0.299	FAM9C-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316476.1	NM_174901	
FHDC1	85462	mdanderson.org	37	4	153897154	153897154	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:153897154A>G	ENST00000511601.1	+	12	2899	c.2711A>G	c.(2710-2712)aAg>aGg	p.K904R	FHDC1_ENST00000260008.3_Missense_Mutation_p.K904R			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	904									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					AGCATGCGCAAGGTCATGCCC	0.687																																						.											0													29.0	32.0	31.0					4																	153897154		2202	4299	6501	SO:0001583	missense	85462			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2711A>G	4.37:g.153897154A>G	ENSP00000427567:p.Lys904Arg			Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.864262	0.71949	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.61859	0.07;0.07	4.98	4.98	0.66077	.	0.724112	0.13319	N	0.396836	T	0.65801	0.2726	L	0.34521	1.04	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.57069	-0.7874	10	0.20519	T	0.43	.	14.6664	0.68910	1.0:0.0:0.0:0.0	.	904	Q9C0D6	FHDC1_HUMAN	R	904	ENSP00000427567:K904R;ENSP00000260008:K904R	ENSP00000260008:K904R	K	+	2	0	FHDC1	154116604	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	8.665000	0.91144	1.873000	0.54277	0.379000	0.24179	AAG		0.687	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
FRG1B	284802	mdanderson.org;bcgsc.ca	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:29625875T>C	ENST00000278882.3	+	5	499	c.119T>C	c.(118-120)aTc>aCc	p.I40T	FRG1B_ENST00000358464.4_Missense_Mutation_p.I40T|FRG1B_ENST00000439954.2_Missense_Mutation_p.I45T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	40								p.I40T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGTACAGAATCGCCCTGAAA	0.358																																						.											4	Substitution - Missense(4)	prostate(4)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.119T>C	20.37:g.29625875T>C	ENSP00000278882:p.Ile40Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	10.51	1.369778	0.24771	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.51071	0.72	1.68	1.68	0.24146	.	0.052751	0.64402	D	0.000001	T	0.59865	0.2225	.	.	.	0.51482	D	0.999924	P	0.49862	0.929	D	0.64687	0.928	T	0.59386	-0.7464	9	0.52906	T	0.07	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	45	F5H5R5	.	T	40;45;40	ENSP00000408863:I45T	ENSP00000278882:I40T	I	+	2	0	FRG1B	28239536	1.000000	0.71417	0.982000	0.44146	0.025000	0.11179	6.565000	0.73974	1.028000	0.39785	0.155000	0.16302	ATC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29625947	29625947	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:29625947T>C	ENST00000278882.3	+	5	571	c.191T>C	c.(190-192)aTt>aCt	p.I64T	FRG1B_ENST00000358464.4_Missense_Mutation_p.I64T|FRG1B_ENST00000439954.2_Missense_Mutation_p.I69T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	64								p.I64T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCAGATGCAATTGGACCAAGA	0.343																																						.											4	Substitution - Missense(4)	urinary_tract(2)|prostate(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.191T>C	20.37:g.29625947T>C	ENSP00000278882:p.Ile64Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	11.16	1.557441	0.27827	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.53640	0.61	1.68	1.68	0.24146	.	0.048324	0.85682	N	0.000000	T	0.39279	0.1072	.	.	.	0.50313	D	0.999869	B	0.11235	0.004	B	0.30943	0.122	T	0.37549	-0.9701	9	0.62326	D	0.03	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	69	F5H5R5	.	T	64;69;64	ENSP00000408863:I69T	ENSP00000278882:I64T	I	+	2	0	FRG1B	28239608	1.000000	0.71417	0.998000	0.56505	0.053000	0.15095	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	ATT		0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29633901	29633901	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:29633901A>G	ENST00000278882.3	+	9	920	c.540A>G	c.(538-540)gaA>gaG	p.E180E	FRG1B_ENST00000358464.4_Silent_p.E180E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	180										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AAACAAGAGAACCAAATTGAA	0.269																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.540A>G	20.37:g.29633901A>G			C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.269	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FUT3	2525	mdanderson.org	37	19	5843822	5843822	+	Silent	SNP	T	T	C	rs199931170	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:5843822T>C	ENST00000303225.6	-	3	1663	c.1029A>G	c.(1027-1029)aaA>aaG	p.K343K	FUT3_ENST00000589620.1_Silent_p.K343K|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000458379.2_Silent_p.K343K|FUT3_ENST00000589918.1_Silent_p.K343K	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	343					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CCTGCTGCAGTTTCCAGCAGG	0.632																																					Esophageal Squamous(82;745 1728 24593 44831)	.											0													61.0	65.0	64.0					19																	5843822		2203	4300	6503	SO:0001819	synonymous_variant	2525				CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.1029A>G	19.37:g.5843822T>C			B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Silent	SNP	ENST00000303225.6	37	CCDS12153.1																																																																																				0.632	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
GABRE	2564	mdanderson.org	37	X	151123190	151123190	+	Missense_Mutation	SNP	C	C	A	rs1061417	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:151123190C>A	ENST00000370328.3	-	9	1557	c.1504G>T	c.(1504-1506)Gtt>Ttt	p.V502F	GABRE_ENST00000483564.1_5'UTR|AF274855.1_ENST00000582865.1_RNA|GABRE_ENST00000370325.1_3'UTR	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	502				V -> F (in Ref. 2; CAA70903). {ECO:0000305}.	gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTAAGGCAAACAAGCCAGTAG	0.547																																						.											0													23.0	23.0	23.0					X																	151123190		2203	4297	6500	SO:0001583	missense	2564			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1504G>T	X.37:g.151123190C>A	ENSP00000359353:p.Val502Phe		E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526136	0.44969	.	.	ENSG00000102287	ENST00000370328	D	0.81996	-1.56	5.34	2.5	0.30297	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.344162	0.20485	N	0.091418	T	0.68805	0.3041	N	0.16743	0.435	0.23101	N	0.998298	P	0.50272	0.933	P	0.48030	0.564	T	0.58645	-0.7600	10	0.18710	T	0.47	.	2.8551	0.05570	0.1845:0.5352:0.1754:0.1049	rs1061417;rs1061417	502	P78334	GBRE_HUMAN	F	502	ENSP00000359353:V502F	ENSP00000359353:V502F	V	-	1	0	GABRE	150873846	0.003000	0.15002	0.979000	0.43373	0.739000	0.42172	0.123000	0.15708	0.077000	0.16863	0.600000	0.82982	GTT		0.547	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
GCNT4	51301	mdanderson.org	37	5	74325354	74325354	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:74325354T>C	ENST00000322348.4	-	1	1370	c.509A>G	c.(508-510)gAt>gGt	p.D170G		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	170					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TTTGAAGGTATCAGGTGCCTT	0.388																																						.											0													150.0	147.0	148.0					5																	74325354		2203	4300	6503	SO:0001583	missense	51301			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.509A>G	5.37:g.74325354T>C	ENSP00000317027:p.Asp170Gly			Missense_Mutation	SNP	ENST00000322348.4	37	CCDS4026.1	.	.	.	.	.	.	.	.	.	.	.	8.629	0.893283	0.17613	.	.	ENSG00000176928	ENST00000322348	T	0.10860	2.83	6.17	2.19	0.27852	.	1.026770	0.07657	N	0.932996	T	0.10551	0.0258	L	0.55990	1.75	0.09310	N	1	B	0.26602	0.154	B	0.27380	0.079	T	0.42189	-0.9466	10	0.25751	T	0.34	-3.0761	2.6203	0.04914	0.2341:0.0635:0.2431:0.4593	.	170	Q9P109	GCNT4_HUMAN	G	170	ENSP00000317027:D170G	ENSP00000317027:D170G	D	-	2	0	GCNT4	74361110	0.000000	0.05858	0.001000	0.08648	0.750000	0.42670	0.726000	0.25984	0.511000	0.28236	0.533000	0.62120	GAT		0.388	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591	
GGT1	2678	mdanderson.org	37	22	25016296	25016296	+	Splice_Site	SNP	G	G	A	rs4049844		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr22:25016296G>A	ENST00000400382.1	+	8	1139	c.384G>A	c.(382-384)ggG>ggA	p.G128G	GGT1_ENST00000248923.4_Splice_Site_p.G128G|GGT1_ENST00000400383.1_Splice_Site_p.G128G|GGT1_ENST00000400380.1_Splice_Site_p.G128G|GGT1_ENST00000406383.2_Splice_Site_p.G128G			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	128					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.G128G(3)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	TCTCCCCAGGGGGGCTGTCGG	0.642																																						.											3	Substitution - coding silent(3)	prostate(3)											17.0	20.0	19.0					22																	25016296		1878	4103	5981	SO:0001630	splice_region_variant	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.383-1G>A	22.37:g.25016296G>A			Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	37	CCDS42992.1																																																																																				0.642	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	Silent
GPRC5A	9052	mdanderson.org	37	12	13061805	13061805	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:13061805A>G	ENST00000014914.5	+	2	1512	c.622A>G	c.(622-624)Aga>Gga	p.R208G	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	208					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	GGGCTGGAAGAGACATGGGGC	0.562																																						.											0													227.0	202.0	210.0					12																	13061805		2203	4300	6503	SO:0001583	missense	9052			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.622A>G	12.37:g.13061805A>G	ENSP00000014914:p.Arg208Gly		B3KV45|O95357	Missense_Mutation	SNP	ENST00000014914.5	37	CCDS8657.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.597318	0.66332	.	.	ENSG00000013588	ENST00000014914;ENST00000534831	D;D	0.88586	-2.4;-2.4	5.42	4.31	0.51392	GPCR, family 3, C-terminal (1);	0.130764	0.50627	D	0.000102	D	0.91496	0.7315	M	0.72894	2.215	0.46437	D	0.999044	D;D	0.54772	0.968;0.968	P;P	0.55303	0.773;0.628	D	0.91580	0.5278	10	0.48119	T	0.1	-20.2389	13.38	0.60762	0.8393:0.1607:0.0:0.0	.	208;208	Q8NFJ5;A8K556	RAI3_HUMAN;.	G	208	ENSP00000014914:R208G;ENSP00000441627:R208G	ENSP00000014914:R208G	R	+	1	2	GPRC5A	12953072	1.000000	0.71417	0.998000	0.56505	0.526000	0.34562	2.719000	0.47244	2.079000	0.62486	0.454000	0.30748	AGA		0.562	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1		
HLA-B	3106	mdanderson.org	37	6	31323116	31323116	+	Silent	SNP	C	C	T	rs1131446	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:31323116C>T	ENST00000412585.2	-	4	901	c.873G>A	c.(871-873)ccG>ccA	p.P291P		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	291	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TGAGGGGCTTCGGCAGCCCCT	0.577									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				C|||	485	0.096845	0.0749	0.0922	5008	,	,		21693	0.0754		0.1074	False		,,,				2504	0.1411					.											0													60.0	57.0	58.0					6																	31323116		2203	4300	6503	SO:0001819	synonymous_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.873G>A	6.37:g.31323116C>T			Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																				0.577	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-DRB5	3127	mdanderson.org	37	6	32487169	32487169	+	Silent	SNP	C	C	T	rs143127183	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32487169C>T	ENST00000374975.3	-	3	692	c.630G>A	c.(628-630)acG>acA	p.T210T		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						TGAGAGGGCTCGTCACGCTTG	0.493													C|||	233	0.0465256	0.059	0.0389	5008	,	,		12789	0.0685		0.0368	False		,,,				2504	0.0225					.											0													73.0	83.0	80.0					6																	32487169		1886	3734	5620	SO:0001819	synonymous_variant	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.630G>A	6.37:g.32487169C>T				Silent	SNP	ENST00000374975.3	37	CCDS4751.1																																																																																				0.493	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
HLA-DRB5	3127	mdanderson.org	37	6	32487214	32487214	+	Silent	SNP	T	T	C	rs557324709|rs144016913|rs41544512	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32487214T>C	ENST00000374975.3	-	3	647	c.585A>G	c.(583-585)cgA>cgG	p.R195R		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CCTCTCCACTTCGAGGAACTG	0.532													t|||	3842	0.767173	0.795	0.8847	5008	,	,		12516	0.7242		0.8171	False		,,,				2504	0.6391					.											0								C		2567,1093		1247,73,510	57.0	63.0	61.0		585	1.8	0.2	6	dbSNP_134	61	5042,2194		2446,150,1022	no	coding-synonymous	HLA-DRB5	NM_002125.3		3693,223,1532	CC,CT,TT		30.3206,29.8634,30.167		195/267	32487214	7609,3287	1830	3618	5448	SO:0001819	synonymous_variant	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.585A>G	6.37:g.32487214T>C				Silent	SNP	ENST00000374975.3	37	CCDS4751.1																																																																																				0.532	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
HLA-DRB5	3127	mdanderson.org	37	6	32487265	32487265	+	Missense_Mutation	SNP	C	C	G	rs139485758	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32487265C>G	ENST00000374975.3	-	3	596	c.534G>C	c.(532-534)caG>caC	p.Q178H		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.Q178H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						AGTCTCCATTCTGAATCAGGC	0.552													C|||	836	0.166933	0.2224	0.1326	5008	,	,		15097	0.1667		0.1531	False		,,,				2504	0.1309					.											1	Substitution - Missense(1)	NS(1)											61.0	68.0	65.0					6																	32487265		1933	3889	5822	SO:0001583	missense	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.534G>C	6.37:g.32487265C>G	ENSP00000364114:p.Gln178His			Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	2.451	-0.326294	0.05350	.	.	ENSG00000198502	ENST00000374975	T	0.14391	2.51	4.6	-9.19	0.00685	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.115120	0.06656	N	0.763651	T	0.02193	0.0068	L	0.35487	1.065	0.80722	P	0.0	B;B	0.19445	0.036;0.003	B;B	0.33690	0.168;0.014	T	0.35871	-0.9771	9	0.35671	T	0.21	.	1.7649	0.03000	0.2235:0.402:0.1926:0.1818	.	105;178	Q29973;Q30154	.;DRB5_HUMAN	H	178	ENSP00000364114:Q178H	ENSP00000364114:Q178H	Q	-	3	2	HLA-DRB5	32595243	0.000000	0.05858	0.000000	0.03702	0.495000	0.33615	-4.437000	0.00234	-3.808000	0.00104	-0.273000	0.10243	CAG		0.552	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
HLA-DRB5	3127	mdanderson.org	37	6	32487268	32487268	+	Silent	SNP	A	A	G	rs75732937	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32487268A>G	ENST00000374975.3	-	3	593	c.531T>C	c.(529-531)atT>atC	p.I177I		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CTCCATTCTGAATCAGGCCTG	0.547													a|||	1034	0.20647	0.2784	0.1513	5008	,	,		14313	0.2331		0.162	False		,,,				2504	0.1667					.											0								G		2642,1214		1289,64,575	61.0	67.0	65.0		531	1.6	0.4	6	dbSNP_131	65	5362,2452		2595,172,1140	no	coding-synonymous	HLA-DRB5	NM_002125.3		3884,236,1715	GG,GA,AA		31.3796,31.4834,31.4139		177/267	32487268	8004,3666	1928	3907	5835	SO:0001819	synonymous_variant	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.531T>C	6.37:g.32487268A>G				Silent	SNP	ENST00000374975.3	37	CCDS4751.1																																																																																				0.547	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
HLA-DRB1	3123	mdanderson.org	37	6	32552123	32552123	+	Missense_Mutation	SNP	G	G	A	rs17879702	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32552123G>A	ENST00000360004.5	-	2	238	c.133C>T	c.(133-135)Cat>Tat	p.H45Y		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	45	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TTGAAGAAATGACACTCCCTC	0.607										Multiple Myeloma(14;0.17)			G|||	483	0.0964457	0.0877	0.0893	5008	,	,		6110	0.1518		0.0666	False		,,,				2504	0.0869					.											0								G	TYR/HIS	269,3975		10,249,1863	17.0	17.0	17.0		133	0.5	0.9	6	dbSNP_124	17	223,8099		6,211,3944	yes	missense	HLA-DRB1	NM_002124.3	83	16,460,5807	AA,AG,GG		2.6796,6.3384,3.9153		45/267	32552123	492,12074	2122	4161	6283	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.133C>T	6.37:g.32552123G>A	ENSP00000353099:p.His45Tyr		P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	229	0.10485347985347986	47	0.09552845528455285	36	0.09944751381215469	90	0.15734265734265734	56	0.07387862796833773	.	10.85	1.465736	0.26335	0.063384	0.026796	ENSG00000196126	ENST00000360004	T	0.00305	8.18	3.52	0.466	0.16716	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	0.903373	0.09722	N	0.764256	T	0.00178	0.0005	L	0.45698	1.435	0.38322	P	0.05645	D	0.89917	1.0	D	0.91635	0.999	T	0.48198	-0.9056	9	0.56958	D	0.05	.	3.2704	0.06879	0.3419:0.2092:0.4489:0.0	rs17879702	45	P01911	2B1F_HUMAN	Y	45	ENSP00000353099:H45Y	ENSP00000353099:H45Y	H	-	1	0	HLA-DRB1	32660101	0.055000	0.20627	0.860000	0.33809	0.020000	0.10135	-0.022000	0.12480	0.246000	0.21394	0.453000	0.30009	CAT		0.607	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
HRC	3270	mdanderson.org	37	19	49657916	49657916	+	Silent	SNP	T	T	C	rs7409255		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:49657916T>C	ENST00000252825.4	-	1	765	c.579A>G	c.(577-579)gaA>gaG	p.E193E	HRC_ENST00000595625.1_Silent_p.E193E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	193	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcttcTCCTTCAT	0.557																																					Melanoma(37;75 1097 24567 25669 30645)	.											0													119.0	95.0	103.0					19																	49657916		2203	4300	6503	SO:0001819	synonymous_variant	3270				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.579A>G	19.37:g.49657916T>C			Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																				0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
HRC	3270	mdanderson.org	37	19	49657920	49657920	+	Missense_Mutation	SNP	C	C	T	rs200730671		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:49657920C>T	ENST00000252825.4	-	1	761	c.575G>A	c.(574-576)gGa>gAa	p.G192E	HRC_ENST00000595625.1_Missense_Mutation_p.G192E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	192	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		ctcctcttcTCCTTCATCATC	0.562																																					Melanoma(37;75 1097 24567 25669 30645)	.											0													124.0	98.0	107.0					19																	49657920		2203	4300	6503	SO:0001583	missense	3270				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.575G>A	19.37:g.49657920C>T	ENSP00000252825:p.Gly192Glu		Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.835792	0.00579	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.05717	3.4	2.59	-1.01	0.10169	.	.	.	.	.	T	0.02156	0.0067	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.46289	-0.9202	9	0.02654	T	1	4.5523	7.8184	0.29274	0.0:0.7009:0.0:0.2991	.	192	P23327	SRCH_HUMAN	E	192;162	ENSP00000252825:G192E	ENSP00000252825:G192E	G	-	2	0	HRC	54349732	0.005000	0.15991	0.001000	0.08648	0.082000	0.17680	-0.740000	0.04861	-0.145000	0.11294	-0.389000	0.06534	GGA		0.562	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
IL5RA	3568	mdanderson.org	37	3	3144422	3144422	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:3144422A>G	ENST00000446632.2	-	4	739	c.165T>C	c.(163-165)gaT>gaC	p.D55D	IL5RA_ENST00000256452.3_Silent_p.D55D|IL5RA_ENST00000430514.2_Silent_p.D55D|IL5RA_ENST00000438560.1_Silent_p.D55D|IL5RA_ENST00000311981.8_Silent_p.D55D|SNORA43_ENST00000517240.1_RNA|IL5RA_ENST00000383846.1_Silent_p.D55D|IL5RA_ENST00000418488.2_Silent_p.D55D|IL5RA_ENST00000445864.2_Silent_p.D55D|IL5RA_ENST00000456302.1_Silent_p.D55D	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	55	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		TTTGCTCTTGATCAGGATTTG	0.333																																					GBM(169;430 2801 24955 28528)	.											0													96.0	94.0	95.0					3																	3144422		2203	4300	6503	SO:0001819	synonymous_variant	3568			M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.165T>C	3.37:g.3144422A>G			B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Silent	SNP	ENST00000446632.2	37	CCDS2559.1																																																																																				0.333	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2		
ITPR1	3708	mdanderson.org	37	3	4856848	4856848	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:4856848A>G	ENST00000443694.2	+	56	7768	c.7768A>G	c.(7768-7770)Agg>Ggg	p.R2590G	ITPR1_ENST00000456211.2_Missense_Mutation_p.R2542G|ITPR1_ENST00000302640.8_Missense_Mutation_p.R2590G|AC018816.3_ENST00000449914.1_Intron|ITPR1_ENST00000357086.4_Missense_Mutation_p.R2557G|ITPR1_ENST00000463980.1_3'UTR|AC018816.3_ENST00000441894.1_Intron|ITPR1_ENST00000423119.2_Missense_Mutation_p.R2557G|ITPR1_ENST00000544951.1_Missense_Mutation_p.R568G|ITPR1_ENST00000354582.6_Missense_Mutation_p.R2590G|AC018816.3_ENST00000489771.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2605					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGCTGACCTGAGGAGTGAGAA	0.468																																						.											0													129.0	127.0	128.0					3																	4856848		2137	4272	6409	SO:0001583	missense	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7768A>G	3.37:g.4856848A>G	ENSP00000401671:p.Arg2590Gly		E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395866	0.83011	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.99329	-4.26;-4.28;-4.27;-4.27;-4.25;-5.75;-4.26	4.84	3.66	0.41972	.	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	H	0.96889	3.9	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	D	0.98406	1.0570	10	0.87932	D	0	.	11.591	0.50945	0.8503:0.1497:0.0:0.0	.	568;2605;2557	B7ZMI3;Q14643;G5E9P1	.;ITPR1_HUMAN;.	G	2605;2590;2590;2557;1051;2557;2542;568;2590	ENSP00000306253:R2590G;ENSP00000346595:R2590G;ENSP00000405934:R2557G;ENSP00000349597:R2557G;ENSP00000397885:R2542G;ENSP00000440564:R568G;ENSP00000401671:R2590G	ENSP00000306253:R2590G	R	+	1	2	ITPR1	4831848	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.213000	0.72194	0.666000	0.31087	0.383000	0.25322	AGG		0.468	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
IFT80	57560	mdanderson.org	37	3	160095234	160095234	+	Silent	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:160095234T>C	ENST00000326448.7	-	4	786	c.354A>G	c.(352-354)ggA>ggG	p.G118G	IFT80_ENST00000477495.1_5'UTR|IFT80_ENST00000483465.1_5'UTR|RP11-432B6.3_ENST00000483754.1_Intron|IFT80_ENST00000496589.1_5'UTR	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	118					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTAATGCTGTTCCTTCATAAT	0.313																																						.											0													118.0	110.0	113.0					3																	160095234		2202	4300	6502	SO:0001819	synonymous_variant	57560			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.354A>G	3.37:g.160095234T>C			B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Silent	SNP	ENST00000326448.7	37	CCDS3188.1																																																																																				0.313	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
JAG1	182	mdanderson.org	37	20	10621581	10621581	+	Splice_Site	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:10621581A>G	ENST00000254958.5	-	25	3564	c.3049T>C	c.(3049-3051)Tct>Cct	p.S1017P	JAG1_ENST00000423891.2_Splice_Site_p.S858P	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1017					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TCTTCAGCAGACTGGAAAAAC	0.408									Alagille Syndrome																													.											0													92.0	83.0	86.0					20																	10621581		2203	4300	6503	SO:0001630	splice_region_variant	182	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3049-1T>C	20.37:g.10621581A>G			A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527328	0.64860	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.87256	-2.22;-2.23	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.77280	0.4107	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.73129	-0.4080	10	0.62326	D	0.03	.	16.2009	0.82078	1.0:0.0:0.0:0.0	.	1017	P78504	JAG1_HUMAN	P	1017;858	ENSP00000254958:S1017P;ENSP00000389519:S858P	ENSP00000254958:S1017P	S	-	1	0	JAG1	10569581	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.915000	0.75770	2.235000	0.73313	0.533000	0.62120	TCT		0.408	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	Missense_Mutation
KIR3DX1	90011	mdanderson.org	37	19	55047076	55047076	+	Silent	SNP	G	G	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:55047076G>A	ENST00000335056.3	+	4	659	c.621G>A	c.(619-621)tcG>tcA	p.S207S	KIR3DX1_ENST00000482404.1_3'UTR			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	207						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		ATGAGTGGTCGGCTCCCAGTG	0.547																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)	.											0													73.0	75.0	74.0					19																	55047076		2186	4295	6481	SO:0001819	synonymous_variant	90011			BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.621G>A	19.37:g.55047076G>A			B7WNL0|Q8N0S4	RNA	SNP	ENST00000335056.3	37																																																																																					0.547	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000140800.2	NR_026716	
KRT6C	286887	mdanderson.org	37	12	52867105	52867105	+	Silent	SNP	G	G	A	rs1053684		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:52867105G>A	ENST00000252250.6	-	1	464	c.417C>T	c.(415-417)acC>acT	p.T139T		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	139	Head.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		TCTGGTTGACGGTGACCTCTT	0.637																																						.											0													51.0	34.0	41.0					12																	52867105		2149	3730	5879	SO:0001819	synonymous_variant	286887			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.417C>T	12.37:g.52867105G>A			A1L4L5|P48666|Q2TAZ9|Q7RTN9	Silent	SNP	ENST00000252250.6	37	CCDS8829.1																																																																																				0.637	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404976.1	NM_173086	
KRT6A	3853	mdanderson.org	37	12	52886556	52886556	+	Silent	SNP	G	G	A	rs1707768		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:52886556G>A	ENST00000330722.6	-	1	485	c.417C>T	c.(415-417)acC>acT	p.T139T		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	139	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCTGGTTGACGGTGACCTCTT	0.622																																						.											0													109.0	105.0	106.0					12																	52886556		2203	4300	6503	SO:0001819	synonymous_variant	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.417C>T	12.37:g.52886556G>A			A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Silent	SNP	ENST00000330722.6	37	CCDS41786.1																																																																																				0.622	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
KRT76	51350	mdanderson.org	37	12	53165930	53165930	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:53165930T>C	ENST00000332411.2	-	5	1138	c.1085A>G	c.(1084-1086)gAg>gGg	p.E362G		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	362	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGCAATCTCCTCATACTGGGC	0.567																																						.											0													93.0	81.0	85.0					12																	53165930		2203	4300	6503	SO:0001583	missense	51350			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1085A>G	12.37:g.53165930T>C	ENSP00000330101:p.Glu362Gly		B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375478	0.61735	.	.	ENSG00000185069	ENST00000332411	D	0.93133	-3.17	4.42	4.42	0.53409	Filament (1);	0.000000	0.44688	D	0.000427	D	0.97736	0.9257	H	0.97186	3.955	0.53005	D	0.99996	D	0.89917	1.0	D	0.79108	0.992	D	0.99004	1.0812	10	0.87932	D	0	.	14.3579	0.66750	0.0:0.0:0.0:1.0	.	362	Q01546	K22O_HUMAN	G	362	ENSP00000330101:E362G	ENSP00000330101:E362G	E	-	2	0	KRT76	51452197	1.000000	0.71417	0.969000	0.41365	0.186000	0.23388	8.037000	0.88933	1.942000	0.56320	0.379000	0.24179	GAG		0.567	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
LILRB1	10859	mdanderson.org	37	19	55148004	55148004	+	Missense_Mutation	SNP	A	A	T	rs200490901		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:55148004A>T	ENST00000396331.1	+	15	2064	c.1707A>T	c.(1705-1707)agA>agT	p.R569S	AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396332.4_Missense_Mutation_p.R570S|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000396315.1_Missense_Mutation_p.R571S|LILRB1_ENST00000434867.2_Missense_Mutation_p.R569S|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396327.3_Missense_Mutation_p.R570S|LILRB1_ENST00000427581.2_Missense_Mutation_p.R620S|LILRB1_ENST00000396317.1_Missense_Mutation_p.R553S|LILRB1_ENST00000324602.7_Missense_Mutation_p.R571S|LILRB1_ENST00000418536.2_Missense_Mutation_p.R553S|LILRB1_ENST00000396321.2_Missense_Mutation_p.R569S	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	569					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		AACACTCCAGACCTAGGAGAG	0.577										HNSCC(37;0.09)																												.											0													101.0	90.0	94.0					19																	55148004		2202	4299	6501	SO:0001583	missense	10859			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1707A>T	19.37:g.55148004A>T	ENSP00000379622:p.Arg569Ser		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	A	8.294	0.818367	0.16607	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00515	7.0;6.93;7.0;6.95;6.91;7.0;7.0;6.87;6.93;6.91	1.41	0.262	0.15597	.	.	.	.	.	T	0.00412	0.0013	L	0.49350	1.555	0.09310	N	1	B;B;B;B;B	0.17667	0.001;0.023;0.002;0.023;0.006	B;B;B;B;B	0.12156	0.001;0.007;0.003;0.007;0.005	T	0.41016	-0.9532	9	0.30854	T	0.27	.	3.3986	0.07315	0.6378:0.0:0.0:0.3622	.	553;571;570;570;569	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	S	569;553;569;570;571;569;570;620;553;571	ENSP00000379614:R569S;ENSP00000391514:R553S;ENSP00000379622:R569S;ENSP00000379618:R570S;ENSP00000315997:R571S;ENSP00000405243:R569S;ENSP00000379623:R570S;ENSP00000395004:R620S;ENSP00000379610:R553S;ENSP00000379608:R571S	ENSP00000315997:R571S	R	+	3	2	LILRB1	59839816	0.000000	0.05858	0.002000	0.10522	0.251000	0.25915	0.202000	0.17295	0.037000	0.15575	0.163000	0.16589	AGA		0.577	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
DDX53	168400	mdanderson.org	37	X	23020661	23020661	+	IGR	SNP	C	C	T	rs77968596		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:23020661C>T	ENST00000327968.5	+	0	2118				RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GTAAATGTTACGTGTTGGTTA	0.318																																						.											0																																										SO:0001628	intergenic_variant	0			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248		X.37:g.23020661C>T			Q0D2N2|Q6NVV4	RNA	SNP	ENST00000327968.5	37	CCDS35214.1																																																																																				0.318	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
LPAR4	2846	mdanderson.org	37	X	78010586	78010586	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:78010586A>G	ENST00000435339.3	+	2	606	c.220A>G	c.(220-222)Act>Gct	p.T74A		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	74					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						GAGAAGTGAGACTGCTATTTT	0.393																																						.											0													237.0	194.0	209.0					X																	78010586		2203	4300	6503	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.220A>G	X.37:g.78010586A>G	ENSP00000408205:p.Thr74Ala		B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	A	14.50	2.554702	0.45487	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.39787	1.06;1.06	3.97	3.97	0.46021	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	L	0.58583	1.82	0.46499	D	0.999075	D	0.89917	1.0	D	0.97110	1.0	T	0.50915	-0.8771	10	0.14252	T	0.57	.	11.0205	0.47715	1.0:0.0:0.0:0.0	.	74	Q99677	LPAR4_HUMAN	A	74	ENSP00000408205:T74A;ENSP00000362398:T74A	ENSP00000362398:T74A	T	+	1	0	LPAR4	77897242	1.000000	0.71417	0.980000	0.43619	0.985000	0.73830	8.627000	0.90974	1.471000	0.48121	0.345000	0.21793	ACT		0.393	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
MFN1	55669	mdanderson.org	37	3	179085853	179085853	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:179085853A>G	ENST00000471841.1	+	9	1063	c.937A>G	c.(937-939)Aga>Gga	p.R313G	MFN1_ENST00000263969.5_Missense_Mutation_p.R313G|MFN1_ENST00000280653.7_Missense_Mutation_p.R313G	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	313	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			ATTTCATGCAAGATTACAGGA	0.348																																						.											0													75.0	76.0	75.0					3																	179085853		2203	4299	6502	SO:0001583	missense	55669			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.937A>G	3.37:g.179085853A>G	ENSP00000420617:p.Arg313Gly		B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.885753	0.51908	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000474903	D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.71	5.34	4.14	0.48551	.	0.042672	0.85682	D	0.000000	D	0.97623	0.9221	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.995	D;P;P	0.83275	0.996;0.827;0.765	D	0.97606	1.0126	10	0.72032	D	0.01	-7.2796	11.8202	0.52235	0.7228:0.2772:0.0:0.0	.	313;341;313	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	G	313;313;313;313;176	ENSP00000420617:R313G;ENSP00000280653:R313G;ENSP00000263969:R313G;ENSP00000419926:R176G	ENSP00000263969:R313G	R	+	1	2	MFN1	180568547	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.269000	0.43346	0.914000	0.36822	0.528000	0.53228	AGA		0.348	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
MIR514A2	574517	mdanderson.org	37	X	146360823	146360823	+	RNA	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:146360823A>G	ENST00000385131.1	-	0	88				MIR514A1_ENST00000385133.1_RNA	NR_030239.1|NR_030240.1				microRNA 514a-2																		ATTATACATGATTGTCACTCT	0.423																																						.											0													71.0	63.0	65.0					X																	146360823		1565	3570	5135			574516					Xq27.3	2011-11-14	2011-11-14	2011-11-14	ENSG00000207866	ENSG00000207866		"""ncRNAs / Micro RNAs"""	32149	non-coding RNA	RNA, micro			"""microRNA 514-2"""	MIRN514-2, MIR514-2			Standard	NR_030239		Approved	hsa-mir-514-2	uc011mww.2				X.37:g.146360823A>G				RNA	SNP	ENST00000385131.1	37																																																																																					0.423	MIR514A2-201	KNOWN	basic	miRNA	miRNA		NR_030239	
MUC4	4585	mdanderson.org	37	3	195505907	195505907	+	Missense_Mutation	SNP	T	T	G	rs138720131		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:195505907T>G	ENST00000463781.3	-	2	13003	c.12544A>C	c.(12544-12546)Act>Cct	p.T4182P	MUC4_ENST00000475231.1_Missense_Mutation_p.T4182P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGCTGGTGACA	0.592																																						.											0													17.0	11.0	13.0					3																	195505907		675	1534	2209	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12544A>C	3.37:g.195505907T>G	ENSP00000417498:p.Thr4182Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	382	0.1749084249084249	89	0.18089430894308944	77	0.212707182320442	112	0.1958041958041958	104	0.13720316622691292	N	6.115	0.389548	0.11581	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.44;1.42	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.20196	N	0.999922	B	0.18013	0.025	B	0.17979	0.02	T	0.31336	-0.9947	7	.	.	.	.	4.5157	0.11934	0.0:0.0:0.3267:0.6733	.	4054	E7ESK3	.	P	4182	ENSP00000417498:T4182P;ENSP00000420243:T4182P	.	T	-	1	0	MUC4	196990686	0.000000	0.05858	0.038000	0.18304	0.018000	0.09664	-4.131000	0.00289	-2.142000	0.00804	-2.389000	0.00228	ACT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1016738	1016738	+	Silent	SNP	A	A	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr11:1016738A>T	ENST00000421673.2	-	31	6113	c.6063T>A	c.(6061-6063)acT>acA	p.T2021T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2021	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGACTGTGTGAGTACTTGGAG	0.552																																						.											0													703.0	637.0	659.0					11																	1016738		2202	4294	6496	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6063T>A	11.37:g.1016738A>T			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017467	1017467	+	Silent	SNP	G	G	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr11:1017467G>T	ENST00000421673.2	-	31	5384	c.5334C>A	c.(5332-5334)acC>acA	p.T1778T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1778	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGGGTTCTGGTGCCTGTAC	0.582																																						.											0													485.0	485.0	485.0					11																	1017467		2202	4293	6495	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5334C>A	11.37:g.1017467G>T			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYO5C	55930	mdanderson.org	37	15	52510728	52510728	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr15:52510728A>G	ENST00000261839.7	-	32	4103	c.3942T>C	c.(3940-3942)acT>acC	p.T1314T		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1314						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TGTTTTCCAAAGTGAGCCGGG	0.443																																						.											0													78.0	74.0	75.0					15																	52510728		1902	4118	6020	SO:0001819	synonymous_variant	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3942T>C	15.37:g.52510728A>G			Q6P1W8	Silent	SNP	ENST00000261839.7	37	CCDS42036.1																																																																																				0.443	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
NAALADL2	254827	mdanderson.org	37	3	175042057	175042057	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:175042057T>C	ENST00000454872.1	+	5	1161	c.1033T>C	c.(1033-1035)Ttc>Ctc	p.F345L	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	345						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CCATGATACCTTCATGGTGTC	0.423																																						.											0													189.0	185.0	186.0					3																	175042057		1905	4118	6023	SO:0001583	missense	254827				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1033T>C	3.37:g.175042057T>C	ENSP00000404705:p.Phe345Leu		Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.676734	0.67928	.	.	ENSG00000177694	ENST00000454872	T	0.39787	1.06	5.58	5.58	0.84498	.	0.081678	0.52532	D	0.000076	T	0.54532	0.1864	L	0.49126	1.545	0.34876	D	0.744096	D	0.69078	0.997	D	0.75020	0.985	T	0.57923	-0.7727	10	0.11794	T	0.64	-15.9193	14.3279	0.66532	0.0:0.0:0.0:1.0	.	345	Q58DX5	NADL2_HUMAN	L	345	ENSP00000404705:F345L	ENSP00000404705:F345L	F	+	1	0	NAALADL2	176524751	1.000000	0.71417	0.896000	0.35187	0.956000	0.61745	5.751000	0.68720	2.122000	0.65172	0.460000	0.39030	TTC		0.423	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
NBPF10	100132406	mdanderson.org	37	1	145368524	145368524	+	Missense_Mutation	SNP	A	A	T	rs111770733	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:145368524A>T	ENST00000369339.3	+	17	2109	c.1856A>T	c.(1855-1857)tAc>tTc	p.Y619F	NBPF10_ENST00000369338.1_Missense_Mutation_p.Y617F|NBPF10_ENST00000342960.5_Missense_Mutation_p.Y3501F			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	796	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGTCAATGTACTTTGAACTA	0.448													.|||	31	0.0061901	0.0159	0.0	5008	,	,		51851	0.001		0.002	False		,,,				2504	0.0072					.											0																																										SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.1856A>T	1.37:g.145368524A>T	ENSP00000358345:p.Tyr619Phe		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.	.	.	.	.	.	.	.	.	.	.	0.426	-0.905953	0.02453	.	.	ENSG00000163386	ENST00000369339;ENST00000369338;ENST00000342960	T;T	0.07327	3.2;3.2	0.732	-1.46	0.08800	.	.	.	.	.	T	0.02571	0.0078	M	0.70595	2.14	0.09310	N	1	B	0.14805	0.011	B	0.24006	0.05	T	0.45848	-0.9233	9	0.34782	T	0.22	.	1.3992	0.02267	0.3771:0.0:0.2897:0.3332	.	565	Q4VC10	.	F	621;617;3501	ENSP00000358344:Y617F;ENSP00000345684:Y3501F	ENSP00000345684:Y3501F	Y	+	2	0	NBPF10	144079881	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.188000	0.03064	-1.054000	0.03214	0.316000	0.21350	TAC		0.448	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
NEFH	4744	mdanderson.org	37	22	29885686	29885686	+	Missense_Mutation	SNP	C	C	A	rs200302220		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr22:29885686C>A	ENST00000310624.6	+	4	2090	c.2057C>A	c.(2056-2058)gCa>gAa	p.A686E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	692	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A686E(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAGTGAAGGCAGAAGCAAAG	0.562																																						.											1	Substitution - Missense(1)	endometrium(1)											86.0	90.0	89.0					22																	29885686		2203	4297	6500	SO:0001583	missense	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2057C>A	22.37:g.29885686C>A	ENSP00000311997:p.Ala686Glu		B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.972244	0.00048	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.81579	-1.51	4.35	0.981	0.19756	.	0.859378	0.09876	N	0.744254	T	0.55816	0.1944	N	0.04043	-0.29	0.18873	N	0.999989	B	0.20780	0.048	B	0.27715	0.082	T	0.45629	-0.9248	10	0.05436	T	0.98	.	6.9319	0.24445	0.6374:0.2859:0.0767:0.0	.	692	P12036	NFH_HUMAN	E	686	ENSP00000311997:A686E	ENSP00000311997:A686E	A	+	2	0	NEFH	28215686	0.010000	0.17322	0.020000	0.16555	0.035000	0.12851	0.923000	0.28757	0.003000	0.14656	-0.259000	0.10710	GCA		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
PABPC3	5042	mdanderson.org	37	13	25671925	25671925	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:25671925T>C	ENST00000281589.3	+	1	1626	c.1589T>C	c.(1588-1590)cTt>cCt	p.L530P		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	530					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ATGCAACAGCTTGCTGTTCAT	0.498																																						.											0													95.0	87.0	90.0					13																	25671925		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1589T>C	13.37:g.25671925T>C	ENSP00000281589:p.Leu530Pro		Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.288930	0.00248	.	.	ENSG00000151846	ENST00000281589	T	0.38077	1.16	0.875	0.875	0.19130	Polyadenylate-binding protein/Hyperplastic disc protein (1);	0.135210	0.32190	N	0.006446	T	0.05181	0.0138	N	0.00095	-2.16	0.31136	N	0.707216	B	0.02656	0.0	B	0.01281	0.0	T	0.37220	-0.9715	10	0.02654	T	1	.	5.2647	0.15593	0.0:0.7663:0.0:0.2337	.	530	Q9H361	PABP3_HUMAN	P	530	ENSP00000281589:L530P	ENSP00000281589:L530P	L	+	2	0	PABPC3	24569925	1.000000	0.71417	0.979000	0.43373	0.086000	0.17979	2.056000	0.41355	-0.049000	0.13379	-0.642000	0.03964	CTT		0.498	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PAK2	5062	mdanderson.org	37	3	196530022	196530022	+	Silent	SNP	C	C	T	rs115224945	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:196530022C>T	ENST00000327134.3	+	4	745	c.423C>T	c.(421-423)agC>agT	p.S141S		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	141					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AATATCTGAGCTTTACTCCTC	0.418																																						.											0													85.0	79.0	81.0					3																	196530022		2203	4300	6503	SO:0001819	synonymous_variant	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.423C>T	3.37:g.196530022C>T			Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																				0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PCMTD1	115294	mdanderson.org	37	8	52733037	52733037	+	Silent	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr8:52733037C>T	ENST00000360540.5	-	7	1354	c.948G>A	c.(946-948)gaG>gaA	p.E316E	PCMTD1_ENST00000522514.1_Silent_p.E316E|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Silent_p.E240E	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	316						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GAtctttttcctcctcttctt	0.393																																						.											0																																										SO:0001819	synonymous_variant	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.948G>A	8.37:g.52733037C>T			Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1																																																																																				0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PHTF2	57157	mdanderson.org	37	7	77569448	77569448	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:77569448A>G	ENST00000248550.7	+	13	1645	c.1569A>G	c.(1567-1569)acA>acG	p.T523T	PHTF2_ENST00000422959.2_Silent_p.T489T|PHTF2_ENST00000307305.8_Silent_p.T485T|PHTF2_ENST00000424760.1_Silent_p.T485T|PHTF2_ENST00000416283.2_Silent_p.T489T|PHTF2_ENST00000275575.7_Silent_p.T485T			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						CTCAAGCTACAGACTTGGAAC	0.368																																						.											0													110.0	101.0	104.0					7																	77569448		1860	4104	5964	SO:0001819	synonymous_variant	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1569A>G	7.37:g.77569448A>G			A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Silent	SNP	ENST00000248550.7	37																																																																																					0.368	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
PIP5K1C	23396	mdanderson.org	37	19	3656451	3656451	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:3656451C>T	ENST00000335312.3	-	6	661	c.573G>A	c.(571-573)atG>atA	p.M191I	PIP5K1C_ENST00000537021.1_Missense_Mutation_p.M191I|PIP5K1C_ENST00000589578.1_Missense_Mutation_p.M191I|PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.M191I	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	191	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCTCCTTGTGCATGACGGTCT	0.632																																					Esophageal Squamous(135;99 1744 12852 27186 39851)	.											0													80.0	81.0	81.0					19																	3656451		2203	4300	6503	SO:0001583	missense	23396			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.573G>A	19.37:g.3656451C>T	ENSP00000335333:p.Met191Ile		B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577761	0.65878	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.35236	1.32;1.32;1.32	4.22	4.22	0.49857	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.33265	0.0857	L	0.43152	1.355	0.54753	D	0.999988	B;B	0.24882	0.113;0.079	B;B	0.19391	0.025;0.017	T	0.29305	-1.0016	10	0.87932	D	0	-34.5769	15.9238	0.79597	0.0:1.0:0.0:0.0	.	191;191	O60331-3;O60331	.;PI51C_HUMAN	I	191	ENSP00000335333:M191I;ENSP00000445992:M191I;ENSP00000444779:M191I	ENSP00000335333:M191I	M	-	3	0	PIP5K1C	3607451	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.568000	0.82369	2.067000	0.61834	0.561000	0.74099	ATG		0.632	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
PRAMEF2	65122	mdanderson.org	37	1	12919552	12919552	+	Missense_Mutation	SNP	T	T	C	rs74056159		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:12919552T>C	ENST00000240189.2	+	3	379	c.292T>C	c.(292-294)Tgg>Cgg	p.W98R		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	98					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCACAGGAGGTGGAAACTTCA	0.517																																						.											0													76.0	93.0	88.0					1																	12919552		2189	4294	6483	SO:0001583	missense	65122				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.292T>C	1.37:g.12919552T>C	ENSP00000240189:p.Trp98Arg			Missense_Mutation	SNP	ENST00000240189.2	37	CCDS149.1	.	.	.	.	.	.	.	.	.	.	T	2.064	-0.414612	0.04766	.	.	ENSG00000120952	ENST00000240189	T	0.16597	2.33	0.842	-1.68	0.08212	.	0.789017	0.12038	N	0.505349	T	0.09642	0.0237	L	0.37697	1.125	0.09310	N	1	B	0.14805	0.011	B	0.18561	0.022	T	0.37934	-0.9684	10	0.22109	T	0.4	.	1.3967	0.02262	0.3312:0.2798:0.0:0.3889	.	98	O60811	PRAM2_HUMAN	R	98	ENSP00000240189:W98R	ENSP00000240189:W98R	W	+	1	0	PRAMEF2	12842139	0.000000	0.05858	0.024000	0.17045	0.040000	0.13550	-0.349000	0.07731	-0.932000	0.03742	0.163000	0.16589	TGG		0.517	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
PTPRH	5794	mdanderson.org	37	19	55716805	55716805	+	Missense_Mutation	SNP	G	G	A	rs200319382		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:55716805G>A	ENST00000376350.3	-	4	530	c.508C>T	c.(508-510)Cac>Tac	p.H170Y	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	170	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGTTAGTGTGTGCTGTGCTT	0.567													t|||	1	0.000199681	0.0	0.0	5008	,	,		19765	0.001		0.0	False		,,,				2504	0.0					.											0													162.0	144.0	150.0					19																	55716805		2203	4299	6502	SO:0001583	missense	5794				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.508C>T	19.37:g.55716805G>A	ENSP00000365528:p.His170Tyr		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	t	14.77	2.635065	0.47049	.	.	ENSG00000080031	ENST00000376350	T	0.57436	0.4	3.93	-1.55	0.08558	Fibronectin, type III (4);Immunoglobulin-like fold (1);	3.173960	0.01664	N	0.025272	T	0.37046	0.0989	N	0.14661	0.345	0.09310	N	1	B	0.31519	0.327	B	0.35607	0.206	T	0.21759	-1.0236	10	0.51188	T	0.08	.	4.2695	0.10780	0.0:0.3384:0.3199:0.3416	.	170	Q9HD43	PTPRH_HUMAN	Y	170	ENSP00000365528:H170Y	ENSP00000365528:H170Y	H	-	1	0	PTPRH	60408617	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.994000	0.00656	-0.644000	0.05465	-2.191000	0.00312	CAC		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
RAD52	5893	mdanderson.org	37	12	1023070	1023070	+	Silent	SNP	T	T	C	rs373361304		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:1023070T>C	ENST00000358495.3	-	11	1323	c.1185A>G	c.(1183-1185)caA>caG	p.Q395Q	RAD52_ENST00000430095.2_Silent_p.Q395Q|RAD52_ENST00000539046.1_Silent_p.Q318Q|RAD52_ENST00000535376.1_5'UTR	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	395					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			CTGTTGTGCGTTGGTCAGCGC	0.448								Homologous recombination																														.											0								T		1,3895		0,1,1947	162.0	143.0	149.0		1185	-0.1	0.0	12		149	0,8312		0,0,4156	no	coding-synonymous	RAD52	NM_134424.2		0,1,6103	CC,CT,TT		0.0,0.0257,0.0082		395/419	1023070	1,12207	1948	4156	6104	SO:0001819	synonymous_variant	5893				CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.1185A>G	12.37:g.1023070T>C			Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Silent	SNP	ENST00000358495.3	37	CCDS8507.2																																																																																				0.448	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	NM_134424	
RBMXL1	494115	mdanderson.org	37	1	89448812	89448812	+	Missense_Mutation	SNP	T	T	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:89448812T>G	ENST00000321792.5	-	2	1125	c.698A>C	c.(697-699)gAt>gCt	p.D233A	CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.D233A|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	233					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D233A(3)									TGGTGCATAATCTCTTGTATC	0.423																																						.											3	Substitution - Missense(3)	kidney(3)											205.0	178.0	187.0					1																	89448812		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.698A>C	1.37:g.89448812T>G	ENSP00000318415:p.Asp233Ala			Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084835	0.76642	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	D;D	0.83163	-1.69;-1.69	1.53	1.53	0.23141	.	0.000000	0.85682	D	0.000000	T	0.79100	0.4389	M	0.71036	2.16	0.46499	D	0.999078	D	0.59357	0.985	P	0.53102	0.718	T	0.78889	-0.2026	10	0.66056	D	0.02	.	6.8078	0.23786	0.0:0.0:0.0:1.0	.	233	Q96E39	RBMXL_HUMAN	A	233	ENSP00000318415:D233A;ENSP00000446099:D233A	ENSP00000318415:D233A	D	-	2	0	RBMXL1	89221400	1.000000	0.71417	0.996000	0.52242	0.787000	0.44495	5.062000	0.64326	0.706000	0.31912	0.254000	0.18369	GAT		0.423	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
RBMXL1	494115	mdanderson.org	37	1	89448817	89448817	+	Silent	SNP	T	T	A	rs569957521	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:89448817T>A	ENST00000321792.5	-	2	1120	c.693A>T	c.(691-693)acA>acT	p.T231T	CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000399794.2_Silent_p.T231T|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	231					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CATAATCTCTTGTATCACGAG	0.438													.|||	4	0.000798722	0.003	0.0	5008	,	,		22700	0.0		0.0	False		,,,				2504	0.0					.											0													204.0	178.0	187.0					1																	89448817		2203	4300	6503	SO:0001819	synonymous_variant	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.693A>T	1.37:g.89448817T>A				Silent	SNP	ENST00000321792.5	37	CCDS716.1																																																																																				0.438	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
RGAG4	340526	mdanderson.org	37	X	71350156	71350156	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:71350156T>C	ENST00000545866.1	-	1	1602	c.1235A>G	c.(1234-1236)aAc>aGc	p.N412S	RGAG4_ENST00000609883.1_Missense_Mutation_p.N412S|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	412										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CTCATTCTTGTTCCTTATctc	0.488																																						.											0													181.0	166.0	171.0					X																	71350156		2112	4196	6308	SO:0001583	missense	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1235A>G	X.37:g.71350156T>C	ENSP00000441366:p.Asn412Ser		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	T	9.642	1.139364	0.21205	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.13307	2.6;2.6	4.24	-5.78	0.02362	.	.	.	.	.	T	0.04543	0.0124	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.40421	-0.9564	8	.	.	.	.	3.4147	0.07372	0.1281:0.4348:0.1242:0.3129	.	412	Q5HYW3	RGAG4_HUMAN	S	412	ENSP00000441366:N412S;ENSP00000418667:N412S	.	N	-	2	0	RGAG4	71266881	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.051000	0.30417	-1.520000	0.01773	-0.438000	0.05819	AAC		0.488	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455	
RHPN2	85415	mdanderson.org	37	19	33493830	33493830	+	Silent	SNP	G	G	A	rs74453945	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:33493830G>A	ENST00000254260.3	-	8	872	c.837C>T	c.(835-837)ctC>ctT	p.L279L	RHPN2_ENST00000400226.4_Silent_p.L128L	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	279	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCATTTTGACGAGCACGCTGA	0.463																																						.											0													55.0	50.0	52.0					19																	33493830		2203	4300	6503	SO:0001819	synonymous_variant	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.837C>T	19.37:g.33493830G>A			B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	ENST00000254260.3	37	CCDS12427.1																																																																																				0.463	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
SIRPB1	10326	mdanderson.org	37	20	1585397	1585397	+	Intron	SNP	T	T	C	rs148754551	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:1585397T>C	ENST00000381605.4	-	1	141				SIRPB1_ENST00000279477.7_Missense_Mutation_p.T248A|SIRPB1_ENST00000381596.1_5'Flank|SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000568365.1_Missense_Mutation_p.T248A|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1						cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.T248A(5)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						CCTCGGATGGTCTCAGACAAG	0.627													t|||	2569	0.512979	0.6967	0.33	5008	,	,		3683	0.4435		0.4473	False		,,,				2504	0.5337					.											5	Substitution - Missense(5)	kidney(3)|prostate(2)											20.0	30.0	27.0					20																	1585397		375	895	1270	SO:0001627	intron_variant	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.76+15117A>G	20.37:g.1585397T>C			A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	757	0.3466117216117216	239	0.48577235772357724	97	0.26795580110497236	219	0.38286713286713286	202	0.26649076517150394	.	0.464	-0.887787	0.02511	.	.	ENSG00000101307	ENST00000279477	T	0.11930	2.73	2.24	-0.597	0.11653	.	.	.	.	.	T	0.00012	0.0000	N	0.20530	0.585	0.47778	P	4.809999999999537E-4	B	0.02656	0.0	B	0.06405	0.002	T	0.45483	-0.9258	8	0.13470	T	0.59	.	3.263	0.06855	0.2055:0.1485:0.0:0.646	.	248	Q5TFQ8	SIRBL_HUMAN	A	248	ENSP00000279477:T248A	ENSP00000279477:T248A	T	-	1	0	SIRPB1	1533397	0.001000	0.12720	0.631000	0.29282	0.161000	0.22273	-0.285000	0.08410	-0.814000	0.04352	-1.120000	0.02017	ACC		0.627	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
SIRPB1	10326	mdanderson.org	37	20	1585454	1585454	+	Intron	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:1585454C>T	ENST00000381605.4	-	1	141				SIRPB1_ENST00000279477.7_Missense_Mutation_p.V229M|SIRPB1_ENST00000381596.1_5'Flank|SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000568365.1_Missense_Mutation_p.V229M|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1						cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						ACGTGGGCCACCTCGCAGATG	0.617																																						.											0													27.0	27.0	27.0					20																	1585454		178	712	890	SO:0001627	intron_variant	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.76+15060G>A	20.37:g.1585454C>T			A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	17.10	3.303595	0.60305	.	.	ENSG00000101307	ENST00000279477	T	0.13538	2.58	2.24	2.24	0.28232	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42314	0.1197	H	0.96518	3.835	0.80722	D	1	D	0.67145	0.996	P	0.62382	0.901	T	0.51156	-0.8741	9	0.66056	D	0.02	.	7.9259	0.29874	0.0:1.0:0.0:0.0	.	229	Q5TFQ8	SIRBL_HUMAN	M	229	ENSP00000279477:V229M	ENSP00000279477:V229M	V	-	1	0	SIRPB1	1533454	0.730000	0.28100	0.997000	0.53966	0.345000	0.29048	0.345000	0.19979	1.232000	0.43678	0.195000	0.17529	GTG		0.617	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
SLC35G6	643664	mdanderson.org	37	17	7385751	7385751	+	Missense_Mutation	SNP	G	G	A	rs200897540		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr17:7385751G>A	ENST00000412468.2	+	2	563	c.448G>A	c.(448-450)Gag>Aag	p.E150K	ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	150	EamA 1.					integral component of membrane (GO:0016021)											CCTCTGCCTTGAGAGCCAGGG	0.592																																						.											0													188.0	178.0	182.0					17																	7385751		2203	4300	6503	SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.448G>A	17.37:g.7385751G>A	ENSP00000396523:p.Glu150Lys			Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420492	0.42918	.	.	ENSG00000181222	ENST00000412468	T	0.49432	0.78	4.33	3.36	0.38483	.	.	.	.	.	T	0.32941	0.0846	N	0.24115	0.695	0.29805	N	0.832132	B	0.10296	0.003	B	0.13407	0.009	T	0.23904	-1.0175	9	0.37606	T	0.19	-2.7213	9.5491	0.39299	0.1018:0.0:0.8982:0.0	.	150	P0C7Q6	S35G6_HUMAN	K	150	ENSP00000396523:E150K	ENSP00000396523:E150K	E	+	1	0	SLC35G6	7326475	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	2.253000	0.43205	0.961000	0.38030	0.563000	0.77884	GAG		0.592	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SLC35G6	643664	mdanderson.org	37	17	7385761	7385761	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr17:7385761G>T	ENST00000412468.2	+	2	573	c.458G>T	c.(457-459)gGt>gTt	p.G153V	ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	153	EamA 1.					integral component of membrane (GO:0016021)											GAGAGCCAGGGTCTCAGTGGC	0.597																																						.											0													189.0	180.0	183.0					17																	7385761		2203	4300	6503	SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.458G>T	17.37:g.7385761G>T	ENSP00000396523:p.Gly153Val			Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582392	0.28180	.	.	ENSG00000181222	ENST00000412468	T	0.50001	0.76	3.93	2.94	0.34122	.	.	.	.	.	T	0.31358	0.0794	N	0.24115	0.695	0.50467	D	0.999875	B	0.06786	0.001	B	0.08055	0.003	T	0.07328	-1.0778	9	0.33141	T	0.24	0.2674	9.8084	0.40808	0.1041:0.0:0.8959:0.0	.	153	P0C7Q6	S35G6_HUMAN	V	153	ENSP00000396523:G153V	ENSP00000396523:G153V	G	+	2	0	SLC35G6	7326485	0.948000	0.32251	1.000000	0.80357	0.984000	0.73092	1.064000	0.30579	0.949000	0.37715	0.563000	0.77884	GGT		0.597	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SPEN	23013	mdanderson.org	37	1	16203072	16203072	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:16203072C>A	ENST00000375759.3	+	3	984	c.780C>A	c.(778-780)agC>agA	p.S260R	SPEN_ENST00000471538.1_3'UTR	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	260	Arg-rich.|Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GACTGGCTAGCCAAGCATCTA	0.537																																						.											0													40.0	37.0	38.0					1																	16203072		2199	4294	6493	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.780C>A	1.37:g.16203072C>A	ENSP00000364912:p.Ser260Arg		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.90|12.90	2.076756|2.076756	0.36662|0.36662	.|.	.|.	ENSG00000065526|ENSG00000065526	ENST00000442985|ENST00000375759;ENST00000438066;ENST00000375753	.|T;T	.|0.35789	.|2.87;1.29	5.78|5.78	4.87|4.87	0.63330|0.63330	.|.	.|.	.|.	.|.	.|.	T|T	0.44767|0.44767	0.1309|0.1309	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.66196	.|0.942	T|T	0.47774|0.47774	-0.9091|-0.9091	5|9	.|0.62326	.|D	.|0.03	-11.3729|-11.3729	14.8667|14.8667	0.70422|0.70422	0.0:0.9311:0.0:0.0689|0.0:0.9311:0.0:0.0689	.|.	.|260	.|Q96T58	.|MINT_HUMAN	D|R	1|260;219;219	.|ENSP00000364912:S260R;ENSP00000388021:S219R	.|ENSP00000364906:S219R	A|S	+|+	2|3	0|2	SPEN|SPEN	16075659|16075659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.758000|0.758000	0.26447|0.26447	1.465000|1.465000	0.48006|0.48006	0.563000|0.563000	0.77884|0.77884	GCC|AGC		0.537	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SSX7	280658	mdanderson.org	37	X	52681937	52681937	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:52681937T>C	ENST00000298181.5	-	3	325	c.167A>G	c.(166-168)gAg>gGg	p.E56G		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	56	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					AGTCATGGCCTCATACTTTCT	0.408																																						.											0													141.0	110.0	120.0					X																	52681937		2203	4299	6502	SO:0001583	missense	280658			BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.167A>G	X.37:g.52681937T>C	ENSP00000298181:p.Glu56Gly			Missense_Mutation	SNP	ENST00000298181.5	37	CCDS14343.1	.	.	.	.	.	.	.	.	.	.	N	2.360	-0.346762	0.05208	.	.	ENSG00000187754	ENST00000298181	T	0.00808	5.67	0.56	-1.12	0.09808	Krueppel-associated box (2);Krueppel-associated box-related (1);	1.212960	0.06009	N	0.649154	T	0.00967	0.0032	L	0.35288	1.05	0.09310	N	1	B	0.16802	0.019	B	0.21151	0.033	T	0.48603	-0.9021	9	0.46703	T	0.11	.	.	.	.	.	56	Q7RTT5	SSX7_HUMAN	G	56	ENSP00000298181:E56G	ENSP00000298181:E56G	E	-	2	0	SSX7	52698662	0.131000	0.22433	0.000000	0.03702	0.011000	0.07611	0.641000	0.24720	-0.722000	0.04922	0.146000	0.16034	GAG		0.408	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358	
TAS2R43	259289	mdanderson.org	37	12	11244591	11244591	+	Missense_Mutation	SNP	C	C	A	rs73064968	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr12:11244591C>A	ENST00000531678.1	-	1	321	c.238G>T	c.(238-240)Gta>Tta	p.V80L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	80					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GTAGTTCTTACTTCTACACTA	0.388																																						.											0													51.0	44.0	46.0					12																	11244591		1913	3938	5851	SO:0001583	missense	259289			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.238G>T	12.37:g.11244591C>A	ENSP00000431719:p.Val80Leu		P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	1.743	-0.491269	0.04322	.	.	ENSG00000255374	ENST00000531678	T	0.33654	1.4	1.97	-0.554	0.11811	.	.	.	.	.	T	0.21962	0.0529	L	0.35542	1.07	0.80722	P	0.0	B	0.12630	0.006	B	0.17722	0.019	T	0.24941	-1.0146	8	0.27082	T	0.32	.	3.9175	0.09230	0.272:0.4604:0.2677:0.0	.	80	P59537	T2R43_HUMAN	L	80	ENSP00000431719:V80L	ENSP00000431719:V80L	V	-	1	0	TAS2R43	11135858	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.905000	0.04075	-0.319000	0.08652	0.184000	0.17185	GTA		0.388	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TAX1BP1	8887	mdanderson.org	37	7	27839640	27839640	+	Silent	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:27839640A>G	ENST00000396319.2	+	13	1783	c.1695A>G	c.(1693-1695)aaA>aaG	p.K565K	TAX1BP1_ENST00000543117.1_Silent_p.K565K|TAX1BP1_ENST00000433216.2_Silent_p.K408K|TAX1BP1_ENST00000409980.1_Silent_p.K565K|TAX1BP1_ENST00000265393.6_Silent_p.K565K	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	565					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			TGGAGCTGAAATGGAAAGAAC	0.289																																						.											0													92.0	88.0	89.0					7																	27839640		2203	4297	6500	SO:0001819	synonymous_variant	8887			U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1695A>G	7.37:g.27839640A>G			B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Silent	SNP	ENST00000396319.2	37	CCDS5415.1																																																																																				0.289	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
TGM1	7051	mdanderson.org	37	14	24730943	24730943	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr14:24730943T>C	ENST00000206765.6	-	3	589	c.466A>G	c.(466-468)Acc>Gcc	p.T156A	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	156					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GATTCATAGGTCCGGGACAGG	0.587																																						.											0													130.0	115.0	120.0					14																	24730943		2203	4300	6503	SO:0001583	missense	7051			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.466A>G	14.37:g.24730943T>C	ENSP00000206765:p.Thr156Ala		B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.285567	0.23478	.	.	ENSG00000092295	ENST00000206765	D	0.85484	-1.99	5.09	-0.61	0.11604	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.496526	0.22150	N	0.063938	T	0.54581	0.1867	N	0.00661	-1.28	0.48185	D	0.999601	B	0.02656	0.0	B	0.01281	0.0	T	0.20571	-1.0271	10	0.33940	T	0.23	-0.5356	6.6344	0.22875	0.0767:0.467:0.3411:0.1152	.	156	P22735	TGM1_HUMAN	A	156	ENSP00000206765:T156A	ENSP00000206765:T156A	T	-	1	0	TGM1	23800783	0.944000	0.32072	0.008000	0.14137	0.592000	0.36648	1.180000	0.32005	-0.465000	0.06953	-0.648000	0.03929	ACC		0.587	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
TECPR2	9895	mdanderson.org	37	14	102881076	102881076	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr14:102881076T>C	ENST00000359520.7	+	5	810	c.584T>C	c.(583-585)cTc>cCc	p.L195P	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Missense_Mutation_p.L195P	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	195					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						AGAAGTCTGCTCTTTTACACT	0.458																																						.											0													150.0	141.0	144.0					14																	102881076		2203	4300	6503	SO:0001583	missense	9895			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.584T>C	14.37:g.102881076T>C	ENSP00000352510:p.Leu195Pro		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117267	0.77323	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.01397	4.94	4.89	4.89	0.63831	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.09423	0.0232	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.991;0.999	T	0.00695	-1.1606	10	0.87932	D	0	.	14.5137	0.67804	0.0:0.0:0.0:1.0	.	195;195;195	B4DK51;A5PKY3;O15040	.;.;TCPR2_HUMAN	P	195	ENSP00000352510:L195P	ENSP00000352510:L195P	L	+	2	0	TECPR2	101950829	1.000000	0.71417	0.959000	0.39883	0.925000	0.55904	7.602000	0.82796	1.825000	0.53177	0.459000	0.35465	CTC		0.458	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
TLR3	7098	mdanderson.org	37	4	187004362	187004362	+	Silent	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:187004362T>C	ENST00000296795.3	+	4	1626	c.1522T>C	c.(1522-1524)Ttg>Ctg	p.L508L	TLR3_ENST00000504367.1_Silent_p.L231L	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	508					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TCTTCGTAACTTGACCATTCT	0.448																																						.											0													102.0	105.0	104.0					4																	187004362		2203	4300	6503	SO:0001819	synonymous_variant	7098			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1522T>C	4.37:g.187004362T>C			B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	37	CCDS3846.1																																																																																				0.448	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
TMEM14B	81853	mdanderson.org	37	6	10756712	10756712	+	Silent	SNP	C	C	T	rs143087269	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:10756712C>T	ENST00000379542.5	+	6	473	c.306C>T	c.(304-306)gcC>gcT	p.A102A	TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000491103.1_3'UTR|RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000473276.1_Missense_Mutation_p.R43C|TMEM14B_ENST00000379530.3_Silent_p.A68A	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B	102						integral component of membrane (GO:0016021)		p.A102A(2)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TGCTGATGGCCGCCAAAGTTG	0.383																																						.											2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)											153.0	131.0	138.0					6																	10756712		2203	4300	6503	SO:0001819	synonymous_variant	81853			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.306C>T	6.37:g.10756712C>T			Q5THN7|Q5THN8|Q96IX7|Q9BVN8	Silent	SNP	ENST00000379542.5	37	CCDS4515.1	.	.	.	.	.	.	.	.	.	.	C	9.245	1.039323	0.19669	.	.	ENSG00000137210	ENST00000473276	T	0.59083	0.29	3.75	-2.69	0.06022	.	.	.	.	.	T	0.50599	0.1625	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61763	-0.6996	6	0.87932	D	0	.	10.1452	0.42760	0.0:0.2374:0.0:0.7626	.	.	.	.	C	43	ENSP00000420580:R43C	ENSP00000420580:R43C	R	+	1	0	TMEM14B	10864698	0.990000	0.36364	0.985000	0.45067	0.897000	0.52465	-0.257000	0.08745	-0.525000	0.06391	-0.312000	0.09012	CGC		0.383	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039836.1	NM_030969	
TUBB8	347688	mdanderson.org	37	10	94011	94011	+	Silent	SNP	G	G	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr10:94011G>T	ENST00000309812.4	-	4	383	c.321C>A	c.(319-321)acC>acA	p.T107T	TUBB8_ENST00000447903.2_Silent_p.T35T|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_Missense_Mutation_p.P71Q	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	107					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CCGCGCCTTCGGTGTAGTGTC	0.597																																					Pancreas(192;2041 3010 9013 18103)	.											0													75.0	63.0	67.0					10																	94011		2203	4300	6503	SO:0001819	synonymous_variant	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.321C>A	10.37:g.94011G>T			Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	2.327	-0.354190	0.05173	.	.	ENSG00000173876	ENST00000309812;ENST00000332708	.	.	.	.	.	.	.	.	.	.	.	T	0.54983	0.1892	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56920	-0.7899	4	0.87932	D	0	.	4.0636	0.09849	0.0:1.0E-4:0.3593:0.6406	.	.	.	.	Q	115;71	.	ENSP00000311042:P115Q	P	-	2	0	RP11-631M21.2	84011	0.004000	0.15560	0.255000	0.24374	0.259000	0.26198	-3.168000	0.00574	-2.119000	0.00827	-2.245000	0.00285	CCG		0.597	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
UBP1	7342	mdanderson.org	37	3	33454243	33454243	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr3:33454243T>C	ENST00000283629.3	-	4	948	c.419A>G	c.(418-420)aAt>aGt	p.N140S	UBP1_ENST00000447368.2_Missense_Mutation_p.N140S|UBP1_ENST00000283628.5_Missense_Mutation_p.N140S|RNU7-110P_ENST00000516891.1_RNA	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	140					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TCCTGGGCGATTCCACTTCCA	0.438																																						.											0													275.0	238.0	251.0					3																	33454243		2203	4300	6503	SO:0001583	missense	7342			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.419A>G	3.37:g.33454243T>C	ENSP00000283629:p.Asn140Ser		Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.694091	0.30052	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	6.17	3.8	0.43715	CP2 transcription factor (1);	0.043738	0.85682	D	0.000000	T	0.07188	0.0182	N	0.11673	0.155	0.53688	D	0.999978	B;B	0.27971	0.196;0.001	B;B	0.23419	0.046;0.016	T	0.14839	-1.0458	10	0.02654	T	1	-24.3373	10.7985	0.46474	0.0:0.1286:0.0:0.8714	.	140;140	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	S	140	ENSP00000283629:N140S;ENSP00000395558:N140S;ENSP00000283628:N140S;ENSP00000401614:N140S	ENSP00000283628:N140S	N	-	2	0	UBP1	33429247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.292000	0.72725	1.163000	0.42636	0.533000	0.62120	AAT		0.438	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
UGT2B4	7363	mdanderson.org	37	4	70360910	70360910	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:70360910A>G	ENST00000305107.6	-	1	716	c.670T>C	c.(670-672)Ttc>Ctc	p.F224L	UGT2B4_ENST00000381096.3_Missense_Mutation_p.F88L|UGT2B4_ENST00000512583.1_Missense_Mutation_p.F224L|UGT2B4_ENST00000506580.1_Intron	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	224					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	AATATTTGGAACCAAAATTCA	0.338																																						.											0													62.0	62.0	62.0					4																	70360910		2188	4298	6486	SO:0001583	missense	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.670T>C	4.37:g.70360910A>G	ENSP00000305221:p.Phe224Leu		A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	A	8.544	0.874021	0.17395	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000381096	T;T;T	0.60548	0.18;0.18;0.18	2.4	1.23	0.21249	.	0.314649	0.25329	U	0.031448	T	0.55721	0.1938	M	0.66378	2.025	0.09310	N	1	B;B;B	0.25272	0.057;0.002;0.122	B;B;B	0.39152	0.057;0.041;0.292	T	0.51787	-0.8661	10	0.42905	T	0.14	.	5.3485	0.16022	0.837:0.0:0.163:0.0	.	88;224;224	A6NCP7;G5E9X8;P06133	.;.;UD2B4_HUMAN	L	224;224;88	ENSP00000421290:F224L;ENSP00000305221:F224L;ENSP00000370486:F88L	ENSP00000305221:F224L	F	-	1	0	UGT2B4	70395499	0.000000	0.05858	0.061000	0.19648	0.011000	0.07611	0.099000	0.15210	1.101000	0.41535	0.248000	0.18094	TTC		0.338	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
VTI1A	143187	mdanderson.org	37	10	114224340	114224340	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr10:114224340C>T	ENST00000393077.2	+	3	304	c.188C>T	c.(187-189)cCa>cTa	p.P63L	VTI1A_ENST00000432306.1_Missense_Mutation_p.P63L	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	63					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		CGAGAGATACCACCCCAAAGT	0.383			T	TCF7L2	colorectal																																	.		Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	0													117.0	108.0	111.0					10																	114224340		2203	4300	6503	SO:0001583	missense	143187			BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.188C>T	10.37:g.114224340C>T	ENSP00000376792:p.Pro63Leu		A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	ENST00000393077.2	37	CCDS7575.2	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839934	0.91117	.	.	ENSG00000151532	ENST00000393077;ENST00000432306	.	.	.	5.62	5.62	0.85841	t-SNARE (1);Vesicle transport v-SNARE, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79661	0.4484	M	0.78456	2.415	0.80722	D	1	P;D	0.59767	0.899;0.986	P;D	0.64144	0.834;0.922	T	0.81154	-0.1062	9	0.66056	D	0.02	-30.1432	19.6486	0.95791	0.0:1.0:0.0:0.0	.	63;63	Q5W0D7;Q96AJ9	.;VTI1A_HUMAN	L	63	.	ENSP00000376792:P63L	P	+	2	0	VTI1A	114214330	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.141000	0.77330	2.646000	0.89796	0.591000	0.81541	CCA		0.383	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2		
ZFP62	643836	mdanderson.org	37	5	180275830	180275830	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:180275830T>C	ENST00000502412.1	-	2	2722	c.2665A>G	c.(2665-2667)Aat>Gat	p.N889D	ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Missense_Mutation_p.N856D|ZFP62_ENST00000359141.6_Missense_Mutation_p.N829D	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	889					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAGGGCATTCCCTCCCTCA	0.453																																						.											0													87.0	74.0	78.0					5																	180275830		692	1591	2283	SO:0001583	missense	643836			AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2665A>G	5.37:g.180275830T>C	ENSP00000423820:p.Asn889Asp		B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Missense_Mutation	SNP	ENST00000502412.1	37	CCDS54955.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.292036	0.23564	.	.	ENSG00000196670	ENST00000512132;ENST00000359141;ENST00000502412;ENST00000405851	T;T;T	0.08008	3.16;3.18;3.14	4.56	3.41	0.39046	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.20074	N	0.999938	B	0.02656	0.0	B	0.01281	0.0	T	0.34453	-0.9828	9	0.62326	D	0.03	.	8.7343	0.34519	0.0:0.0911:0.0:0.9089	.	889	Q8NB50	ZFP62_HUMAN	D	856;829;889;487	ENSP00000426193:N856D;ENSP00000352053:N829D;ENSP00000423820:N889D	ENSP00000352053:N829D	N	-	1	0	ZFP62	180208436	0.554000	0.26522	0.702000	0.30337	0.225000	0.24961	2.852000	0.48310	1.077000	0.40990	0.460000	0.39030	AAT		0.453	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
ZMYM2	7750	mdanderson.org	37	13	20579236	20579236	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr13:20579236A>G	ENST00000382874.2	+	6	1346	c.1156A>G	c.(1156-1158)Acc>Gcc	p.T386A	ZMYM2_ENST00000382883.3_5'Flank|ZMYM2_ENST00000382871.2_Missense_Mutation_p.T386A|ZMYM2_ENST00000382869.3_Missense_Mutation_p.T386A|ZMYM2_ENST00000382881.3_Missense_Mutation_p.T299A	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AATGAAAGGAACCATTGTTGC	0.313																																						.											0													89.0	87.0	88.0					13																	20579236		1813	4065	5878	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.1156A>G	13.37:g.20579236A>G	ENSP00000372327:p.Thr386Ala		A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.030264	0.75504	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382881;ENST00000382874;ENST00000382871	T;T;T;T	0.18338	2.22;2.23;2.22;2.22	5.15	5.15	0.70609	TRASH (1);Zinc finger, MYM-type (1);	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	L	0.34521	1.04	0.80722	D	1	P;B	0.41498	0.752;0.423	P;B	0.51866	0.682;0.076	T	0.03231	-1.1058	10	0.17832	T	0.49	6.0766	14.9966	0.71436	1.0:0.0:0.0:0.0	.	386;299	Q9UBW7;Q9UBW7-2	ZMYM2_HUMAN;.	A	386;386;299;386;386	ENSP00000372322:T386A;ENSP00000372334:T299A;ENSP00000372327:T386A;ENSP00000372324:T386A	ENSP00000372322:T386A	T	+	1	0	ZMYM2	19477236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.850000	0.92190	1.928000	0.55862	0.482000	0.46254	ACC		0.313	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
ZNF141	7700	mdanderson.org	37	4	367169	367169	+	Missense_Mutation	SNP	G	G	A	rs145966198		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:367169G>A	ENST00000240499.7	+	4	1092	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	315					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						CAAATGTGAAGAATGTGGCAA	0.388																																						.											0																																										SO:0001583	missense	7700			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.943G>A	4.37:g.367169G>A	ENSP00000240499:p.Glu315Lys		Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327325	0.41197	.	.	ENSG00000131127	ENST00000240499	T	0.07327	3.2	1.24	1.24	0.21308	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13030	0.0316	L	0.42487	1.325	0.80722	P	0.0	P	0.39624	0.681	P	0.51833	0.681	T	0.18871	-1.0323	7	.	.	.	.	7.8922	0.29684	0.0:0.0:1.0:0.0	.	315	Q15928	ZN141_HUMAN	K	315	ENSP00000240499:E315K	.	E	+	1	0	ZNF141	357169	0.000000	0.05858	0.076000	0.20297	0.968000	0.65278	-0.068000	0.11561	0.591000	0.29711	0.313000	0.20887	GAA		0.388	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	mdanderson.org	37	4	367199	367199	+	Missense_Mutation	SNP	A	A	T	rs114931928		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:367199A>T	ENST00000240499.7	+	4	1122	c.973A>T	c.(973-975)Acc>Tcc	p.T325S	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	325					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						TAGGTCCACAACCCTTACTAA	0.383																																						.											0													56.0	62.0	60.0					4																	367199		2197	4296	6493	SO:0001583	missense	7700			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.973A>T	4.37:g.367199A>T	ENSP00000240499:p.Thr325Ser		Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	A	3.741	-0.053524	0.07362	.	.	ENSG00000131127	ENST00000240499	T	0.07216	3.21	1.24	-0.0286	0.13921	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03220	0.0094	N	0.04636	-0.2	0.09310	N	1	B	0.19200	0.034	B	0.22152	0.038	T	0.47995	-0.9073	8	.	.	.	.	4.1736	0.10341	0.7434:0.0:0.2566:0.0	.	325	Q15928	ZN141_HUMAN	S	325	ENSP00000240499:T325S	.	T	+	1	0	ZNF141	357199	0.000000	0.05858	0.216000	0.23742	0.983000	0.72400	-6.049000	0.00083	0.495000	0.27882	0.260000	0.18958	ACC		0.383	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	mdanderson.org	37	4	367201	367201	+	Silent	SNP	C	C	A	rs111394409		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:367201C>A	ENST00000240499.7	+	4	1124	c.975C>A	c.(973-975)acC>acA	p.T325T	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	325					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						GGTCCACAACCCTTACTAAAC	0.383																																						.											0													56.0	61.0	59.0					4																	367201		2198	4296	6494	SO:0001819	synonymous_variant	7700			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.975C>A	4.37:g.367201C>A			Q6DK07	Silent	SNP	ENST00000240499.7	37	CCDS33931.1																																																																																				0.383	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	mdanderson.org	37	4	367206	367206	+	Missense_Mutation	SNP	C	C	G	rs113884485		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:367206C>G	ENST00000240499.7	+	4	1129	c.980C>G	c.(979-981)aCt>aGt	p.T327S	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	327					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ACAACCCTTACTAAACATAAG	0.378																																						.											0													53.0	58.0	56.0					4																	367206		2200	4295	6495	SO:0001583	missense	7700			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.980C>G	4.37:g.367206C>G	ENSP00000240499:p.Thr327Ser		Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.468247	0.26335	.	.	ENSG00000131127	ENST00000240499	T	0.35973	1.28	1.24	0.227	0.15359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14700	0.0355	N	0.10733	0.035	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.27502	-1.0072	8	.	.	.	.	3.3488	0.07145	0.0:0.4599:0.0:0.5401	.	327	Q15928	ZN141_HUMAN	S	327	ENSP00000240499:T327S	.	T	+	2	0	ZNF141	357206	0.000000	0.05858	0.576000	0.28549	0.982000	0.71751	-2.477000	0.00985	0.591000	0.29711	0.313000	0.20887	ACT		0.378	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF845	91664	mdanderson.org	37	19	53856730	53856730	+	Silent	SNP	G	G	A	rs201351032	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr19:53856730G>A	ENST00000595091.1	+	5	3021	c.2802G>A	c.(2800-2802)aaG>aaA	p.K934K	ZNF845_ENST00000458035.1_Silent_p.K934K			Q96IR2	ZN845_HUMAN	zinc finger protein 845	934					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K934K(3)		endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TAATTCATAAGACAATTCATA	0.368													.|||	271	0.0541134	0.0507	0.0576	5008	,	,		22260	0.0456		0.0924	False		,,,				2504	0.0256					.											3	Substitution - coding silent(3)	kidney(3)																																								SO:0001819	synonymous_variant	91664			BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2802G>A	19.37:g.53856730G>A				Silent	SNP	ENST00000595091.1	37	CCDS46170.1																																																																																				0.368	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
C1orf177	163747	bcgsc.ca	37	1	55279488	55279488	+	Splice_Site	DEL	A	A	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr1:55279488delA	ENST00000371273.3	+	7	779	c.764delA	c.(763-765)aaa>aa	p.K257fs	C1orf177_ENST00000358193.3_Splice_Site_p.K257fs	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	257										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						TTTTCTTAGAAAAAAAAGCCC	0.418																																						.											0													49.0	56.0	54.0					1																	55279488		2203	4300	6503	SO:0001630	splice_region_variant	163747			AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.763-1A>-	1.37:g.55279488delA			B7WPL2|Q8N7Y9	Frame_Shift_Del	DEL	ENST00000371273.3	37	CCDS44153.1																																																																																				0.418	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607	Frame_Shift_Del
MUC6	4588	bcgsc.ca	37	11	1016809	1016809	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr11:1016809G>T	ENST00000421673.2	-	31	6042	c.5992C>A	c.(5992-5994)Cca>Aca	p.P1998T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1998	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGTGTGATGGGGTTGGATAG	0.537																																						.											0													1427.0	1415.0	1419.0					11																	1016809		2203	4298	6501	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5992C>A	11.37:g.1016809G>T	ENSP00000406861:p.Pro1998Thr		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	8.115	0.779667	0.16120	.	.	ENSG00000184956	ENST00000421673	T	0.16743	2.32	2.76	-1.01	0.10169	.	.	.	.	.	T	0.13372	0.0324	M	0.62723	1.935	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.43798	-0.9369	9	0.08381	T	0.77	.	6.0025	0.19529	0.0:0.1776:0.4618:0.3606	.	1998	Q6W4X9	MUC6_HUMAN	T	1998	ENSP00000406861:P1998T	ENSP00000406861:P1998T	P	-	1	0	MUC6	1006809	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-0.427000	0.06999	0.033000	0.15463	-0.864000	0.03007	CCA		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
DHX58	79132	bcgsc.ca	37	17	40263795	40263795	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr17:40263795T>C	ENST00000251642.3	-	3	338	c.116A>G	c.(115-117)aAg>aGg	p.K39R		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	39	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TAGGTGCCGCTTGGCCACATA	0.597																																						.											0													122.0	111.0	115.0					17																	40263795		2203	4300	6503	SO:0001583	missense	79132			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.116A>G	17.37:g.40263795T>C	ENSP00000251642:p.Lys39Arg		Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	37	CCDS11416.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.485758	0.26686	.	.	ENSG00000108771	ENST00000251642;ENST00000423748;ENST00000413196;ENST00000430773	T;T;T	0.35048	1.98;1.33;1.33	4.99	3.91	0.45181	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.108247	0.64402	D	0.000009	T	0.19366	0.0465	N	0.21240	0.645	0.32355	N	0.557916	B;B	0.14012	0.009;0.004	B;B	0.20955	0.032;0.014	T	0.16394	-1.0404	10	0.16896	T	0.51	-7.3343	3.4805	0.07601	0.1649:0.1754:0.0:0.6598	.	39;39	B7Z455;Q96C10	.;DHX58_HUMAN	R	39	ENSP00000251642:K39R;ENSP00000416389:K39R;ENSP00000404639:K39R	ENSP00000251642:K39R	K	-	2	0	DHX58	37517321	0.895000	0.30542	1.000000	0.80357	0.390000	0.30446	0.434000	0.21494	0.931000	0.37242	-0.624000	0.04008	AAG		0.597	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	NM_024119	
BBS5	129880	bcgsc.ca	37	2	170343593	170343593	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr2:170343593A>G	ENST00000295240.3	+	3	533	c.157A>G	c.(157-159)Aca>Gca	p.T53A	RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.T53A|BBS5_ENST00000554017.1_Missense_Mutation_p.T53A|BBS5_ENST00000392663.2_Missense_Mutation_p.T53A	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	53					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACTCTTGGTAACAAATTTAAG	0.343									Bardet-Biedl syndrome																													.											0													175.0	182.0	180.0					2																	170343593		2203	4300	6503	SO:0001583	missense	129880	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.157A>G	2.37:g.170343593A>G	ENSP00000295240:p.Thr53Ala		D3DPC3|Q6PKN0	Missense_Mutation	SNP	ENST00000295240.3	37	CCDS2233.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.734544	0.89482	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.91147	0.7212	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.985;0.996;0.998	D	0.92831	0.6280	10	0.87932	D	0	-16.5329	15.6945	0.77484	1.0:0.0:0.0:0.0	.	53;53;53	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	A	53	ENSP00000295240:T53A;ENSP00000452313:T53A;ENSP00000376431:T53A;ENSP00000424363:T53A	ENSP00000295240:T53A	T	+	1	0	BBS5;RP11-724O16.1	170051839	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.012000	0.93624	2.094000	0.63399	0.533000	0.62120	ACA		0.343	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384	
FRG1B	284802	bcgsc.ca	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																						.											2	Substitution - Missense(2)	endometrium(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA		0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																						.											0													56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu		A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT1	2195	bcgsc.ca	37	4	187584590	187584590	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr4:187584590delG	ENST00000441802.2	-	3	3652	c.3443delC	c.(3442-3444)accfs	p.T1148fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1148	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATTTTCCATGATTTCTGGGTA	0.418										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	.											0													178.0	170.0	173.0					4																	187584590		1897	4121	6018	SO:0001589	frameshift_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.3443delC	4.37:g.187584590delG	ENSP00000406229:p.Thr1148fs			Frame_Shift_Del	DEL	ENST00000441802.2	37	CCDS47177.1																																																																																				0.418	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
RAPGEF6	51735	bcgsc.ca	37	5	130788798	130788798	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:130788798A>G	ENST00000509018.1	-	21	3354	c.3149T>C	c.(3148-3150)gTt>gCt	p.V1050A	CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.V1100A|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.V1050A|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.V1055A|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.V1050A|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.V1050A|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.V765A	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1050	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CATTCGAACAACTTGGCGGAT	0.358																																					Melanoma(168;435 1955 13113 13877 23213)	.											0													107.0	107.0	107.0					5																	130788798		2203	4300	6503	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3149T>C	5.37:g.130788798A>G	ENSP00000421684:p.Val1050Ala		A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494322	0.85069	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000514667	T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48	4.94	4.94	0.65067	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.118660	0.56097	D	0.000032	T	0.42359	0.1199	M	0.62088	1.915	0.80722	D	1	P;B;P;B;P;P;B	0.48089	0.788;0.03;0.855;0.357;0.905;0.865;0.392	B;B;P;B;B;P;B	0.49561	0.289;0.038;0.615;0.142;0.405;0.61;0.201	T	0.44742	-0.9308	10	0.87932	D	0	.	14.8925	0.70620	1.0:0.0:0.0:0.0	.	1050;1050;1050;765;1100;1055;1050	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	A	1050;1055;1050;1050;1055;765;1050;1100	ENSP00000421684:V1050A;ENSP00000309298:V1055A;ENSP00000426081:V1050A;ENSP00000296859:V1050A;ENSP00000426910:V765A;ENSP00000311419:V1050A;ENSP00000426948:V1100A	ENSP00000426948:V1100A	V	-	2	0	RAPGEF6;FNIP1	130816697	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.335000	0.96500	1.991000	0.58162	0.383000	0.25322	GTT		0.358	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
RNF145	153830	bcgsc.ca	37	5	158630640	158630640	+	5'UTR	SNP	T	T	C	rs368977591		TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr5:158630640T>C	ENST00000424310.2	-	0	345				RNF145_ENST00000520638.1_Missense_Mutation_p.K10E|RNF145_ENST00000521606.2_Missense_Mutation_p.K13E|RNF145_ENST00000518802.1_Missense_Mutation_p.K26E|RNF145_ENST00000519865.1_5'UTR|RNF145_ENST00000274542.2_Missense_Mutation_p.K24E	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tttttttttttcttttttttt	0.368																																						.											0													33.0	36.0	35.0					5																	158630640		2203	4300	6503	SO:0001623	5_prime_UTR_variant	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-15A>G	5.37:g.158630640T>C			B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.071233	0.00379	.	.	ENSG00000145860	ENST00000274542;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000520638	T;T;T;T;T	0.77489	-1.09;-1.07;-1.07;-1.1;-1.06	1.66	0.33	0.15929	.	4.233800	0.00610	N	0.000418	T	0.52581	0.1743	N	0.08118	0	0.09310	N	0.999996	P;P;P;P;P	0.42584	0.784;0.544;0.544;0.544;0.673	B;B;B;B;B	0.28638	0.092;0.032;0.032;0.032;0.071	T	0.53711	-0.8400	10	0.41790	T	0.15	18.6048	3.7362	0.08511	0.0:0.2254:0.0:0.7746	.	12;13;10;26;24	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1-2	.;.;.;.;.	E	24;12;13;26;10	ENSP00000274542:K24E;ENSP00000430753:K12E;ENSP00000445115:K13E;ENSP00000430955:K26E;ENSP00000429071:K10E	ENSP00000274542:K24E	K	-	1	0	RNF145	158563218	0.030000	0.19436	0.002000	0.10522	0.002000	0.02628	0.517000	0.22832	-0.074000	0.12820	-1.322000	0.01289	AAA		0.368	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
HLA-DRB5	3127	bcgsc.ca	37	6	32489853	32489853	+	Missense_Mutation	SNP	A	A	C	rs78961241	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32489853A>C	ENST00000374975.3	-	2	261	c.199T>G	c.(199-201)Ttg>Gtg	p.L67V		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						TCGAAGCGCAAGTCCTCCTCT	0.577																																						.											0								C	VAL/LEU	2586,1204		1234,118,543	36.0	33.0	34.0		199	1.9	0.0	6	dbSNP_131	34	4829,2467		2224,381,1043	yes	missense	HLA-DRB5	NM_002125.3	32	3458,499,1586	CC,CA,AA		33.813,31.7678,33.1138	benign	67/267	32489853	7415,3671	1895	3648	5543	SO:0001583	missense	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.199T>G	6.37:g.32489853A>C	ENSP00000364114:p.Leu67Val			Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	1631	0.7467948717948718	319	0.6483739837398373	310	0.856353591160221	456	0.7972027972027972	546	0.7203166226912929	.	0.616	-0.823178	0.02755	0.682322	0.66187	ENSG00000198502	ENST00000374975	T	0.00291	8.27	4.81	1.93	0.25924	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	1.770390	0.03508	N	0.219068	T	0.00012	0.0000	N	0.01096	-1.015	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.10520	-1.0626	9	0.02654	T	1	.	4.8505	0.13535	0.1413:0.505:0.2738:0.08	rs1059580;rs1064668;rs2308797;rs3200314;rs3205648	67	Q30154	DRB5_HUMAN	V	67	ENSP00000364114:L67V	ENSP00000364114:L67V	L	-	1	2	HLA-DRB5	32597831	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-1.699000	0.01906	-0.141000	0.11374	-0.464000	0.05259	TTG		0.577	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
HLA-DRB1	3123	bcgsc.ca	37	6	32551999	32551999	+	Missense_Mutation	SNP	T	T	C	rs17885129	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32551999T>C	ENST00000360004.5	-	2	362	c.257A>G	c.(256-258)gAc>gGc	p.D86G		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	86	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GTACTCAGCGTCAGGCCGCCC	0.627										Multiple Myeloma(14;0.17)																												.											0													38.0	41.0	40.0					6																	32551999		2192	4284	6476	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.257A>G	6.37:g.32551999T>C	ENSP00000353099:p.Asp86Gly		P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	11.82	1.752417	0.31046	.	.	ENSG00000196126	ENST00000360004	T	0.00269	8.37	3.52	-7.04	0.01578	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	11.458300	0.00979	N	0.003354	T	0.00109	0.0003	M	0.93763	3.455	0.09310	N	1	B	0.19935	0.04	B	0.31245	0.126	T	0.41106	-0.9527	10	0.72032	D	0.01	.	2.7835	0.05367	0.4374:0.0858:0.3314:0.1454	rs17885129;rs28724093;rs34095932	86	P01911	2B1F_HUMAN	G	86	ENSP00000353099:D86G	ENSP00000353099:D86G	D	-	2	0	HLA-DRB1	32659977	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.520000	0.00221	-1.648000	0.01510	-0.554000	0.04202	GAC		0.627	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
HLA-DQA1	3117	bcgsc.ca	37	6	32609299	32609299	+	Missense_Mutation	SNP	A	A	C	rs199556640|rs371894400|rs1064944	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32609299A>C	ENST00000343139.5	+	2	397	c.295A>C	c.(295-297)Atg>Ctg	p.M99L	HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.M99L|HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.M99L	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	98	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						CTTGAACATCATGATTAAACG	0.478																																						.											0								C	LEU/MET	392,3666		82,228,1719	95.0	82.0	86.0		295	-7.9	0.0	6	dbSNP_86	86	635,6861		87,461,3200	yes	missense	HLA-DQA1	NM_002122.3	15	169,689,4919	CC,CA,AA		8.4712,9.6599,8.8887	benign	99/256	32609299	1027,10527	2029	3748	5777	SO:0001583	missense	3117				CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.295A>C	6.37:g.32609299A>C	ENSP00000339398:p.Met99Leu		O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.630061	0.00115	0.096599	0.084712	ENSG00000196735	ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949	T;T;T;T	0.00628	6.11;6.11;6.11;6.11	3.97	-7.95	0.01148	.	1.376450	0.04709	N	0.417235	T	0.00039	0.0001	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.42292	-0.9460	10	0.02654	T	1	.	0.8881	0.01249	0.3982:0.2011:0.1237:0.2771	rs1064944;rs1064945;rs1142336;rs3188083;rs3205995;rs12722087;rs17405576;rs17415903;rs28383452	105;99	Q59F33;G4XQK2	.;.	L	99	ENSP00000339398:M99L;ENSP00000378767:M99L;ENSP00000437302:M99L;ENSP00000364087:M99L	ENSP00000339398:M99L	M	+	1	0	HLA-DQA1	32717277	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-13.284000	0.00001	-6.444000	0.00004	-0.922000	0.02736	ATG		0.478	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
HLA-DQA1	3117	bcgsc.ca	37	6	32609312	32609312	+	Missense_Mutation	SNP	A	A	C	rs1129808	byFrequency	TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr6:32609312A>C	ENST00000343139.5	+	2	410	c.308A>C	c.(307-309)tAc>tCc	p.Y103S	HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.Y103S|HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.Y103S	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	102	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						ATTAAACGCTACAACTCTACC	0.468													.|||	2180	0.435304	0.3873	0.6153	5008	,	,		11385	0.4147		0.501	False		,,,				2504	0.3262					.											0								C	SER/TYR	808,3428		291,226,1601	83.0	69.0	74.0		308	3.1	0.2	6	dbSNP_86	74	1870,6184		638,594,2795	yes	missense	HLA-DQA1	NM_002122.3	144	929,820,4396	CC,CA,AA		23.2183,19.0746,21.7901	benign	103/256	32609312	2678,9612	2118	4027	6145	SO:0001583	missense	3117				CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.308A>C	6.37:g.32609312A>C	ENSP00000339398:p.Tyr103Ser		O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	998|998	0.45695970695970695|0.45695970695970695	166|166	0.33739837398373984|0.33739837398373984	207|207	0.5718232044198895|0.5718232044198895	275|275	0.4807692307692308|0.4807692307692308	350|350	0.46174142480211083|0.46174142480211083	.|.	0.041|0.041	-1.285527|-1.285527	0.01387|0.01387	0.190746|0.190746	0.232183|0.232183	ENSG00000196735|ENSG00000196735	ENST00000486548|ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949	.|T;T;T;T	.|0.00644	.|6.01;6.01;6.01;6.01	3.97|3.97	3.11|3.11	0.35812|0.35812	.|.	.|0.418357	.|0.24189	.|N	.|0.040724	T|T	0.00073|0.00073	0.0002|0.0002	N|N	0.00092|0.00092	-2.175|-2.175	0.35002|0.35002	P|P	0.24390500000000004|0.24390500000000004	.|B;B	.|0.15141	.|0.012;0.0	.|B;B	.|0.22880	.|0.042;0.003	T|T	0.13255|0.13255	-1.0516|-1.0516	4|9	.|0.02654	.|T	.|1	.|.	12.6013|12.6013	0.56499|0.56499	0.1821:0.8179:0.0:0.0|0.1821:0.8179:0.0:0.0	rs1129808;rs1142337;rs3188091;rs3205997;rs9272711;rs12722088;rs17415910;rs36218703|rs1129808;rs1142337;rs3188091;rs3205997;rs9272711;rs12722088;rs17415910;rs36218703	.|109;103	.|Q59F33;G4XQK2	.|.;.	P|S	76|103	.|ENSP00000339398:Y103S;ENSP00000378767:Y103S;ENSP00000437302:Y103S;ENSP00000364087:Y103S	.|ENSP00000339398:Y103S	T|Y	+|+	1|2	0|0	HLA-DQA1|HLA-DQA1	32717290|32717290	0.051000|0.051000	0.20477|0.20477	0.243000|0.243000	0.24186|0.24186	0.024000|0.024000	0.10985|0.10985	-0.092000|-0.092000	0.11129|0.11129	0.478000|0.478000	0.27488|0.27488	-0.922000|-0.922000	0.02736|0.02736	ACA|TAC		0.468	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
FLNC	2318	bcgsc.ca	37	7	128477551	128477551	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr7:128477551C>T	ENST00000325888.8	+	4	1060	c.799C>T	c.(799-801)Cct>Tct	p.P267S	FLNC_ENST00000346177.6_Missense_Mutation_p.P267S	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	267					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						ACCTGGTGCCCCTGTTCGATC	0.592																																						.											0													132.0	143.0	139.0					7																	128477551		2172	4295	6467	SO:0001583	missense	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.799C>T	7.37:g.128477551C>T	ENSP00000327145:p.Pro267Ser		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187648	0.78789	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.87491	-2.26;-2.24	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.89287	0.6672	M	0.84082	2.675	0.58432	D	0.999999	P;P	0.42827	0.477;0.791	B;B	0.41374	0.107;0.355	D	0.91376	0.5123	10	0.87932	D	0	.	17.7208	0.88350	0.0:1.0:0.0:0.0	.	267;267	Q14315-2;Q14315	.;FLNC_HUMAN	S	267	ENSP00000327145:P267S;ENSP00000344002:P267S	ENSP00000327145:P267S	P	+	1	0	FLNC	128264787	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.818000	0.86416	2.431000	0.82371	0.655000	0.94253	CCT		0.592	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
DNM1	1759	bcgsc.ca	37	9	130984588	130984588	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chr9:130984588A>G	ENST00000372923.3	+	7	1054	c.962A>G	c.(961-963)gAc>gGc	p.D321G	DNM1_ENST00000393594.3_Missense_Mutation_p.D321G|DNM1_ENST00000475805.1_Missense_Mutation_p.D321G|DNM1_ENST00000341179.7_Missense_Mutation_p.D321G|DNM1_ENST00000486160.1_Missense_Mutation_p.D321G	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	321					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CGCCCTGATGACCCAGCTCGC	0.622																																					GBM(113;146 1575 2722 28670 29921)	.											0													69.0	66.0	67.0					9																	130984588		2203	4300	6503	SO:0001583	missense	1759			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.962A>G	9.37:g.130984588A>G	ENSP00000362014:p.Asp321Gly		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293179	0.80914	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	5.93	5.93	0.95920	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	M	0.64080	1.96	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.997;0.997	T	0.81473	-0.0917	10	0.27082	T	0.32	-4.3692	16.3817	0.83467	1.0:0.0:0.0:0.0	.	321;321;321	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	G	321;321;321;316;321;321	ENSP00000419225:D321G;ENSP00000345680:D321G;ENSP00000362014:D321G;ENSP00000377219:D321G;ENSP00000420045:D321G	ENSP00000345680:D321G	D	+	2	0	DNM1	130024409	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.339000	0.96797	2.276000	0.75962	0.454000	0.30748	GAC		0.622	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
MT-CYB	4519	bcgsc.ca	37	M	14895	14895	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrM:14895T>C	ENST00000361789.2	+	1	149	c.149T>C	c.(148-150)tTc>tCc	p.F50S	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	50					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CACAGGACTATTCCTAGCCAT	0.517																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.149T>C	M.37:g.14895T>C	ENSP00000354554:p.Phe50Ser		Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																					0.517	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
ATP6AP1	537	bcgsc.ca	37	X	153662710	153662746	+	Frame_Shift_Del	DEL	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	-			TCGA-KN-8436-01A-11D-2310-10	TCGA-KN-8436-11A-01D-2311-10	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	CCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f150a5ed-a759-488c-8e9f-ef78b544382a	eebc909a-ec85-460b-8c31-fa959090bf28	g.chrX:153662710_153662746delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	ENST00000369762.2	+	7	902_938	c.841_877delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	c.(841-879)ccagtgggaggacctgactcccctcacctttggggtgagfs	p.PVGGPDSPHLWGE281fs	GDI1_ENST00000447750.2_5'Flank	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	281					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.L288R(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTACAAGGACCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTGCAGGAACTCAA	0.574																																						.											1	Substitution - Missense(1)	ovary(1)																																								SO:0001589	frameshift_variant	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.841_877delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	X.37:g.153662710_153662746delCCAGTGGGAGGACCTGACTCCCCTCACCTTTGGGGTG	ENSP00000358777:p.Pro281fs		A6ZKI4|Q8NBT4|Q9H0C7	Frame_Shift_Del	DEL	ENST00000369762.2	37	CCDS35451.1																																																																																				0.574	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183	
