#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLK	9748	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	105727558	105727558	+	Missense_Mutation	SNP	A	A	C	rs137997569		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr10:105727558A>C	ENST00000369755.3	+	1	600	c.55A>C	c.(55-57)Aag>Cag	p.K19Q	SLK_ENST00000335753.4_Missense_Mutation_p.K19Q	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	19	Poly-Lys.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GAAGAAGAAGAAGCAGTACGA	0.458													A|||	1	0.000199681	0.0	0.0014	5008	,	,		14767	0.0		0.0	False		,,,				2504	0.0				NSCLC(111;540 1651 1927 4474 17706)	.											0								A	GLN/LYS	1,4405	2.1+/-5.4	0,1,2202	129.0	137.0	134.0		55	4.6	1.0	10	dbSNP_134	134	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLK	NM_014720.2	53	0,3,6500	CC,CA,AA		0.0233,0.0227,0.0231	probably-damaging	19/1236	105727558	3,13003	2203	4300	6503	SO:0001583	missense	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.55A>C	10.37:g.105727558A>C	ENSP00000358770:p.Lys19Gln		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	A	31	5.085324	0.94100	2.27E-4	2.33E-4	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.71222	-0.55;-0.55	4.57	4.57	0.56435	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81973	0.4936	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.991	D	0.84148	0.0421	10	0.72032	D	0.01	.	13.9341	0.64015	1.0:0.0:0.0:0.0	.	19;19	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	Q	19	ENSP00000336824:K19Q;ENSP00000358770:K19Q	ENSP00000336824:K19Q	K	+	1	0	SLK	105717548	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.916000	0.92745	1.690000	0.51089	0.260000	0.18958	AAG		0.458	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720	
CLECL1	160365	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	9885606	9885606	+	Silent	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr12:9885606G>A	ENST00000327839.3	-	1	289	c.255C>T	c.(253-255)taC>taT	p.Y85Y		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						TGATGTCAGCGTAGACTACAT	0.428																																						.											0													81.0	83.0	82.0					12																	9885606		2203	4300	6503	SO:0001819	synonymous_variant	160365			AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.255C>T	12.37:g.9885606G>A				Silent	SNP	ENST00000327839.3	37	CCDS8603.1	.	.	.	.	.	.	.	.	.	.	G	3.107	-0.183527	0.06340	.	.	ENSG00000184293	ENST00000542530	.	.	.	1.99	0.826	0.18829	.	.	.	.	.	T	0.23806	0.0576	.	.	.	0.23150	N	0.99822	.	.	.	.	.	.	T	0.23762	-1.0179	4	.	.	.	.	3.7836	0.08690	0.8053:0.0:0.1947:0.0	.	.	.	.	M	37	.	.	T	-	2	0	CLECL1	9776873	0.623000	0.27094	0.135000	0.22099	0.139000	0.21198	0.228000	0.17814	0.226000	0.20979	-0.255000	0.11280	ACG		0.428	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
MAGEL2	54551	hgsc.bcm.edu	37	15	23890897	23890897	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:23890897G>T	ENST00000532292.1	-	1	278	c.184C>A	c.(184-186)Ccc>Acc	p.P62T		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GCCTGCTGGGGGGGTAGCTGG	0.701																																						.											0													6.0	8.0	7.0					15																	23890897		1843	4012	5855	SO:0001583	missense	54551			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.184C>A	15.37:g.23890897G>T	ENSP00000433433:p.Pro62Thr			Missense_Mutation	SNP	ENST00000532292.1	37																																																																																					0.701	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr17:7578208T>A	ENST00000269305.4	-	6	830	c.641A>T	c.(640-642)cAt>cTt	p.H214L	TP53_ENST00000420246.2_Missense_Mutation_p.H214L|TP53_ENST00000455263.2_Missense_Mutation_p.H214L|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.H214L|TP53_ENST00000359597.4_Missense_Mutation_p.H214L|TP53_ENST00000445888.2_Missense_Mutation_p.H214L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	214	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H214R(61)|p.0?(8)|p.?(5)|p.H82R(4)|p.H214fs*33(4)|p.H121R(4)|p.H214fs*5(2)|p.D208fs*1(1)|p.H82fs*>9(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.H121fs*33(1)|p.T211_S215delTFRHS(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCACACTATGTCGAAAAGT	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	98	Substitution - Missense(69)|Deletion - Frameshift(12)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(3)|Complex - deletion inframe(1)	lung(27)|liver(12)|ovary(8)|biliary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|central_nervous_system(5)|large_intestine(5)|urinary_tract(5)|prostate(4)|bone(4)|stomach(3)|breast(3)|haematopoietic_and_lymphoid_tissue(2)|soft_tissue(1)|skin(1)|pancreas(1)											127.0	114.0	119.0					17																	7578208		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.641A>T	17.37:g.7578208T>A	ENSP00000269305:p.His214Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	37	6.001408	0.97189	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.052737	0.85682	D	0.000000	D	0.99518	0.9828	L	0.45228	1.405	0.80722	D	1	D;D;B;D;D;D;D	0.89917	1.0;0.996;0.176;0.999;0.997;0.997;0.999	D;D;B;D;D;D;D	0.79108	0.992;0.981;0.088;0.99;0.982;0.989;0.98	D	0.97889	1.0296	10	0.87932	D	0	-26.1151	13.4753	0.61306	0.0:0.0:0.0:1.0	.	175;214;214;121;214;214;214	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	214;214;214;214;214;214;203;121;82;121;82	ENSP00000410739:H214L;ENSP00000352610:H214L;ENSP00000269305:H214L;ENSP00000398846:H214L;ENSP00000391127:H214L;ENSP00000391478:H214L;ENSP00000425104:H82L;ENSP00000423862:H121L	ENSP00000269305:H214L	H	-	2	0	TP53	7518933	1.000000	0.71417	0.283000	0.24790	0.961000	0.63080	7.996000	0.88334	2.128000	0.65567	0.460000	0.39030	CAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
OR10H2	26538	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	15839010	15839010	+	Missense_Mutation	SNP	C	C	T	rs373719619		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr19:15839010C>T	ENST00000305899.3	+	1	177	c.157C>T	c.(157-159)Cgc>Tgc	p.R53C		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CTGGAGCGAGCGCAGCCTCCA	0.612																																						.											0													197.0	159.0	172.0					19																	15839010		2203	4300	6503	SO:0001583	missense	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.157C>T	19.37:g.15839010C>T	ENSP00000306095:p.Arg53Cys		Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	12.82	2.052310	0.36181	.	.	ENSG00000171942	ENST00000305899	T	0.01084	5.36	2.88	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.270198	0.26563	N	0.023673	T	0.01523	0.0049	M	0.64630	1.985	0.34217	D	0.674979	B	0.22983	0.078	B	0.15870	0.014	T	0.20140	-1.0284	10	0.56958	D	0.05	.	5.6424	0.17571	0.0:0.8456:0.0:0.1544	.	53	O60403	O10H2_HUMAN	C	53	ENSP00000306095:R53C	ENSP00000306095:R53C	R	+	1	0	OR10H2	15700010	0.000000	0.05858	0.919000	0.36401	0.801000	0.45260	-0.657000	0.05335	1.446000	0.47643	0.537000	0.68136	CGC		0.612	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
ZNF528	84436	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	52919685	52919685	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr19:52919685G>T	ENST00000360465.3	+	7	2006	c.1580G>T	c.(1579-1581)gGc>gTc	p.G527V	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AATCAATGTGGCAAGGTCTTT	0.393																																						.											0													69.0	64.0	66.0					19																	52919685		2203	4300	6503	SO:0001583	missense	84436			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1580G>T	19.37:g.52919685G>T	ENSP00000353652:p.Gly527Val		B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	37	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	G	8.697	0.908812	0.17833	.	.	ENSG00000167555	ENST00000360465	T	0.23754	1.89	1.94	0.84	0.18912	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53690	0.1812	H	0.94462	3.54	0.42832	D	0.994028	D	0.76494	0.999	D	0.65140	0.932	T	0.57100	-0.7869	9	0.87932	D	0	.	7.3395	0.26630	0.1512:0.0:0.8488:0.0	.	527	Q3MIS6	ZN528_HUMAN	V	527	ENSP00000353652:G527V	ENSP00000353652:G527V	G	+	2	0	ZNF528	57611497	0.982000	0.34865	0.063000	0.19743	0.026000	0.11368	1.708000	0.37899	0.140000	0.18849	-0.262000	0.10625	GGC		0.393	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
TGM3	7053	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	20	2306576	2306576	+	Silent	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr20:2306576T>C	ENST00000381458.5	+	8	1128	c.1065T>C	c.(1063-1065)gcT>gcC	p.A355A	TGM3_ENST00000463090.1_3'UTR	NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	355					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	TGTTGGATGCTACCCCGCAGG	0.522																																						.											0													122.0	80.0	94.0					20																	2306576		2202	4299	6501	SO:0001819	synonymous_variant	7053			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1065T>C	20.37:g.2306576T>C			A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Silent	SNP	ENST00000381458.5	37	CCDS33435.1																																																																																				0.522	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
YTHDC1	91746	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	69195975	69195975	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr4:69195975T>A	ENST00000344157.4	-	8	1511	c.1176A>T	c.(1174-1176)agA>agT	p.R392S	YTHDC1_ENST00000355665.3_Missense_Mutation_p.R374S|YTHDC1_ENST00000579690.1_Missense_Mutation_p.R392S	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	392	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TCCTTGCAGATCTAAATGCAA	0.294																																						.											0													32.0	33.0	33.0					4																	69195975		2196	4285	6481	SO:0001583	missense	91746			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1176A>T	4.37:g.69195975T>A	ENSP00000339245:p.Arg392Ser		Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.256900	0.59321	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.30981	1.51;1.51	5.44	4.27	0.50696	YTH domain (2);	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.80183	2.485	0.80722	D	1	D;D	0.64830	0.971;0.994	D;D	0.75020	0.981;0.985	T	0.58781	-0.7576	10	0.87932	D	0	.	11.0667	0.47979	0.0:0.0727:0.0:0.9273	.	374;392	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	S	392;374	ENSP00000339245:R392S;ENSP00000347888:R374S	ENSP00000339245:R392S	R	-	3	2	YTHDC1	68878570	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.624000	0.46444	0.921000	0.36994	0.482000	0.46254	AGA		0.294	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
TCERG1	10915	hgsc.bcm.edu	37	5	145838656	145838656	+	Silent	SNP	G	G	A	rs569890952		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr5:145838656G>A	ENST00000296702.5	+	4	686	c.648G>A	c.(646-648)caG>caA	p.Q216Q	TCERG1_ENST00000394421.2_Silent_p.Q216Q	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	216	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			cccaggcccaggcccaggccc	0.731																																						.											0													10.0	14.0	13.0					5																	145838656		2190	4261	6451	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.648G>A	5.37:g.145838656G>A			Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
GPRIN1	114787	hgsc.bcm.edu	37	5	176026120	176026143	+	In_Frame_Del	DEL	CTCAAAGACCCAGGATCCTCCTTC	CTCAAAGACCCAGGATCCTCCTTC	-	rs3797464|rs200519605|rs386695335|rs550332435|rs77245696|rs142779818|rs371149640|rs199714570|rs373697082|rs201635586	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	CTCAAAGACCCAGGATCCTCCTTC	CTCAAAGACCCAGGATCCTCCTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr5:176026120_176026143delCTCAAAGACCCAGGATCCTCCTTC	ENST00000303991.4	-	2	870_893	c.693_716delGAAGGAGGATCCTGGGTCTTTGAG	c.(691-717)aggaaggaggatcctgggtctttgaga>aga	p.231_239RKEDPGSLR>R		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	231				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.L238L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCCACCTTTCTCAAAGACCCAGGATCCTCCTTCCTCGGTGACA	0.491																																						.											1	Substitution - coding silent(1)	lung(1)								863,3329		131,601,1364						1.0	0.0		dbSNP_134	123	1529,6607		196,1137,2735	no	coding	GPRIN1	NM_052899.2		327,1738,4099	A1A1,A1R,RR		18.793,20.5868,19.403				2392,9936				SO:0001651	inframe_deletion	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.693_716delGAAGGAGGATCCTGGGTCTTTGAG	5.37:g.176026120_176026143delCTCAAAGACCCAGGATCCTCCTTC	ENSP00000305839:p.Arg231_Leu238del		C9JM70|Q8ND74|Q96PZ4	In_Frame_Del	DEL	ENST00000303991.4	37	CCDS4405.1																																																																																				0.491	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
RP1L1	94137	hgsc.bcm.edu	37	8	10465962	10465962	+	Missense_Mutation	SNP	C	C	A	rs111646478	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr8:10465962C>A	ENST00000382483.3	-	4	5869	c.5646G>T	c.(5644-5646)gaG>gaT	p.E1882D		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1962					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGGCTGGGCCTCTCCTTCTG	0.617													C|||	159	0.0317492	0.0061	0.0548	5008	,	,		16897	0.001		0.0805	False		,,,				2504	0.0317					.											0													156.0	173.0	168.0					8																	10465962		1942	4150	6092	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5646G>T	8.37:g.10465962C>A	ENSP00000371923:p.Glu1882Asp		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	6.872	0.530264	0.13127	.	.	ENSG00000183638	ENST00000382483	T	0.07800	3.16	1.4	-2.79	0.05841	.	.	.	.	.	T	0.04861	0.0131	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.44267	-0.9339	9	0.23891	T	0.37	.	7.224	0.26005	0.6018:0.3982:0.0:0.0	.	1882	A6NKC6	.	D	1882	ENSP00000371923:E1882D	ENSP00000371923:E1882D	E	-	3	2	RP1L1	10503372	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-3.895000	0.00340	-0.232000	0.09811	-0.516000	0.04426	GAG		0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
SLC6A14	11254	hgsc.bcm.edu	37	X	115572265	115572265	+	Splice_Site	DEL	G	G	-			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:115572265delG	ENST00000371900.4	+	3	434	c.346delG	c.(346-348)ggt>gt	p.G116fs		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	116					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	ATTGTTTCAAGGTTGGTATTA	0.373																																						.											0													222.0	206.0	212.0					X																	115572265		2203	4300	6503	SO:0001630	splice_region_variant	11254			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.346+1G>-	X.37:g.115572265delG			Q5H942	Frame_Shift_Del	DEL	ENST00000371900.4	37	CCDS14570.1																																																																																				0.373	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		Frame_Shift_Del
OR1S2	219958	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	57970779	57970779	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:57970779G>A	ENST00000302592.6	-	1	874	c.875C>T	c.(874-876)aCt>aTt	p.T292I		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TGTCACCACAGTGAATAGGAC	0.448																																						.											0													152.0	142.0	145.0					11																	57970779		2201	4296	6497	SO:0001583	missense	219958			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.875C>T	11.37:g.57970779G>A	ENSP00000305469:p.Thr292Ile		Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457628	0.43634	.	.	ENSG00000197887	ENST00000302592	T	0.00241	8.46	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.129483	0.35207	N	0.003376	T	0.00468	0.0015	M	0.90198	3.095	0.31600	N	0.652805	P	0.44044	0.825	P	0.46299	0.511	T	0.21759	-1.0236	10	0.72032	D	0.01	.	16.8288	0.85938	0.0:0.0:1.0:0.0	.	292	Q8NGQ3	OR1S2_HUMAN	I	292	ENSP00000305469:T292I	ENSP00000305469:T292I	T	-	2	0	OR1S2	57727355	0.120000	0.22244	0.998000	0.56505	0.443000	0.32047	2.643000	0.46604	2.622000	0.88805	0.655000	0.94253	ACT		0.448	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
ARHGAP32	9743	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	128840231	128840231	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:128840231T>C	ENST00000310343.9	-	22	4834	c.4835A>G	c.(4834-4836)tAc>tGc	p.Y1612C	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.Y1263C|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.Y1263C	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1612	Interaction with GAB2.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TCTTGGGCAGTAGGCTGGCTC	0.532																																						.											0													89.0	82.0	84.0					11																	128840231		2201	4297	6498	SO:0001583	missense	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4835A>G	11.37:g.128840231T>C	ENSP00000310561:p.Tyr1612Cys		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.779073	0.49891	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.14144	2.55;2.53;2.53	5.66	4.47	0.54385	.	0.256463	0.39759	N	0.001266	T	0.24314	0.0589	M	0.62723	1.935	0.34814	D	0.738056	D	0.63880	0.993	P	0.53185	0.72	T	0.34650	-0.9820	10	0.72032	D	0.01	.	10.8803	0.46935	0.2372:0.0:0.0:0.7628	.	1612	A7KAX9	RHG32_HUMAN	C	1612;1263;1263	ENSP00000310561:Y1612C;ENSP00000376425:Y1263C;ENSP00000432862:Y1263C	ENSP00000310561:Y1612C	Y	-	2	0	ARHGAP32	128345441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.416000	0.44644	2.156000	0.67533	0.533000	0.62120	TAC		0.532	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
C15orf59	388135	hgsc.bcm.edu;mdanderson.org	37	15	74032954	74032954	+	Silent	SNP	C	C	T	rs144044826		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:74032954C>T	ENST00000569673.1	-	3	1390	c.186G>A	c.(184-186)tcG>tcA	p.S62S	C15orf59_ENST00000558834.1_5'UTR|C15orf59_ENST00000379822.4_Silent_p.S62S			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	62										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGTCGAAGTCCGAGGTTAGCT	0.612																																						.											0								C		0,4396		0,0,2198	149.0	153.0	152.0		186	-9.7	0.9	15	dbSNP_134	152	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	C15orf59	NM_001039614.1		0,1,6494	TT,TC,CC		0.0116,0.0,0.0077		62/294	74032954	1,12989	2198	4297	6495	SO:0001819	synonymous_variant	388135				CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.186G>A	15.37:g.74032954C>T				Silent	SNP	ENST00000569673.1	37	CCDS32289.1																																																																																				0.612	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614	
ZNF319	57567	broad.mit.edu;hgsc.bcm.edu	37	16	58030679	58030679	+	Silent	SNP	G	G	A	rs372922346		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr16:58030679G>A	ENST00000299237.2	-	2	2113	c.1491C>T	c.(1489-1491)taC>taT	p.Y497Y	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						GGTCTGACGCGTACTTGAAGC	0.617																																						.											0								G		0,4396		0,0,2198	53.0	45.0	48.0		1491	-6.4	0.0	16		48	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF319	NM_020807.1		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		497/583	58030679	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	57567			AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1491C>T	16.37:g.58030679G>A			Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																				0.617	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
ARFGEF1	10565	hgsc.bcm.edu	37	8	68112661	68112661	+	Silent	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr8:68112661T>C	ENST00000262215.3	-	38	5744	c.5355A>G	c.(5353-5355)ctA>ctG	p.L1785L	ARFGEF1_ENST00000517955.1_5'UTR|ARFGEF1_ENST00000520381.1_Silent_p.L1239L|ARFGEF1_ENST00000518230.1_Silent_p.L623L	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1785					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GAACTTTAGTTAGAAACAAAA	0.428																																						.											0													114.0	113.0	113.0					8																	68112661		2203	4300	6503	SO:0001819	synonymous_variant	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5355A>G	8.37:g.68112661T>C			Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1																																																																																				0.428	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
CLCNKB	1188	broad.mit.edu;mdanderson.org	37	1	16383402	16383402	+	Silent	SNP	C	C	T	rs6698427		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:16383402C>T	ENST00000375679.4	+	20	2166	c.2055C>T	c.(2053-2055)gcC>gcT	p.A685A	CLCNKB_ENST00000375667.3_Silent_p.A515A|FAM131C_ENST00000494078.1_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	685					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ATCCGCCAGCCCCAAAGTGAG	0.587																																						.											0													66.0	64.0	65.0					1																	16383402		2203	4300	6503	SO:0001819	synonymous_variant	1188			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.2055C>T	1.37:g.16383402C>T			B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	37	CCDS168.1																																																																																				0.587	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
NBPF14	25832	broad.mit.edu	37	1	148010987	148010987	+	Silent	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:148010987T>C	ENST00000369219.1	-	14	1651	c.1635A>G	c.(1633-1635)tcA>tcG	p.S545S				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	545	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.S545S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					CTGAAGGAGTTGAATAACATC	0.478																																						.											1	Substitution - coding silent(1)	kidney(1)											2.0	2.0	2.0					1																	148010987		627	1514	2141	SO:0001819	synonymous_variant	25832			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1635A>G	1.37:g.148010987T>C			Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	-	0.755	-0.771349	0.02951	.	.	ENSG00000122497	ENST00000310701	.	.	.	.	.	.	.	.	.	.	.	T	0.08714	0.0216	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.36480	-0.9746	2	.	.	.	.	.	.	.	.	.	.	.	R	551	.	.	Q	-	2	0	NBPF14	146477611	0.914000	0.31030	0.004000	0.12327	0.003000	0.03518	-0.265000	0.08644	-0.568000	0.06038	-0.564000	0.04169	CAA		0.478	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
UCN3	114131	broad.mit.edu	37	10	5415962	5415962	+	Silent	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr10:5415962C>T	ENST00000380433.3	+	2	507	c.279C>T	c.(277-279)acC>acT	p.T93T		NM_053049.2	NP_444277.2	Q969E3	UCN3_HUMAN	urocortin 3	93					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|digestion (GO:0007586)|positive regulation of insulin secretion (GO:0032024)|positive regulation of membrane potential (GO:0045838)|response to corticosterone (GO:0051412)|response to glucose (GO:0009749)|response to immobilization stress (GO:0035902)|response to starvation (GO:0042594)	axon terminus (GO:0043679)|extracellular space (GO:0005615)|varicosity (GO:0043196)				endometrium(1)|large_intestine(1)	2						CCAGAGGCACCCGGTACAGAT	0.627																																						.											0													57.0	57.0	57.0					10																	5415962		2201	4299	6500	SO:0001819	synonymous_variant	114131			AF361943	CCDS7065.1	10p15.1	2013-02-28	2012-10-17		ENSG00000178473	ENSG00000178473		"""Endogenous ligands"""	17781	protein-coding gene	gene with protein product	"""stresscopin"", ""prepro-urocortin 3"""	605901				11416224	Standard	NM_053049		Approved	UCNIII, SPC	uc001ihx.1	Q969E3	OTTHUMG00000017594	ENST00000380433.3:c.279C>T	10.37:g.5415962C>T			Q496H2|Q5SR91	Silent	SNP	ENST00000380433.3	37	CCDS7065.1																																																																																				0.627	UCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046547.1	NM_053049	
MUC6	4588	broad.mit.edu;mdanderson.org;bcgsc.ca	37	11	1017180	1017180	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:1017180G>A	ENST00000421673.2	-	31	5671	c.5621C>T	c.(5620-5622)aCa>aTa	p.T1874I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1874	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AATGGTGCCTGTTGGCATTGA	0.582																																						.											0													502.0	480.0	488.0					11																	1017180		2202	4286	6488	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5621C>T	11.37:g.1017180G>A	ENSP00000406861:p.Thr1874Ile		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.623016	0.28889	.	.	ENSG00000184956	ENST00000421673	T	0.22539	1.95	3.05	1.02	0.19986	.	.	.	.	.	T	0.28928	0.0718	L	0.39898	1.24	0.09310	N	1	P	0.44478	0.836	P	0.58391	0.838	T	0.13019	-1.0525	9	0.51188	T	0.08	.	6.6132	0.22763	0.1151:0.1811:0.7038:0.0	.	1874	Q6W4X9	MUC6_HUMAN	I	1874	ENSP00000406861:T1874I	ENSP00000406861:T1874I	T	-	2	0	MUC6	1007180	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.013000	0.12678	0.118000	0.18165	-0.671000	0.03813	ACA		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	broad.mit.edu	37	11	1270045	1270045	+	Missense_Mutation	SNP	A	A	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:1270045A>C	ENST00000529681.1	+	31	11993	c.11935A>C	c.(11935-11937)Acc>Ccc	p.T3979P	MUC5B_ENST00000447027.1_Missense_Mutation_p.T3982P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3979	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		gctgaccaccaccgccaccac	0.642																																						.											0													19.0	27.0	24.0					11																	1270045		1254	2834	4088	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11935A>C	11.37:g.1270045A>C	ENSP00000436812:p.Thr3979Pro		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	8.902	0.956543	0.18507	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637	T;T	0.20332	2.08;2.27	2.84	-0.148	0.13424	.	.	.	.	.	T	0.28034	0.0691	L	0.46157	1.445	0.09310	N	1	D	0.65815	0.995	P	0.56278	0.795	T	0.13602	-1.0503	9	0.87932	D	0	.	6.7891	0.23689	0.809:0.0:0.191:0.0	.	3982	E9PBJ0	.	P	3979;3982;3923	ENSP00000436812:T3979P;ENSP00000415793:T3982P	ENSP00000343037:T3923P	T	+	1	0	MUC5B	1226621	0.000000	0.05858	0.001000	0.08648	0.323000	0.28346	-5.417000	0.00124	0.078000	0.16900	0.248000	0.18094	ACC		0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
FMNL3	91010	broad.mit.edu	37	12	50045190	50045190	+	Silent	SNP	A	A	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr12:50045190A>T	ENST00000293590.5	-	15	1880	c.1647T>A	c.(1645-1647)tcT>tcA	p.S549S	FMNL3_ENST00000550488.1_Silent_p.S549S|FMNL3_ENST00000352151.5_Silent_p.S498S|FMNL3_ENST00000335154.5_Silent_p.S549S			Q8IVF7	FMNL3_HUMAN	formin-like 3	549					actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						TCAACACCACAGAGGGTGCAG	0.607																																						.											0													28.0	31.0	30.0					12																	50045190		1957	4153	6110	SO:0001819	synonymous_variant	91010			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1647T>A	12.37:g.50045190A>T			B0JZA7|Q6ZRJ1	Silent	SNP	ENST00000293590.5	37																																																																																					0.607	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		NM_175736	
PXN	5829	broad.mit.edu	37	12	120662127	120662127	+	Missense_Mutation	SNP	C	C	A	rs202176482		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr12:120662127C>A	ENST00000228307.7	-	2	208	c.67G>T	c.(67-69)Gtg>Ttg	p.V23L	PXN_ENST00000424649.2_Missense_Mutation_p.V23L|PXN_ENST00000267257.7_Missense_Mutation_p.V23L|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000458477.2_5'UTR|PXN_ENST00000536957.1_Missense_Mutation_p.V21L	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	23					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACAAGAACACAGGCCGTTTG	0.622																																						.											0													56.0	64.0	61.0					12																	120662127		1999	4147	6146	SO:0001583	missense	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.67G>T	12.37:g.120662127C>A	ENSP00000228307:p.Val23Leu		B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379542	0.61845	.	.	ENSG00000089159	ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000543331	T;T;T;T;T	0.54866	0.57;0.55;0.61;0.55;0.62	5.44	4.55	0.56014	.	0.125619	0.52532	D	0.000069	T	0.32734	0.0839	N	0.11560	0.145	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.14023	0.007;0.01	T	0.11084	-1.0602	10	0.19147	T	0.46	-13.2736	14.4703	0.67512	0.0:0.9281:0.0:0.0719	.	23;23	P49023-2;P49023	.;PAXI_HUMAN	L	23;23;21;23;24	ENSP00000228307:V23L;ENSP00000391283:V23L;ENSP00000443887:V21L;ENSP00000267257:V23L;ENSP00000443745:V24L	ENSP00000228307:V23L	V	-	1	0	PXN	119146510	0.996000	0.38824	0.990000	0.47175	0.987000	0.75469	3.301000	0.51842	2.559000	0.86315	0.591000	0.81541	GTG		0.622	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859	
HERC2	8924	broad.mit.edu;mdanderson.org	37	15	28456246	28456246	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:28456246T>A	ENST00000261609.7	-	44	7079	c.6971A>T	c.(6970-6972)tAc>tTc	p.Y2324F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTCAGGATGTATAGCTTCAA	0.582																																						.											0													49.0	46.0	47.0					15																	28456246		2202	4298	6500	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6971A>T	15.37:g.28456246T>A	ENSP00000261609:p.Tyr2324Phe			Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.862647	0.51482	.	.	ENSG00000128731	ENST00000261609	T	0.37752	1.18	4.84	3.72	0.42706	.	0.068466	0.64402	D	0.000012	T	0.49236	0.1545	L	0.51422	1.61	0.58432	D	0.999996	P	0.52842	0.956	D	0.65010	0.931	T	0.44174	-0.9345	10	0.54805	T	0.06	.	10.4591	0.44567	0.0:0.0766:0.0:0.9234	.	2324	O95714	HERC2_HUMAN	F	2324	ENSP00000261609:Y2324F	ENSP00000261609:Y2324F	Y	-	2	0	HERC2	26129841	1.000000	0.71417	0.994000	0.49952	0.534000	0.34807	6.123000	0.71614	0.872000	0.35775	0.459000	0.35465	TAC		0.582	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CTDP1	9150	broad.mit.edu	37	18	77477838	77477838	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr18:77477838C>T	ENST00000299543.7	+	10	2386	c.2239C>T	c.(2239-2241)Cgg>Tgg	p.R747W	CTDP1_ENST00000075430.7_Missense_Mutation_p.R747W	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	747					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CTTTCCCGACCGGGAGGGTGT	0.667																																						.											0													38.0	44.0	42.0					18																	77477838		2203	4300	6503	SO:0001583	missense	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.2239C>T	18.37:g.77477838C>T	ENSP00000299543:p.Arg747Trp		A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	ENST00000299543.7	37	CCDS12017.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202466	0.38905	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.48522	0.81;0.81	5.22	2.76	0.32466	FCP1-like phosphatase, C-terminal (1);	0.476726	0.24289	N	0.039825	T	0.58694	0.2140	L	0.50333	1.59	0.30776	N	0.742543	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.65443	0.893;0.893;0.935	T	0.62324	-0.6878	10	0.66056	D	0.02	-37.4624	11.866	0.52493	0.7087:0.2913:0.0:0.0	.	628;747;747	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	W	747	ENSP00000299543:R747W;ENSP00000075430:R747W	ENSP00000075430:R747W	R	+	1	2	CTDP1	75578826	1.000000	0.71417	0.564000	0.28396	0.064000	0.16182	2.452000	0.44961	0.276000	0.22118	-0.457000	0.05445	CGG		0.667	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
GDF5	8200	broad.mit.edu	37	20	34021909	34021909	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr20:34021909A>G	ENST00000374372.1	-	4	1807	c.1304T>C	c.(1303-1305)tTc>tCc	p.F435S	GDF5_ENST00000374369.3_Missense_Mutation_p.F435S|GDF5OS_ENST00000374375.1_5'UTR			P43026	GDF5_HUMAN	growth differentiation factor 5	435					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GCGCAATGGGAACTCGCACAG	0.602																																						.											0													135.0	118.0	124.0					20																	34021909		2203	4300	6503	SO:0001583	missense	8200			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1304T>C	20.37:g.34021909A>G	ENSP00000363492:p.Phe435Ser		E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.999143	0.74818	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	D;D	0.84146	-1.81;-1.81	4.53	4.53	0.55603	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90300	0.6966	L	0.60904	1.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91390	0.5134	10	0.87932	D	0	.	14.0234	0.64571	1.0:0.0:0.0:0.0	.	435;435	F1T0J1;P43026	.;GDF5_HUMAN	S	435	ENSP00000363489:F435S;ENSP00000363492:F435S	ENSP00000363489:F435S	F	-	2	0	GDF5	33485323	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.139000	0.94554	1.893000	0.54813	0.459000	0.35465	TTC		0.602	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
USP25	29761	broad.mit.edu	37	21	17150316	17150316	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr21:17150316G>A	ENST00000285679.6	+	4	731	c.362G>A	c.(361-363)gGa>gAa	p.G121E	USP25_ENST00000400183.2_Missense_Mutation_p.G121E|USP25_ENST00000351097.5_Missense_Mutation_p.G121E|USP25_ENST00000285681.2_Missense_Mutation_p.G121E|USP25_ENST00000547201.1_3'UTR	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	121					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		AGGGAGACTGGAATAACTGAT	0.343																																						.											0													59.0	60.0	60.0					21																	17150316		2203	4300	6503	SO:0001583	missense	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.362G>A	21.37:g.17150316G>A	ENSP00000285679:p.Gly121Glu		C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735801	0.89482	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.30448	1.94;1.95;1.53;1.95	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	N	0.14661	0.345	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;1.0	D;D;D;D	0.91635	0.943;0.998;0.943;0.999	T	0.20940	-1.0260	10	0.19590	T	0.45	.	18.85	0.92224	0.0:0.0:1.0:0.0	.	121;121;121;121	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	E	121	ENSP00000285681:G121E;ENSP00000285679:G121E;ENSP00000299574:G121E;ENSP00000383044:G121E	ENSP00000285679:G121E	G	+	2	0	USP25	16072187	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.379000	0.97198	2.526000	0.85167	0.585000	0.79938	GGA		0.343	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
CD80	941	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	119263627	119263627	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr3:119263627C>T	ENST00000264246.3	-	3	550	c.188G>A	c.(187-189)cGc>cAc	p.R63H	CD80_ENST00000478182.1_Missense_Mutation_p.R63H|CD80_ENST00000383669.3_Missense_Mutation_p.R63H|CD80_ENST00000383668.3_Missense_Mutation_p.R63H	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	63	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	CCAGTAGATGCGAGTTTGTGC	0.468																																					Melanoma(132;135 1764 1806 5833 14593)	.											0													165.0	141.0	149.0					3																	119263627		2203	4300	6503	SO:0001583	missense	941				CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.188G>A	3.37:g.119263627C>T	ENSP00000264246:p.Arg63His		Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	37	CCDS2989.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704898	0.68615	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.13	5.13	0.70059	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43260	D	0.000584	T	0.82162	0.4977	M	0.83603	2.65	0.21020	N	0.999801	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.996;0.998;0.998	T	0.75190	-0.3405	10	0.62326	D	0.03	-12.7701	13.9575	0.64160	0.0:1.0:0.0:0.0	.	63;63;63;63	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	H	63	ENSP00000264246:R63H;ENSP00000418364:R63H;ENSP00000373165:R63H;ENSP00000373164:R63H	ENSP00000264246:R63H	R	-	2	0	CD80	120746317	0.550000	0.26489	0.052000	0.19188	0.026000	0.11368	3.213000	0.51153	2.665000	0.90641	0.650000	0.86243	CGC		0.468	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191	
GK2	2712	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	80328442	80328442	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr4:80328442C>A	ENST00000358842.3	-	1	930	c.913G>T	c.(913-915)Gct>Tct	p.A305S		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AGTTTGTAAGCTACTGTGGTC	0.438																																						.											0													122.0	106.0	111.0					4																	80328442		2203	4300	6503	SO:0001583	missense	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.913G>T	4.37:g.80328442C>A	ENSP00000351706:p.Ala305Ser		Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541867	0.45280	.	.	ENSG00000196475	ENST00000358842	D	0.91068	-2.78	4.18	4.18	0.49190	Carbohydrate kinase, FGGY, C-terminal (1);	0.171235	0.50627	D	0.000109	D	0.95984	0.8692	M	0.93978	3.48	0.58432	D	0.999995	D	0.65815	0.995	D	0.72338	0.977	D	0.96118	0.9082	10	0.72032	D	0.01	-12.0764	12.3114	0.54929	0.0:1.0:0.0:0.0	.	305	Q14410	GLPK2_HUMAN	S	305	ENSP00000351706:A305S	ENSP00000351706:A305S	A	-	1	0	GK2	80547466	1.000000	0.71417	0.998000	0.56505	0.018000	0.09664	6.529000	0.73812	2.645000	0.89757	0.585000	0.79938	GCT		0.438	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
TRAPPC13	80006	broad.mit.edu;mdanderson.org;bcgsc.ca	37	5	64942924	64942924	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr5:64942924T>A	ENST00000399438.3	+	5	688	c.343T>A	c.(343-345)Tcc>Acc	p.S115T	TRAPPC13_ENST00000438419.2_Missense_Mutation_p.S115T|TRAPPC13_ENST00000231526.4_Missense_Mutation_p.S115T|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.S115T|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.S115T	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	115																	TCTTTCAGCCTCCAATGCTGC	0.358																																						.											0													67.0	62.0	64.0					5																	64942924		1824	4087	5911	SO:0001583	missense	80006				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.343T>A	5.37:g.64942924T>A	ENSP00000382367:p.Ser115Thr		Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	ENST00000399438.3	37	CCDS47222.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133539	0.56828	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	L	0.35854	1.095	0.80722	D	1	B;B;B;B	0.16603	0.015;0.006;0.015;0.018	B;B;B;B	0.23018	0.026;0.015;0.026;0.043	T	0.51474	-0.8701	9	0.44086	T	0.13	-26.3722	15.8523	0.78943	0.0:0.0:0.0:1.0	.	115;115;115;115	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	T	115	.	ENSP00000231526:S115T	S	+	1	0	C5orf44	64978680	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.153000	0.67306	0.455000	0.32223	TCC		0.358	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370113.1	NM_024941	
MCTP1	79772	broad.mit.edu;mdanderson.org;bcgsc.ca	37	5	94253666	94253666	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr5:94253666G>C	ENST00000515393.1	-	8	1284	c.1285C>G	c.(1285-1287)Cca>Gca	p.P429A	MCTP1_ENST00000505208.1_Missense_Mutation_p.P208A|MCTP1_ENST00000505078.1_Intron|MCTP1_ENST00000312216.8_Missense_Mutation_p.P208A|MCTP1_ENST00000429576.2_Intron	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	429					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		GGAAGAGCTGGCCTGCCGCAC	0.428																																						.											0													66.0	70.0	68.0					5																	94253666		2203	4300	6503	SO:0001583	missense	79772				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1285C>G	5.37:g.94253666G>C	ENSP00000424126:p.Pro429Ala		Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	37	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360751	0.24598	.	.	ENSG00000175471	ENST00000515393;ENST00000312216;ENST00000512425;ENST00000505208	T;T;T;T	0.76709	-1.04;-0.91;-0.86;-1.03	5.14	3.35	0.38373	.	0.184499	0.33327	N	0.005036	T	0.60779	0.2295	N	0.22421	0.69	0.22591	N	0.998957	B;B	0.22683	0.043;0.073	B;B	0.21917	0.025;0.037	T	0.48198	-0.9056	10	0.32370	T	0.25	-0.7513	6.646	0.22934	0.0906:0.0:0.7344:0.175	.	429;208	Q6DN14;Q6DN14-2	MCTP1_HUMAN;.	A	429;208;90;208	ENSP00000424126:P429A;ENSP00000308957:P208A;ENSP00000431075:P90A;ENSP00000426438:P208A	ENSP00000308957:P208A	P	-	1	0	MCTP1	94279422	1.000000	0.71417	0.977000	0.42913	0.388000	0.30384	2.101000	0.41787	0.742000	0.32697	0.655000	0.94253	CCA		0.428	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
HIST1H2BK	85236	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	27114569	27114569	+	Silent	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr6:27114569T>C	ENST00000356950.1	-	1	8	c.9A>G	c.(7-9)gaA>gaG	p.E3E	HIST1H2BK_ENST00000396891.4_Silent_p.E3E|MIR3143_ENST00000584253.1_RNA|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACTTCGCTGGTTCCGGCATGT	0.562																																						.											0													51.0	51.0	51.0					6																	27114569		2203	4300	6503	SO:0001819	synonymous_variant	85236			AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.9A>G	6.37:g.27114569T>C			A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	CCDS4621.1																																																																																				0.562	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
CD99	4267	broad.mit.edu	37	X	2658825	2658825	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:2658825C>T	ENST00000381192.3	+	10	720	c.538C>T	c.(538-540)Cgt>Tgt	p.R180C	CD99_ENST00000381187.3_Missense_Mutation_p.R164C	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule	180					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						CACAGTTCAGCGTACTCTTTT	0.507																																						.											0													246.0	235.0	239.0					X																	2658825		2203	4296	6499	SO:0001583	missense	4267			M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.538C>T	X.37:g.2658825C>T	ENSP00000370588:p.Arg180Cys		A6NIW1|O00518|Q6ICV7	Missense_Mutation	SNP	ENST00000381192.3	37	CCDS14119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.349|9.349	1.065017|1.065017	0.20067|0.20067	.|.	.|.	ENSG00000002586|ENSG00000002586	ENST00000381177|ENST00000381192;ENST00000381187	.|T;T	.|0.32988	.|1.45;1.43	1.06|1.06	0.16|0.16	0.14972|0.14972	.|.	.|0.193478	.|0.31648	.|U	.|0.007288	T|T	0.10208|0.10208	0.0250|0.0250	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|D;D;D	.|0.63880	.|0.993;0.993;0.993	.|B;B;B	.|0.32928	.|0.155;0.155;0.155	T|T	0.33675|0.33675	-0.9859|-0.9859	6|10	0.87932|0.52906	D|T	0|0.07	.|.	3.1953|3.1953	0.06631|0.06631	0.0:0.6805:0.0:0.3195|0.0:0.6805:0.0:0.3195	.|.	.|164;180;180	.|A6NIW1;B2R932;P14209	.|.;.;CD99_HUMAN	V|C	78|180;164	.|ENSP00000370588:R180C;ENSP00000370582:R164C	ENSP00000370570:A78V|ENSP00000370582:R164C	A|R	+|+	2|1	0|0	CD99|CD99	2668825|2668825	0.043000|0.043000	0.20138|0.20138	0.005000|0.005000	0.12908|0.12908	0.523000|0.523000	0.34469|0.34469	-0.075000|-0.075000	0.11431|0.11431	-0.010000|-0.010000	0.14271|0.14271	0.284000|0.284000	0.19432|0.19432	GCG|CGT		0.507	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055624.1	NM_001122898	
SHROOM2	357	broad.mit.edu	37	X	9900608	9900608	+	Silent	SNP	A	A	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:9900608A>C	ENST00000380913.3	+	6	3375	c.3285A>C	c.(3283-3285)ccA>ccC	p.P1095P	SHROOM2_ENST00000493668.1_3'UTR|SHROOM2_ENST00000418909.2_5'UTR	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1095					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GGCCCTTCCCAACGCCATCCC	0.697																																						.											0													41.0	37.0	39.0					X																	9900608		2203	4300	6503	SO:0001819	synonymous_variant	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3285A>C	X.37:g.9900608A>C			B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																				0.697	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
CAMKK2	10645	ucsc.edu	37	12	121678593	121678593	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr12:121678593C>T	ENST00000324774.5	-	17	2504	c.1676G>A	c.(1675-1677)aGt>aAt	p.S559N	CAMKK2_ENST00000402834.4_Missense_Mutation_p.S559N|CAMKK2_ENST00000337174.3_3'UTR|CAMKK2_ENST00000404169.3_Missense_Mutation_p.S559N|CAMKK2_ENST00000347034.2_Missense_Mutation_p.S516N|CAMKK2_ENST00000545538.1_Intron|CAMKK2_ENST00000392474.2_Intron|CAMKK2_ENST00000538733.1_3'UTR|CAMKK2_ENST00000412367.2_3'UTR	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	559					calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACGCAGGGACTGCCTCTCAC	0.677																																						.											0													26.0	31.0	29.0					12																	121678593		2203	4299	6502	SO:0001583	missense	10645			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.1676G>A	12.37:g.121678593C>T	ENSP00000312741:p.Ser559Asn		A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	ENST00000324774.5	37	CCDS9216.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376530	0.24857	.	.	ENSG00000110931	ENST00000347034;ENST00000324774;ENST00000404169	T;T;T	0.73363	-0.71;-0.74;-0.74	5.47	5.47	0.80525	.	.	.	.	.	T	0.58090	0.2098	N	0.22421	0.69	0.42015	D	0.990956	B;B	0.13594	0.008;0.005	B;B	0.13407	0.009;0.004	T	0.53606	-0.8415	9	0.27785	T	0.31	0.0303	8.3402	0.32239	0.0:0.8324:0.0:0.1676	.	516;559	Q96RR4-4;Q96RR4	.;KKCC2_HUMAN	N	516;559;559	ENSP00000321230:S516N;ENSP00000312741:S559N;ENSP00000384600:S559N	ENSP00000312741:S559N	S	-	2	0	CAMKK2	120162976	0.000000	0.05858	0.034000	0.17996	0.002000	0.02628	-0.015000	0.12634	2.748000	0.94277	0.655000	0.94253	AGT		0.677	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402563.1	NM_172226	
KNDC1	85442	ucsc.edu	37	10	135020674	135020674	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr10:135020674T>C	ENST00000304613.3	+	20	3634	c.3613T>C	c.(3613-3615)Tgc>Cgc	p.C1205R	KNDC1_ENST00000368571.2_3'UTR|KNDC1_ENST00000368572.2_Missense_Mutation_p.C1207R			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1205					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCTGGAGCCCTGCACCCTCCC	0.662																																						.											0													27.0	25.0	26.0					10																	135020674		2194	4296	6490	SO:0001583	missense	85442			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3613T>C	10.37:g.135020674T>C	ENSP00000304437:p.Cys1205Arg		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.315195	0.23908	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.12039	2.72;2.72	3.63	0.808	0.18719	.	0.277674	0.29321	U	0.012493	T	0.11793	0.0287	L	0.57536	1.79	0.45005	D	0.998027	D	0.54601	0.967	P	0.46026	0.501	T	0.32851	-0.9891	10	0.23302	T	0.38	-17.9744	0.8433	0.01155	0.2313:0.1132:0.178:0.4774	.	1205	Q76NI1	VKIND_HUMAN	R	1205;1207	ENSP00000304437:C1205R;ENSP00000357561:C1207R	ENSP00000304437:C1205R	C	+	1	0	KNDC1	134870664	0.783000	0.28701	0.988000	0.46212	0.474000	0.32979	1.015000	0.29963	0.039000	0.15632	0.353000	0.21931	TGC		0.662	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
MTMR7	9108	ucsc.edu	37	8	17206529	17206529	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr8:17206529A>G	ENST00000180173.5	-	5	564	c.530T>C	c.(529-531)gTg>gCg	p.V177A	MTMR7_ENST00000523571.1_5'UTR|MTMR7_ENST00000521857.1_Missense_Mutation_p.V177A	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	177	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		GGAACTCCCCACTATGATGTG	0.428																																						.											0													135.0	129.0	131.0					8																	17206529		2203	4300	6503	SO:0001583	missense	9108			AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.530T>C	8.37:g.17206529A>G	ENSP00000180173:p.Val177Ala		A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865172	0.91511	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.92595	-3.07;-3.07	5.24	5.24	0.73138	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.241929	0.41823	D	0.000808	D	0.92750	0.7695	L	0.52364	1.645	0.80722	D	1	P	0.43024	0.798	P	0.54372	0.75	D	0.90246	0.4290	10	0.15499	T	0.54	.	15.851	0.78930	1.0:0.0:0.0:0.0	.	177	Q9Y216	MTMR7_HUMAN	A	177	ENSP00000180173:V177A;ENSP00000429733:V177A	ENSP00000180173:V177A	V	-	2	0	MTMR7	17250900	1.000000	0.71417	0.949000	0.38748	0.995000	0.86356	6.971000	0.76105	2.281000	0.76405	0.533000	0.62120	GTG		0.428	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
MTDH	92140	ucsc.edu;bcgsc.ca	37	8	98736833	98736833	+	Missense_Mutation	SNP	T	T	C	rs372764968		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr8:98736833T>C	ENST00000336273.3	+	12	2012	c.1684T>C	c.(1684-1686)Tct>Cct	p.S562P	MTDH_ENST00000519934.1_Missense_Mutation_p.S506P	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	562					lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			TTTAGCCAAGTCTGAAACTAG	0.323																																						.											0													102.0	104.0	103.0					8																	98736833		2203	4300	6503	SO:0001583	missense	92140			AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.1684T>C	8.37:g.98736833T>C	ENSP00000338235:p.Ser562Pro		Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	ENST00000336273.3	37	CCDS6274.1	.	.	.	.	.	.	.	.	.	.	T	15.21	2.766344	0.49574	.	.	ENSG00000147649	ENST00000336273;ENST00000519934;ENST00000521933	T;T	0.54479	0.57;0.57	5.64	5.64	0.86602	.	0.059502	0.64402	D	0.000001	T	0.64702	0.2622	L	0.42245	1.32	0.49213	D	0.99976	D	0.89917	1.0	D	0.85130	0.997	T	0.63107	-0.6711	10	0.38643	T	0.18	-5.6617	14.4204	0.67180	0.0:0.0:0.0:1.0	.	562	Q86UE4	LYRIC_HUMAN	P	562;506;185	ENSP00000338235:S562P;ENSP00000428168:S506P	ENSP00000338235:S562P	S	+	1	0	MTDH	98806009	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.491000	0.66887	2.148000	0.66965	0.533000	0.62120	TCT		0.323	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2		
MYO15A	51168	ucsc.edu	37	17	18057479	18057479	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr17:18057479T>C	ENST00000205890.5	+	44	8461	c.8123T>C	c.(8122-8124)gTg>gCg	p.V2708A	MYO15A_ENST00000418233.3_5'UTR|MYO15A_ENST00000585180.1_5'UTR	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2708	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					AGCCATCCTGTGCAGCTTGAC	0.612																																						.											0													70.0	81.0	78.0					17																	18057479		2074	4222	6296	SO:0001583	missense	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8123T>C	17.37:g.18057479T>C	ENSP00000205890:p.Val2708Ala		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753191	0.69648	.	.	ENSG00000091536	ENST00000205890	D	0.87966	-2.32	5.19	5.19	0.71726	.	.	.	.	.	D	0.83348	0.5235	M	0.65677	2.01	0.80722	D	1	P	0.43788	0.817	B	0.36959	0.237	T	0.82806	-0.0275	9	0.37606	T	0.19	.	10.2936	0.43610	0.0:0.0803:0.0:0.9197	.	2708	Q9UKN7	MYO15_HUMAN	A	2708	ENSP00000205890:V2708A	ENSP00000205890:V2708A	V	+	2	0	MYO15A	17998204	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.531000	0.60602	1.952000	0.56665	0.460000	0.39030	GTG		0.612	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
SBNO2	22904	ucsc.edu;bcgsc.ca	37	19	1116843	1116843	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr19:1116843A>G	ENST00000361757.3	-	16	2024	c.1787T>C	c.(1786-1788)tTc>tCc	p.F596S	SBNO2_ENST00000587024.1_Missense_Mutation_p.F586S|SBNO2_ENST00000438103.2_Missense_Mutation_p.F539S	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	596					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGAGACGAAGCAGTTGAG	0.677																																						.											0													35.0	42.0	40.0					19																	1116843		2167	4255	6422	SO:0001583	missense	22904			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1787T>C	19.37:g.1116843A>G	ENSP00000354733:p.Phe596Ser		A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.142945	0.57044	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.81240	0.4781	M	0.90705	3.14	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.994;0.998;0.999	D	0.84066	0.0377	9	0.49607	T	0.09	-26.5993	12.8397	0.57794	1.0:0.0:0.0:0.0	.	596;596;539	B4DV91;Q9Y2G9;Q9Y2G9-3	.;SBNO2_HUMAN;.	S	596;539;620	.	ENSP00000250872:F620S	F	-	2	0	SBNO2	1067843	1.000000	0.71417	0.997000	0.53966	0.026000	0.11368	8.873000	0.92357	1.879000	0.54435	0.460000	0.39030	TTC		0.677	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
USP6	9098	ucsc.edu;mdanderson.org	37	17	5037195	5037195	+	Missense_Mutation	SNP	G	G	A	rs74900103		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr17:5037195G>A	ENST00000574788.1	+	15	2628	c.398G>A	c.(397-399)aGg>aAg	p.R133K	USP6_ENST00000304328.5_5'UTR|USP6_ENST00000332776.4_Missense_Mutation_p.R133K|USP6_ENST00000250066.6_Missense_Mutation_p.R133K			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	133	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ATGAAGGAGAGGGGCAAGAGG	0.547			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													185.0	166.0	173.0					17																	5037195		2203	4300	6503	SO:0001583	missense	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.398G>A	17.37:g.5037195G>A	ENSP00000460380:p.Arg133Lys		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	G	0.090	-1.168985	0.01660	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.26373	1.74;1.74	0.862	-1.72	0.08107	Rab-GAP/TBC domain (4);	0.104487	0.64402	N	0.000003	T	0.05135	0.0137	N	0.01576	-0.805	0.34807	D	0.737346	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40459	-0.9562	10	0.05351	T	0.99	.	2.1908	0.03898	0.3285:0.3345:0.337:0.0	.	133;133	B9A6N0;P35125	.;UBP6_HUMAN	K	133	ENSP00000328010:R133K;ENSP00000250066:R133K	ENSP00000250066:R133K	R	+	2	0	USP6	4977919	0.068000	0.21057	0.092000	0.20876	0.093000	0.18481	0.731000	0.26058	-1.381000	0.02112	-1.368000	0.01194	AGG		0.547	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
ZMYM4	9202	ucsc.edu	37	1	35865108	35865108	+	Silent	SNP	A	A	G			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:35865108A>G	ENST00000314607.6	+	23	3539	c.3459A>G	c.(3457-3459)ggA>ggG	p.G1153G	ZMYM4_ENST00000373297.2_Silent_p.G1064G	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1153					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTAATAAAGGACAGGGAATCC	0.408																																						.											0													83.0	83.0	83.0					1																	35865108		2203	4300	6503	SO:0001819	synonymous_variant	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.3459A>G	1.37:g.35865108A>G			A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Silent	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	A	9.861	1.196401	0.22037	.	.	ENSG00000146463	ENST00000457946	.	.	.	5.38	0.146	0.14833	.	.	.	.	.	T	0.42517	0.1206	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20273	-1.0280	4	.	.	.	-10.5428	2.3725	0.04334	0.5597:0.1194:0.2068:0.1141	.	.	.	.	A	812	.	.	T	+	1	0	ZMYM4	35637695	0.998000	0.40836	0.994000	0.49952	0.974000	0.67602	0.553000	0.23391	-0.188000	0.10499	-1.887000	0.00540	ACA		0.408	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
ACSF3	197322	mdanderson.org	37	16	89167138	89167138	+	Missense_Mutation	SNP	G	G	C	rs11547019	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr16:89167138G>C	ENST00000317447.4	+	3	426	c.49G>C	c.(49-51)Gcg>Ccg	p.A17P	ACSF3_ENST00000406948.3_Missense_Mutation_p.A17P|ACSF3_ENST00000378345.4_Intron	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	17			A -> P (in dbSNP:rs11547019). {ECO:0000269|PubMed:15489334}.		fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CTGCGCCTTGGCGTCCTGCCG	0.682													G|||	282	0.0563099	0.0015	0.0317	5008	,	,		14874	0.1597		0.0577	False		,,,				2504	0.0399					.											0								G	PRO/ALA,PRO/ALA	30,4298		0,30,2134	16.0	18.0	17.0		49,49	0.4	0.0	16	dbSNP_120	17	334,8134		7,320,3907	yes	missense,missense	ACSF3	NM_001127214.2,NM_174917.3	27,27	7,350,6041	CC,CG,GG		3.9443,0.6932,2.8446	benign,benign	17/577,17/577	89167138	364,12432	2164	4234	6398	SO:0001583	missense	197322			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.49G>C	16.37:g.89167138G>C	ENSP00000320646:p.Ala17Pro		A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	37	CCDS10974.1	150	0.06868131868131869	0	0.0	5	0.013812154696132596	96	0.16783216783216784	49	0.06464379947229551	G	12.21	1.870413	0.33069	0.006932	0.039443	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.57595	0.81;0.39;0.81	5.02	0.452	0.16634	.	1.418140	0.04327	N	0.351700	T	0.00144	0.0004	L	0.48362	1.52	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.04427	-1.0952	10	0.35671	T	0.21	-22.3275	2.9079	0.05727	0.0869:0.3051:0.3296:0.2784	rs11547019	17	Q4G176	ACSF3_HUMAN	P	17	ENSP00000320646:A17P;ENSP00000440734:A17P;ENSP00000384627:A17P	ENSP00000320646:A17P	A	+	1	0	ACSF3	87694639	0.000000	0.05858	0.009000	0.14445	0.070000	0.16714	-0.170000	0.09897	0.149000	0.19098	0.650000	0.86243	GCG		0.682	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
ADAMTS7	11173	mdanderson.org	37	15	79057989	79057989	+	Missense_Mutation	SNP	C	C	T	rs200769684		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:79057989C>T	ENST00000388820.4	-	19	4474	c.4264G>A	c.(4264-4266)Gag>Aag	p.E1422K	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1422	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E1422K(3)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCACTTGCCTCGCTCCAGTTT	0.657																																						.											3	Substitution - Missense(3)	skin(2)|NS(1)											31.0	34.0	33.0					15																	79057989		2188	4275	6463	SO:0001583	missense	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4264G>A	15.37:g.79057989C>T	ENSP00000373472:p.Glu1422Lys		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	c	8.994	0.978370	0.18812	.	.	ENSG00000136378	ENST00000388820	T	0.54279	0.58	4.21	-8.41	0.00961	.	0.609972	0.15843	N	0.241932	T	0.35248	0.0925	L	0.51914	1.62	0.19775	N	0.999954	B	0.14012	0.009	B	0.10450	0.005	T	0.45483	-0.9258	10	0.07325	T	0.83	.	13.64	0.62243	0.0:0.6736:0.1359:0.1905	.	1422	Q9UKP4	ATS7_HUMAN	K	1422	ENSP00000373472:E1422K	ENSP00000373472:E1422K	E	-	1	0	ADAMTS7	76845044	0.010000	0.17322	0.706000	0.30403	0.289000	0.27227	-0.206000	0.09398	-1.547000	0.01715	-2.551000	0.00177	GAG		0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
RP11-93K22.13	0	mdanderson.org	37	3	129810128	129810128	+	lincRNA	SNP	G	G	A	rs6804080	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr3:129810128G>A	ENST00000514010.1	-	0	248				ALG1L2_ENST00000507643.1_RNA																							ACGACAAGCCGGCATCTTTCT	0.562													g|||	949	0.189497	0.2595	0.1758	5008	,	,		19352	0.004		0.3032	False		,,,				2504	0.1789					.											0																																												644974																															3.37:g.129810128G>A				Silent	SNP	ENST00000514010.1	37																																																																																					0.562	RP11-93K22.13-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000358040.1		
ALPP	250	mdanderson.org	37	2	233246249	233246249	+	Missense_Mutation	SNP	A	A	G	rs1048994		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr2:233246249A>G	ENST00000392027.2	+	11	1621	c.1352A>G	c.(1351-1353)gAa>gGa	p.E451G	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	451			E -> G (in dbSNP:rs1048994).		dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CCCCTGGACGAAGAGACCCAC	0.652																																						.											0													29.0	32.0	31.0					2																	233246249		2202	4300	6502	SO:0001583	missense	250			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1352A>G	2.37:g.233246249A>G	ENSP00000375881:p.Glu451Gly		P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	A	9.569	1.120522	0.20877	.	.	ENSG00000163283	ENST00000392027	D	0.95788	-3.81	2.35	0.169	0.15017	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.915038	0.09277	N	0.824307	D	0.85204	0.5643	N	0.04297	-0.235	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74137	-0.3762	10	0.27082	T	0.32	.	3.4287	0.07420	0.1752:0.5616:0.1571:0.1061	rs1048994;rs2678507;rs3189067;rs17416148	451	P05187	PPB1_HUMAN	G	451	ENSP00000375881:E451G	ENSP00000375881:E451G	E	+	2	0	ALPP	232954493	0.000000	0.05858	0.003000	0.11579	0.183000	0.23260	0.070000	0.14573	-0.126000	0.11682	0.254000	0.18369	GAA		0.652	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
BAZ1B	9031	mdanderson.org	37	7	72861634	72861634	+	Silent	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr7:72861634C>T	ENST00000339594.4	-	16	4142	c.3804G>A	c.(3802-3804)gaG>gaA	p.E1268E	BAZ1B_ENST00000404251.1_Silent_p.E1268E	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1268	Poly-Glu.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				cctcctcctcctcttcttcct	0.438																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)	.											0													178.0	145.0	156.0					7																	72861634		2203	4300	6503	SO:0001819	synonymous_variant	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.3804G>A	7.37:g.72861634C>T			B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1																																																																																				0.438	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
DCAF8L2	347442	mdanderson.org	37	X	27765417	27765417	+	Silent	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:27765417G>A	ENST00000451261.2	+	5	804	c.405G>A	c.(403-405)gaG>gaA	p.E135E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	135	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggaggaggaggaggaggagg	0.577																																						.											0													15.0	14.0	14.0					X																	27765417		692	1587	2279	SO:0001819	synonymous_variant	347442				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.405G>A	X.37:g.27765417G>A			B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																				0.577	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
ENOSF1	55556	mdanderson.org	37	18	712568	712568	+	Missense_Mutation	SNP	G	G	A	rs3786349	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr18:712568G>A	ENST00000251101.7	-	1	108	c.20C>T	c.(19-21)tCc>tTc	p.S7F	ENOSF1_ENST00000340116.7_5'Flank|ENOSF1_ENST00000539164.1_Missense_Mutation_p.S7F|ENOSF1_ENST00000580982.1_Missense_Mutation_p.S7F|ENOSF1_ENST00000383578.3_5'UTR	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	7					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CGAGAGCCGGGAGATCCTGCC	0.766													G|||	601	0.120008	0.0265	0.0778	5008	,	,		9725	0.2748		0.1412	False		,,,				2504	0.0951					.											0								G	,PHE/SER	105,3179		1,103,1538	5.0	5.0	5.0		,20	-1.5	0.0	18	dbSNP_107	5	546,5710		15,516,2597	no	utr-5,missense	ENOSF1	NM_001126123.3,NM_017512.5	,155	16,619,4135	AA,AG,GG		8.7276,3.1973,6.8239	,benign	,7/444	712568	651,8889	1642	3128	4770	SO:0001583	missense	55556			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.20C>T	18.37:g.712568G>A	ENSP00000251101:p.Ser7Phe		A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	ENST00000251101.7	37	CCDS11822.1	329	0.15064102564102563	28	0.056910569105691054	34	0.09392265193370165	161	0.28146853146853146	106	0.13984168865435356	G	10.32	1.318029	0.23994	0.031973	0.087276	ENSG00000132199	ENST00000251101;ENST00000539164	T;T	0.42131	0.98;0.98	4.19	-1.5	0.08691	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B	0.30455	0.28	B	0.25506	0.061	T	0.26018	-1.0115	8	0.42905	T	0.14	.	10.165	0.42875	0.083:0.5405:0.3765:0.0	rs3786349	7	Q7L5Y1	ENOF1_HUMAN	F	7	ENSP00000251101:S7F;ENSP00000446321:S7F	ENSP00000251101:S7F	S	-	2	0	ENOSF1	702568	0.079000	0.21365	0.023000	0.16930	0.684000	0.39900	0.057000	0.14279	-0.433000	0.07286	0.313000	0.20887	TCC		0.766	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
EP400	57634	mdanderson.org	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000330386.6_Silent_p.Q2644Q|EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102					.											17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)											28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EPB41L4B	54566	mdanderson.org	37	9	112082510	112082510	+	Missense_Mutation	SNP	C	C	T	rs117569740	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr9:112082510C>T	ENST00000374566.3	-	1	734	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	EPB41L4B_ENST00000374557.4_Missense_Mutation_p.V73M	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	73				V -> M (in Ref. 2; BAA96079). {ECO:0000305}.	actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGATGTGCACGGCCGCGCCG	0.796													c|||	470	0.0938498	0.0129	0.072	5008	,	,		4964	0.1855		0.159	False		,,,				2504	0.0573					.											0									MET/VAL,MET/VAL	73,2621		0,73,1274	2.0	3.0	2.0		217,217	2.9	1.0	9	dbSNP_132	2	697,5609		29,639,2485	no	missense,missense	EPB41L4B	NM_018424.2,NM_019114.3	21,21	29,712,3759	TT,TC,CC		11.053,2.7097,8.5556	benign,benign	73/519,73/901	112082510	770,8230	1347	3153	4500	SO:0001583	missense	54566			AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.217G>A	9.37:g.112082510C>T	ENSP00000363694:p.Val73Met		Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	37	CCDS43859.1	304	0.1391941391941392	12	0.024390243902439025	31	0.0856353591160221	123	0.21503496503496503	138	0.1820580474934037	c	16.13	3.036368	0.54896	0.027097	0.11053	ENSG00000095203	ENST00000374566;ENST00000374557	D;D	0.84070	-1.77;-1.8	2.94	2.94	0.34122	.	.	.	.	.	T	0.00178	0.0005	N	0.24115	0.695	0.27693	P	0.9460421	D;D	0.89917	1.0;0.999	D;D	0.66847	0.947;0.92	T	0.07597	-1.0764	8	0.35671	T	0.21	.	10.0702	0.42328	0.0:1.0:0.0:0.0	.	73;73	Q9H329-2;Q9H329	.;E41LB_HUMAN	M	73	ENSP00000363694:V73M;ENSP00000363685:V73M	ENSP00000363685:V73M	V	-	1	0	EPB41L4B	111122331	0.998000	0.40836	0.998000	0.56505	0.000000	0.00434	1.975000	0.40569	1.467000	0.48044	0.000000	0.15137	GTG		0.796	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	
FA2H	79152	mdanderson.org	37	16	74808425	74808425	+	Silent	SNP	G	G	A	rs929881	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr16:74808425G>A	ENST00000219368.3	-	1	298	c.229C>T	c.(229-231)Ctg>Ttg	p.L77L	FA2H_ENST00000544337.1_5'UTR	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	77	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						TACTGCTCCAGCCAGCGGCGC	0.761													A|||	1247	0.249002	0.447	0.2046	5008	,	,		11282	0.0377		0.3151	False		,,,				2504	0.1626					.											0								A		1423,2211		327,769,721	5.0	6.0	5.0		229	2.9	1.0	16	dbSNP_86	5	2074,5176		390,1294,1941	no	coding-synonymous	FA2H	NM_024306.4		717,2063,2662	AA,AG,GG		28.6069,39.158,32.1297		77/373	74808425	3497,7387	1817	3625	5442	SO:0001819	synonymous_variant	79152			BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.229C>T	16.37:g.74808425G>A			B7Z8T6|O75213|Q96DK1|Q9H1A5	Silent	SNP	ENST00000219368.3	37	CCDS10911.1																																																																																				0.761	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306	
ERICH6B	220081	mdanderson.org	37	13	46170726	46170726	+	Missense_Mutation	SNP	A	A	G	rs28548352|rs142875900|rs375947127	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr13:46170726A>G	ENST00000298738.2	-	3	579	c.415T>C	c.(415-417)Tat>Cat	p.Y139H		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		139	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTCCCCAGATActcttcctcc	0.488																																						.											0													134.0	79.0	95.0					13																	46170726		692	1566	2258	SO:0001583	missense	220081																														ENST00000298738.2:c.415T>C	13.37:g.46170726A>G	ENSP00000298738:p.Tyr139His		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089484	0.07053	.	.	ENSG00000165837	ENST00000298738	T	0.06294	3.32	2.4	-0.599	0.11645	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.27594	0.182;0.071	B;B	0.26310	0.068;0.009	T	0.43925	-0.9361	9	0.87932	D	0	0.4727	0.1132	0.00058	0.3431:0.2385:0.1823:0.236	rs28548352	139;139	A2VDI6;Q5W0A0	.;F194B_HUMAN	H	139	ENSP00000298738:Y139H	ENSP00000298738:Y139H	Y	-	1	0	FAM194B	45068727	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-6.553000	0.00061	0.160000	0.19432	0.358000	0.22013	TAT		0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	mdanderson.org	37	13	46170735	46170735	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs28460344|rs375947127	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr13:46170735C>T	ENST00000298738.2	-	3	570	c.406G>A	c.(406-408)Gag>Aag	p.E136K		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TActcttcctcctccagatgc	0.483													C|||	1385	0.276558	0.1362	0.4308	5008	,	,		19628	0.1627		0.494	False		,,,				2504	0.2505					.											0													134.0	78.0	95.0					13																	46170735		692	1565	2257	SO:0001583	missense	220081																														ENST00000298738.2:c.406G>A	13.37:g.46170735C>T	ENSP00000298738:p.Glu136Lys		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869929	0.17322	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.1	0.141	0.14811	.	.	.	.	.	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.001	T	0.43015	-0.9417	9	0.87932	D	0	-1.9096	5.6342	0.17528	0.0:0.5396:0.0:0.4604	rs28460344	136;136	A2VDI6;Q5W0A0	.;F194B_HUMAN	K	136	ENSP00000298738:E136K	ENSP00000298738:E136K	E	-	1	0	FAM194B	45068736	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.079000	0.14782	-0.180000	0.10637	-1.380000	0.01176	GAG		0.483	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	mdanderson.org	37	13	46170737	46170737	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs375947127|rs117004691	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr13:46170737T>C	ENST00000298738.2	-	3	568	c.404A>G	c.(403-405)gAg>gGg	p.E135G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						ctcttcctcctccagatgctc	0.493													T|||	1383	0.276158	0.1362	0.4308	5008	,	,		19669	0.1607		0.494	False		,,,				2504	0.2505					.											0													133.0	77.0	94.0					13																	46170737		692	1565	2257	SO:0001583	missense	220081																														ENST00000298738.2:c.404A>G	13.37:g.46170737T>C	ENSP00000298738:p.Glu135Gly		Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	8.448	0.852491	0.17106	.	.	ENSG00000165837	ENST00000298738	T	0.06608	3.28	2.24	-2.01	0.07410	.	.	.	.	.	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40534	-0.9558	9	0.87932	D	0	-2.345	6.5075	0.22204	0.0:0.4358:0.0:0.5642	.	135;135	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	135	ENSP00000298738:E135G	ENSP00000298738:E135G	E	-	2	0	FAM194B	45068738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.707000	0.05041	-0.286000	0.09076	-1.636000	0.00776	GAG		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
FBXO41	150726	mdanderson.org	37	2	73492614	73492614	+	Missense_Mutation	SNP	A	A	T	rs526106	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr2:73492614A>T	ENST00000521871.1	-	5	1775	c.1360T>A	c.(1360-1362)Tcc>Acc	p.S454T	FBXO41_ENST00000520530.2_Missense_Mutation_p.S454T|FBXO41_ENST00000295133.5_Missense_Mutation_p.S515T			Q8TF61	FBX41_HUMAN	F-box protein 41	454				S -> T (in Ref. 3; BAB85526). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						GGGGGCTGGGACCGCTCTGAG	0.716													A|||	1654	0.330272	0.2837	0.2421	5008	,	,		11856	0.4752		0.2674	False		,,,				2504	0.3712					.											0								A	THR/SER	1058,2838		144,770,1034	15.0	18.0	17.0		1360	-0.8	0.9	2	dbSNP_83	17	2135,6093		283,1569,2262	no	missense	FBXO41	NM_001080410.2	58	427,2339,3296	TT,TA,AA		25.948,27.1561,26.3362	benign	454/876	73492614	3193,8931	1948	4114	6062	SO:0001583	missense	150726			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1360T>A	2.37:g.73492614A>T	ENSP00000428646:p.Ser454Thr		G3V0Z7|Q2M1V8	Missense_Mutation	SNP	ENST00000521871.1	37	CCDS46337.2	714	0.3269230769230769	138	0.2804878048780488	100	0.27624309392265195	275	0.4807692307692308	201	0.26517150395778366	A	13.31	2.199095	0.38806	0.271561	0.25948	ENSG00000163013	ENST00000295133;ENST00000521871	.	.	.	5.52	-0.818	0.10833	.	0.643686	0.15471	N	0.260595	T	0.00012	0.0000	N	0.14661	0.345	0.44611	P	0.0024170000000000025	.	.	.	.	.	.	T	0.43523	-0.9386	6	0.07030	T	0.85	.	0.8479	0.01166	0.1821:0.347:0.2234:0.2476	rs526106	.	.	.	T	515;454	.	ENSP00000295133:S515T	S	-	1	0	FBXO41	73346122	0.998000	0.40836	0.946000	0.38457	0.962000	0.63368	0.752000	0.26362	-0.113000	0.11958	0.454000	0.30748	TCC		0.716	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377381.1		
FRG1B	284802	mdanderson.org	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr20:29625875T>C	ENST00000278882.3	+	5	499	c.119T>C	c.(118-120)aTc>aCc	p.I40T	FRG1B_ENST00000439954.2_Missense_Mutation_p.I45T|FRG1B_ENST00000358464.4_Missense_Mutation_p.I40T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	40								p.I40T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGTACAGAATCGCCCTGAAA	0.358																																						.											4	Substitution - Missense(4)	prostate(4)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.119T>C	20.37:g.29625875T>C	ENSP00000278882:p.Ile40Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	10.51	1.369778	0.24771	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.51071	0.72	1.68	1.68	0.24146	.	0.052751	0.64402	D	0.000001	T	0.59865	0.2225	.	.	.	0.51482	D	0.999924	P	0.49862	0.929	D	0.64687	0.928	T	0.59386	-0.7464	9	0.52906	T	0.07	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	45	F5H5R5	.	T	40;45;40	ENSP00000408863:I45T	ENSP00000278882:I40T	I	+	2	0	FRG1B	28239536	1.000000	0.71417	0.982000	0.44146	0.025000	0.11179	6.565000	0.73974	1.028000	0.39785	0.155000	0.16302	ATC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HOMEZ	57594	mdanderson.org	37	14	23744823	23744823	+	Missense_Mutation	SNP	A	A	T	rs3208861	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr14:23744823A>T	ENST00000357460.5	-	2	1778	c.1614T>A	c.(1612-1614)gaT>gaA	p.D538E	HOMEZ_ENST00000431326.2_Missense_Mutation_p.D540E|HOMEZ_ENST00000561013.1_Missense_Mutation_p.D540E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	538	Poly-Asp.			D -> E (in Ref. 5; AAI30393). {ECO:0000305}.|Missing (in Ref. 3; BAG63992). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcatcatcatcttcctcct	0.473																																						.											0													38.0	39.0	38.0					14																	23744823		2191	4254	6445	SO:0001583	missense	57594			AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1614T>A	14.37:g.23744823A>T	ENSP00000350049:p.Asp538Glu		A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	ENST00000357460.5	37	CCDS45085.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.558686	0.00136	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.70631	-0.5;-0.5	.	.	.	Armadillo-like helical (1);	.	.	.	.	T	0.40522	0.1120	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33752	-0.9856	7	0.02654	T	1	.	.	.	.	rs3208861	540;538	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	E	538;540	ENSP00000350049:D538E;ENSP00000406579:D540E	ENSP00000350049:D538E	D	-	3	2	HOMEZ	22814663	0.164000	0.22935	0.167000	0.22817	0.037000	0.13140	-2.011000	0.01452	-1.137000	0.02888	-1.213000	0.01624	GAT		0.473	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
HOMEZ	57594	mdanderson.org	37	14	23744826	23744826	+	Silent	SNP	T	T	C	rs35076736|rs76331664|rs67447855	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr14:23744826T>C	ENST00000357460.5	-	2	1775	c.1611A>G	c.(1609-1611)gaA>gaG	p.E537E	HOMEZ_ENST00000431326.2_Silent_p.E539E|HOMEZ_ENST00000561013.1_Silent_p.E539E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	537	Poly-Asp.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcatcatcttcctcctcct	0.483																																						.											0													39.0	39.0	39.0					14																	23744826		2192	4262	6454	SO:0001819	synonymous_variant	57594			AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1611A>G	14.37:g.23744826T>C			A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Silent	SNP	ENST00000357460.5	37	CCDS45085.1																																																																																				0.483	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
KIF26B	55083	mdanderson.org	37	1	245851609	245851609	+	Missense_Mutation	SNP	C	C	G	rs150834033	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:245851609C>G	ENST00000407071.2	+	12	5764	c.5324C>G	c.(5323-5325)cCc>cGc	p.P1775R	KIF26B_ENST00000366518.4_Missense_Mutation_p.P1394R	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1775	Ser-rich.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AGCTCGCCCCCCGGTGGGAAG	0.721													C|||	70	0.0139776	0.0023	0.0274	5008	,	,		10300	0.002		0.0308	False		,,,				2504	0.0153					.											0								C	ARG/PRO	25,3179		2,21,1579	8.0	9.0	9.0		5324	5.3	0.0	1	dbSNP_134	9	219,6715		2,215,3250	yes	missense	KIF26B	NM_018012.3	103	4,236,4829	GG,GC,CC		3.1584,0.7803,2.4068	probably-damaging	1775/2109	245851609	244,9894	1602	3467	5069	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5324C>G	1.37:g.245851609C>G	ENSP00000385545:p.Pro1775Arg		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	37	0.01694139194139194	4	0.008130081300813009	10	0.027624309392265192	1	0.0017482517482517483	22	0.029023746701846966	C	12.79	2.043373	0.36085	0.007803	0.031584	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.83837	-1.77;-1.76	5.29	5.29	0.74685	.	.	.	.	.	T	0.76744	0.4030	M	0.78801	2.425	0.80722	D	1	D;D	0.57899	0.981;0.966	P;P	0.52758	0.708;0.564	D	0.85045	0.0925	9	0.87932	D	0	.	18.9252	0.92541	0.0:1.0:0.0:0.0	.	1394;1775	B7WPD9;Q2KJY2	.;KI26B_HUMAN	R	1775;1394;1391	ENSP00000385545:P1775R;ENSP00000355475:P1394R	ENSP00000355475:P1394R	P	+	2	0	KIF26B	243918232	0.998000	0.40836	0.016000	0.15963	0.081000	0.17604	7.547000	0.82146	2.475000	0.83589	0.462000	0.41574	CCC		0.721	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KRTAP5-4	387267	mdanderson.org	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																						.											1	Substitution - coding silent(1)	kidney(1)											4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A				Silent	SNP	ENST00000399682.1	37																																																																																					0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
MAML2	84441	mdanderson.org	37	11	95825383	95825383	+	Silent	SNP	C	C	T	rs113349418|rs141671766|rs60727839	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:95825383C>T	ENST00000524717.1	-	2	3096	c.1812G>A	c.(1810-1812)caG>caA	p.Q604Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	604					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gttgctgctgctgctgctgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													19.0	23.0	22.0					11																	95825383		1910	3681	5591	SO:0001819	synonymous_variant	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1812G>A	11.37:g.95825383C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	mdanderson.org	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	1	Substitution - coding silent(1)	kidney(1)											28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MRPS30	10884	mdanderson.org	37	5	44809454	44809454	+	Silent	SNP	A	A	G	rs142383960		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr5:44809454A>G	ENST00000507110.1	+	1	428	c.390A>G	c.(388-390)gaA>gaG	p.E130E	RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000508945.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	130					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					ccgagcccgaacccgaacctg	0.706																																						.											0													13.0	15.0	14.0					5																	44809454		2196	4295	6491	SO:0001819	synonymous_variant	10884			AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.390A>G	5.37:g.44809454A>G			Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Silent	SNP	ENST00000507110.1	37	CCDS3951.1																																																																																				0.706	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640	
MSANTD1	345222	mdanderson.org	37	4	3257593	3257593	+	Silent	SNP	C	C	T	rs362287	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr4:3257593C>T	ENST00000438480.2	+	3	2485	c.738C>T	c.(736-738)cgC>cgT	p.R246R	MSANTD1_ENST00000510580.1_Silent_p.R246R|MSANTD1_ENST00000507492.1_Silent_p.R233R	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	246										endometrium(1)|lung(2)	3						AGGTGCGCCGCGTGCTGGACC	0.667													C|||	1288	0.257188	0.0802	0.3069	5008	,	,		14882	0.3343		0.3787	False		,,,				2504	0.2566					.											0								C		442,3382		40,362,1510	7.0	8.0	8.0		738	-0.3	1.0	4	dbSNP_79	8	2174,5164		319,1536,1814	no	coding-synonymous	C4orf44	NM_001042690.1		359,1898,3324	TT,TC,CC		29.6266,11.5586,23.4367		246/279	3257593	2616,8546	1912	3669	5581	SO:0001819	synonymous_variant	345222				CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.738C>T	4.37:g.3257593C>T			C9J6V0	Silent	SNP	ENST00000438480.2	37	CCDS47003.1																																																																																				0.667	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
NRD1	4898	mdanderson.org	37	1	52306075	52306075	+	Silent	SNP	T	T	C	rs78724482	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:52306075T>C	ENST00000354831.7	-	2	642	c.453A>G	c.(451-453)gaA>gaG	p.E151E	NRD1_ENST00000544028.1_Silent_p.E19E|NRD1_ENST00000539524.1_Silent_p.E19E|NRD1_ENST00000352171.7_Silent_p.E151E|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						cttcttcttcttcctccacct	0.388																																						.											0													165.0	136.0	146.0					1																	52306075		2203	4300	6503	SO:0001819	synonymous_variant	4898			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.453A>G	1.37:g.52306075T>C			A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Silent	SNP	ENST00000354831.7	37	CCDS559.1																																																																																				0.388	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
OR4N3P	390539	mdanderson.org	37	15	22413717	22413717	+	IGR	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:22413717C>T								RP11-69H14.6 (29909 upstream) : RP11-2F9.4 (20172 downstream)																							GGTGGACTTCCTCTCTGAGAA	0.517																																						.											0																																										SO:0001628	intergenic_variant	390539																															15.37:g.22413717C>T				RNA	SNP		37																																																																																				0	0.517								
PI4KAP2	375133	mdanderson.org	37	22	21829555	21829555	+	RNA	SNP	T	T	G	rs377578228		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr22:21829555T>G	ENST00000450651.1	-	0	1783							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.I530L(4)		endometrium(3)|urinary_tract(1)	4						TCCAACATGATAGTGACCAGG	0.607																																						.											4	Substitution - Missense(4)	endometrium(3)|urinary_tract(1)											26.0	21.0	23.0					22																	21829555		692	1582	2274			375133					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21829555T>G			Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	ENST00000450651.1	37																																																																																					0.607	PI4KAP2-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000334908.1		
ROBO3	64221	mdanderson.org	37	11	124750455	124750455	+	Missense_Mutation	SNP	G	G	A	rs200255001|rs199686375		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:124750455G>A	ENST00000397801.1	+	27	4292	c.4100G>A	c.(4099-4101)cGg>cAg	p.R1367Q	ROBO3_ENST00000525482.1_3'UTR|ROBO3_ENST00000538940.1_Missense_Mutation_p.R1345Q|ROBO3_ENST00000543966.1_Missense_Mutation_p.R130Q	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1367					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.R1367Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		agccggagtcggagtcagagc	0.657													-|||	1	0.000199681	0.0	0.0	5008	,	,		15316	0.0		0.0	False		,,,				2504	0.001					.											1	Substitution - Missense(1)	central_nervous_system(1)											14.0	22.0	19.0					11																	124750455		2003	4113	6116	SO:0001583	missense	64221			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4100G>A	11.37:g.124750455G>A	ENSP00000380903:p.Arg1367Gln			Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	-	9.957	1.221827	0.22457	.	.	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.63744	-0.06;-0.05;0.9	.	.	.	.	2.111980	0.03039	N	0.153117	T	0.44414	0.1292	N	0.22421	0.69	0.25439	N	0.98812	B	0.11235	0.004	B	0.01281	0.0	T	0.13548	-1.0505	9	0.26408	T	0.33	.	3.585	0.07967	0.0:0.5:0.5:0.0	.	1367	Q96MS0	ROBO3_HUMAN	Q	1367;1345;130	ENSP00000380903:R1367Q;ENSP00000441797:R1345Q;ENSP00000438799:R130Q	ENSP00000380903:R1367Q	R	+	2	0	ROBO3	124255665	0.941000	0.31946	0.996000	0.52242	0.523000	0.34469	-0.157000	0.10085	-0.000000	0.14550	0.000000	0.15137	CGG		0.657	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
S1PR2	9294	mdanderson.org	37	19	10334663	10334663	+	Silent	SNP	T	T	G	rs2116942	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr19:10334663T>G	ENST00000590320.1	-	2	1029	c.919A>C	c.(919-921)Agg>Cgg	p.R307R	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	307					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						ACCCCCGGCCTCCAGCACTGC	0.706													G|||	2764	0.551917	0.7678	0.4568	5008	,	,		9629	0.3095		0.5895	False		,,,				2504	0.5389				Pancreas(194;229 3020 15179 45747)	.											0								G		3127,1219		1156,815,202	15.0	18.0	17.0		919	1.6	0.4	19	dbSNP_96	17	5012,3506		1509,1994,756	no	coding-synonymous	S1PR2	NM_004230.3		2665,2809,958	GG,GT,TT		41.1599,28.0488,36.7304		307/354	10334663	8139,4725	2173	4259	6432	SO:0001819	synonymous_variant	9294			AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.919A>C	19.37:g.10334663T>G			Q86UN8	Silent	SNP	ENST00000590320.1	37	CCDS12229.1																																																																																				0.706	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
SLC35G5	83650	mdanderson.org	37	8	11188748	11188748	+	Missense_Mutation	SNP	C	C	A	rs538767857	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr8:11188748C>A	ENST00000382435.4	+	1	352	c.133C>A	c.(133-135)Ctg>Atg	p.L45M		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	45						integral component of membrane (GO:0016021)											GGTGGCCCTGCTGGGTGGGGG	0.677													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		16814	0.001		0.0	False		,,,				2504	0.0					.											0													47.0	54.0	52.0					8																	11188748		2203	4300	6503	SO:0001583	missense	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.133C>A	8.37:g.11188748C>A	ENSP00000371872:p.Leu45Met		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	C	8.482	0.859971	0.17178	.	.	ENSG00000177710	ENST00000382435	T	0.34275	1.37	0.34	0.34	0.15985	.	0.230767	0.22238	N	0.062730	T	0.18841	0.0452	N	0.24115	0.695	0.31574	N	0.655966	B	0.13145	0.007	B	0.14578	0.011	T	0.06570	-1.0819	10	0.52906	T	0.07	-3.4659	2.848	0.05549	0.0:0.5979:0.0:0.4021	.	45	Q96KT7	S35G5_HUMAN	M	45	ENSP00000371872:L45M	ENSP00000371872:L45M	L	+	1	2	SLC35G5	11226158	0.990000	0.36364	0.929000	0.37066	0.229000	0.25112	-0.196000	0.09532	0.426000	0.26116	0.089000	0.15464	CTG		0.677	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
SMARCA2	6595	mdanderson.org	37	9	2039815	2039815	+	Silent	SNP	G	G	A	rs574062756	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr9:2039815G>A	ENST00000382203.1	+	4	914	c.705G>A	c.(703-705)caG>caA	p.Q235Q	SMARCA2_ENST00000491574.1_3'UTR|SMARCA2_ENST00000357248.2_Silent_p.Q235Q|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000349721.2_Silent_p.Q235Q|SMARCA2_ENST00000382194.1_Silent_p.Q235Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	235	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcaacagcagc	0.587													G|||	41	0.0081869	0.0151	0.0029	5008	,	,		10366	0.0089		0.0	False		,,,				2504	0.0102					.											0													10.0	13.0	12.0					9																	2039815		2161	4205	6366	SO:0001819	synonymous_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.705G>A	9.37:g.2039815G>A			B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																				0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TAF7L	54457	mdanderson.org	37	X	100531437	100531437	+	Silent	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:100531437C>T	ENST00000372907.3	-	10	1040	c.1029G>A	c.(1027-1029)gaG>gaA	p.E343E	TAF7L_ENST00000372905.2_Intron|TAF7L_ENST00000324762.6_Intron|TAF7L_ENST00000356784.1_Silent_p.E257E	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	343	Glu-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						catcctcatcctcatcttcat	0.413																																					Ovarian(104;431 1530 3210 15406 18594)	.											0													210.0	163.0	179.0					X																	100531437		2203	4300	6503	SO:0001819	synonymous_variant	54457			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1029G>A	X.37:g.100531437C>T			Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Silent	SNP	ENST00000372907.3	37	CCDS35347.1																																																																																				0.413	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
TAF7L	54457	mdanderson.org	37	X	100531443	100531443	+	Missense_Mutation	SNP	T	T	A	rs201479972		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:100531443T>A	ENST00000372907.3	-	10	1034	c.1023A>T	c.(1021-1023)gaA>gaT	p.E341D	TAF7L_ENST00000372905.2_Intron|TAF7L_ENST00000324762.6_Intron|TAF7L_ENST00000356784.1_Missense_Mutation_p.E255D	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	341	Glu-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						catcctcatcttcatcatcct	0.423																																					Ovarian(104;431 1530 3210 15406 18594)	.											0													214.0	170.0	185.0					X																	100531443		2203	4300	6503	SO:0001583	missense	54457			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1023A>T	X.37:g.100531443T>A	ENSP00000361998:p.Glu341Asp		Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	t	3.169	-0.170386	0.06461	.	.	ENSG00000102387	ENST00000372907;ENST00000356784	T;T	0.04194	3.68;5.26	4.65	-9.3	0.00649	Armadillo-like helical (1);	0.509071	0.14654	N	0.306382	T	0.00906	0.0030	N	0.00926	-1.1	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.34254	-0.9836	10	0.13853	T	0.58	0.4824	1.2941	0.02066	0.3347:0.1119:0.1394:0.414	.	341	Q5H9L4	TAF7L_HUMAN	D	341;255	ENSP00000361998:E341D;ENSP00000349235:E255D	ENSP00000349235:E255D	E	-	3	2	TAF7L	100418099	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.944000	0.00681	-2.253000	0.00698	-1.727000	0.00703	GAA		0.423	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
TAF7L	54457	mdanderson.org	37	X	100531446	100531446	+	Missense_Mutation	SNP	A	A	C	rs200145772		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:100531446A>C	ENST00000372907.3	-	10	1031	c.1020T>G	c.(1018-1020)gaT>gaG	p.D340E	TAF7L_ENST00000372905.2_Intron|TAF7L_ENST00000324762.6_Intron|TAF7L_ENST00000356784.1_Missense_Mutation_p.D254E	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	340	Glu-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						cctcatcttcatcatcctcat	0.423																																					Ovarian(104;431 1530 3210 15406 18594)	.											0													216.0	172.0	187.0					X																	100531446		2203	4300	6503	SO:0001583	missense	54457			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1020T>G	X.37:g.100531446A>C	ENSP00000361998:p.Asp340Glu		Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	a	1.221	-0.626850	0.03610	.	.	ENSG00000102387	ENST00000372907;ENST00000356784	T;T	0.20463	3.75;2.07	4.65	-8.53	0.00916	Armadillo-like helical (1);	1.425020	0.05265	N	0.516431	T	0.05318	0.0141	N	0.03115	-0.41	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27938	-1.0059	10	0.02654	T	1	0.0484	3.5395	0.07806	0.2328:0.4402:0.222:0.105	.	340	Q5H9L4	TAF7L_HUMAN	E	340;254	ENSP00000361998:D340E;ENSP00000349235:D254E	ENSP00000349235:D254E	D	-	3	2	TAF7L	100418102	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.122000	0.01321	-1.525000	0.01762	-0.457000	0.05445	GAT		0.423	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
TMPRSS13	84000	mdanderson.org	37	11	117789302	117789302	+	Silent	SNP	C	C	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:117789302C>T	ENST00000430170.2	-	2	360	c.273G>A	c.(271-273)ccG>ccA	p.P91P	TMPRSS13_ENST00000445164.2_Silent_p.P91P|TMPRSS13_ENST00000526090.1_Silent_p.P91P|TMPRSS13_ENST00000528626.1_Silent_p.P91P|TMPRSS13_ENST00000524993.1_Silent_p.P91P	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	91	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		ATGCCAGAGCCGGAGATGCCC	0.627																																						.											0													59.0	69.0	65.0					11																	117789302		2036	4169	6205	SO:0001819	synonymous_variant	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.273G>A	11.37:g.117789302C>T			B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	ENST00000430170.2	37	CCDS58185.1																																																																																				0.627	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TMPRSS13	84000	mdanderson.org	37	11	117789342	117789342	+	Missense_Mutation	SNP	T	T	C	rs75037497		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:117789342T>C	ENST00000430170.2	-	2	320	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q78R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	78	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.672																																						.											0													40.0	48.0	46.0					11																	117789342		1932	4119	6051	SO:0001583	missense	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.233A>G	11.37:g.117789342T>C	ENSP00000387702:p.Gln78Arg		B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	t	0.008	-1.884785	0.00532	.	.	ENSG00000137747	ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87966	-2.32;-2.25;-2.25;-2.25;-2.14	3.14	-4.2	0.03823	.	0.847229	0.09877	N	0.744233	T	0.60090	0.2242	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.55780	-0.8087	9	0.11182	T	0.66	.	9.3313	0.38023	0.0:0.381:0.0:0.619	.	78	E9PRA0	.	R	78	ENSP00000435813:Q78R;ENSP00000434279:Q78R;ENSP00000387702:Q78R;ENSP00000394114:Q78R;ENSP00000436502:Q78R	ENSP00000387702:Q78R	Q	-	2	0	TMPRSS13	117294552	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.313000	0.08103	-0.789000	0.04498	-1.186000	0.01703	CAG		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TMPRSS13	84000	mdanderson.org	37	11	117789345	117789345	+	Missense_Mutation	SNP	G	G	C	rs61900347	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:117789345G>C	ENST00000430170.2	-	2	317	c.230C>G	c.(229-231)gCc>gGc	p.A77G	TMPRSS13_ENST00000445164.2_Missense_Mutation_p.A77G|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.A77G	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	77	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		AGATGCCTGGGCTGGAGATGC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		14255	0.002		0.0	False		,,,				2504	0.0					.											0													39.0	48.0	45.0					11																	117789345		1921	4109	6030	SO:0001583	missense	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.230C>G	11.37:g.117789345G>C	ENSP00000387702:p.Ala77Gly		B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	219|219	0.10027472527472528|0.10027472527472528	67|67	0.13617886178861788|0.13617886178861788	52|52	0.143646408839779|0.143646408839779	45|45	0.07867132867132867|0.07867132867132867	55|55	0.07255936675461741|0.07255936675461741	G|G	4.978|4.978	0.181711|0.181711	0.09495|0.09495	.|.	.|.	ENSG00000137747|ENSG00000137747	ENST00000336500|ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	.|D;D;D;D;D	.|0.88431	.|-2.38;-2.36;-2.36;-2.34;-2.24	3.11|3.11	1.04|1.04	0.20106|0.20106	.|.	.|1.049680	.|0.07486	.|N	.|0.904837	.|T	.|0.02380	.|0.0073	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.28776	.|-1.0033	.|9	.|0.20046	.|T	.|0.44	.|.	6.0296|6.0296	0.19673|0.19673	0.1228:0.2258:0.6514:0.0|0.1228:0.2258:0.6514:0.0	rs61900347|rs61900347	.|77	.|E9PRA0	.|.	.|G	-1|77	.|ENSP00000435813:A77G;ENSP00000434279:A77G;ENSP00000387702:A77G;ENSP00000394114:A77G;ENSP00000436502:A77G	.|ENSP00000387702:A77G	.|A	-|-	.|2	.|0	TMPRSS13|TMPRSS13	117294555|117294555	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.105000|0.105000	0.15333|0.15333	-0.045000|-0.045000	0.13468|0.13468	-0.189000|-0.189000	0.12847|0.12847	.|GCC		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TRIOBP	11078	mdanderson.org	37	22	38122448	38122448	+	Silent	SNP	C	C	T	rs739137	byFrequency	TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr22:38122448C>T	ENST00000406386.3	+	7	4140	c.3885C>T	c.(3883-3885)agC>agT	p.S1295S		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1295					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGTGCAGCAGCGGGGGCCGCA	0.726													C|||	1686	0.336661	0.1543	0.2867	5008	,	,		13163	0.5863		0.3877	False		,,,				2504	0.3088					.											0								C		648,3004		99,450,1277	5.0	7.0	6.0		3885	3.6	1.0	22	dbSNP_86	6	3246,4490		767,1712,1389	no	coding-synonymous	TRIOBP	NM_001039141.2		866,2162,2666	TT,TC,CC		41.9597,17.7437,34.1939		1295/2366	38122448	3894,7494	1826	3868	5694	SO:0001819	synonymous_variant	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3885C>T	22.37:g.38122448C>T			B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																				0.726	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
ZFYVE19	84936	mdanderson.org	37	15	41099910	41099910	+	Silent	SNP	A	A	G	rs62018606		TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:41099910A>G	ENST00000355341.4	+	1	624	c.123A>G	c.(121-123)gcA>gcG	p.A41A	ZFYVE19_ENST00000563530.1_3'UTR|ZFYVE19_ENST00000299173.10_Silent_p.A41A|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000570108.1_Intron|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000336455.5_Intron	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	41					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		Ggggcggggcagggcagggaa	0.716																																						.											0													16.0	22.0	20.0					15																	41099910		1992	4147	6139	SO:0001819	synonymous_variant	84936			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.123A>G	15.37:g.41099910A>G			B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Silent	SNP	ENST00000355341.4	37	CCDS42025.1																																																																																				0.716	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418996.1	NM_032850	
PDE4DIP	9659	bcgsc.ca	37	1	144906195	144906195	+	Splice_Site	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:144906195T>C	ENST00000369354.3	-	19	2627	c.2438A>G	c.(2437-2439)gAc>gGc	p.D813G	PDE4DIP_ENST00000313431.9_Splice_Site_p.D976G|PDE4DIP_ENST00000479408.2_Splice_Site_p.D600G|PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000530740.1_Splice_Site_p.D950G|PDE4DIP_ENST00000369356.4_Splice_Site_p.D813G|PDE4DIP_ENST00000369351.3_Splice_Site_p.D813G|PDE4DIP_ENST00000313382.9_Splice_Site_p.D879G|PDE4DIP_ENST00000529945.1_Splice_Site_p.D976G|PDE4DIP_ENST00000369349.3_Splice_Site_p.D813G|PDE4DIP_ENST00000369359.4_Splice_Site_p.D950G			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	813					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CATTTGCAGGTCCTAGAAGTC	0.398			T	PDGFRB	MPD																																	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													77.0	80.0	79.0					1																	144906195		2203	4296	6499	SO:0001630	splice_region_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2437-1A>G	1.37:g.144906195T>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.258082	0.80246	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.18810	4.41;4.34;4.34;4.31;4.24;3.42;3.4;2.32;2.35;2.19	5.97	5.97	0.96955	.	.	.	.	.	T	0.24586	0.0596	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;0.999	D;D;D;D;D	0.91635	0.998;0.981;0.999;0.978;0.985	T	0.02721	-1.1119	9	0.46703	T	0.11	.	12.9928	0.58630	0.0:0.0:0.0:1.0	.	976;813;976;879;813	E9PL24;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;MYOME_HUMAN	G	879;813;813;976;950;950;813;813;976;976;600	ENSP00000327209:D879G;ENSP00000358360:D813G;ENSP00000358363:D813G;ENSP00000435654:D950G;ENSP00000358366:D950G;ENSP00000358357:D813G;ENSP00000358355:D813G;ENSP00000316434:D976G;ENSP00000433392:D976G;ENSP00000436791:D600G	ENSP00000327209:D879G	D	-	2	0	PDE4DIP	143617552	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.735000	0.68587	2.323000	0.78572	0.467000	0.42956	GAC		0.398	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	Missense_Mutation
FMN2	56776	bcgsc.ca	37	1	240497469	240497469	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr1:240497469T>C	ENST00000319653.9	+	13	4935	c.4705T>C	c.(4705-4707)Tca>Cca	p.S1569P	FMN2_ENST00000545751.1_Missense_Mutation_p.S165P	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1569	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTTTCAGGCCTCACAGATGAA	0.368																																						.											0													125.0	138.0	134.0					1																	240497469		2203	4300	6503	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4705T>C	1.37:g.240497469T>C	ENSP00000318884:p.Ser1569Pro		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	T	25.1	4.598050	0.87055	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.20738	2.05;2.05	5.52	5.52	0.82312	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.53938	D	0.000051	T	0.51924	0.1703	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;0.999	D;D;D;D	0.91635	0.999;0.931;0.999;0.998	T	0.59862	-0.7374	10	0.87932	D	0	.	15.6348	0.76944	0.0:0.0:0.0:1.0	.	165;215;198;1569	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	P	1569;165;196;45	ENSP00000318884:S1569P;ENSP00000437918:S165P	ENSP00000318884:S1569P	S	+	1	0	FMN2	238564092	1.000000	0.71417	0.996000	0.52242	0.922000	0.55478	5.067000	0.64357	2.096000	0.63516	0.459000	0.35465	TCA		0.368	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ZDHHC13	54503	bcgsc.ca	37	11	19174169	19174169	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr11:19174169A>G	ENST00000446113.2	+	8	932	c.811A>G	c.(811-813)Aca>Gca	p.T271A	ZDHHC13_ENST00000532812.1_3'UTR|ZDHHC13_ENST00000399351.3_Missense_Mutation_p.T141A	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	271					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						TATGCTAAAAACAGAAGCCAA	0.363																																						.											0													60.0	58.0	58.0					11																	19174169		1802	4056	5858	SO:0001583	missense	54503			AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.811A>G	11.37:g.19174169A>G	ENSP00000400113:p.Thr271Ala		Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	ENST00000446113.2	37	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	A	9.311	1.055651	0.19907	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.64085	-0.08;-0.08	5.51	3.18	0.36537	Ankyrin repeat-containing domain (3);	1.062360	0.07154	N	0.849542	T	0.36635	0.0974	N	0.05230	-0.09	0.23210	N	0.998117	B	0.02656	0.0	B	0.04013	0.001	T	0.28996	-1.0026	10	0.10902	T	0.67	-4.7782	5.7177	0.17970	0.673:0.0:0.327:0.0	.	271	Q8IUH4	ZDH13_HUMAN	A	271;141	ENSP00000400113:T271A;ENSP00000382288:T141A	ENSP00000382288:T141A	T	+	1	0	ZDHHC13	19130745	0.000000	0.05858	1.000000	0.80357	0.987000	0.75469	0.106000	0.15354	0.945000	0.37605	0.472000	0.43445	ACA		0.363	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387821.1	NM_019028	
ANPEP	290	bcgsc.ca	37	15	90349234	90349234	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr15:90349234T>C	ENST00000300060.6	-	2	894	c.581A>G	c.(580-582)tAc>tGc	p.Y194C		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	194	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CTCGCTGCGGTAGAAGCCCGC	0.612																																					NSCLC(30;827 977 2459 19669 26125)	.											0													88.0	82.0	84.0					15																	90349234		2200	4299	6499	SO:0001583	missense	290			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.581A>G	15.37:g.90349234T>C	ENSP00000300060:p.Tyr194Cys		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257356	0.80246	.	.	ENSG00000166825	ENST00000300060	T	0.07114	3.22	4.8	4.8	0.61643	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	H	0.98965	4.385	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.66085	-0.6011	10	0.87932	D	0	.	12.3003	0.54870	0.0:0.0:0.0:1.0	.	194	P15144	AMPN_HUMAN	C	194	ENSP00000300060:Y194C	ENSP00000300060:Y194C	Y	-	2	0	ANPEP	88150238	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.099000	0.71466	1.794000	0.52575	0.460000	0.39030	TAC		0.612	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
FHOD1	29109	bcgsc.ca	37	16	67273272	67273272	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr16:67273272T>C	ENST00000258201.4	-	2	534	c.287A>G	c.(286-288)gAg>gGg	p.E96G		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	96	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ATAGAAGCCCTCCAGCATCTC	0.582																																						.											0													91.0	78.0	83.0					16																	67273272		2198	4300	6498	SO:0001583	missense	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.287A>G	16.37:g.67273272T>C	ENSP00000258201:p.Glu96Gly		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925603	0.73213	.	.	ENSG00000135723	ENST00000258201	T	0.25414	1.8	5.0	5.0	0.66597	GTPase-binding/formin homology 3 (1);	0.057492	0.64402	D	0.000002	T	0.34629	0.0904	L	0.47190	1.495	0.80722	D	1	D	0.59767	0.986	P	0.53266	0.722	T	0.10965	-1.0607	10	0.87932	D	0	.	12.5809	0.56390	0.0:0.0:0.0:1.0	.	96	Q9Y613	FHOD1_HUMAN	G	96	ENSP00000258201:E96G	ENSP00000258201:E96G	E	-	2	0	FHOD1	65830773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.945000	0.75947	2.105000	0.64084	0.533000	0.62120	GAG		0.582	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
SOGA1	140710	bcgsc.ca	37	20	35437043	35437043	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr20:35437043T>C	ENST00000357779.3	-	8	2299	c.1973A>G	c.(1972-1974)aAc>aGc	p.N658S	SOGA1_ENST00000456801.2_Missense_Mutation_p.N499S|SOGA1_ENST00000279034.6_Missense_Mutation_p.N658S|SOGA1_ENST00000237536.4_Missense_Mutation_p.N896S			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	658					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CACCAGCATGTTCTTCTCCTG	0.582											OREG0025909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													47.0	50.0	49.0					20																	35437043		1958	4165	6123	SO:0001583	missense	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1973A>G	20.37:g.35437043T>C	ENSP00000350424:p.Asn658Ser	855	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	T	17.78	3.473425	0.63737	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.28	5.28	0.74379	.	0.048321	0.85682	D	0.000000	T	0.35970	0.0950	L	0.36672	1.1	0.41468	D	0.98808	B	0.31435	0.323	B	0.34824	0.19	T	0.15321	-1.0441	10	0.26408	T	0.33	-56.7913	14.3227	0.66496	0.0:0.0:0.0:1.0	.	658	O94964-4	.	S	896;658;499;658	ENSP00000237536:N896S;ENSP00000279034:N658S;ENSP00000413886:N499S;ENSP00000350424:N658S	ENSP00000237536:N896S	N	-	2	0	KIAA0889	34870457	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.807000	0.62576	2.216000	0.71823	0.533000	0.62120	AAC		0.582	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SYNE1	23345	bcgsc.ca	37	6	152590301	152590301	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr6:152590301G>T	ENST00000367255.5	-	99	19295	c.18694C>A	c.(18694-18696)Cag>Aag	p.Q6232K	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q6161K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q5844K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q6232K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q6161K|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q756K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6232					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTTGTTGCTGGAGACTGCTC	0.547										HNSCC(10;0.0054)																												.											0													114.0	105.0	108.0					6																	152590301		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18694C>A	6.37:g.152590301G>T	ENSP00000356224:p.Gln6232Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	32	5.127081	0.94429	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.58797	0.4;0.39;0.31;0.39;0.55;1.02	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000020	T	0.65481	0.2695	M	0.69823	2.125	0.80722	D	1	D;D;D	0.58268	0.97;0.97;0.982	P;P;P	0.54629	0.576;0.576;0.757	T	0.64854	-0.6309	10	0.46703	T	0.11	.	19.9066	0.97010	0.0:0.0:1.0:0.0	.	6232;6232;6161	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	K	6232;6161;6232;6161;5844;756	ENSP00000356224:Q6232K;ENSP00000396024:Q6161K;ENSP00000265368:Q6232K;ENSP00000390975:Q6161K;ENSP00000341887:Q5844K;ENSP00000349276:Q756K	ENSP00000265368:Q6232K	Q	-	1	0	SYNE1	152631994	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.269000	0.95684	2.779000	0.95612	0.655000	0.94253	CAG		0.547	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SLC6A14	11254	bcgsc.ca	37	X	115572266	115572266	+	Splice_Site	DEL	G	G	-			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chrX:115572266delG	ENST00000371900.4	+	3	434		c.e3+1			NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TTGTTTCAAGGTTGGTATTAA	0.373																																						.											0													220.0	204.0	209.0					X																	115572266		2203	4300	6503	SO:0001630	splice_region_variant	11254			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.346+1G>-	X.37:g.115572266delG			Q5H942	Splice_Site	DEL	ENST00000371900.4	37	CCDS14570.1																																																																																				0.373	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		Intron
ARHGEF3	50650	bcgsc.ca	37	3	56789174	56789175	+	Frame_Shift_Ins	INS	-	-	GGAGC			TCGA-KO-8416-01A-11D-2310-10	TCGA-KO-8416-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d29543e-8601-4fd0-8e76-3df3de465cab	539a0194-ea33-4213-b815-b8dbbc07a276	g.chr3:56789174_56789175insGGAGC	ENST00000296315.3	-	3	377_378	c.209_210insGCTCC	c.(208-210)tccfs	p.-70fs	ARHGEF3_ENST00000496106.1_Frame_Shift_Ins_p.-76fs|ARHGEF3_ENST00000498517.1_5'UTR|ARHGEF3_ENST00000495373.1_Frame_Shift_Ins_p.-70fs|ARHGEF3_ENST00000497267.1_Frame_Shift_Ins_p.-41fs|ARHGEF3_ENST00000338458.4_Frame_Shift_Ins_p.-102fs|ARHGEF3_ENST00000413728.2_Frame_Shift_Ins_p.-76fs	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		GGAAGCTAATGGAGCGCTAAAC	0.55																																						.											0																																										SO:0001589	frameshift_variant	50650			AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.209_210insGCTCC	3.37:g.56789174_56789175insGGAGC	ENSP00000296315:p.Ser70fs		A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Frame_Shift_Ins	INS	ENST00000296315.3	37	CCDS2878.1																																																																																				0.550	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
